 |
INTRODUCTION |
Tat is a regulatory protein of the human immunodeficiency virus
type I (HIV-I)1 released by
HIV-infected cells (1). Extracellular Tat is implicated in the
progression of AIDS (2-4) and in the pathogenesis of AIDS-associated pathologies including Kaposi's sarcoma (5, 6), AIDS-dementia (7), and
increased tumor incidence (8, 9). Extracellular Tat exerts its
pleiotropic effects by acting on different target cells. Three classes
of cell-surface receptors have been implicated in the biological
activity of extracellular Tat: cell adhesion receptors of the integrin
family (10), the vascular endothelial growth factor receptors Flt-1 and
Flk-1/KDR (11, 12), and the chemokine receptors CCR2 and CCR3 (13).
Interaction of extracellular Tat with these receptors may activate
various intracellular signaling pathways responsible for the biological
responses elicited by this protein in the different target cells
(13-17).
Tat is a heparin-binding protein (18, 19) that interacts with heparan
sulfate (HS) proteoglycans (HSPGs) of the cell surface and
extracellular matrix (20). This allows the extracellular storage of Tat
that can be mobilized in a biologically active form by free heparin
(20). HSPG interaction is implicated in cell internalization of Tat
(13), and it is required for the HIV-LTR-transactivating activity of
extracellular Tat.2 Both
activities are competed by free heparin/HS (19). On the other hand,
free heparin potentiates the mitogenic and chemotactic activity exerted
by extracellular Tat in cultured endothelial cells and its angiogenic
activity in vivo (13). Interestingly, polysulfonated
heparin-mimicking compounds can interfere with the biological activity
of extracellular Tat and may represent potent inhibitors of possible
therapeutic value (19).
The molecular bases of heparin-Tat interaction have been investigated.
As observed for various heparin binding growth factors and cytokines
(21, 22), sulfate groups of heparin are of importance for Tat binding.
Indeed, high affinity Tat-heparin interaction requires at least some
2-O, 6-O, and N positions to be
sulfated (18). These sulfate groups bind to a stretch of positively
charged amino acid residues present in the basic domain of the Tat
protein (19). Also, the size of heparin is of importance in mediating Tat interaction, because very low molecular weight heparin shows a poor
capacity to bind and antagonize the biological activity of
extracellular Tat when compared with conventional heparin (18).
The minimum size of the heparin/HS chain required for protein
interaction has been identified for different growth factors. For
instance, a hexa-octasaccharide represents the minimum size of HS
required for the binding to hepatocyte growth factor (HGF) (23, 24) and
platelet-derived growth factor (25), whereas the minimum binding
sequence for fibroblast growth factor-2 (FGF-2) has been identify as a
pentasaccharide (26, 27). In contrast, larger HS fragments (ranging
from 18 to 20 saccharide residues) are required for binding to the
platelet factor-4 tetramer (28) and interleukin-8 dimer (29).
The minimum binding sequence of heparin/HS able to interact with the
growth factor may be insufficient to promote its biological activity.
Indeed, the minimum heparin/HS sequence able to affect the biological
activity of FGF-2 is composed of at least 10-12 saccharide residues
(30-33). Moreover, a correlation exists between the length of the
FGF-2-binding oligosaccharides and their capacity to restore
FGF-2-induced proliferation in HSPG-deprived endothelial cells (31).
The same correlation exists between the size of HGF-binding sulfated
oligosaccharides and their capacity to potentiate the mitogenic
activity of the growth factor (34). A possible explanation of these
findings is based on the capacity of larger GAG chains to bind several
growth factor molecules. For instance, a single molecule of
conventional heparin binds up to 10 molecules of FGF-2 (35), thus
inducing growth factor oligomerization (30, 36). Also, heparin promotes
dimerization of HGF (34, 37) and interleukin-8 (38).
In this present study we investigated the capacity of size-defined,
heparin-derived oligosaccharides to bind to Tat protein and to affect
the biological activity of extracellular Tat. The results demonstrate
that six saccharide residues represent the minimum requirement for Tat
interaction. The apparent affinity of binding increases with increasing
the molecular size of the heparin chain, with large fragments (
18
saccharides) approaching the binding capacity and antagonist activity
of full-size heparin. Also, depending on its size and relative
concentration, one heparin chain can bind up to 4-6 molecules of Tat protein.
| |
EXPERIMENTAL PROCEDURES |
Preparation and Radiolabeling of Heparin
Oligosaccharides--
Even-numbered heparin-derived oligosaccharides
were prepared from bovine lung heparin and 3H-labeled as
described previously (29). Briefly, the polysaccharides were
depolymerized with nitrous acid at pH 1.5. Cleavage products were
reduced either by N2BH4 to prepare nonlabeled
fragments or by NaB[3H]4 to radiolabel them,
and size-separated by gel filtration on Bio-Gel P-10 (29). The specific
activity of the radiolabeled fragments reached 1 × 106 dpm/µmol fragment.
Recombinant HIV-I Tat--
Recombinant HIV-I Tat was expressed
in Escherichia coli as glutathione S-transferase
(GST) fusion protein. The corresponding plasmid construct derives from
pGST-Tat 2E, originally obtained by cloning the coding region of both
exons of HIV-IHXB2 Tat in the commercial vector pGEX2T (39). This
construct codes for the 86-amino acid Tat protein. Recombinant GST-Tat
was also fused at its C terminus to the green fluorescent protein
(GFP). To this purpose, the enhanced GFP coding region was amplified by
polymerase chain reactions from the commercial vector pEGFP-N1
(CLONTECH, Palo Alto, CA) using primers 5'
GTGGAATTCATGGTGAGCAAGGGCGAGGAG and 3' ATTTCGCCGGCGCTGAGATCTGGGCCCGCG,
carrying EcoRI- and SmaI-cleavable sites,
respectively. The amplified product was digested with the two
restriction enzymes, gel-purified, and ligated in frame to the
respective sites in pGST-Tat 2E.
Purification of recombinant GST-Tat and GST-Tat-GFP proteins was
performed by glutathione-agarose affinity chromatography as described
(39, 40). The purity (>95%) and integrity of the proteins were
routinely checked by SDS-polyacrylamide gel electrophoresis and silver
staining. Previous studies have shown that the GST and GFP moieties do
not interfere with the LTR-transactivating activity of Tat or with its
capacity to bind heparin (Ref. 18 and data not shown).
Recombinant GST-Tat was labeled with 125I (17 Ci/mg, NEN
Life Science Products) using Iodogen (Pierce) to a specific
radioactivity of 400 cpm/fmol as described previously (19).
Immobilization of GST-Tat to Glutathione-Agarose Beads and
[3H]-Heparin Binding Assay--
Aliquots (400 µl) of
glutathione-agarose beads were mixed with 7 nmol of recombinant
GST-Tat. After incubation at 4 °C, beads were extensively washed,
resuspended in 25 mM Tris-HCl, pH 7.5, containing 150 mM NaCl (TBS), and stored at 4 °C until use. Under these
conditions, up to 90% of the protein binds to the resin. The capacity
of full-size heparin and oligosaccharides to bind to immobilized Tat
was evaluated as described previously (19). Briefly, 110 pmol of
3H-labeled saccharides were loaded onto 80-µl columns
containing 1.3 nmol of GST-Tat protein and allowed to recycle inside
the column for 15 min at 4 °C at a flow rate of 0.3 ml/min by means of a peristaltic minipump. Preliminary experiments had shown that 15 min of recycling were sufficient to reach equilibrium for the binding
of 3H-labeled saccharide to immobilized
Tat.3 Then, the column was
extensively washed with TBS, and bound radioactivity was eluted in a
single step with a 2.0 M NaCl wash, or it was eluted
stepwise with increasing concentrations of NaCl, all in TBS.
Radioactivity in the different fractions was measured in a liquid
scintillation counter. To evaluate the dissociation constant (Kd) of the interaction of GST-Tat with full-size
and 22- and 6-mer heparin, the column was loaded with increasing
concentrations of the 3H-labeled saccharides that were
allowed to reach equilibrium with immobilized Tat as described above.
Bound radioactivity was eluted with a 2.0 M NaCl wash, and
binding data were then analyzed according to the procedure originally
described by Scatchard (41).
Binding of Heparin Oligosaccharide to Free GST-Tat--
To
evaluate the capacity of 3H-labeled heparin
oligosaccharides to interact with GST-Tat in solution, the method
described by Maccarana et al. (26) was used with minor
modifications. Aliquots of GST-Tat were incubated for 20 min at room
temperature with different amounts of 3H-labeled heparin
oligosaccharides in a final volume of 200 µl in TBS. Samples were
then filtered through 25-mm filters (Polyscreen polyvinylidene
difluoride membrane, NEN Life Science Products) equilibrated with TBS
and placed onto a Sartorius filtration apparatus. Filters were washed
twice with 5 ml of TBS, and retained radioactivity was eluted by
washing the filter with 2 ml of 2.0 M NaCl in TBS. The
eluate was mixed to 2 ml of water and 16 ml of Ready Safe liquid
scintillation mixture (Beckman) and counted in a liquid scintillation
counter. Control experiments performed using 125I-GST-Tat
as a tracer demonstrated that this procedure allows the recovery of up
to 97% of the protein both in the absence or presence of heparin.
Cell Cultures--
HL3T1 cells are derived from HeLa cells and
contain integrated copies of pL3CAT, a plasmid in which the bacterial
gene for chloramphenicol acetyltransferase (CAT) is directed by the
HIV-I LTR (42).
T53 Tat-less cells were obtained by subcloning the T53 cell line
originally established from adenocarcinoma of skin adnexa of
Tat-transgenic mice (9, 43). Dot blot analysis of the conditioned
medium of T53 Tat-less cells performed with anti-Tat antibodies
revealed that this clone does not produce detectable amounts of
extracellular Tat when compared with parental T53 cells (data not
shown). Nevertheless, T53 Tat-less cells retain the capacity to
proliferate when exposed to extracellular Tat (see below). All cells
were grown and maintained in Dulbecco's modified minimal essential
medium (DMEM) with 10% fetal calf serum (FCS) (Life Technologies,
Inc.).
Cell Internalization of GST-Tat--
Cell internalization of
GST-Tat was studied by using radiolabeled 125I-GST-Tat and
fluorescent GST-Tat-GFP. In the first set of experiments, HL3T1 cells
were seeded in 24-well dishes at the density of 45,000 cells/cm2 in DMEM containing 10% FCS. After 24 h,
cell cultures were washed twice with TBS and incubated in binding
medium (serum-free medium containing 0.15% gelatin and 20 mM Hepes buffer, pH 7.5) complemented with 20 ng/ml of
125I-GST-Tat plus 200 ng/ml of unlabeled GST-Tat as a
carrier in the absence or presence of the different oligosaccharides.
100 µM chloroquine was added to cell cultures to prevent
lysosomal degradation of cell-internalized Tat. After 16 h at
37 °C, the cells were washed three times with cold TBS and lysed by
incubation with 0.5% Triton X-100 in 0.1 M sodium
phosphate, pH 8.1. Radioactivity of the cell lysates was measured, and
nonspecific binding, determined in the presence of a 200-fold molar
excess of unlabeled GST-Tat (4 µg/ml), was subtracted. Under these
experimental conditions, up to 90% of the radioactivity remains
associated to the cell after a wash with 2.0 M NaCl in
sodium acetate, pH 4.0 (45), thus demonstrating the intracellular
localization of cell-associated 125I.
In a second set of experiments, glass coverslips (10 mm in diameter)
were immersed in 65% HNO3 for 1 h, washed with
distilled water, immersed in 7% NaOH for one more hour, washed with
distilled water again, and dried. Coverslips were then placed within
24-well tissue culture plates, and HL3T1 cells were seeded at 20,000 cells/cm2 and allowed to adhere onto glass coverslips.
Adherent cells were then incubated for 6 h at 37 °C in DMEM
containing 10% FCS in the presence of 400 ng/ml of GST-Tat-GFP in the
absence or presence of the different oligosaccharides. 100 µM chloroquine was added to cell cultures to prevent
lysosomal degradation of internalized Tat. At the end of incubation,
the excess of GST-Tat-GFP was removed, and cell cultures were washed
twice with 2.0 M NaCl in phosphate-buffered saline to
remove GST-Tat-GFP adsorbed onto the cell surface. Then cells were
fixed by a 5-min incubation with 3% paraformaldehyde in
phosphate-buffered saline containing 2% sucrose. Observations were
carried out under a Nikon photomicroscope equipped for epifluorescence.
LTR-CAT-transactivating Activity Assay--
HL3T1 cells were
seeded in 24-well dishes at the density of 20,000 cells/cm2
in DMEM containing 10% FCS. After 24 h, cell cultures were washed twice with TBS and incubated for another 24 h in fresh medium containing 10% FCS and 100 µM chloroquine in the absence
or presence of recombinant GST-Tat (200 ng/ml) and of increasing
concentrations of the oligosaccharide under test. After 24 h the
medium was changed to DMEM with 10% FCS, and cells were incubated for
another 24 h. At the end of the incubation, cells were extracted
and the amount of CAT protein present in the cell extracts was
determined by the CAT enzyme-linked immunosorbent assay kit (Roche
Molecular Biochemicals) according to the manufacturer's instructions.
T53 Tat-less Cell Proliferation Assay--
T53 Tat-less cells
were seeded in 96-well dishes at 15,000 cells/cm2 in DMEM
containing 10% FCS. After 24 h, subconfluent cultures were washed
twice with DMEM and treated with fresh medium containing 10% FCS and
100 ng/ml of GST-Tat in the absence or presence of different
heparin-derived oligosaccharides or full-length heparin. After 24 h of incubation at 37 °C, cells were trypsinized and counted in a
Burker chamber.
| |
RESULTS |
Heparin Oligosaccharide Binding to Immobilized Tat--
To
identify the minimum size of heparin required for Tat interaction,
heparin-derived 3H-labeled oligosaccharides of defined size
were evaluated for their capacity to bind to GST-Tat immobilized onto
glutathione-agarose beads. This experimental model had already been
used to characterize the binding of Tat to heparin and different
polysulfated/polysulfonated compounds (18, 19). To this purpose, 110 pmol of the different even-numbered 3H-labeled heparin
fragments were loaded onto 80-µl columns containing a molar excess
(1.3 nmol) of immobilized GST-Tat. As described under "Experimental
Procedures," the samples were allowed to reach equilibrium within the
column at 4 °C and then, after extensive washing under physiological
buffer conditions, bound radioactivity was eluted with a 2.0 M NaCl wash and measured in a liquid scintillation counter.
Full-size [3H]heparin (average Mr = 11,000, corresponding to approximately 32 saccharide units) was used
as a control (18). Under these experimental conditions, more than 80%
of the total amount of loaded 6-mer heparin and larger oligosaccharides
bind to immobilized Tat (Fig. 1). In
contrast, 4-mer heparin shows a very limited specific interaction with
the protein. The specificity of the binding was demonstrated by the
capacity of a 10-fold molar excess of unlabeled full-size heparin to
inhibit the binding of 3H oligomers (data not shown) and of
full-size [3H]heparin (Fig. 1) to immobilized GST-Tat and
by the incapacity of full-size [3H]heparin to interact
with immobilized GST devoid of the Tat moiety (18).
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Binding of [3H]heparin
oligosaccharides to immobilized GST-Tat. 3H-Labeled
even-numbered heparin fragments were loaded at 110 pmol/sample onto
80-µl glutathione-agarose columns containing 1.3 nmol of immobilized
GST-Tat and were allowed to reach equilibrium at 4 °C. After
extensive washing under physiological buffer conditions, the
radioactivity bound to the column was eluted with a 2.0 M
NaCl wash and measured in a liquid scintillation counter. Full-size
[3H]heparin (UFH) in the absence ( ) or
presence (+) of a 10-fold molar excess of unlabeled heparin was used as
positive and negative control, respectively. Data are expressed as
percents of the radioactivity bound to the column in respect to the
radioactivity originally loaded. The experiment is representative of
two independent experiments with similar results.
|
|
We then evaluated the relative affinity of the different heparin
oligosaccharides for immobilized GST-Tat. To this purpose, subsaturating amounts of 3H-labeled full-size and 22-, 12-, 6-, and 4-mer heparin (all at 110 pmol per sample) were loaded onto
80-µl columns containing 1.3 nmol of immobilized GST-Tat protein and
were allowed to reach equilibrium at 4 °C. After extensive washing
with TBS, the columns were stepwise eluted with increasing
concentrations of NaCl in TBS, and radioactivity was measured in the
different fractions. Again, all the heparin oligosaccharides fully bind
to immobilized Tat with the only exception being 4-mer heparin, which
is mostly recovered in the flow-through of the column and in the first
0.2 M NaCl wash (Fig. 2). The
ionic strength necessary to disrupt Tat-heparin interaction increases
with increasing the size of the oligosaccharide and 6-, 12-, 22-mer-,
and full-size heparin eluting from the column at 0.4, 0.6, 1.0, and 1.2 M NaCl, respectively (Fig. 2).
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Affinity chromatography of
[3H]heparin oligosaccharides on immobilized GST-Tat.
Full-size and 22-, 12-, 6-, and 4-mer [3H]heparin
fragments were loaded at 110 pmol/sample onto 80-µl
glutathione-agarose columns containing 1.3 nmol of immobilized GST-Tat
and were allowed to reach equilibrium at 4 °C. After extensive
washing under physiological buffer conditions, columns were stepwise
eluted with increasing concentrations of NaCl. Radioactivity in the
eluted fractions was measured in a liquid scintillation counter. The
experiments shown are representative of two to three independent
experiments with similar results. F.T., flow-through of the
column.
|
|
Taken together, the data indicate that 5-6 saccharide residues
represent the minimum requirement for a significant Tat interaction under physiological buffer conditions. Also, they demonstrate that the
affinity of heparin-Tat interaction strictly depends upon the size of
the heparin oligomer and raise the possibility that, in the presence of
a molar excess of GST-Tat, a saccharide chain of appropriate length can
set up multiple interactions with more than one molecule of Tat, thus
increasing the strength of the interaction.
To further investigate this possibility, we evaluated the ionic
strength required to disrupt heparin-Tat interaction when subsaturating
and saturating amounts of full-size [3H]heparin (0.04 and
3.10 nmol, respectively) were loaded onto 80-µl glutathione-agarose
columns containing 1.3 nmol of immobilized GST-Tat. In agreement with
the data shown in Fig. 2A, under subsaturating conditions
heparin elutes from immobilized GST-Tat at high ionic strength (1.2 M NaCl, Fig. 3A).
In contrast, when heparin binds to GST-Tat under saturating conditions,
it elutes from the column at a much lower ionic strength (0.4-0.6
M NaCl, Fig. 3B). These data are in keeping with
the hypothesis that subsaturating concentrations of heparin may favor
the binding of a single saccharide chain with several Tat molecules,
leading to a strong interaction. In contrast, a weaker interaction
occurs when an excess of heparin chains compete for the binding to a
limited number of GST-Tat molecules, possibly leading to the formation
of equimolar heparin-GST-Tat complexes.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of the concentration of heparin on its
interaction with immobilized GST-Tat. Full-size
[3H]heparin was loaded at 0.04 nmol/sample (A)
or at 3.1 nmol/sample (B) onto 80-µl glutathione-agarose
columns containing 1.3 nmol of immobilized GST-Tat and was allowed to
reach equilibrium at 4 °C. After extensive washing under
physiological buffer conditions, columns were stepwise eluted with
increasing concentrations of NaCl. Radioactivity in the eluted
fractions was measured in a liquid scintillation counter. The
experiments were repeated twice with similar results. F.T.,
flow-through of the column.
|
|
To directly demonstrate the possibility that a single heparin chain of
appropriate size can establish multiple interactions with numerous
GST-Tat molecules, we calculated the molar ratio and
Kd of the interaction of immobilized GST-Tat with 6-mer heparin and 22-mer heparin (19). For this purpose, increasing amounts (from subsaturating to saturating concentrations) of the two
3H-labeled oligomers were loaded onto glutathione-agarose
columns containing 0.4 nmol of immobilized GST-Tat and were allowed to reach binding equilibrium with immobilized Tat. After extensive washing, bound radioactivity was eluted with a 2.0 M NaCl
wash. As shown in Fig. 4, the binding of
6-mer [3H]heparin fragments and of 22-mer
[3H]heparin fragments to immobilized GST-Tat is
dose-dependent and saturable. Scatchard plot analysis of
the binding data reveals a single component binding for 6-mer
[3H]heparin-Tat interaction with a Kd
equal to 0.7 ± 0.4 µM and a molar
oligosaccharide:GST-Tat ratio of about 1:1 (Fig. 4A,
inset). In contrast, the binding of 22-mer
[3H]heparin to immobilized GST-Tat is consistent with a
two-component binding curve (Fig. 4B, inset). A
high affinity binding (Kd = 30 ± 14 nM) occurs at subsaturating concentrations of 22-mer [3H]heparin with a molar oligosaccharide:GST-Tat ratio
equal to approximately 1:4. A low affinity binding
(Kd = 1.6 ± 0.4 µM) occurs
instead at saturating concentrations of 22-mer [3H]heparin with a molar ratio equal to approximately
1:1. A biphasic interaction was also obtained for the binding of
full-size [3H]heparin to immobilized GST-Tat. At
subsaturating concentrations, full-size heparin binds to immobilized
GST-Tat with a high affinity interaction (Kd = 73 ± 14 nM) and a molar ratio equal to approximately
1:3. Full-size heparin binds instead with a low affinity interaction
(Kd = 0.9 ± 0.4 µM) and a 1:1
molar ratio at saturating concentrations (data not shown). Therefore, at low ratios of 22-mer or full-size heparin to Tat, approximately 3-4
molecules of the protein bind per GAG molecule with high affinity, whereas at higher heparin concentrations only 1 Tat molecule binds heparin at a much lower affinity. Accordingly, short heparin
oligosaccharides (6-mer) can establish only a low affinity, equimolar
interaction with Tat protein.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 4.
Scatchard plot analysis of the binding of 6- and 22-mer [3H]heparin to immobilized GST-Tat.
Increasing concentrations of 6-mer [3H]heparin
(A) or of 22-mer [3H]heparin (B)
were loaded onto 80-µl glutathione-agarose columns containing 0.4 nmol of immobilized GST-Tat and were allowed to reach equilibrium at
4 °C. After extensive washing under physiological buffer conditions,
radioactivity bound to the column was eluted with a 2.0 M
NaCl wash, measured in a liquid scintillation counter, and expressed as
nanomoles of heparin molecules bound to immobilized GST-Tat. The
insets show the Scatchard plot interpolations of the binding
data. The experiments were repeated two to three times with similar
results.
|
|
Heparin Oligosaccharide Binding to Free Tat--
When tested for
biological activity, GST-Tat is administered as a free molecule (see
below). On this basis, the capacity of the different heparin
oligosaccharides to interact with GST-Tat was also investigated in
solution by using a filter binding assay (26). Experiments were
performed in the presence of equimolar amounts of heparin fragments in
respect to free Tat to emphasize their different affinity for the
protein. To this purpose, 110 pmol of free GST-Tat were incubated for
20 min at room temperature with 110 pmol of heparin
3H-oligomers in a final volume of 200 µl of TBS. At the
end of incubation, 3H-oligomer-GST-Tat complexes were
recovered by a passage through a nitrocellulose membrane, and
protein-bound radioactivity was measured (Fig.
5). Under these experimental conditions,
18-mer heparin represents the smallest oligosaccharide able to retain a
Tat-binding capacity similar to that shown by full-size heparin. A
decrease of the size of the oligosaccharide results in a proportional decrease of its Tat-binding capacity, with no significant binding being
observed for 
8-mer oligosaccharides. In agreement with the data
obtained with immobilized GST-Tat (see Fig. 2), these findings
demonstrate that the affinity of heparin fragment-GST-Tat interaction
increases with increasing the size of the oligosaccharide.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
Heparin oligosaccharide binding to GST-Tat in
solution. 3H-Labeled even-numbered heparin fragments
(110 pmol/sample) were incubated for 20 min at room temperature with
110 pmol of GST-Tat in a final volume of 200 µl of phosphate-buffered
saline. At the end of incubation, samples were applied to
polyvinylidene difluoride membrane under suction. The protein, together
with any retained radioactivity, was recovered from the membrane and
measured in a liquid scintillation counter. Full-size
[3H]heparin (UFH) in the absence
(-) or presence (+) of a 10-fold molar excess of
unlabeled heparin was used as positive and negative control,
respectively. The experiment is representative of three independent
experiments with similar results.
|
|
To assess whether large heparin fragments retain the capacity to
complex numerous Tat molecules when the protein is presented in a free
form to the GAG, increasing amounts of 22-mer [3H]heparin
were incubated for 20 min at room temperature with 110 pmol of free
GST-Tat in a final volume of 200 µl of TBS. At the end of incubation,
22-mer [3H]heparin-GST-Tat complexes were recovered by a
passage through a nitrocellulose membrane, and radioactivity was
measured. As shown in Fig. 6A,
22-mer [3H]heparin binds free GST-Tat in a
dose-dependent, saturable manner. Also in this case,
Scatchard plot analysis of the binding data reveals a biphasic binding
(Fig. 6B). As observed for immobilized GST-Tat, a high
affinity binding (Kd = 5 ± 3 nM)
occurs at subsaturating concentrations of 22-mer
[3H]heparin with a molar oligosaccharide:GST-Tat ratio
equal to approximately 1:6. In contrast, a low affinity binding
(Kd = 0.3 ± 0.1 µM) with a molar
ratio equal to approximately 1:1 occurs at saturating concentrations of
22-mer [3H]heparin.
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6.
Scatchard plot analysis of the interaction
between 22-mer [3H]heparin and free GST-Tat.
A, the binding of increasing concentrations of 22-mer
[3H]heparin to 110 pmol of free GST-Tat was evaluated as
described in the legend to Fig. 5. B, Scatchard plot
analysis of the binding data. The experiments were repeated twice with
similar results.
|
|
Effect of Heparin Oligosaccharides on the Biological Activity of
Extracellular Tat--
Heparin oligosaccharides were evaluated for
their capacity to inhibit the cellular uptake and the
HIV-I-LTR-transactivating activity of extracellular Tat in HL3T1 cells.
These cells are derived from HeLa cells and contain integrated copies
of pL3CAT, a plasmid in which the bacterial cat gene is
directed by the HIV-I LTR (42). Full-size heparin has been demonstrated
to inhibit both cell internalization and LTR-transactivating activity
of extracellular Tat in this experimental model (19). In a first series
of experiments, subconfluent cultures of HL3T1 were incubated for
16 h at 37 °C with 20 ng/ml of 125I-GST-Tat
complemented with 200 ng/ml of unlabeled GST-Tat as a carrier, in the
absence or presence of increasing concentrations of 6-mer heparin or of
full-size heparin. At the end of incubation, free and cell
surface-associated 125I-GST-Tat was removed, cells were
lysed, and the amount of intracellular radioactivity was measured. As
shown in Fig. 7A, full-size
heparin inhibits the internalization of 125I-GST-Tat in a
dose-dependent manner (ID50 10 nM), whereas 6-mer heparin is barely effective
(ID50 10 µM). When all the
oligosaccharides available were tested in the same assay at the dose of
1.8 µM, the results shown in Fig. 7B were
obtained. Clearly, the ability of the different oligosaccharides to
inhibit 125I-GST-Tat internalization in HL3T1 cells is
directly related to their size, with the smallest oligosaccharides
(8-mer) being almost ineffective.
View larger version (64K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of heparin oligosaccharides on cell
internalization of extracellular GST-Tat. HL3T1 cells were treated
with 20 ng/ml of 125I-GST-Tat plus 200 ng/ml of unlabeled
protein as a carrier in the absence or presence of increasing
concentrations of 6-mer- ( ) or full-size ( ) heparin
(A) or with 1.8 µM amounts of the various
even-numbered heparin fragments (B). After 16 h of
incubation at 37 °C, the medium was removed, cells were lysed, and
radioactivity was measured in the cell extract. Nonspecific
radioactivity was evaluated by incubating the cells at 4 °C in the
presence of 20 ng/ml 125I-GST-Tat and a 200-fold molar
excess of unlabeled GST-Tat (4 µg/ml) and was subtracted from each
experimental point. In A, each point is the mean of one to
six determinations in duplicate, and S.E. never exceeded 11% of the
mean value. In B, each point is the mean ± S.E. of one
to three determinations in duplicate. C, HL3T1 cells were
treated with 400 ng/ml GST-Tat-GFP alone (panel a) or added
with 1.8 µM 22-mer- (panel b) or 6-mer heparin
(panel c). After 6 h of incubation at 37 °C, free
and cell surface-associated GST-Tat-GFP was removed, and cells were
fixed and photographed under a microscope equipped for epifluorescence.
UFH, full-size [3H]heparin.
|
|
To confirm these observations, the effect of heparin oligosaccharides
on the internalization of fluorescent GST-Tat-GFP was evaluated.
Preliminary experiments had shown that the GFP moiety does not
significantly affect the heparin-binding capacity, cellular uptake, or
LTR-transactivating activity of Tat.3 On this basis,
subconfluent cultures of HL3T1 cells were incubated for 6 h at
37 °C with 400 ng/ml of GST-Tat-GFP in the absence or presence of
1.8 µM 4- or 22-mer heparin. At the end of incubation, free and cell surface-associated GST-Tat-GFP were removed, and cells
were photographed under a microscope equipped for epifluorescence. In
control cells, internalized GST-Tat-GFP accumulates in punctuated structures corresponding to cell lysosomes (Fig. 7C,
panel a). Addition of 22-mer heparin completely inhibits the
internalization of GST-Tat-GFP (Fig. 7C, panel
b), whereas 4-mer heparin is ineffective (Fig. 7C,
panel c).
Heparin-derived oligosaccharides were then evaluated for their capacity
to inhibit the LTR-transactivating activity of extracellular Tat. To
this purpose, subconfluent cultures of HL3T1 cells were incubated with
200 ng/ml of GST-Tat in the presence of increasing concentrations of 6- and 14-mer- or full-size heparin. At the end of the incubation, the
amount of intracellular CAT protein, proportional to the
LTR-transactivating activity exerted by GST-Tat, was measured by a CAT
enzyme-linked immunosorbent assay kit. As shown in Fig.
8A, the different heparin
molecules inhibit the LTR-transactivating activity of GST-Tat in a
dose-dependent manner with ID50 equal to
approximately 100, 1.0, and 0.1 nM for 6- and 14-mer- and
full-size heparin, respectively. In agreement with these observations,
when all the oligosaccharides available were tested at 70 nM, the capacity of the different heparin oligomers to
inhibit the LTR-transactivating activity of Tat was directly related to
their size, with 4-mer heparin being ineffective and 18-mer heparin
being the smallest fragment that retains an inhibitory potency similar
to that shown by full-size heparin (Fig. 8B).
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of heparin oligosaccharides on
LTR-transactivating activity of extracellular GST-Tat. HL3T1 cells
were treated with 200 ng/ml GST-Tat in the absence or presence of
increasing concentrations of 6-mer (), 14-mer ( ), or full-size
heparin () (A) or with 70 nM amounts of the
various even-numbered heparin fragments (B). After 48 h
of incubation at 37 °C, cell extracts were assayed for the levels of
CAT antigen by enzyme-linked immunosorbent assay. Data are expressed as
percents of the LTR-transactivating activity measured in control
cultures treated with GST-Tat alone. In A, each point is the
mean of two to three determinations in duplicate, and S.E. never
exceeded 15% of the mean value. In B, each point is the
mean ± S.E. of three determinations in duplicate. UFH,
full-size heparin.
|
|
Heparin-derived oligosaccharides were also evaluated for their capacity
to inhibit the mitogenic activity exerted by extracellular Tat on T53
Tat-less cells. These cells were obtained by subcloning the
Tat-producing T53 cell line originally established from adenocarcinoma of skin adnexa of Tat-transgenic mice (43, 9). T53 Tat-less cells do
not produce significant amounts of extracellular Tat when compared with
parental T53 cells (see "Experimental Procedures"). When incubated
for 24 h in 10% FCS in the absence or presence of 100 ng/ml of
GST-Tat, subconfluent cultures of T53 Tat-less cells undergo 0.8 and
1.8 cell population doublings, respectively, thus indicating that
extracellular Tat is able to induce proliferation of these cells.
Full-size heparin inhibits the mitogenic activity of GST-Tat in a
dose-dependent manner with an ID50 equal to 0.1 nM. In contrast, 6-mer heparin does not affect the
mitogenic activity of GST-Tat when tested at 1 µM (Fig.
9A). Also in this experimental model, the antagonist activity of the heparin oligosaccharides was
directly related to their size, with 20-22 saccharide residues being
the minimum size required to elicit an inhibitory activity similar to that exerted by full-size heparin (Fig. 9B).
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of heparin oligosaccharides on the
mitogenic activity of extracellular GST-Tat. T53 Tat-less cells
were incubated in DMEM complemented with 10% FCS and treated with 100 ng/ml GST-Tat in the absence or presence of increasing concentrations
of 6-mer () or full-size heparin () (A) or with 1.0 nM amounts of the various even-numbered heparin fragments
(B). After 24 h of incubation at 37 °C, cell were
trypsinized and counted. Data are expressed as percents of the increase
of cell proliferation observed in cell cultures treated with GST-Tat
alone in respect to untreated control cultures. When incubated for
24 h in 10% FCS in the absence or presence of 100 ng/ml of
GST-Tat, subconfluent cultures of T53 Tat-less cells undergo 0.8 and
1.8 cell population doublings, respectively. UFH, full-size
heparin.
|
|
| |
DISCUSSION |
HIV-I Tat, originally viewed as a viral transactivating factor
with an intracellular mechanism of action, can also act as an
extracellular growth factor endowed with heparin-binding capacity. The
interaction of Tat with heparin modulates various biological effects
exerted by extracellular Tat on target cells (13, 18, 19).
Here, by using a series of size-defined heparin fragments, we have
observed that 5-6 saccharide residues represent the minimum size
required for a significant interaction with Tat protein under physiological buffer conditions. Affinity chromatography on immobilized GST-Tat followed by Scatchard plot analysis of the binding data has
shown that 1 molecule of 6-mer heparin binds 1 molecule of immobilized
GST-Tat with low affinity (Kd equal to approximately 0.7 µM). Accordingly, the interaction is disrupted at
relatively low ionic strength (0.4 M NaCl). It must be
pointed out that all the hexasaccharide fragments of the 6-mer heparin
population bind Tat when the protein is present in a molar excess in
respect to the heparin oligosaccharide. This indicates that all the
fragments contain Tat-binding sequence(s). Previous studies had shown
that Tat-heparin interaction requires at least some 2-O-,
6-O-, and N-positions to be sulfated (18).
Disaccharide units containing 2-O-, 6-O-, and
N-sulfate groups are predominantly present in heparin (21),
even though specific factor binding sequences, possibly present in HS,
may be hidden in heparin because of its high degree of sulfation.
A low affinity interaction was also observed when longer heparin
saccharide chains (22-mer and full-size heparin) were allowed to
interact with Tat at a high ratio of heparin to immobilized protein.
Indeed, when only one molecule of immobilized Tat binds one GAG chain,
the interaction has a Kd equal to approximately 0.9-1.6 µM and is disrupted at 0.4 M NaCl.
However, a significant increase of the affinity of the binding was
observed when subsaturating concentrations of 22-mer or full-size
heparin are presented to an excess of Tat protein. Under these
experimental conditions, 3-4 molecules of immobilized Tat can bind a
single 22-mer or full-size heparin chain. This causes a significant
increase of the affinity of Tat-heparin interaction (with
Kd values ranging from 30 to 70 nM),
which is disrupted at NaCl concentrations 1.0 M. These
data were confirmed by studying the interaction of 22-mer heparin with
GST-Tat in solution. Also in this case, an increase from 1 to 6 of the
number of GST-Tat molecules that bind to a single heparin chain causes
a dramatic increase of the affinity of the interaction
(Kd equal to 0.3 µM and 5 nM, respectively). These data suggest the possibility that
Tat may establish a cooperative interaction with heparin in which the
binding of the first Tat molecule facilitates the interaction of more
Tat molecules to adjacent Tat-binding regions of the GAG chain. This
may cause the formation of highly packed multimeric Tat-heparin
complexes, as already observed for FGF-2-heparin complexes in which a
single heparin chain (Mr = 15,000) can bind up
to 6-7 molecules of the growth factor (46).
The possibility that Tat molecules can establish mutual interactions
leading to Tat oligomerization has been advanced (47, 48). The heparin
chain may therefore provide the appropriate scaffold to facilitate and
stabilize this interaction, as already observed for different growth
factors and cytokines, including FGF-2 (30, 36), HGF (37),
platelet-derived growth factor (28), and midkine (49). All of these
growth factors share the characteristic to bind to cognate tyrosine
kinase receptors that require dimerization to signal inside the cell.
On this basis, growth factor oligomerization mediated by cell-surface
HSPGs may promote receptor dimerization, signaling, and biological
activity (34, 50). Interestingly, Tat also binds to tyrosine kinase receptors, including Flt-1, responsible for the chemotactic activity exerted by Tat on monocyte/macrophages (11), and Flk-1/KDR, responsible
for the chemotactic, mitogenic, and angiogenic activity exerted by Tat
on endothelial cells (12). These observations raise the possibility
that cell surface HSPGs may facilitate Tat oligomerization and that
this may be of importance for the biological activity of extracellular
Tat. Experiments are in progress in our laboratory to assess this hypothesis.
Our data show that heparin oligosaccharides exert a Tat-antagonist
activity in different biological assays. As observed for polysulfated/polysulfonated compounds (19), heparin fragments inhibit
cell internalization and LTR-transactivating activity of extracellular
Tat in H3T1 cells and its mitogenic activity in T53 Tat-less cells. In
agreement with the in vitro binding studies, the relative
capacity of heparin oligomers to inhibit the activity of extracellular
Tat in the different assays is a function of their size, with at least
18-20 saccharide residues being required to confer to the
oligosaccharide chain an antagonist potency similar to full-size
heparin. Interestingly, 6-mer heparin is unable to exert a significant
antagonist activity when compared with full-size heparin. Indeed, the
ID50 values for 6-mer heparin are at least 1,000 times
higher than that of full-size heparin in all the biological assays.
This lack of activity cannot be entirely explained by the lower
affinity of 6-mer heparin for Tat (Kd = 0.7 µM) when compared with full-size heparin (Kd = 70 nM), suggesting that different
structural requirements and/or oligomerization-inducing ability are
implicated in Tat interaction and antagonist activity of heparin. A
dissociation between binding capacity and antagonist activity of
heparin oligosaccharides had been already demonstrated for
heparin-FGF-2 interaction in which a pentasaccharide represents the
minimum FGF-2-binding sequence (26, 27), whereas at least 10 saccharide
residues are required to modulate the biological activity of the growth
factor (30-33).
Taken together, the data suggest that in vivo cell surface
interaction and biological activity of extracellular Tat may depend strictly on the GAG milieu of the extracellular environment where free
and cell-associated HSPGs, depending upon their relative concentration
and size, compete for the binding to extracellular Tat, thus regulating
its bioavailability and biological activity. Relevant to this point, it
is interesting to note that the expression and release of HSPGs undergo
significant changes during AIDS progression. For instance, a novel
proteoglycan has been isolated in the urine from AIDS patients (51),
and HSPGs are selectively expressed during the development of
AIDS-associated Kaposi's sarcoma (52), a pathological condition in
which Tat plays a key role by inducing neovascularization as well as
cell proliferation and chemotaxis of Kaposi's sarcoma spindle cells
(5, 53).
Extracellular Tat has been proposed as a target for pharmacological and
immunological approaches in the therapy of AIDS and AIDS-associated
pathologies (54). Besides their Tat-antagonist activity, heparin and
polysulfated compounds can prevent HIV infection and cell-killing
in vitro (55), suggesting the potential use of heparin-like
molecules as "multi-target" compounds able to affect different
aspects of HIV infection and AIDS-related disorders. A pilot clinical
trial in patients with advanced AIDS has demonstrated the possibility
of treating patients with low molecular weight heparin on a long term
basis with no evidence of drug toxicity or bleeding episodes (44). Our
results may help to design tailored Tat-antagonist oligosaccharides
with a favorable therapeutic window.
,
, and
TOP
ABSTRACT
INTRODUCTION
