|
J Biol Chem, Vol. 274, Issue 40, 28075-28078, October 1, 1999
COMMUNICATION
p48 (ISGF-3 ) Is Involved in Interferon- -induced
Suppression of Hepatitis B Virus Enhancer-1 Activity*
Kazuhiko
Nakao §,
Keisuke
Nakata¶,
Mayumi
Yamashita ,
Youko
Tamada ,
Keisuke
Hamasaki¶,
Hiroki
Ishikawa¶,
Yuji
Kato¶,
Katsumi
Eguchi¶, and
Nobuko
Ishii
From the Health Research Center and the
Department of Clinical Pharmacology, Nagasaki University and the
¶ First Department of Internal Medicine, Nagasaki University
School of Medicine, 1-7-1, Sakamoto, Nagasaki 852-8501, Japan
 |
ABSTRACT |
Interferon- (IFN- ) suppresses hepatitis B
virus (HBV) gene expression by reducing its enhancer-1 activity.
IFN- induces transcription factors, interferon-stimulated gene
factor 3 (ISGF3), and interferon regulatory factor-1 (IRF-1), which
activate interferon-inducible gene expression through binding to the
interferon-stimulated regulatory element (ISRE) "AGTTTCNNTTTCNC" in
the gene promoters. We found the ISRE-like sequence
"AGGCTTTCACTTTCTC" in the HBV enhancer-1 region and elucidated the
role of this sequence. Gel mobility shift assay showed binding of
in vitro translated IRF-1 and in vitro
translated p48 (ISGF3- ), which is a component of ISGF3 to this
sequence. However, nuclear extracts binding to this sequence from human
hepatoma cells (HuH-7) treated with IFN- contained only the protein
consisted of p48. In transfection experiments, IFN- suppressed the
HBV enhancer-1 activity, and overexpression of p48 enhanced this
inhibitory effect. Both mutation and deletion of the ISRE-like sequence
in the HBV enhancer-1 region reduced the suppressive effect of IFN- .
Our results suggest that the ISRE-like sequence in the HBV enhancer-1
can interact with the protein containing p48 and mediate the
IFN- -induced suppression of the enhancer activity.
 |
INTRODUCTION |
Hepatitis B virus (HBV)1
causes acute hepatitis, chronic hepatitis, and liver cirrhosis and is
closely linked to hepatocellular carcinoma (1). Interferon-
(IFN- ) has been used as an anti-viral agent against chronic HBV
infection (2), resulting in improvement of clinical outcome in patients
with chronic HBV infection (3). IFN- suppresses expression of HBV
gene by reducing the HBV enhancer-1 activity (4). We have reported
previously that IFN- in combination with tumor necrosis factor-
(TNF- ) or interleukin-1 (IL-1 ) synergistically suppress the
HBV enhancer-1 activity (5). In addition, recent studies have shown
that cytotoxic T lymphocytes, which release various cytokines, play an
important role in noncytolytic clearance of HBV from hepatocytes
(6-8).
Type I IFN (IFN- and - ) induces the formation of a
heterotrimetric transcription factor complex, interferon-stimulated
gene factor 3 (ISGF3) (9), which consists of signal transducers and
activators of transcription 1 and 2 (STAT1 and STAT2) (10) and p48
(ISGF3 ) (11), after binding to its receptor. ISGF3 translocates into
the nucleus and binds to the interferon-stimulated regulatory element
(ISRE) in the promoter of a variety of interferon-inducible genes, and
transactivates their expression (10). Interferon regulatory factor-1
(IRF-1) is another important factor induced by type I and II IFNs (12).
Since the sequence of IRF-1 binding site termed IRF-E overlaps with
ISRE (13), IRF-1 also binds to ISRE sequence and activates the
interferon-inducible gene transcription (14). p48 and IRF-1 show a
homology within their amino-terminal regions and are members of the IRF
family together with other IRFs (15). However, analysis in mice
deficient for the p48 gene has shown that induction of some
interferon-inducible genes such as 2',5'-oligoadenylate synthetase
(2',5'-OAS) (16) and double-stranded RNA-dependent protein
kinase (PKR) (17) are p48-dependent and that IRF-1 cannot
compensate completely for the loss of p48 (13), suggesting that p48 and
IRF-1 are, in part, functionally different.
Recent studies have demonstrated the presence of ISRE-like sequence in
several viral genomes, such as Qp promoter region of the Epstein-Barr
virus (EBV) nuclear antigen 1 gene (18, 19), U5 region of the bovine
leukemia virus long terminal repeat (20), and downstream region of the
human immunodeficiency virus type 1 long terminal repeat (21) and that
IRF-1, but not ISGF3, interacts with these ISRE-like sequences and
regulates viral gene expression (19-21). We also found the ISRE-like
sequence in the 5' region of the HBV enhancer-1, which is located just
before the X gene promoter and enhances the transcription of not only
the X gene but also the Core, Pre-S, and S gene of the HBV specifically
in hepatocytes (22). In the present study, we determined whether the
ISRE-like sequence in the HBV enhancer-1 could interact with p48 or
IRF-1 and act as a cis-element mediating the IFN- action. We showed that IFN- induced a complex formation of this sequence with the protein containing p48 and that the complex formation was
relevant to the IFN- -induced suppression of the enhancer activity.
This is the first report suggesting that p48, together with its
partners, directly binds to HBV DNA sequence and participates in the
regulation of HBV gene expression.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
The HuH-7 human hepatoma cell line was
maintained in a chemically defined medium, IS-RPMI (23) with 2% fetal
bovine serum. In each experiment, the medium was replaced with
serum-free IS-RPMI containing recombinant human IFN- 2a (Nippon
Roche Co., Tokyo, Japan), recombinant human IFN- 1a (Shionogi Co.,
Osaka, Japan), or IL-1 (Otsuka Pharmaceutical Co., Tokushima,
Japan), then incubated for the indicated periods.
Gel Mobility Shift Assay--
The full-length human p48
(ISGF3 ) cDNA cloned into pBluescript SK(+) (11), which was
kindly provided by Dr. D. E. Levy (Department of Pathology, New
York University School of Medicine), was subjected to in
vitro transcription and translation with TNT T7 quick-coupled
transcription/translation system (Promega Corp., Madison, WI). pUC
IRF-1 and pHIRF4S-51 plasmids containing the full-length human IRF-1
and IRF-2 cDNA, respectively, were kindly provided by Dr. T. Taniguchi (Department of Immunology, Tokyo University, Tokyo, Japan).
The IRF cDNAs were subcloned to pGEM 7(+) (Promega Corp.) and
subjected to in vitro transcription and translation. The
HuH-7 cells were treated with 1,000 IU/ml IFN- (2 h) or 100 IU/ml
IFN- (2 and 24 h), and the nuclear extract was prepared as
described previously (24). Anti-human p48 rabbit serum was also
provided by Dr. D. E. Levy, and anti-human IRF-1 rabbit serum was
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The
following double-stranded oligonucleotides were used as a probe or
competitor in the assays (only the sense strand is shown): HBV
ISRE-like sequence (25), GCAGGCTTTCACTTTCTCGC; mutated HBV ISRE-like
sequence (mutations are underlined),
GCAGGCCCTCACCTTCTCGC; 2'5'-OAS ISRE (26),
CTGTTGGTTTCGTTTCCTCAGA; C13 oligonucleotide (IRF-E) (27),
TCTCACTTTCACTTTCACTT. The probe was end-labeled with
[ -32P]ATP using T4 polynucleotide kinase. The proteins
prepared from the in vitro transcription and translation or
nuclear extract were incubated with 10 fmol of the labeled probe for 30 min at 24 °C in the presence of 40 mM KCl, 20 mM HEPES (pH 7.9), 1 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol, 2 µg of
poly(dI-dC), 1 µg of salmon testes DNA, and 8% glycerol. The
reaction mixture was electrophoresed on a 4% polyacrylamide gel
containing 25 mM Tris borate and 0.25 mM EDTA.
Cell Transfection and Chloramphenicol Acetyltransferase (CAT)
Assay--
To construct the pXEn-CAT plasmid containing the HBV
enhancer-1 and X promoter region, NsiI (937) to
NcoI (1244) fragment from pBRHBadr125 (25) was inserted into
the pCAT-basic plasmid (Promega Corp.). To construct the
pXEnISRE(M)-CAT plasmid, which contains T to C substitutions in the
ISRE-like sequence, the AccI (943) to StuI (985)
fragment containing the ISRE-like sequence in the pXEn-CAT plasmid was
replaced with double-stranded oligonucleotide with the sequence
5'-ATACAATCTAAGCAGGCCCTCACCTTCTCGCCAACTTATAAGG-3' (mutations are underlined). To construct the pXEn ISRE-CAT
plasmid, the NsiI (937) to StuI (985) fragment
containing the ISRE-like sequence was deleted from pXEn-CAT plasmid.
Similarly, to construct the pX-CAT plasmid, which has only the X
promoter region, the NsiI(937) to SphI (1105)
fragment containing the full HBV enhancer-1 region was deleted from
pXEn-CAT plasmid. The full-length IRF-1 and IRF-2 cDNAs from pUC
IRF-1 and pHIRF4S-51 plasmids, respectively, were inserted into the
expression vehicle, pcDNA3 (Invitrogen Corp., Carlsbad, CA), to
yield the IRF-1 and IRF-2 expression plasmids, pcIRF-1 and pcIRF-2,
respectively. p48 expression plasmid, pcp48, was also constructed by
inserting the full-length p48 cDNA into the pcDNA3.
Transfection was performed using 3 µg of plasmid DNA per flask (25 cm2) by the lipofection method (28). Two days later, cells
were harvested and lysed by five cycles of freezing and thawing. The lysate was heated at 60 °C for 15 min to inactivate deacetylase, centrifuged at 15,000 rpm for 5 min, and the supernatant was used for
determination of CAT activity as described previously (29). pSV- -galactosidase control vector (Promega Corp.) was cotransfected with CAT plasmids to correct the transfection efficacy in each experiment.
Northern Blotting--
The HuH-7 cells were treated with 1,000 IU/ml IFN- or 100 IU/ml IFN- . Total RNA was isolated from the
cells before and at 1, 2, 4, 8, and 24 h after treatment by the
guanidium isothiocyanate method for analyzing the levels of p48 and
IRF-1 mRNA using p48 and IRF-1 cDNA probe, respectively.
 |
RESULTS AND DISCUSSION |
We found the ISRE-like sequence "AGGCTTTCACTTTCTC" in the HBV
enhancer-1 region at positions 958-973 (25), which is similar to the
ISRE sequence in interferon-inducible gene promoters (26, 30-33)
(Table I). Moreover, the HBV ISRE-like
sequence is precisely conserved among the different subtypes of HBV
(25, 34-36). Therefore, we examined whether p48 or IRF-1 could bind to
this sequence by the gel mobility shift assay using a oligonucleotide
probe that contained the HBV ISRE-like sequence. The in
vitro translated p48 formed a complex band with the probe (Fig.
1A, lane 1).
Addition of 100 times molar excess of nonlabeled 2',5'-OAS ISRE and HBV ISRE-like oligonucleotide competitors reduced the density of the complex band (Fig. 1A, lanes 2 and 4),
but addition of nonlabeled mutated HBV ISRE-like oligonucleotide did
not (Fig. 1A, lane 5), in which T to C
substitutions at key positions known to impair the ISRE function were
introduced (20, 24). The in vitro translated IRF-1 also
formed a complex band with the probe (Fig. 1A, lane 6). This interaction was also abolished by addition of 100 times molar excess of the nonlabeled C13 oligonucleotide that contains the
IRF-1 binding consensus sequence (IRF-E) (13, 27) and HBV ISRE-like
oligonucleotide competitors (Fig. 1A, lanes 7 and 9), but addition of nonlabeled mutated HBV ISRE-like
oligonucleotide did not (Fig. 1A, lane 10). These
results indicate that p48 and IRF-1 can recognize the ISRE-like
sequence in the HBV enhancer-1 region.
View this table:
[in this window]
[in a new window]
|
Table I
Sequence similarities between ISRE sequence in the interferon-inducible
gene promoters and ISRE-like sequence in the HBV enhancer-1
|
|

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 1.
Interaction between HBV ISRE-like sequence
and in vitro translated p48, IRF-1, or nuclear
extracts from HuH-7 cells treated with IFN- or
IFN- . A, A 20-bp
oligonucleotide containing the HBV ISRE-like sequence was used as a
radiolabeled probe, incubated with 2 µl of the in vitro
translated p48 (lanes 1-5) or IRF-1 (lanes
6-10) in the presence or absence of 100-fold molar excess of
nonlabeled competitor DNA, then subjected to gel electrophoresis. The
competitor DNAs used in this study were 2',5'-OAS ISRE (lane
2), C13 oligonucleotide (lane 7), nonspecific
(lanes 3 and 8), HBV ISRE-like (lanes 4 and 9),
and mutated HBV ISRE-like (lanes 5 and 10) oligonucleotides.
No competitor DNA was added to the sample shown in lanes 1 and 6. B, a 20-bp oligonucleotide probe
containing the HBV ISRE-like sequence was incubated with 2 µl of the
in vitro translated p48 (lane 1), 10 µg of
nuclear extracts from the cells nontreated (lane 2), treated
with IFN- (1,000 IU/ml) for 2 h (lanes 3-8),
treated with IFN- (100 IU/ml) for 2 h (lane 9), or
treated with IFN- (100 IU/ml) for 24 h (lanes 10 and
11). 2',5'-OAS ISRE (lane 4), HBV ISRE-like (lane
7), and mutated HBV ISRE-like (lane 8) oligonucleotides
were added to the sample as competitor DNAs. In lanes 5, 6,
and 11, nuclear extracts were preincubated for 30 min with
the rabbit antisera, anti-p48 serum (lanes 5 and
11) or anti-IRF-1 serum (lane 6).
|
|
To determine whether IFN- could induce the binding of nuclear
proteins to the HBV ISRE-like sequence in the cells, nuclear extracts
were prepared from HuH-7 cells treated with 1,000 IU/ml IFN- for
2 h. The nuclear extract from the IFN- -treated cells formed a
complex band with the probe (Fig. 1B, lane 3).
Addition of 100 times molar excess of the nonlabeled 2',5'-OAS ISRE and HBV ISRE-like oligonucleotide competitors reduced the density of the
complex band (Fig. 1B, lanes 4 and 7),
but addition of nonlabeled mutated HBV ISRE-like oligonucleotide did
not (Fig. 1B, lane 8). Furthermore, addition of
anti-p48 serum led to a supershift of the complex band (Fig.
1B, lane 5), but addition of anti-IRF-1 did not
(Fig. 1B, lane 6), suggesting that the binding protein induced in the cells by IFN- contained p48 but not IRF-1 in
its molecule. In addition, the position of the p48-associated complex
band using in vitro translated one (Fig. 1B,
lane 1) was different from that the nuclear extract from
IFN- -treated cells (Fig. 1B, lane 3). This
would account for ISGF3 formation in IFN- -treated cells, although
our work did not address whether STAT1 and STAT2 are actually involved
in its complex formation. We could not detect any shifted bands
corresponding to IRF-1 in this condition. The nuclear extract from
HuH-7 cells treated with IFN- for 24 h, but not that treated
with IFN- for 2 h, formed a complex band with the HBV ISRE-like
oligonucleotide probe (Fig. 1B, lanes 9 and
10) at the similar position of the p48-associated complex band (Fig. 1B, lane 1). Addition of anti-p48
serum led to a supershift of this complex band (Fig. 1B,
lane 11), suggesting that 24-h IFN- treatment induces p48
in HuH-7 cells as described previously (11, 15).
By the functional analysis of the HBV ISRE-like sequence, varying
lengths of the HBV enhancer-1 and X promoter region were linked to the
CAT gene (Fig. 2A). pXEn-CAT
contains the full-length of the HBV enhancer-1 and X promoter region,
while pXEnISRE(M)-CAT contains three nucleotide mutations in the
ISRE-like sequence as described under "Experimental Procedures."
pXEn ISRE-CAT lacks the 48-bp region containing the ISRE-like
sequence in pXEn-CAT, and pX-CAT contains only the X promoter region.
These CAT plasmids were transfected into HuH-7 cells. Afterward, the
cells were treated with 1,000 IU/ml IFN- , 100 IU/ml IL-1 , or
both, since at least 1,000 IU/ml IFN- was required for an apparent
suppression of the HBV enhancer-1 activity (Fig.
3A, lanes 1-5),
and since we have shown previously that IFN- in combination with
IL-1 or TNF- produced a more profound suppression of the HBV
enhancer-1 activity than IFN- alone (5). CAT expression from
pXEn-CAT was suppressed by approximately 45 and 80% by IFN- alone
and IFN- in combination with IL-1 , respectively (Fig.
2B, lanes 2 and 4), but its expression
was not suppressed by IL-1 alone as reported previously (5) (Fig.
2B, lane 3). CAT expression from pXEnISRE(M)-CAT
and pXEn ISRE-CAT, which showed a base-line CAT activity almost
similar to that from pXEn-CAT, showed only a slight suppression by
IFN- alone and IFN- in combination with IL-1 , respectively
(Fig. 2B, lanes 6 and 8 and
lanes 10 and 12). IFN- alone or IFN- in
combination with IL-1 did not affect CAT expression from pX-CAT
(Fig. 2B, lanes 14 and 16). These
results suggest that the ISRE-like sequence in the HBV enhancer-1
region is likely to mediate the IFN- -induced suppression of the
enhancer activity. This is a surprising result, because ISRE existing
in the promoters of interferon-inducible genes behaves as a positive cis-element (26, 30-33). It is not clear, at present, why
the HBV ISRE-like sequence works negatively. However, our results are
supported by the following findings. 1) IFN- suppresses the activity
of EBV nuclear antigen 1 gene promoter containing ISRE-like sequence
(19). 2) IRF-2, which counteracts with IRF-1 by competitive binding to
ISRE (37), can directly activate the expression of human histone H4
gene through binding to ISRE in its promoter (38).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of IFN- ,
IL-1 , or both on the HBV enhancer-1 and X
promoter activities. A, schema of the HBV enhancer-1 to
X promoter region (25) and constructs of chimeric CAT plasmids.
Shaded ellipse indicates the ISRE-like sequence.
B, the HuH-7 cells were transfected with 3 µg of the
indicated plasmids and incubated with IFN- (1,000 IU/ml), IL-1
(100 IU/ml), or both. Two days later, CAT activity was analyzed. The
amount of extracts and incubation time were 10 µg of protein and 30 min, respectively. Data represent CAT activity relative to the control
(pXEn-CAT without treatment; lane 1) and are expressed as
mean ± S.D. of three separate experiments.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of IFN- ,
IFN- , and overexpression of p48, IRF-1, or
IRF-2 on HBV enhancer-1 activity. A, the HuH-7 cells
were transfected with 3 µg of pXEn-CAT and incubated with various
concentration of IFN- or IFN- for 48 h, and CAT activity was
analyzed. Lane 1, without treatment; lane 2, 10 IU/ml IFN- ; lane 3, 100 IU/ml IFN- ; lane 4,
1,000 IU/ml IFN- ; lane 5, 10,000 IU/ml IFN- ;
lane 6, 100 IU/ml IFN- ; lane 7, 1,000 IU/ml
IFN- ; lane 8, 100 IU/ml IFN- for 24 h followed by
1,000 IU/ml IFN- for 24 h. The amount of extracts and
incubation time were 10 µg of protein and 30 min, respectively. Data
represent CAT activity relative to the control (without treatment,
lane 1) and are expressed as mean ± S.D. of three
separate experiments. B, the HuH-7 cells were cotransfected
with 3 µg of each indicated plasmid, and CAT activity was analyzed.
Lane 1, pXEn-CAT with pcDNA3 (vehicle); lane
2, pXEn-CAT with pcDNA3 following IFN- treatment (1,000 IU/ml); lane 3, pXEn-CAT with pcp48 (p48); lane
4, pXEn-CAT with pcp48 following IFN- treatment (1,000 IU/ml);
lane 5, pXEn-CAT with pcIRF-1 (IRF-1); lane 6, pXEn-CAT with pcIRF-2 (IRF-2). The amount of extracts and incubation
time were 15 µg of protein and 45 min, respectively. Data represent
CAT activity relative to the control (pXEn-CAT with pcDNA3,
lane 1) and are expressed as mean ± S.D. of three
separate experiments.
|
|
It has been shown that pretreatment of HeLa cells with IFN- before
stimulation with IFN- results in increased levels of p48 and
enhances the expression of IFN- -inducible genes (39) and that the
stable transfection of p48 expression vehicle effectively enhances the
response to IFN- treatment in melanoma cells (40). As suspected, the
treatment of HuH-7 cells with 100 IU/ml IFN- followed by 1,000 IU/ml
IFN- enhanced the suppressive effect of IFN- on pXEn-CAT activity
by approximately 45-70% (Fig. 3A, lanes 4 and
8), although the IFN- treatment alone showed a little effect on its activity (Fig. 3A, lanes 6 and
7). In addition, we cotransfected the p48 expression plasmid
together with pXEn-CAT into HuH-7 cells, followed by incubation with or
without 1,000 IU/ml IFN- . p48 transfection without IFN- treatment
resulted in approximately 20% decrease in pXEn-CAT activity (Fig.
3B, lane 3), compared with vehicle transfection
(Fig. 3B, lane 1). In contrast, p48 transfection
followed by IFN- treatment markedly reduced pXEn-CAT activity by
80% (Fig. 3B, lane 4). However, cotransfection experiments by IRF-1 or its counterpart IRF-2 expression plasmid together with pXEn-CAT showed no significant changes (Fig.
3B, lanes 5 and 6), even though the
in vitro translated IRF-1 interacted with the HBV ISRE-like
sequence (Fig. 1A, lane 6). These results suggest
that abundance of p48 enhances the IFN- -mediated suppression of the
HBV enhancer-1 activity in HuH-7 cells. Kimura et al. (13) have reported that p48 is essential to the induction of anti-viral genes such as 2',5'-OAS and PKR by IFN- , and IRF-1 cannot compensate for the loss of p48. The authors also showed that expression of guanylate-binding protein (GBP) was largely dependent on IRF-1, indicating the diversity of p48 and IRF-1 function. In addition, p48 is
a key factor involved in IFN- - and IFN- -induced anti-viral responses against encephalomyocarditis virus, vesicular stomatitis virus, and herpes simplex virus (13). Taken together, it is possible
that suppression of HBV enhancer activity by IFN- is largely
dependent on p48 rather than IRF-1.
In an attempt to investigate whether IFN- induced p48 or IRF-1
mRNAs in HuH-7 cells, Northern blot analysis was performed. IRF-1
mRNA was induced at 1 h after 1,000 IU/ml IFN- treatment (Fig. 4A, lane 2),
but its induction was transient as described previously (37), while
induction of p48 mRNA was still detected 24 h after treatment
with IFN- (Fig. 4A, lane 6). Similar results were obtained with 100 IU/ml IFN- treatment (Fig. 4B). It
is known that p48 is induced by IFN- or by viral infection (11, 15).
However, recent reports have also revealed that p48 mRNA is induced
by IFN- in human peripheral blood mononuclear cells (41) and that
IFN- / can stimulate the promoter activity of p48 gene in murine
macrophage cell line (42).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 4.
Induction of p48 and IRF-1 genes by
IFN- or IFN- in HuH-7
cells. The HuH-7 cells were treated with IFN- (1,000 IU/ml)
(A) or IFN- (100 IU/ml) (B). Total RNA was
extracted from the cells at the indicated times, and 10 µg of total
RNA was subjected to electrophoresis. Northern blot analysis was
performed using p48 or IRF-1 cDNA probe.
|
|
The suppression of HBV enhancer-1 activity by IFN- in combination
with IL-1 was apparently greater than that induced by IFN- alone.
Such synergistic effect was also observed with TNF- (5) or IFN-
(Fig. 3A, lane 8). These cytokines are associated with the noncytolytic clearance of HBV from hepatocyte by cytotoxic T
lymphocytes (6-8). Accordingly, it is likely that IFN- interacts with other cytokines to eradicate the infected virus more efficiently, although further studies are necessary to clarify how IFN- and other
cytokines act cooperatively in viral clearance.
 |
ACKNOWLEDGEMENTS |
We thank Dr. T. Taniguchi (Department of
Immunology, Tokyo University, Tokyo, Japan) for generously providing
the pUCIRF-1 and pHIRF4S-51 plasmids. We also thank Dr. D. E. Levy
(Department of Pathology, New York University School of Medicine) for
generously providing the p48 (ISGF3 ) cDNA cloned into
pBluescript SK(+) and anti-human p48 rabbit serum and Dr. F. G. Issa (Word-Medex, Sydney, Australia) for the careful reading and
editing of the manuscript.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Health Research Center,
Nagasaki University, 1-7-1, Sakamoto, Nagasaki 852-8501, Japan. Tel.:
81-95-849-7532; Fax: 81-95-849-7533 (or 7270); E-mail: kazuhiko@net.nagasaki-u.ac.jp.
1
The abbreviations used are: HBV, hepatitis B
virus; IFN, interferon; TNF- , tumor necrosis factor- ; IL-1 ,
interleukin-1 ; ISGF3; interferon-stimulated gene factor 3; STAT,
signal transducers and activators of transcription; ISRE,
interferon-stimulated regulatory element; IRF, interferon regulatory
factor; 2',5'-OAS, 2',5'-oligoadenylate synthetase; EBV, Epstein-Barr
virus; PKR, double-stranded RNA-dependent protein kinase;
CAT, chloramphenicol acetyltransferase; ISG54, interferon-stimulated
gene encoding protein of 54 kDa; GBP, guanylate-binding protein; bp,
base pair(s).
 |
REFERENCES |
| 1.
|
Popper, H.,
Shafritz, D. A.,
and Hoofnagle, J. H.
(1987)
Hepatology
7,
764-772[Medline]
[Order article via Infotrieve]
|
| 2.
|
Hoofnagle, J. H.,
and Di Bisceglie, A. M.
(1997)
N. Engl. J. Med.
336,
347-356[Free Full Text]
|
| 3.
|
Niederau, C.,
Heintges, T.,
Lange, S.,
Goldmann, G.,
Niederau, C. M.,
and Häussinger, D.
(1996)
N. Engl. J. Med.
334,
1422-1427[Abstract/Free Full Text]
|
| 4.
|
Tur-Kaspa, R.,
Teicher, L.,
Laub, O.,
Dagan, D.,
Bloom, B. R.,
and Schafritz, D. A.
(1990)
J. Virol.
64,
1821-1824[Abstract/Free Full Text]
|
| 5.
|
Hamasaki, K.,
Nakata, K.,
Nakao, K.,
Mitsuoka, S.,
Tsutsumi, T.,
Kato, Y.,
Shima, M.,
Ishii, N.,
Tamaoki, T.,
and Nagataki, S.
(1992)
Biochem. Biophys. Res. Commun.
183,
904-909[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Guidotti, L. G.,
Ando, K.,
Hobbs, M. B.,
Ishikawa, T.,
Runkel, L.,
Schreiber, R. D.,
and Chisari, F. V.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
3764-3768[Abstract/Free Full Text]
|
| 7.
|
Guidotti, L. G.,
Ishikawa, T.,
Hobbs, M. V.,
Matzke, B.,
Schreiber, R.,
and Chisari, F. V.
(1996)
Immunity
4,
25-36[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Chisari, F. V.
(1997)
J. Clin. Invest.
99,
1472-1477[Medline]
[Order article via Infotrieve]
|
| 9.
|
Levy, D. E.,
Kessler, D. S.,
Pine, R.,
and Darnell, J. E., Jr.
(1989)
Genes Dev.
3,
1362-1371[Abstract/Free Full Text]
|
| 10.
|
Darnell, J. E., Jr.,
Kerr, I. M.,
and Stark, G. R.
(1994)
Science
264,
1415-1421[Abstract/Free Full Text]
|
| 11.
|
Veals, S. A.,
Schindler, C.,
Leonard, D.,
Fu, X.-Y.,
Aebersold, R.,
Darnell, J. E., Jr.,
and Levy, D. E.
(1992)
Mol. Cell. Biol.
12,
3315-3324[Abstract/Free Full Text]
|
| 12.
|
Miyamoto, M.,
Fujita, T.,
Kimura, Y.,
Maruyama, M.,
Harada, H.,
Sudo, Y.,
Miyata, T.,
and Taniguchi, T.
(1988)
Cell
54,
903-913[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Kimura, T.,
Kadokawa, Y.,
Harada, H.,
Matsumoto, M.,
Sato, M.,
Kashiwazaki, Y.,
Tarutani, M.,
Tan, R. S.-P.,
Takasugi, T.,
Matsuyama, T.,
Mak, T. W.,
Noguchi, S.,
and Taniguchi, T.
(1996)
Genes Cells
1,
115-124[Abstract]
|
| 14.
|
Reis, L. F. L.,
Harada, H.,
Wolchok, J. D.,
Taniguchi, T.,
and Vilcek, J.
(1992)
EMBO J.
11,
185-193[Medline]
[Order article via Infotrieve]
|
| 15.
|
Nguyen, H.,
Hiscott, J.,
and Pitha, P. M.
(1997)
Cytokine Growth Factor Rev.
8,
293-312[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Shiojiri, S.,
Fukunaga, R.,
Ichii, Y.,
and Sokawa, Y.
(1986)
J. Biochem. (Tokyo)
99,
1455-1464[Abstract/Free Full Text]
|
| 17.
|
Meurs, E.,
Chong, K.,
Galabru, J.,
Thomas, N.,
Kerr, I. M.,
Williams, B. R. G.,
and Hovanessian, A. G.
(1990)
Cell
62,
379-390[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Schaefer, B. C.,
Paulson, E.,
Strominger, J. L.,
and Speck, S. H.
(1997)
Mol. Cell. Biol.
17,
873-886[Abstract]
|
| 19.
|
Nonkwelo, C.,
Ruf, I. K.,
and Sample, J.
(1997)
J. Virol.
71,
6887-6897[Abstract]
|
| 20.
|
Kiermer, V.,
Van Lint, C.,
Briclet, D.,
Vanhulle, C.,
Kettmann, R.,
Verdin, E.,
Burny, A.,
and Droogmans, L.
(1998)
J. Virol.
72,
5526-5534[Abstract/Free Full Text]
|
| 21.
|
Van Lint, C.,
Amella, C. A.,
Emiliani, S.,
John, M.,
Jie, T.,
and Verdin, E.
(1997)
J. Virol.
71,
6113-6127[Abstract]
|
| 22.
|
Su, H.,
and Yee, J.-K.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
2708-2712[Abstract/Free Full Text]
|
| 23.
|
Nakabayashi, H.,
Taketa, K.,
Yamane, T.,
Miyazaki, M.,
Miyano, K.,
and Sato, J.
(1984)
Gann
75,
151-158[Medline]
[Order article via Infotrieve]
|
| 24.
|
Levy, D. E.,
Kessler, D. S.,
Pine, R.,
Reich, N.,
and Darnell, J. E., Jr.
(1988)
Genes Dev.
2,
383-393[Abstract/Free Full Text]
|
| 25.
|
Fujiyama, A.,
Miyanohara, A.,
Nozaki, C.,
Yoneyama, T.,
Ohtomo, N.,
and Matsubara, K.
(1983)
Nucleic Acids Res.
11,
4601-4610[Abstract/Free Full Text]
|
| 26.
|
Cohen, B.,
Peretz, D.,
Vaimain, D.,
Benech, P.,
and Chebath, J.
(1988)
EMBO J.
7,
1411-1419[Medline]
[Order article via Infotrieve]
|
| 27.
|
Fujita, T.,
Sakakibara, J.,
Sudo, Y.,
Miyamoto, M.,
Kimura, Y.,
and Taniguchi, T.
(1988)
EMBO J.
7,
3397-3405[Medline]
[Order article via Infotrieve]
|
| 28.
|
Tsutsumi, T.,
Ido, A.,
Nakao, K.,
Hamasaki, K.,
Kato, Y.,
Ohtsuru, A.,
Nakata, K.,
Tamaoki, T.,
and Nagataki, S.
(1994)
Gastroenterology
107,
499-504[Medline]
[Order article via Infotrieve]
|
| 29.
|
Nakao, K.,
Miyao, Y.,
Ohe, Y.,
and Tamaoki, T.
(1989)
Nucleic Acids Res.
17,
9833-9842[Abstract/Free Full Text]
|
| 30.
|
Reich, N.,
Evans, B.,
Levy, D.,
Fahey, D.,
Knight, E., Jr.,
and Darnell, J. E., Jr.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
6394-6398[Abstract/Free Full Text]
|
| 31.
|
Reid, L. E.,
Brasnett, A. H.,
Gilbert, C. S.,
Porter, A. C. G.,
Gewert, D. R.,
Stark, G. R.,
and Kerr, I. M.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
840-844[Abstract/Free Full Text]
|
| 32.
|
Tanaka, H.,
and Samuel, C. E.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
7995-7999[Abstract/Free Full Text]
|
| 33.
|
Lew, D. J.,
Decker, T.,
Strehlow, I.,
and Darnell, J. E.
(1991)
Mol. Cell. Biol.
11,
182-191[Abstract/Free Full Text]
|
| 34.
|
Galibert, F.,
Mandart, E.,
Fitoussi, F.,
Tiollais, P.,
and Charnay, P.
(1979)
Nature
281,
646-650[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Ono, Y.,
Onda, H.,
Sasada, R.,
Igarashi, K.,
Sugino, Y.,
and Nishioka, K.
(1983)
Nucleic Acids Res.
11,
1747-1757[Abstract/Free Full Text]
|
| 36.
|
Okamoto, H.,
Imai, M.,
Shimozaki, M.,
Hoshi, Y.,
Iizuka, H.,
Gotanda, T.,
Tsuda, F.,
Miyakawa, Y.,
and Mayumi, M.
(1986)
J. Gen. Virol.
67,
2305-2314[Abstract/Free Full Text]
|
| 37.
|
Harada, H.,
Fujita, T.,
Miyamoto, M.,
Kimura, Y.,
Maruyama, M.,
Furia, A.,
Miyata, T.,
and Taniguchi, T.
(1989)
Cell
58,
729-739[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Vaughan, P. S.,
Aziz, F.,
van Wijnen, A. J.,
Wu, S.,
Hrada, H.,
Taniguchi, T.,
Soprano, K. J.,
Stein, J. L.,
and Stein, G. S.
(1995)
Nature
377,
362-365[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Levy, D. E.,
Lew, D. J.,
Decker, T.,
Kessler, D. S.,
and Darnell, J. E., Jr.
(1990)
EMBO J.
9,
1105-1111[Medline]
[Order article via Infotrieve]
|
| 40.
|
Leonard, G. T.,
and Sen, G. C.
(1997)
J. Virol.
71,
5095-5101[Abstract]
|
| 41.
|
Lehtonen, A.,
Matikainen, S.,
and Julkunen, I.
(1997)
J. Immunol.
159,
794-803[Abstract]
|
| 42.
|
Weihua, X.,
Ling, W.,
and Kalvakolanu, D. V.
(1999)
Antiviral Res.
40,
145-153[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. F. Alcantara, H. Tang, and A. McLachlan
Functional characterization of the interferon regulatory element in the enhancer 1 region of the hepatitis B virus genome
Nucleic Acids Res.,
May 1, 2002;
30(9):
2068 - 2075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rang, M. Bruns, T. Heise, and H. Will
Antiviral Activity of Interferon-alpha against Hepatitis B Virus Can Be Studied in Non-hepatic Cells and Is Independent of MxA
J. Biol. Chem.,
March 1, 2002;
277(10):
7645 - 7647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Samuel
Antiviral Actions of Interferons
Clin. Microbiol. Rev.,
October 1, 2001;
14(4):
778 - 809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rang, T. Heise, and H. Will
Lack of a Role of the Interferon-stimulated Response Element-like Region in Interferon alpha -induced Suppression of Hepatitis B Virus in Vitro
J. Biol. Chem.,
January 26, 2001;
276(5):
3531 - 3535.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Xiao, L. Wang, X. Yang, T. Chen, D. Hodge, P. F. Johnson, and W. Farrar
CCAAT/Enhancer-binding Protein beta Mediates Interferon-gamma -induced p48 (ISGF3-gamma ) Gene Transcription in Human Monocytic Cells
J. Biol. Chem.,
June 22, 2001;
276(26):
23275 - 23281.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|