![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 4, 2518-2524, January 22, 1999
,From the Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, New Jersey 08543, the § Clinical Immunology Section, NIA, National Institutes of Health, Baltimore, Maryland 21224, and the ¶ NCI-Frederick Cancer Research and Development Center, National Institutes of Health, Frederick, Maryland 21702
| |
ABSTRACT |
|---|
|
|
|---|
All CD44 isoforms are modified with
chondroitin sulfate (CS), while only those containing variably spliced
exon V3 are modified with both CS and heparan sulfate (HS). The CS is
added to a serine-glycine (SG) site in CD44 exon E5, while HS and CS
are added to the SGSG site in exon V3. Site-directed mutagenesis and
other molecular biology techniques were used to determine the minimal
motifs responsible for the addition of CS and HS to CD44 (see
accompanying paper (Greenfield, B., Wang, W.-C., Marquardt, H.,
Piepkorn, M., Wolff, E. A., Aruffo, A., and Bennett, K. L. (1999) J. Biol. Chem. 274, 2511-2517)). We have used
this information to generate artificial proteoglycans containing the
extracellular domain of the cell adhesion protein lymphocyte
function-associated antigen-3 (LFA-3) (CD58) and CD44 motifs modified
with CS or a combination of CS and HS. Analysis of the CD44-modified
LFA-3 protein showed that it retains the ability to engage and trigger
the function of its natural ligand CD2, resulting in T cell activation.
In addition, the glycosaminoglycan-modified artificial proteoglycan is
capable of binding the chemokine RANTES (regulated upon
activation, normally T cell
expressed and secreted) and delivering it to
human T cells, resulting in enhanced T cell activation. These data
demonstrate that artificial proteoglycans can be engineered with
functional domains that have enhanced activity by codelivering
glycosaminoglycan-binding molecules. The artificial proteoglycans
were also used as a model system to explore the glycosaminoglycan
binding properties of basic-fibroblast growth factor and the chemokine
RANTES. While basic-fibroblast growth factor was shown to bind HS
alone, this model revealed that RANTES binds not only HS, as has been
demonstrated in the past, but also CS. Thus, artificial proteoglycans
can be used for studying the glycosaminoglycan binding patterns of
growth factors and chemokines and provide a means to manipulate the
levels, types, and activity of glycosaminoglycan-binding proteins
in vitro and in vivo.
CD44 is a widely distributed type I membrane protein that binds
hyaluronan, other extracellular matrix components, and osteopontin (1-6). The interactions between CD44 and its ligands have been shown
to participate in cell migration and activation (7-12). The exons
encoding the CD44 gene can be variably spliced to give rise to multiple
protein isoforms (13-15). Expression of these CD44 isoforms can be
tissue-specific, developmentally regulated, and/or regulated by cell
activation. Most of these isoforms arise from the variable splicing of
exons encoding polypeptide fragments located in the extracellular
region of CD44, downstream of the hyaluronan binding domain (16). The
function of these variably spliced domains is largely unexplored;
however, a number of interesting observations have been made. For
example, it has been shown in a rat model of tumor metastasis, that a
previously nonmetastatic cell line can be rendered aggressively
metastatic following the overexpression of CD44 variants containing
variably spliced exon V6 (17, 18). It has also been shown that changes
in the pattern of glycosylation of CD44 resulting from the addition of
variably spliced exons, which are modified extensively with
O-linked carbohydrates, can modulate the hyaluronan binding
activity of CD44 (19, 20). In addition, different CD44 isoforms are
modified with different glycosaminoglycan
(GAG)1 polymers, including HS
(21). The important role proteoglycans play in regulating the function
of HS-binding growth factors and chemokines is being studied (22-25),
and it has been proposed that HS-modified CD44 isoforms may play a role
in the binding and presentation of HS-binding chemokines (26).
We and others had reported previously that CD44 isoforms containing
variably spliced exon V3 are modified with HS (21, 27, 28). These
studies were extended to show that the HS is added to the SGSG motif in
CD44 exon V3. This site can also be modified with CS. We showed that CS
is added to at least one of the SG motifs located in CD44 exon E5. In
addition, we identified sequences in exon V3 required for HS assembly
(see accompanying paper (46)). HS assembly was supported in exon E5
when eight amino acids from exon V3 were inserted into exon E5. This
ability to introduce a HS assembly site into a protein led to the idea
that recombinant artificial proteoglycans could be created to deliver
heparin-binding proteins to sites of interest.
We generated such artificial proteoglycans and used a model of T cell
costimulation to analyze their activity. T cells are activated through
the T cell receptor by foreign antigens presented by antigen presenting
cells in the context of major histocompatibility complex. However, this
signal alone is not sufficient to induce a proliferative activation
response. Accessory molecules expressed on the surface of T cells (such
as CD2) provide a requisite second signal (costimulation signal) by
binding to their respective ligands on antigen presenting cells,
resulting in T cell activation and proliferation (29, 30). The T cell
molecule CD2 binds to lymphocyte function-associated antigen-3 (LFA-3),
which is expressed on antigen presenting cells, including B cells,
memory T cells, monocytes, and dendritic cells. The combination of an
antigen binding to the T cell receptor and ligation of LFA-3 to CD2 on
the T cell surface results in costimulation and subsequent
proliferation of T cells. The stimulation of T cells can also be
augmented by the presence of growth factors or chemokines (31, 32).
We designed a recombinant artificial proteoglycan with dual
costimulatory activity. The dual activity stems from LFA-3 (which binds
CD2 on T cells) and from GAG-modified CD44 exon V3 (which binds growth
factors and chemokines). This artificial proteoglycan provides a system
to study the interaction of growth factors and chemokines with GAGs and
ultimately can be used as a means of directing the levels and types of
chemokines and growth factors to induce a particular physiological
effect. In this manuscript, we characterize the functional domains of
this artificial proteoglycan and use it as a test system to extend our
knowledge regarding the GAG binding characteristics of the chemokine
RANTES. In addition, we demonstrate the in vitro activity of
the artificial proteoglycan in a model of T cell activation.
Construction of LFA-3 Artificial Proteoglycan Expression
Vectors--
The LFA-3-Rg construct has been described previously
(29). Oligonucleotide primers used for inserting the CD44 V3
eight-amino acid motif (see accompanying paper (46)) after the Ser-Gly
present in the extracellular domain of LFA-3 were:
LFA-3-FP-HindIII, AAGCTTCGACGAGCCATGGTTGCT; LFA-3-RP8aa-BamHI,
GGGATCCCCGATAAAATCTTCATCATCATCAATACCGCTGCTTGGGATACAGGT. Polymerase chain reaction product was digested with
HindIII and BamHI (Boehringer Mannheim),
gel-purified, and ligated into a mammalian expression vector containing
the sequence for an immunoglobulin constant region (Rg) as described in
the accompanying paper (46).
For constructing LFA-3 extracellular domain with complete CD44 V3
domains, primers used were LFA-3-FP-HindIII and
LFA-3-RP-SpeI ACTAGTTCTGTGTCTTGAATGACCGCT. Polymerase
chain reaction products were digested with HindIII and
SpeI (Boehringer Mannheim), gel-purified, and ligated into
HindIII and SpeI (Boehringer Mannheim) cut
V3wt-Rg or V3E5/8aa-Rg expression vectors
described in the accompanying paper (46).
Metabolic Labeling and Enzymatic Digestion--
COS cells were
purchased from American Type Culture Collection (Manassas, VA) and
maintained in Dulbecco's modified Eagle's medium (Life Technologies,
Inc.) with 10% fetal bovine serum, penicillin (100 units/ml),
streptomycin (100 µg/ml), and 2 mM L-glutamine. The Rg fusion proteins were produced in COS
cells, radiolabeled with [35S]NaHSO4 (NEN
Life Science Products), and purified from culture supernatants using
protein A-Sepharose (Repligen, Cambridge, MA) as described previously
(28). The labeled protein was divided into four aliquots. One aliquot
was left untreated, and the others were digested for 1 h at
37 °C with 50 milliunits of Proteus vulgaris chondroitin
ABC lyase, 2 milliunits of Flavobacterium heparinum heparitinase (ICN Immunobiologicals, Costa Mesa, CA), or both enzymes.
Samples were washed in phosphate-buffered saline containing 0.05%
Tween 20, heated for 10 min at 95 °C in sample buffer containing SDS
with Binding ELISAs--
Immulon II 96-well microtiter plates
(Dynatech Laboratories, Alexandria, VA) were coated with
LFA-3/V3wt-Rg or LFA-3-Rg at a concentration of 10 µg/ml
in carbonate/bicarbonate buffer (see above) overnight at 4 °C. All
subsequent steps were performed at room temperature. The plates were
washed three times and blocked with 2% bovine serum albumin in
phosphate-buffered saline for 1 h. Recombinant human b-FGF or
RANTES (R & D Systems, Minneapolis, MN) was added to the wells at the
concentrations indicated under "Results" and incubated for 1 h. Goat anti-sera specific for b-FGF or RANTES (R & D Systems) at 1 µg/ml was incubated for 1 h, followed by donkey anti-goat IgG
conjugated to horseradish peroxidase (Jackson ImmunoResearch, West
Grove, PA) at 1:10,000 for 1 h. Chromogen-Substrate solution
(Genetic Systems Corp., Seattle, WA) was added to the wells for 15 min.
The reaction was stopped by the addition of 1.0 N
H2SO4, and the ratio of the absorbance at
450-630 nm was read. Inhibition of b-FGF or RANTES binding was tested
by treating LFA-3/V3wt-Rg-coated wells with heparitinase or
chondroitin ABC lyase (ICN) at concentrations of 0.07 unit/ml and 3.3 units/ml, respectively (in phosphate-buffered saline containing 50 mM NaOAc and 1 mM CaCl2, pH 7.8),
1 h at 43 °C, before proceeding with the assay as described
above. Results are expressed as the mean value of triplicate wells ± S.D.
Costimulation Assays with Th1 and Th2 Clones--
The tetanus
toxoid-reactive human T cell (Th1) clone, H1.2, and the
Dermatophagoides pteronyssinus-reactive human T cell (Th2) clone, 2DP.21, were tested for their ability to proliferate in the
presence of recombinant human RANTES (PeproTech, Rocky Hill, NJ) in the
presence or absence of immobilized anti-CD3 mAb and/or LFA-3/V3wt-Rg or LFA-3-Rg alone (31). These clones have
been shown previously to be chemokine-reactive by their ability to induce migration and facilitate adhesion to endothelial cells and
extracellular matrix
proteins.2 These clones were
stimulated at 2-week intervals with either tetanus toxoid (10 µg/ml)
or D. pteronyssinus (1:100 dilution), and
autologous peripheral blood mononuclear cells (irradiated at 1500 rads)
were added to the culture as feeder cells. The T cell clones were only
utilized in proliferation studies upon resting and were found to be
free of contaminating feeder cells. Ninety-six well microtiter plates
were coated 24 h in advance with either control mouse IgG or
anti-CD3 mAb (10 µg/ml) in the presence or absence of
LFA-3/V3wt-Rg or LFA-3-Rg (10 µg/ml) in
carbonate-bicarbonate buffer, pH 8.9. After incubation, the plates were
blocked by adding 200 µl of culture medium to each well and then
incubating the plates for an additional 2 h at 37 °C. Again,
after incubation, the plates were gently washed (four times) with
culture medium until the pH was approximately 7.2. Recombinant human
RANTES diluted in culture medium was then added to the coated plates
and incubated at 37 °C for 2 h. (The C-C chemokine, RANTES, was
purchased from PeproTech, Rocky Hill, NJ. Endotoxin levels were
performed on each lot of chemokine used in these studies using a
Limulus Lysate assay and were found to possess <0.1 ng of
lipopolysaccharide/ml of chemokine.) Control wells containing culture
medium in place of RANTES were incubated in the same manner. The plates
were then gently washed with culture medium. Purified human T cell
clones were placed at 2 × 104 cells/well on the
coated plates and then incubated at 37 °C for 48 h. After
incubation, the plates were pulsed with 1 µCi of
[3H]thymidine for an additional 18-24 h. The plates were
then harvested and counted on a liquid scintillation counter. The
results are expressed as the mean number of counts/min ± S.D. All
of the costimulation experiments were performed blinded.
Generation of Artificial Proteoglycans Modified with HS and
CS--
Proteoglycans such as CD44 capture, concentrate, and present
GAG-binding proteins, including growth factors, cytokines, and chemokines, to specialized receptors. Via this mechanism, proteoglycans play a key role in regulating the activity of these GAG-binding proteins. Therefore, the ability to generate artificial proteoglycans would result in a novel class of recombinant proteins, which could be
used to direct the activity of GAG-binding proteins in vitro and in vivo.
In the accompanying paper (46), we demonstrated that a Rg fusion
protein containing CD44 exon V3 supports CS and HS assembly and that
the proteoglycan is able to bind b-FGF. We also showed that CD44 exon
E5 only supports CS assembly. In addition, it was shown that the GAG
assembly specificity of exon V3 and E5 could be manipulated by
exchanging the eight amino acids that followed the SGSG sequence in
CD44 exon V3 with the eight amino acids that followed the first SG
sequence in exon E5. Using the knowledge of the sequence requirement
that determines the specificity of GAG assembly, we decided to test
whether we could generate artificial proteoglycans with a GAG-modified
CD44 motif for delivering growth factors and chemokines.
We initiated our investigation on the preparation of artificial
proteoglycans by generating an LFA-3 (CD58) recombinant fusion protein.
LFA-3 was chosen for two reasons: first, it is a very well
characterized single chain type I membrane protein; and second, it is a
ligand for the T cell antigen CD2 and has an easily measurable costimulatory activity. The binding of a monoclonal antibody directed to CD3 (which is complexed with the T cell receptor) mimics antigen binding in the context of major histocompatibility complex to the T
cell surface and induces proliferation of the T cells. This, in
combination with the ligation of LFA-3 to CD2, results in costimulation and enhanced proliferation of T cells (29). The chemokine RANTES is
also capable of providing a costimulatory signal in combination with
anti-CD3 antibody, which results in enhanced T cell proliferation (31).
The interactions between these T cell signaling molecules and their
natural ligands are represented in Fig.
1A. A model of the
corresponding signaling pathways, which could be activated by an
artificial proteoglycan consisting of LFA-3 combined with GAG-modified
CD44 (indicated by V3wt), is shown in Fig.
1B.
To generate a GAG-modified LFA-3 Rg fusion protein, the sequence coding
for CD44 exon V3 (wild type) was placed between the LFA-3 extracellular
domain and the Rg domain, thereby creating LFA-3/V3wt-Rg
(Fig. 2). Analysis of the GAG
modification on LFA-3/V3wt-Rg is shown in Fig.
3, left panel. Digestion with
a combination of heparitinase and chondroitin ABC lyase is required for
GAG removal (apparent molecular mass 100-220 kDa), indicating that
this proteoglycan is modified with both CS and HS. Retention of a small
amount of the radiolabel is observed and is due to keratan sulfate and
possibly other oligosaccharide modification of the CD44 (33).
Next we explored the possibility of generating an artificial
proteoglycan, which was modified with CS but not HS. This was done by
constructing a chimeric gene containing a sequence encoding the CD44 V3
exon with the eight amino acids derived from CD44 exon E5, which is
modified with only CS (V3E5/8aa, see accompanying paper
(46)). The resulting fusion protein, LFA-3/V3E5/8aa-Rg (Fig. 2), is modified exclusively with CS (Fig. 3, right
panel). These findings demonstrate that inclusion of the CD44
derived V3E5/8aa domain results in a CS-modified proteoglycan.
Basic-FGF Binds HS, while RANTES Binds Both CS and HS--
We
further analyzed the activity of the GAG-modified LFA-3 artificial
proteogycan by studying its ability to bind growth factors and
chemokines. The binding activities of various growth factors and
chemokines to heparin and heparan sulfate have been explored extensively (22, 25, 34-36). In particular, the binding of RANTES to
intact extracellular matrix has been shown to be mediated by HS (37).
The ability of b-FGF and RANTES to bind the artificial proteoglycan
LFA-3/V3wt-Rg (modified with HS and CS) or an LFA-3-Rg control (not modified with HS or CS) was examined by ELISA. As shown in
Fig. 4A, b-FGF binds to
LFA-3/V3wt-Rg in a concentration-dependent manner and does not bind to LFA-3-Rg. The binding to
LFA-3/V3wt-Rg is abolished by pretreatment with
heparitinase but not chondroitin ABC lyase (Fig. 4B),
indicating the binding of b-FGF is mediated by HS and not CS.
The chemokine RANTES was also tested for binding to the artificial
proteoglycans. Like b-FGF, RANTES shows binding to
LFA-3/V3wt-Rg and not to LFA-3-Rg (Fig.
5A). However, a different and
unexpected pattern of binding emerged when RANTES was tested with
enzyme-treated LFA-3/V3wt-Rg. Neither heparitinase nor
chondroitin ABC lyase treatment alone reduces RANTES binding; however,
a combination of the two enzymes eliminates binding to the GAG-modified
protein (Fig. 5B). These results indicate that while b-FGF
binds only HS-modified CD44, RANTES is capable of binding both CS- and
HS-modified CD44.
The LFA-3 Domain of the Artificial Proteoglycan Is Active--
The
binding of a monoclonal antibody directed to CD3 (which is complexed
with the T cell receptor) mimics antigen binding on the T cell surface,
and in combination with the ligation of LFA-3 to CD2, results in
costimulation and subsequent proliferation of the T cells (29). This
experimental model was used to test whether inclusion of the CD44-V3
domain and its GAG modification altered the CD2 binding and
costimulatory properties of LFA-3. The ability of
LFA-3/V3wt-Rg to drive Th1 and Th2 cell proliferation in
the presence of anti-CD3 mAb showed that inclusion of the CD44-derived sequences and GAG modification does not affect the ability of the LFA-3
moiety to bind CD2 and engage its costimulatory function (Fig.
6).
The above experiments demonstrate that a recombinant artificial
proteoglycan can be generated with two independent functional domains.
Next we tested whether the two domains can act in concert to enhance a
biological activity.
Delivery of RANTES with Artificial Proteoglycan
LFA-3/V3wt-Rg Enhances LFA-3/CD3 T Cell Proliferation of
Human Th1 and Th2 Cell Clones--
Studies have demonstrated that
soluble chemokines exert a costimulatory effect on T cell activation
and proliferation if added in combination with the proper T cell
stimulus (31). For example, the chemokine RANTES is capable of
stimulating human T cell proliferation in the presence of anti-CD3 mAb.
To further test the artificial proteoglycan, we examined the
costimulatory effects of RANTES bound to LFA-3/V3wt-Rg on
Th1 or Th2 cell clones using plates coated with anti-CD3 mAb and either
LFA-3/V3wt-Rg or LFA-3-Rg. The cultures were examined
72 h later to assess effects on cell proliferation. In these
studies, RANTES was incubated for 2 h on precoated plates and then
washed to remove nonbound chemokine before adding T cell clones. Thus,
the responses observed in these studies are only examining the
presentation of RANTES by the ligands bound to the plate. Parallel
samples with and without RANTES were tested, and the difference in
signal given by the samples with RANTES over that of the corresponding
controls without RANTES is shown in Fig.
7. These results demonstrate that the
chemokine RANTES induces an increase in proliferation in response to
immobilized LFA-3/V3wt-Rg and anti-CD3 mAb, as compared
with LFA-3-Rg and anti-CD3 mAb. These data show that it is possible to
make artificial proteoglycans with multiple functional domains and that
their activity is enhanced by codelivering biologically active GAG
binding molecules.
In the accompanying paper (46), we showed that a recombinant
form of CD44 exon V3 alone could be expressed as a HS- and CS-modified
proteoglycan. In contrast, a mutant form of this exon, in which the
eight residues located downstream of the SGSG site were replaced with
those located downstream of the first SG site in exon E5
(V3E5/8aa), was modified with only CS. These observations led us to examine whether we could generate artificial proteoglycans containing both CS and HS or CS only. We designed artificial
proteoglycans by preparing chimeric proteins containing CD44 exon V3,
which would be modified with HS and CS, or proteins containing the
mutant CD44 exon V3E5/8aa, which would be modified with
only CS.
The LFA-3/V3wt-Rg and LFA-3/V3E5/8aa-Rg
constructs reported in this study provide examples of these artificial
proteoglycans. In these examples, the chimeric protein has three
functional domains. The amino-terminal domain is a receptor-targeting
domain, LFA-3, which binds to CD2. The second domain contains the GAG
polymer (either HS and CS in the V3wt-containing protein or
CS in the V3E5/8aa-containing protein). The third domain is
an immunoglobulin constant region, which binds to molecules known to
interact with the constant region of human IgG1. We were concerned that
the inclusion of the GAG-modified domain would perturb the function of
the other polypeptides in the chimera, and thus we examined in detail
the functional properties of each of the domains of LFA-3/V3wt-Rg. All of the domains of this artificial
proteoglycan function as expected. The CD44-V3 domain is modified with
HS and CS and is capable of binding b-FGF and RANTES. The LFA-3 domain is capable of engaging CD2 and triggering a costimulatory signal, and
the immunoglobulin domain binds anti-IgG1 antibodies and protein A
(allowing for a simple method of purification).
The generation of artificial proteoglycans provided a system for
studying the binding of growth factors and chemokines to GAGs and led
us to the finding that the chemokine RANTES binds CS. The ability of
RANTES to bind CS has broad implications with respect to the identity
of proteoglycans responsible for chemokine presentation. Chemokines
participate in the regulation of immune responses by acting as
chemoattractants and activators of leukocytes. The recruitment of
leukocytes to sites of inflammation requires the formation and
maintenance of chemokine gradients, which are achieved by the
interaction of chemokines with proteoglycans. The capture of chemokines
by endothelial proteoglycans provides the mechanism to concentrate and
present chemokines in biologically active form to the signaling
receptors of passing leukocytes (22, 24, 25, 38). One of the
proteoglycans proposed to participate in this process is CD44. The
standard CD44 isoform (CD44H) contains no variably spiced exons and is
modified with CS but not HS (28). CD44H is expressed by resting and
activated lymphocytes and activated endothelial cells. In this study,
we show that CD44 modified with CS alone is capable of binding and
presenting the chemokine RANTES but not the HS-binding growth factor
b-FGF. On the other hand, CD44 isoforms containing variably spliced
exon V3, which are expressed by activated monocytes, dendritic cells,
and keratinocytes, are modified with HS and CS and are capable of
binding both RANTES and b-FGF. These findings indicate that the
alternative splicing of CD44 provides a molecular mechanism for CD44 to
function as an immune regulator, by determining which growth factors
and/or chemokines are localized and presented. The ability of
CS-modified CD44 to bind RANTES indicates that CS-modified
proteoglycans play an important role in adding diversity to the process
of chemokine binding and presentation. There is evidence to suggest
that CS-modified proteoglycans are more abundant than HS-modified
proteoglycans (39, 40) and, as such, may play a dominant role in
chemokine activity.
The artificial proteoglycan LFA-3/V3wt-Rg was tested for
its ability to deliver the chemokine RANTES and enhance the biological activity of the targeting domain. Soluble chemokines have been shown to
exert a costimulatory effect on T cell activation and proliferation if
added in combination with the proper T cell stimulus (31). An increase
in proliferation of T cell clones was observed when RANTES was added to
LFA-3/V3wt-Rg and anti-CD3 mAb-coated plates as compared
with immobilized LFA-3-Rg and anti-CD3 mAb. In addition, human T cells
exhibited potent chemotaxis in response to C-C chemokines immobilized
on LFA-3/V3wt-Rg-, but not LFA-3-Rg-, coated polycarbonate filters
(data not shown), strongly supporting the presentation ability of our
recombinant CD44 construct. Taken together, these data demonstrate that
artificial proteoglycans can be engineered such that the biological
activity of the targeting domain can be enhanced by delivering
GAG-binding molecules.
We attempted to generate an artificial proteoglycan by placing the
eight aa located downstream of the SGSG in CD44 exon V3 downstream of a
natural SG site in a polypeptide typically not modified with GAG
chains. These studies were performed with LFA-3, which contains a
single SG and does not normally support GAG assembly. The placement of
the eight amino acids (IDDDEDFI) from CD44 exon V3 downstream of the SG
site in LFA-3 did not result in CS and/or HS
assembly.3 This supports the
notion that the enzymes responsible for GAG assembly recognize the SG
site to be modified in a three-dimensional context. This is consistent
with the observations that not all SG sites support GAG assembly. Such
a structural requirement for GAG assembly has been observed in the
analysis of decorin (41).
The ability to generate artificial proteoglycans was attractive
in light of recent evidence which indicates that proteoglycans play an
important role in regulating the activity of GAG binding molecules,
including growth factors and chemokines (42). This regulatory function
is mediated in part by the ability of proteoglycans to bind multiple
copies of GAG-binding proteins, prolonging their high local
concentration, and increasing the likelihood that they will encounter,
bind, and drive the oligomerization of their specific signaling
receptors. There is also evidence that some GAG-binding proteins, upon
interaction with GAGs, induce dimerization of their receptors,
potentially changing their conformation, creating a more favorable
environment for ligand driven receptor signaling (43). In addition,
there appears to be a significant level of specificity in the
interaction between GAG-binding proteins and GAGs. For example, certain
HS-binding proteins can bind only to a subset of HS-modified
proteoglycans (44). This specificity is thought to be driven by HS
heterogeneity arising from distinct levels of sulfation, disaccharide
composition, and chain length (45). Differences between the abilities
of GAG-binding proteins to bind CS or HS also impart specificity to
interactions with proteoglycans, as shown by the comparison of b-FGF
and RANTES binding to CD44. Thus artificial proteoglycans containing
targeting domains and/or functional domains can be used to manipulate
the levels, types, and activity of GAG-binding proteins in
vitro and in vivo. In addition, artificial
proteoglycans provide a convenient in vitro system to study
the binding relationships between GAGs and the proteins with which they interact.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
![]()
MATERIALS AND METHODS
-mercaptoethanol, and analyzed on 8-16% Tris/glycine SDS-polyacrylamide gel electrophoresis gels (Novex, San Diego, CA).
Gels were fixed, soaked in Amplify solution (Amersham Pharmacia Biotech), dried, and then analyzed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
![]()
RESULTS

View larger version (15K):
[in a new window]
Fig. 1.
T cell costimulation signals enhanced by
chemokine presentation. A, antigens presented in the
context of the major histocompatibility complex (MHC)
provide a stimulatory signal by binding to the T cell receptor
(TCR)-CD3 complex. The binding of LFA-3 to CD2 provides a
second, costimulatory signal. Proteoglycans (PG) containing
heparan sulfate (solid line) and/or chondroitin sulfate
(dashd line) concentrate and present growth
factors or chemokines (
) to their cell surface receptors
(CR), providing a costimulatory signal to the T cell.
B, the binding of a monoclonal antibody to CD3 (complexed
with the T cell receptor) in vitro mimics antigen binding on
the T cell surface in vivo. An artificial proteoglycan
consisting of LFA-3 and GAG-modified CD44 (V3wt)
provides two costimulatory signals by binding CD2 while concentrating
and presenting chemokines or growth factors via heparan sulfate or
chondroitin sulfate to cell surface receptors.

View larger version (16K):
[in a new window]
Fig. 2.
Recombinant artificial proteoglycans.
Line drawing of LFA-3-Rg and VCAM-1-Rg fusion proteins containing wild
type CD44 exon V3 (V3wt) or CD44 exon V3 containing
the eight amino acids found downstream of the first SG site in exon E5
(V3E5/8aa). Boxes representing LFA-3,
VCAM-1, CD44, and immunoglobulin constant region domains are
labeled.

View larger version (33K):
[in a new window]
Fig. 3.
Left panel, the chimeric LFA-3 protein
containing CD44 exon V3 is modified with CS and HS. Right
panel, the LFA-3 protein containing CD44 mutant V3 exon,
V3E5/8aa, is modified with CS.
[35S]NaHSO4-labeled LFA-3/V3wt-Rg
or LFA-3/V3E5/8aa-Rg protein was recovered from the
supernatant of COS cell transfectants, purified, and divided equally
into four aliquots. One aliquot was left untreated, and the others were
digested for 1 h with heparitinase, chondroitin ABC lyase, or with
both enzymes. The proteins were then resolved by SDS- polyacrylamide
gel electrophoresis and analyzed by radiography.

View larger version (14K):
[in a new window]
Fig. 4.
GAG-modified LFA-3 interacts with growth
factors. A, ELISA binding activity of b-FGF to
recombinant proteoglycan. B-FGF binds to GAG-modified
LFA-3/V3wt-Rg (
) but not LFA-3-Rg (
). Binding was
detected using goat anti-serum specific for b-FGF, followed by donkey
anti-goat IgG HRP. B, analysis of b-FGF binding to
enzyme-treated recombinant proteoglycan. B-FGF binding to
LFA-3/V3wt-Rg treated with heparitinase (
), chondroitin
ABC lyase (
), or untreated (
) was compared by ELISA.

View larger version (14K):
[in a new window]
Fig. 5.
A, GAG-modified LFA-3 interacts with
chemokines. The binding activity of RANTES to recombinant proteoglycan
was measured by ELISA. RANTES binds to GAG-modified
LFA-3/V3wt-Rg (
) but not LFA-3-Rg (
). B,
analysis of RANTES binding to enzyme-treated recombinant proteoglycan.
The binding activity of RANTES to LFA-3/V3wt-Rg treated
with heparitinase(
), chondroitin ABC lyase (
), both enzymes
(
), or untreated (
) was compared by ELISA.

View larger version (33K):
[in a new window]
Fig. 6.
GAG-modified LFA-3 in combination with
anti-CD3 mAb induces proliferation of human T cell clones. Human
Th1 and Th2 clones were incubated on plates coated with
LFA-3/V3wt-Rg (white columns), anti-CD3 mAb
(black columns), or a combination of both
LFA-3/V3wt-Rg and anti-CD3 mAb (gray columns).
Cell proliferation was measured by [3H]thymidine
uptake.

View larger version (23K):
[in a new window]
Fig. 7.
Delivery of RANTES with the artificial
proteoglycan LFA-3/V3wt-Rg enhances T cell proliferation of
Th1 and Th2 clones stimulated with anti-CD3 mAb and LFA-3. Plates
coated with LFA-3-Rg (black columns),
LFA-3/V3wt-Rg (gray columns), anti-CD3 mAb + LFA-3-Rg (hatched columns), or anti-CD3 mAb + LFA-3/V3wt-Rg (white columns) were preincubated
with RANTES at 1 µg/ml before adding human Th1 and Th2 cell clones.
In the presence of anti-CD3 mAb, delivery of RANTES with
LFA-3/V3wt-Rg induced greater proliferation than that
observed with LFA-3-Rg. Cell proliferation was measured by
[3H]thymidine uptake.
![]()
DISCUSSION
| |
ACKNOWLEDGEMENTS |
|---|
We thank Bill Bear for oligonucleotide primer preparation, as well as Joe Cook and Trent Youngman for DNA sequencing. We are also grateful to Robin Michaels and Debby Baxter for help in the preparation of this manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: BMS-PRI, P. O. Box
4000, Princeton, NJ 08543. Tel.: 609-252-6072; Fax: 609-252-6058; E-mail: wolffe{at}bms.com.
The abbreviations used are: GAG, glycosaminoglycan; b-FGF, basic fibroblast growth factor; CD, cluster of differentiation; CS, chondroitin sulfate; ELISA, enzyme-linked immunosorbent assay; HS, heparan sulfate; LFA-3, lymphocyte function associated antigen-3; mAb, monoclonal antibody; RANTES, regulated upon activation, normally T cell expressed and secreted; Rg, recombinant immunoglobulin; SG, serine/glycine; Th1/Th2, T helper cells; wt, wild type; aa, amino acid(s).
2 D. Taub, unpublished data.
3 B. Greenfield, unpublished observations.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. I. Khan, S. M. Kerfoot, B. Heit, L. Liu, G. Andonegui, B. Ruffell, P. Johnson, and P. Kubes Role of CD44 and Hyaluronan in Neutrophil Recruitment J. Immunol., December 15, 2004; 173(12): 7594 - 7601. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nakamura, N. Suenaga, K. Taniwaki, H. Matsuki, K. Yonezawa, M. Fujii, Y. Okada, and M. Seiki Constitutive and Induced CD44 Shedding by ADAM-Like Proteases and Membrane-Type 1 Matrix Metalloproteinase Cancer Res., February 1, 2004; 64(3): 876 - 882. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Roscic-Mrkic, M. Fischer, C. Leemann, A. Manrique, C. J. Gordon, J. P. Moore, A. E. I. Proudfoot, and A. Trkola RANTES (CCL5) uses the proteoglycan CD44 as an auxiliary receptor to mediate cellular activation signals and HIV-1 enhancement Blood, August 15, 2003; 102(4): 1169 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cichy, R. Bals, J. Potempa, A. Mani, and E. Pure Proteinase-mediated Release of Epithelial Cell-associated CD44. EXTRACELLULAR CD44 COMPLEXES WITH COMPONENTS OF CELLULAR MATRICES J. Biol. Chem., November 8, 2002; 277(46): 44440 - 44447. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Broide Fast Flowing Eosinophils . Signals for Stopping and Stepping Out of Blood Vessels Am. J. Respir. Cell Mol. Biol., June 1, 2002; 26(6): 637 - 640. [Full Text] [PDF] |
||||
![]() |
C. Sassetti, A. Van Zante, and S. D. Rosen Identification of Endoglycan, a Member of the CD34/Podocalyxin Family of Sialomucins J. Biol. Chem., March 17, 2000; 275(12): 9001 - 9010. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mbemba, J. C. Gluckman, and L. Gattegno Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF)-1{alpha} Glycobiology, January 1, 2000; 10(1): 21 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Greenfield, W.-C. Wang, H. Marquardt, M. Piepkorn, E. A. Wolff, A. Aruffo, and K. L. Bennett Characterization of the Heparan Sulfate and Chondroitin Sulfate Assembly Sites in CD44 J. Biol. Chem., January 22, 1999; 274(4): 2511 - 2517. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawashima, M. Hirose, J. Hirose, D. Nagakubo, A. H. K. Plaas, and M. Miyasaka Binding of a Large Chondroitin Sulfate/Dermatan Sulfate Proteoglycan, Versican, to L-selectin, P-selectin, and CD44 J. Biol. Chem., November 3, 2000; 275(45): 35448 - 35456. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hirose, H. Kawashima, O. Yoshie, K. Tashiro, and M. Miyasaka Versican Interacts with Chemokines and Modulates Cellular Responses J. Biol. Chem., February 9, 2001; 276(7): 5228 - 5234. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||