 |
INTRODUCTION |
Carbohydrates are the major source of energy for mammalian cells.
High carbohydrate intake results in the conversion of excess carbohydrates to triglycerides in the liver and adipocyte. This process
is accompanied by the induction of many enzymes of the glycolytic and
lipogenic pathways. This glucose response has been found to be, at
least in part, at the transcriptional level, e.g. in the
case of the L-pyruvate kinase
(L-PK)1 (1), aldolase B (2),
spot 14 (S14) (3), acetyl-CoA carboxylase ACC (4), hormone-sensitive
lipase HSL (5), and fatty acid synthase (6) genes. However, little
information has been reported so far on the transacting factors that
confer transcriptional glucose responsiveness on these genes.
Our laboratory has extensively studied the regulation of the L-PK gene
by glucose. Doiron et al. (7) suggested that glucose is
metabolized into active intermediates that in turn activate specific
transcriptional factors that enhance the L-PK gene promoter. We defined
a sequence responsible for mediating the positive response to glucose
and the negative responses to cAMP in the proximal L-PK promoter from
the position 
172 to 142 bp, ex vivo by transient expression assays in hepatocytes in primary culture and in
vivo in transgenic mice (8-11). This DNA-binding site was termed
the glucose response element (GlRE). This GlRE is closely related to
the carbohydrate response element (ChoRE) described by Towle's group
(12) in the regulatory region of the S14 gene and also to the glucose
response element recently identified upstream of the glucagon receptor
gene (13). In the context of the wild-type L-PK promoter, the complex
that binds to this element cooperates with an adjacent DNA-binding
site, the auxiliary site L3 (8, 10), to confer a strong glucose
responsiveness. This auxiliary site has been shown to bind mainly
hepatocyte nuclear factor 4 (HNF4) in the liver but has also some
affinity for chicken ovalbumin upstream promoter transcription factor
(COUP-TF) (10, 14) and nuclear factor 1 (15). However, our group and
Towle's group showed that a GlRE multimer is sufficient to confer both
carbohydrates and cAMP responses in the absence of the auxiliary site
(8, 10). The GlRE consists of two palindromic noncanonical E boxes (CANNTG) separated by 5 bp (12). The full activity of the L-PK GlRE
seems to require the cooperation between these two E boxes (8, 10). We
have found that these E boxes are able to bind the upstream stimulatory
factors (USFs), which are members of the basic helix-loop-helix/leucine
zipper family (10, 16). In vivo footprinting on the 183-PK
promoter suggested that both E boxes are occupied in the liver (17).
In vitro experiments showed that, in the liver as well as in
most cells and tissues tested (18), USF binding activity is mainly
accounted for by the USF1/USF2 heterodimer. By different approaches in
cell culture and in vivo, we have shown that USF was
implicated in the response of the L-PK gene to glucose (8, 9, 10, 19).
Accordingly, response of the L-PK, S14, and fatty acid synthase genes
to dietary glucose is abnormal in USF2-defective knock-out mice (20,
21). In USF1/ knock-out mice, only dietary response of the fatty acid synthase gene was impaired, whereas that of the L-PK and S14 genes
was normal (21, 22). However, USFs alone cannot account for the
transcriptional response to glucose because most genes whose promoters
include USF-binding E boxes are not regulated by glucose (23). In
addition, the glucose responsiveness conferred by GlREs/ChoREs is
clearly not parallel to their affinity for USFs (24). Finally, gel
shift assays with the L-PK GlRE as probe can detect, under some
conditions, other binding proteins than USFs (Refs. 15 and 25 and this
paper). We therefore undertook research of novel partners of the
glucose response complex interacting with the L-PK GlRE.
Using a one-hybrid system in yeast with the GlRE as the target
sequence, we cloned the COUP-TFII orphan nuclear receptor (also referred to as ARP-1) (26). COUP-TF is a member of the steroid/thyroid hormone receptor (TR) superfamily and was first identified as a
homodimer that binds to a direct repeat regulatory element (DR1) in the
chicken ovalbumin gene promoter (27). Indeed, COUP-TFII is able to bind
to the GlRE in vitro, and COUP-TF-containing complexes interacting with the GlRE are detected in liver nuclear extracts. DNA
binding activities of these complexes do not seem to be modulated by
diets. COUP-TF- and USF-binding sites are overlapping, and consequently
binding of these factors mutually interferes one on the other.
Here, we demonstrate that overexpression of COUP-TFII not only inhibits
USF-dependent transactivation of the L-PK promoter but also
represses its stimulation by glucose in hepatocytes. Furthermore, a
mutant GlRE with very low affinity for COUP-TFII conferred an impaired
glucose response, because of increased activity under low glucose
conditions. We propose that the glucose responsiveness mediated by the
GlRE could involve a complex interaction between USF transactivators
and COUP-TFII, probably in association with other, as yet not
characterized partners. COUP-TFII-containing dimers could be involved
in a glucose sensor system abrogating transactivation by USFs in the
absence of glucose.
| |
MATERIALS AND METHODS |
Yeast Strain--
The Saccharomyces cerevisiae strain
used in this study was the CD156 strain (MATa, ade2,
his3, leu2, lys2, trp1, ura3, gal4, gal80, cbf1
). The
CYC1-HIS3 gene fusion used for the one-hybrid screen was as
described in Blaiseau et al. (28). Wild-type GlRE motifs of
the L-PK gene was cloned as two oriented copies, 200 bp upstream of the
TATA box owing to the unique cloning site XhoI. The
resulting plasmid was linearized with StuI (within the
URA3 marker) and used to transform the CD156 strain. Stable
uracil prototroph transformants were selected, and correct integration events were verified by Southern blot analysis.
Screening of a Mouse Embryo cDNA-VP16 Fusion
Library--
About 109 cells of strain YMV1
(cbf1::hisg,
ura3::GlRE-HIS3::URA3) were transformed with
90 µg of the cDNA fusion library (kindly provided by Dr. A. Vojtek) (29) in the presence of 300 µg of salmon sperm carrier DNA
according to Bartel and Fields (30). After transformation, the cells
were recovered for 1 h in complete yeast medium and plated, and
histidine prototroph, aminotriazole (AT, 30 mM)-resistant
transformants were selected. From a screen of about 2 × 106 transformants, 60 AT-resistant clones were selected
after 3-10 days at 30 °C. The corresponding plasmids were recovered
and then tested for specificity by transforming yeast cells containing either the GlRE-HIS3 or the unrelated MEF3-HIS3
gene construct integrated in the genome. From this second round of
selection, only one plasmid was shown to result in the specific
activation of the GlRE-HIS3 reporter gene. The cDNA
insert contained within this plasmid was sequenced using the Sanger
dideoxy termination method adapted to the automated sequencer 373A from
Applied Biosystems.
Plasmid Constructions--
All plasmids were constructed by
using standard DNA cloning procedures. The constructs were verified by
nucleotide sequencing.
(LL)2-54PK/CAT and (MM)2-54PK/CAT constructs
comprise two oriented copies of the L-PK GlRE (also called LL and L4
boxes) (8, 10) or MM (10) ligated to the 54 to +11 proximal base
pairs of the L-PK minimal promoter (31). L-PK firefly luciferase (Luc) constructs are novel. Restriction or oligonucleotidic fragments of the
L-PK gene corresponding to the regions 54, 96, or 183 to +11
nucleotides with respect to the transcriptional start were subcloned
into the basic plasmid pGL3 (Promega). (LL)3-96PK/Luc, (MM)3-96PK/Luc, (L3)3-54PK/Luc, and
(LL)3-54PK/Luc plasmids consist of three oriented tandem
repeats of L-PK GlRE motif inserted in front of the 96 PK/Luc or 54
PK/Luc constructs, respectively. To correct for variations because of
the transfection procedure and cell types, we cotransfected each test
plasmid with a RSV/Rluc vector. This vector contains a cDNA
encoding Renilla luciferase gene (pRL-null/Promega) driven
by the RSV promoter.
For cell transfection experiments, we used the human COUP-TFII cDNA
cloned into an eukaryotic expression vector, pMT2, driven by the
adenovirus major late promoter and the simian virus 40 enhancer region
(kindly provided by Dr. S. Karathanasis). Human USF2a was cloned into
an eukaryotic expression vector, pCR3, driven by the cytomegalovirus
immediate-early promoter region (18). The USF2 gene gives rise
predominantly to full-length USF2a subunits, associated with two minor
forms, USF2b (resulting from an alternative splicing out of an exon in
the NH2 domain) and mini-USF2, a NH2 truncated form.
COUP-TFII used for in vitro transcription/translation was
obtained by inserting the COUP-TFII EcoRI cDNA fragment
into the pCR3 vector. The recombinant rat COUP-TFII expression vector
pGEX-KG-COUP-TFII was a gift from J.-M. Boutin. The
NcoI-XhoI fragment, containing the entire coding
frame, was inserted in the same sites in the pGEX-KG vector (32). All
plasmids were purified with a Qiagen kit.
Animals--
Three-month-old Harlan Sprague-Dawley rats were
subjected to different previously described nutritional and hormonal
treatments to study L-PK expression in the rat liver (1). Animals were fasted for 48 h and then separated into three groups and refed for
24 h with different diets: high carbohydrate for the first group,
high protein for the second group, and high fat for the third group. As
previously demonstrated, we observed that the endogenous L-PK mRNA
was abundant in the animals of the first group and scarcely detectable
in the animals of the other two groups (data not shown). Other rats
were fed with a regular chow ad libitum.
In Vitro Transcription and Translation--
The plasmids
pCR3/COUP-TFII and pCR3/USF2a were linearized with NotI and
XbaI, respectively, and transcribed with T7 RNA polymerase in the presence of m7G(5')ppp(5')G (Roche Molecular
Biochemicals). The resulting mRNAs were translated in
vitro with rabbit reticulocyte lysate according to the
manufacturer's instructions (Promega).
Recombinant Protein Production--
GST-COUP-TFII protein was
expressed in Escherichia coli BL-21 (DE3). Overnight
cultures of bacteria that were newly transformed with the plasmid
pGEX-KG-COUP-TFII were diluted with 10 volumes of medium, cultured for
several hours to an optical density of 0.6 at 600 nm, and induced with
1 mM isopropyl-
-D-thiogalactopyranoside at
37 °C for 3 h. Bacteria from 500 ml of culture were harvested and resuspended in 10 ml of NTEN [(20 mM Tris-HCl, pH 8, 100 mM NaCl, 2 mM EDTA, 0.5% Nonidet P-40, 10 µg of leupeptin/ml, 10 µg of pepstatin/ml, 10 µg of aprotinin/ml,
1 mM phenylmethylsulfonyl fluoride). The lysates were
sonicated, and after centrifugation, the supernatants were mixed with
glutathione-Sepharose 4B beads (500 µl, Amersham Pharmacia Biotech)
at 4 °C for 30 min in NTEN buffer. After two washes with TG buffer
(20 mM Tris-HCl, pH 8, 10% glycerol, 1 mM
dithiothreitol), the GST-COUP-TFII was eluted with the TG buffer
containing 30 mM glutathione. USF2a protein was expressed
in E. coli tagged with histidine residues at its N terminus,
allowing purification over Ni2+ affinity resin as described
(18).
Extract Preparation and EMSA--
Nuclear extracts for EMSA were
prepared at a concentration of about 10 mg/ml. Different methods of
nuclear extract preparation were tested. Results present nuclear
extract preparation according to the procedure described in Hasegawa
et al. (25) in the presence of phosphatase inhibitors, as
described in Ref. 33.
EMSA were performed at room temperature with 1 ng of double-stranded
oligonucleotides as probes, end-labeled and blunt-ended using Klenow
enzyme with the appropriate radionucleotide or labeled in the presence
of [
-32P]ATP and polynucleotide kinase. Incubation
reactions were done on ice in the presence of 10 mM
Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM
dithiothreitol, 5% (v/v) glycerol, 1 µg of poly(dI-dC) (100 ng for
recombinant proteins), and either 5 µg of liver nuclear extracts or
1-4 µl of reticulocyte lysate extracts and recombinant proteins. In
Fig. 5B, the reaction buffer used was 20 mM
Hepes/KOH, pH 7.9, 50 mM KCl, 0.2 mM EDTA, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 10% (v/v) glycerol as reported by Hasegawa et
al. (25). For competition assays, 10-50 ng of different
oligonucleotides were used as specific competitors, and 50 ng of MEF3
oligonucleotide was used as an unrelated competitor. For antibody
supershift analysis, 0.5-1 µl of the antiserum were included in the
binding reactions.
Each reaction mixture was then electrophoresed in a native 6% (w/v)
polyacrylamide gel in 0.25 × Tris-borate-EDTA (or 5% in the case
of the in vitro translated product and recombinant proteins experiments or 4.5% in Fig. 5B). Gels were prerun for 30 min and run for 3-4 h at 140 V.
The sequences of L-PK/GlRE (L4 or LL), MM, L-PK/L3, Sp1, DR1, MLP,
NF-Y, and MEF3 oligonucleotides were as follows: GlRE L-PK site (bp
172 to 142) TGGGCGCCACGGGGCACTCCCGTGGTTCCTG; MM site (bp 172 to
142) TGGGCGCCACGTGGCACTCACGTGGTTCCTG; L3 L-PK site (bp 150 to
121) TGGTTCCTGGACTCTGGCCCCCAGTGTACA; Sp1 site (from Santa
Cruz) ATTCGATCGGGGCGGGGCGAGC; DR1 site GGCGGGCCCAGGTCAGAGGTCATTAGA; USF
MLP adenovirus 2 site (bp 70 to 43) AGGTGTAGGCCACGTGACCGGGTGTTCC; NF-Y rat albumin (bp 93 to 65) GGGGTAGGAACCAATGAAATGAAAGGTTA; and MEF3 myogenin (bp 87 to 63) GAGGGGGGCTCAGGTTTCTGTGGCG.
Anti-COUP-TFII antibody, used to characterize the retarded complexes in
supershift or Western blotting experiments, was provided by Dr. S. Karathanasis. RXR
and TR antibodies were purchased from Santa
Cruz. Anti-USFs (USF1 and LZ2) antibodies were produced in our
laboratory (18).
DNase I Footprinting--
A 100-bp
XbaI-NheI rat L-PK 5'-flanking region (196 to
96 containing the GlRE) was used for DNase I footprinting analysis. The labeled fragment was obtained by digestion of the 183-PK/CAT plasmid by NheI (coding strand) or by XbaI
(noncoding strand), followed by filling in with Klenow fragment of DNA
polymerase in the presence of [32P[dCTP and
[32P]dTTP and then digested with XbaI or
NheI. The DNase I footprinting was performed with a
footprinting kit (Amersham Pharmacia Biotech). Before digestion with
0.1 unit of DNase I, the labeled fragments were incubated with various
amounts of COUP-TFII recombinant protein (10, 25, and 50 ng). The DNA
fragments were analyzed on a 7.5% (w/v) denaturing polyacrylamide
sequencing gel. The chemical reaction for G+A on the same fragments
were included as markers.
Western Blot Analysis--
The eluted GST-COUP-TFII recombinant
protein (100 ng) or liver nuclear or whole COS-7 cell extracts (20 µg) were separated by 10-12% (w/v) SDS-polyacrylamide gel
electrophoresis and transferred to nitrocellulose membranes in a
Bio-Rad apparatus according to the manufacturer's instructions. After
blocking of nonspecific protein-binding sites for 1 h at room
temperature in TBST (50 mM Tris-HCl, pH 8, 150 mM NaCl, 0.05% (v/v) Tween 20) containing 5% (w/v) nonfat
dry milk, the blots were incubated with the primary hCOUP-TF antibody
at a 1:500 dilution (a generous gift from Dr. S. Karathanasis) or with
primary affinity-purified hUSF2 (LZ2) at a 1:500 dilution and (18) or
with GST antibody at a 1:1000 dilution for 3 h at room
temperature. Following three washes of 20 min each in TBST, the
secondary antibody, peroxidase-conjugated swine anti-rabbit (Dako), was
added at a 1:4000 dilution and left for 45 min at room temperature. The
blots were washed again, and peroxidase activity was detected by
autoradiography with ECL enhanced chemiluminescence system (Amersham
Pharmacia Biotech). To ensure comparable loading of the samples, blots
performed with nuclear and whole cell extracts were incubated with
anti-annexin V antibody at a 1:1000 dilution.
Cell Culture Conditions, Transfections, and CAT and Luciferase
Assays--
COS-7 were plated at 70% of confluence on 6-cm-diameter
dish and cultured at 37 °C in Dulbecco's modified Eagle's medium
supplemented with 5% (v/v) fetal calf serum and antibiotics. COS-7
cells were transfected 15 h after plating by the lipofection
method, using the
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methylsulfate transfection reagent (Roche Molecular Biochemicals).
Cells were transfected with a total amount of 6 µg of plasmid DNA
divided into 2 µg of reporter constructs, various amounts of
expression vector, 0.2 µg of the pRSV-luciferase plasmid as an
internal transfection control (34), and pKSBluescript as a carrier to
keep constant total amount of DNA. Cells were harvested 36 h after
transfection, and cellular lysates were prepared for CAT assays as
described previously (31). The luciferase activity was assayed as
described by De Wet et al. (34) using a Lumat LB 9507 luminometer (EGG-Berthold). Results are calculated from the ratio of
CAT/luciferase activity expressed in arbitrary units.
Adult male Harlan Sprague-Dawley rats (160-200 g) were fed with
regular ad libitum chow when used in the experiments.
Hepatocytes were isolated as described (31). One and a half million
freshly isolated cells were plated in 6-cm dishes in 3 ml of 199 medium containing 5 mM glucose supplemented with 1 µM triiodothyronine, 1 µM dexamethasone, 20 nM insulin, and 10% (v/v) fetal calf serum, replaced
2 h later by 199 medium plus hormones and 10% fetal calf serum.
6 h after plating, transfection was performed by the lipofection method
(N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate) in 199 medium supplemented with 1 µM
triiodothyronine, 1 µM dexamethasone, and 20 nM insulin. Cells were transfected with a total amount of 5 µg of plasmid DNA, e.g. 4 µg of reporter constructs,
various amounts of expression vector, and pKSBluescript as a carrier to
keep total amount of DNA constant. The concentration of expression
vectors used was determined in preliminary experiments as the maximal
concentration before occurrence of nonspecific squelching phenomena.
The medium containing the liposome-DNA complex was removed 10 h
later and replaced by glucose-free 199 medium supplemented with 1 µM triiodothyronine, 1 µM dexamethasone, 20 nM insulin, and either 5 mM glucose or 25 mM glucose. Luciferase extracts were prepared 30 h
after transfection. Luciferase activities assays were performed using
the dual luciferase reporter assay system (Promega). The total amount
of protein, was determined in each cell extracts by a Bradford assay.
Because no or very low variation was measured, results were calculated
from the ratio of luciferase/Renilla activities expressed in
arbitrary units. Results were corrected for by the 54 (see Fig. 7) or
96 L-PK activities (see Fig. 6B). Each experiment was made
in triplicate and repeated three to five times.
| |
RESULTS |
Molecular Cloning of COUP-TFII by One-hybrid Selection in
Yeast--
To identify transcriptional factors other than USF that
could recognize the L-PK GlRE (also named L4 or LL boxes), we used the
one-hybrid method, which allows, in yeast cells, the cloning of
eukaryotic DNA-binding factors. First, we observed by mobility shift
assays that wild-type yeast cell extracts do contain proteins capable
of binding to the L-PK GlRE with a high affinity (data not shown). It
was previously established that, in S. cerevisiae, the major
CACGTG binding activity is accounted for by the multifunctional factor
cbf1p (35). To increase the sensitivity of our one-hybrid screen, we decided to perform the screen in cells that do not express
CBF1, thus avoiding competition between the endogenous GlRE
binding activity and the factors encoded by the transfected cDNA
libraries. The CBF1 gene was disrupted by using the
hisg-URA3-hisg marker construct (36). In a second step, the
URA3 marker was removed from the cbf1 locus
because of recombination between the two hisg direct repeats
by selecting for uracil auxotroph cells on 5-fluoroorotate-containing
medium (37), yielding the CD156 strain
(cbf1::hisg). As expected, the cbf1
cells were methionine auxotroph and exhibited only a residual GlRE DNA
binding activity (data not shown). A GlRE-HIS3 reporter gene was then
integrated into the genome of the CD156 strain at the URA3
locus. The GlRE-HIS3 fusion consisted of two tandem copies
of the GlRE inserted 200 bp upstream of the TATA box of the
CYC1 promoter, with its own UAS deleted, and placed in front
of the HIS3 gene. The resulting strain (YMV1) exhibited a
leaky His+ phenotype that was suppressed by the addition of 10 mM AT to the medium. The YMV1 strain was transformed by an
adult rat liver cDNA expression library that coded for oriented
poly(A) tail protein segments fused to the Gal4p transcriptional
activation domain. Transformants were selected directly for growth in
the presence of 10 mM AT. From a screen of about 2 × 106 transformants, 30 colonies capable of growing in the
presence of 10 mM AT appeared over a course of 8 days.
Plasmid DNA was recovered from these colonies and used to retransform
the YMV1 and the YMEF3 control strains (the latter comprising the
unrelated integrated MEF3-HIS3 gene fusion). Only one
plasmid gave rise to AT-resistant clones when transformed in the YMV1
strain but not in YMEF3 control strain. Sequencing of this plasmid
revealed that it encodes an USF2 cDNA deleted from exons 1 and 2 and fused in frame to the Gal4p activation domain. This result thus
confirmed that in yeast cells, USF is indeed capable of binding to the
L-PK GlRE and provided us with a positive control of our screening.
To account for the fact that this first screen did not reveal a new
GlRE-binding factor, we next surmised that if such proteins exist, they
might be more abundant in tissues other than liver. Therefore, we
performed a new one-hybrid screen in the YMV1 strain with another
library that expresses short fragments of mouse embryo cDNA fused
to the VP16 activation domain (29). In this case, the transformants
were selected directly for growth in the presence of 30 mM
AT. From a screen of about 2 × 106 transformants, 60 colonies capable of growing in the presence of 30 mM AT
appeared over a course of 10 days, and plasmids were recovered. After
retransformation of both the YMV1 and YMEF3 strains, only one plasmid
was shown to encode a fusion protein capable of specifically activating
transcription of the GlRE-HIS3 reporter gene. Sequencing revealed that
this plasmid expressed the VP16 activation domain fused to an 80-amino
acid open reading frame comprising the COUP-TFII DNA-binding domain
flanked by additional residues.
COUP-TFII Protein Binds to the L-PK GlRE--
The DNA binding
capacity of the entire COUP-TFII protein was assessed by EMSA with
in vitro translated COUP-TFII. Double-stranded oligonucleotide containing wild-type L-PK GlRE was retarded by in
vitro translated COUP-TFII (Fig.
1A, lane 1). A
polyclonal antiserum raised against COUP-TFII specifically recognized
the protein-DNA complex (Fig. 1A, lane 2). We
also demonstrated that in vitro translated COUP-TFII bound
to a DR1 probe was competed for by the L-PK GlRE oligonucleotide (data
not shown). In addition, as previously demonstrated USF2a was retarded
and displaced by anti-USF2 (Fig. 1A, lanes 3 and
4). The faint band migrating faster was also displaced by
anti-USF2 antibody (Fig. 1A, lanes 3 and 4). This USF protein was described as mini-USF (USF2)
(18) and was supposed to be generated by internal translation
initiation from internal methionines.
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 1.
EMSA analysis of the interaction between the
L-PK GlRE and COUP-TFII. A, COUP-TFII was synthesized
by in vitro transcription-translation using the linearized
pCR3/COUP-TFII plasmid as template. 4 µl of reticulocyte lysate were
incubated with the radiolabeled GlRE probe, here termed LL. Lane
1, lysate with the COUP-TFII template; lane 2, same as
lane 1 plus 1 µl of anti-COUP-TFII antibody; lane
3, lysate with the USF2 template; lane 4, same as
lane 3 plus anti-USF2 antibody. B, the probe was
a mutated GlRE motif termed MM, with two palindromic CACGTG motifs (see
Fig. 2). Lane 1, lysate with the COUP-TFII template;
lane 2, lysate with the USF2 template. The position of the
COUP-TFII-DNA binding complex and USF binding activities
(arrows) and the supershifted COUP-TFII- or USF DNA-binding
complexes (asterisk) are indicated.
|
|
Binding of COUP-TFII to the GlRE was also evaluated by DNase I
protection assays, using recombinant COUP-TFII protein and the 196 to
96 region of the L-PK gene promoter as probe. A protection pattern
was observed between bases 172 and 142 encompassing the GlRE site
(Fig. 2A for coding strand and
Fig. 2B for noncoding strand). A second region was strongly
protected between bases 142 and 126 corresponding to the L3 box.
This L3 region contains a DR1 site that has been previously described
to bind not only HNF4 but also COUP-TF (10). Examination of the GlRE
area suggested that it could encompass at least two COUP-TFII-binding
sites. COUP-TFII strongly protected a central half-site between 162 and 157 and more weakly 5' and 3' half-sites, generating direct repeats DR1 or DR7 in the GlRE (half-sites are delineated by
arrows in Fig. 2C). These two DR1 and DR7 sites
have been shown by EMSA to have similar affinity for COUP-TFII (data
not shown). A G to T mutation of the second position of the central
half-site (mutant MM) practically abolished any affinity for COUP-TFII
(Fig. 1B, lane 1), whereas this mutation created
a consensus E box (CACGTG) with high affinity for USF (Fig.
1B, lane 2). These results suggested that
COUP-TFII and USF binding to the GlRE could interfere one with the
other.
View larger version (89K):
[in this window]
[in a new window]
|
Fig. 2.
DNase I footprinting protection of the rat
L-PK promoter by COUP-TFII. A 3'-end-labeled L-PK promoter
fragment extending from 196 to 96 bp was subjected to partial
digestion by DNase I in the absence (Free) or in the
presence of increasing amounts of recombinant COUP-TFII protein, either
on the coding (A) or on the noncoding strand (B)
as outlined under "Materials and Methods." A sequencing reaction
performed on this fragment (Maxam and Gilbert) was run in parallel
(G+A). The protected regions are indicated by either a solid
or a dotted line (indicating partial protection), and
arrows indicate hypersensitivity to digestion relative to
the free DNA. The numbers alongside refer to the positions
with respect to the transcriptional initiation site. C, the
oligonucleotides containing the wild-type L-PK GlRE (LL) or mutated
L-PK GlRE (MM) used in the experiments are shown. Arrows
indicate COUP-TF half-binding sites, and brackets indicate
the DR1 or the DR7 COUP-TF DNA-binding sites. E-boxes are in
boxes. Mutated nucleotides are indicated by vertical
lines.
|
|
Interference between COUP-TFII and USF in Binding to the
GlRE--
To understand more precisely the interaction between
COUP-TFII and USF transcription factors and the GlRE, we performed band shift experiments using COUP-TFII and USF2 recombinant proteins. In
these experiments, a combination of both proteins in various ratios was
used. Recombinant COUP-TFII and USF2a proteins formed two major
distinct complexes (Fig. 3, lanes
1 and 6). In lane 6 of Fig. 3, the major
faster migrating complex was a USF2a homodimer, and the slower complex
corresponded to two homodimers, each binding to one of the two
palindromic E boxes separated by 5 bp. Accordingly, both can be
competed for by a USF-binding site and displaced by anti-USF antibodies
(data not shown). In lane 1 of Fig. 3, COUP-TFII corresponded to a major fast migrating complex (truncated, tCOUP-TFII), whereas a minor slower migrating band (full-length, fCOUP-TFII) was, on
this gel, at the limit of detection. Fig. 3B shows a Western blot analysis of recombinant COUP-TFII, demonstrating that the major
form was a proteolytic product. The same result has been previously
reported by Malik and Karathanasis (26), namely that recombinant
full-length COUP-TFII (rARP-1) preparations were very sensitive to
proteolytic cleavage, leading to a truncated form retaining DNA binding
activity.
View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
EMSA analysis of USF2a and COUP-TFII binding
to the GlRE. A, USF2a and COUP-TFII were synthesized
using recombinant GST-COUP-TFII or HIS-USF2 proteins. The labeled probe
was the wild-type GlRE oligonucleotide. Concentration of COUP-TFII and
USF2a was appreciated by an SDS-polyacrylamide gel autoradiogram. Both
proteins were added in various ratios indicated above the figure.
Lane 1, COUP-TFII constant; lanes 2-5, COUP-TFII
constant, USF2a increasing; lane 6, USF2a constant;
lanes 7-9, USF2a constant, COUP-TFII increasing; lane
5, same as lane 4 plus 10 ng of DR1 site. Position of
USF2a homodimers or tetramers and COUP-TFII-specific retarded band are
indicated on the left. B, analysis of purified
GST-COUP-TFII recombinant protein. 100 ng of product was analyzed by
SDS-polyacrylamide gel electrophoresis and revealed on a Western blot
by anti-GST antibody in lane 1 and by anti-COUP-TFII
antibody in lane 2. The fast migrating band is a
GST/COUP-TFII truncated form (tCOUP-TFII), whereas the minor
slower migrating band is the GST/COUP-TFII full-length form
(fCOUP-TFII).
|
|
Upon addition of increasing amounts of USF2a, an increase in USF2a-DNA
complexes and a corresponding decrease in the COUP-TFII retarded
complex was observed (Fig. 3, lanes 2-4). Conversely, upon
addition of increasing amounts of COUP-TFII, an increase in
COUP-TFII-DNA complex and a corresponding decrease in the USF2a retarded complexes was observed (Fig. 3, lanes 7-9). These
results suggest a competition between USF and COUP-TFII for binding to the GlRE. However, we could observe a minor complex detected only when
both COUP-TFII and USF are present. This complex was clearly detectable
at a ratio of 1 COUP-TFII/2 USF2 (Fig. 3, lanes 4 and 7), displaced by DR1 (Fig. 3, lane 5) and MLP
sites (data not shown). This result suggests that a ternary complex
consisting of the GlRE probe, one USF dimer, and one COUP-TF dimer can
be detected in vitro in the presence of concentrated
recombinant factors. Fig. 2C shows that, indeed, binding of
a USF dimer on the downstream E box and a COUP-TF dimer on the DR1
overlapping the upstream E box is in principle conceivable.
Liver Nuclear Extracts Contain Different Factors Able to Bind the
L-PK GlRE--
We performed band shift experiments using the GlRE
oligonucleotide and liver nuclear extracts from rats fed a regular diet ad libitum. EMSA were performed with a novel binding buffer
as compared with the one previously used in our laboratory (18) and the
one described by Hasegawa et al. (25). This buffer is characterized, in particular, by increased EDTA concentration (to 1 mM) and absence of KCl. In this new binding conditions, up
to seven DNA-protein complexes were detected with the GlRE probe (Fig.
4, lane 1). Identification and
specificity of these complexes were analyzed by competition with
unlabeled oligonucleotides and depletion or supershift by specific
antibodies. All of these complexes were specific because they were
displaced by 10 ng of unlabeled GlRE site (Fig. 4, lane 3).
The complex 2 corresponded to binding of the USF1/USF2 dimers because
depletion by anti-USF antibodies (Fig. 4, lane 2) and
competition with an unlabeled MLP site (data not shown and Ref. 18)
suppressed formation of this complex. Complexes 1 were likely to belong
to the Sp1 family of transcriptional factors as demonstrated by
competition with a GC box-containing oligonucleotide (lane 4). Finally,
the complex 3 binding activities remaining after USF depletion and Sp1
DNA binding activity displacement were competed for by an excess of a
DR1 motif (Fig. 4, lanes 12 and 13) and of the L3
element of the L-PK gene promoter, which also contains a DR1 site (Fig.
4, lanes 14 and 15) (10); in contrast the complex
3 binding activities were not displaced by an unrelated probe (Fig. 4,
lane 11). These results suggest that the complexes 3 could
contain members of the nuclear receptor superfamily. To determine
whether the complex 3 binding activities actually corresponded to
COUP-TFII, we used an antibody toward COUP-TFII. The addition of this
antibody to liver nuclear extracts, depleted of USF DNA binding
activity, supershifted the complex 3 binding activities (Fig. 4,
lane 5), whereas the addition of anti-RXR or anti-TR
antibodies did not affect them (Fig. 4, lanes 6 and
7). After depletion of USF and Sp1 DNA binding activities,
we observed that the addition of COUP-TF supershifted both complexes 3 (Fig. 4, lane 8), whereas the addition of anti-RXR or
anti-TR antibodies did not affect them (Fig. 4, lanes 9 and 10). All other antibodies specific to various members of
the nuclear receptor superfamily tested so far were without any effect
on the complex 3-DNA binding activities (data not shown). These results
confirm that the two COUP-TFII containing complexes binding to the GlRE
can be easily detected in liver nuclear extracts, provided that binding
conditions are optimized.
View larger version (90K):
[in this window]
[in a new window]
|
Fig. 4.
EMSA analysis of nuclear GlRE-binding
proteins in the liver. Liver nuclear extracts (6 µg) were
prepared from rats fed ad libitum a regular diet.
Competition experiments were performed with either 25 or 50 ng
unlabeled oligonucleotides. Lane 1, nuclear extract;
lane 2, same as lane 1 plus 0.3 µl of anti-USF1
and 0.3 µl of USF2 antibodies; lane 3, same as lane
2 plus GlRE competitor; lane 4, same as lane
2 plus Sp1 competitor; lane 5, same as lane
2 plus 1 µl of anti-COUP-TFII antibody; lane 6, same
as lane 2 plus 1 µl of anti-RXR antibody; lane
7, same as lane 2 plus 1 µl of anti-TR antibody;
lane 8, same as lane 4 plus 1 µl of
anti-COUP-TFII antibody; lane 9, same as lane 4 plus 1 µl of anti-RXR antibody; lane 10, same as
lane 4 plus 1 µl of anti-TR antibody; lane
11, same as lane 4 plus MEF3 competitor; lane
12, same as lane 4 plus 25 ng of DR1 competitor;
lane 13, same as lane 4 plus 50 ng of DR1
competitor; lane 14, same as lane 4 plus 25 ng of
L3 competitor; lane 15, same as lane 4 plus 50 ng
of L3 competitor. Position of the complexes of types 1, 2, and 3 were
indicated on the left. F indicates free
probe.
|
|
In Vitro Binding of COUP-TFII-containing Complexes Is Not
Significantly Modulated by Diets--
In Fig.
5A, we compared the GlRE
binding activities in liver nuclear extracts of rats fed either L-PK
gene inducing diet (i.e. high carbohydrate, lanes
1 and 2) or L-PK gene inhibiting diet (i.e.
high protein in lane 3 and high fat in lane 4).
The complexes described in Fig. 4 were still observed, in particular
complex 2, i.e. USF, supershifted by anti-USF antibodies
(Fig. 5A, lane 5), and complexes 3 supershifted
by anti-COUP-TFII antibodies (Fig. 5A, lane 6)
but not by anti-RXR antibodies (Fig. 5A, lane 7)
and competed for by a DR1 motif (Fig. 5A, lane
8). With respect to the NF-Y (rat albumin CAAT box) (Fig.
5C) and nuclear factor 1 (data not shown) complexes
characterized in parallel to control quality and quantity of the
nuclear extracts, none of the GlRE binding activities seemed to be
detectably affected by diets. We also found that the relative binding
activity of the different GlRE-binding complexes depends on the binding
conditions; Fig. 5B shows the patterns obtained with
extracts from carbohydrate-refed and protein-rich diet-refed rats using
the binding buffer described by Hasegawa et al. (25). Here,
as in our previous publication (18), USF is the major binding activity,
whereas COUP-TF-containing complexes and GC-box binding activities are
scarcely detectable (compare lanes 1 and 3 of
Fig. 5A and lanes 1 and 2 of Fig.
5B).
View larger version (46K):
[in this window]
[in a new window]
|
Fig. 5.
EMSA analysis of the nuclear GlRE-binding
proteins in the liver of rats fed different diets. A,
EMSA analysis using the same binding buffer as in Fig. 4. 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol, 5% (v/v) glycerol. C1 and
C2 are extracts from different animals. Lanes 1 and 2, nuclear extract from a rat refed a carbohydrate-rich
diet (C); lane 3, nuclear extract from a rat
refed a protein-rich diet (P); lane 4, nuclear
extract from a rat refed a fat-rich diet (F); lane
5, same as lane 1 plus 0.25 µl of anti-USF1 and 0.25 µl of USF2 antibodies; lane 6, same as lane 1 plus 1 µl of anti-COUP-TFII antibody; lane 7, same as
lane 1 plus 1 µl of anti-RXR antibody; lane
8, same as lane 1 plus DR1 competitor. B,
EMSA analysis using the binding buffer described by Hasegawa et
al. (25): 20 mM Hepes/KOH, pH 7.9, 50 mM
KCl, 0.2 mM EDTA, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 10% (v/v) glycerol.
Lane 1, same as lane 1 of A;
lane 2, same as lane 3 of A.
C, EMSA analysis with the NF-Y probe. The extracts
C2, C1, P, and F are the
same as in lanes 1-4 of A. D, Western
blot analysis of COUP-TFII and USF2 proteins in extracts C1 and P (same
as lanes 2 and 3 in A). The retarded
complexes of types 1, 2, and 3 are indicated on the left,
the asterisk indicates the position of the supershifted
complexes, and F indicates the position of free probe.
|
|
In Fig. 5D, we evaluated the presence of COUP-TFII and USF2
in carbohydrate and protein-refed liver nuclear extracts by Western blot analysis with specific antibodies. The amounts of COUP-TFII and
USF2 proteins were similar under both dietary conditions used.
COUP-TFII Represses USF2-dependent Transcription of the
L-PK Promoter in COS-7 Cells--
COUP-TF has been demonstrated to be
a repressor of transcription of many genes (27). Therefore, we explored
the possibility that COUP-TFII homodimers might counteract the activity
of USFs on a promoter depending on the GlRE element. To test this
hypothesis, COS-7 cells were transiently transfected with L-PK reporter
plasmids and both USF2a and COUP-TFII expression vectors. The
(LL)2-54-PK/CAT reporter plasmid was directed by two copies
of the wild-type GlRE, while the (MM)2-54-PK/CAT construct
was directed by two copies of the MM mutant GlRE. This latter mutant
was characterized by very low affinity for COUP-TFII and high affinity
for USF (Fig. 2C). Fig.
6A showed that expression of
USF2a increased dramatically the CAT activity of the LL reporter
construct (lane 3), as previously reported (19). As expected
USF2a also increased activity of the MM mutant reporter gene (Fig.
6A, lane 10) because canonical E boxes were
created. COUP-TFII overexpression in transfected COS-7 cells inhibited
this USF2a-mediated activation of the reporter genes in a
dose-dependent fashion, but this inhibition was more important on the LL (Fig. 6A, lanes 4-7) than on
the MM construct (lanes 11-14). Western blot controls
allowed us to assure that the COUP-TFII inhibitory effect was not due
to inhibition of the USF2a expression vector; USF2a abundance was
constant in cells transfected with a same amount of USF2a expression
vector and increasing amounts of COUP-TFII expression vector (Fig.
6A, lower panels). These results demonstrate that
COUP-TFII is capable of antagonizing transactivation by USF2a of a
reporter gene directed by the wild-type GlRE but that this antagonism
effect is strongly reduced by a GlRE mutation decreasing affinity for
COUP-TFII.
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6.
Compared cis-acting effects of the wild-type
(LL) and mutant (MM) GlREs on COUP-TFII-dependent
inhibition and glucose responsiveness of L-PK reporter constructs.
A, COS-7 cells were transfected with 2 µg of different
reporter constructs: (LL)2-54-PK/CAT and
(MM)2-54-PK/CAT. In addition, cells were co-transfected
with different amounts of expression vectors, as indicated below the
figure: pSV2/COUP-TFII and CMV/USF2a. The CAT activity was standardized
by the luciferase activity generated by 200 ng of co-transfected
RSV/Luc plasmid and expressed in arbitrary units. The data are taken
from two separate studies involving triplicate samples. The results are
represented as the means ± S.D., n = 6. B, hepatocytes were cultured in the presence of either 5 or
25 mM glucose. They were transfected with 4 µg of
different report constructs: (LL)3-96-PK/Luc,
(MM)3-96-PK/Luc. Results are calculated from the ratio of
luciferase/Renilla activities expressed in arbitrary units.
The results are obtained from five separate experiments. Each
bar represents the mean ± S.D., n = 10.
|
|
COUP-TFII Represses GlRE-mediated Glucose Induction in
Hepatocytes--
To determine whether COUP-TFII could play a role in
mediating the glucose responsiveness, we used the natural 183 L-PK
promoter and a reporter gene carrying three copies of the GlRE placed
upstream of the 54 L-PK minimal promoter, (LL)3-54-PK/Luc
in hepatocytes in primary culture. To increase sensitivity of the assay
after transient transfection in hepatocytes, we constructed different pGL3 luciferase chimeric L-PK constructs. As can be seen in Fig. 7, both the natural 183 L-PK promoter
and the artificial promoter with oligomerized GlRE (LL)-binding sites
were specifically stimulated by glucose, 8- and 50-fold, respectively,
whereas a construct directed by oligomerized box L3,
(L3)3-54-PK/Luc was insensitive to glucose. Cotransfection
of hepatocytes with both glucose-responsive L-PK/Luc constructs and
COUP-TFII expression vector repressed the response to glucose, strongly
for the (LL)3-54-PK construct and totally for the 183-PK
construct. Because the inhibitory effect of COUP-TFII overexpression on
the glucose-dependent promoter activation was observed with
the (LL)3-54 plasmid devoid of the L3 element, which was
found to bind HNF4 and COUP-TF factors (10), as well as with the
183-PK construct, this effect could not be ascribed to competition of
COUP-TFII for binding of HNF4 to element L3 but rather to interaction
with the GlRE. Accordingly, COUP-TFII did not repress activity of the
(L3)3-54 construct in hepatocytes. To confirm these data,
we also studied the effect of HNF4 overexpression on the inhibition by
COUP-TFII of the glucose-dependent 183-PK/Luc activation;
although HNF4 overproduction increased the glucose responsiveness, as
already described (38), it did not block the inhibitory action of
COUP-TFII (data not shown). Therefore, these experiments demonstrate
that COUP-TFII is an inhibitor of glucose responsiveness that acts
through the GlRE.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of COUP-TFII overexpression on the
glucose responsiveness of L-PK-GlRE-dependent promoters in
hepatocytes in primary culture. Cells were cultured in the
presence of either 5 or 25 mM glucose. The hepatocytes were
transfected with 4 µg of different reporter constructs:
(L3)3-54-PK/Luc, (LL)3-54-PK/Luc, or
183-PK/Luc. In addition, the cells were co-transfected with 500 ng of
pSV2/COUP-TFII (+) or of the empty vector (). These amounts of
expression vectors were previously determined as the highest amounts
before occurrence of nonspecific squelching. Results are calculated
from the ratio of luciferase/Renilla activities expressed in
arbitrary units. The results were obtained in triplicate experiments.
Each bar represents the mean ± S.D.,
n = 10.
|
|
This conclusion was supported by the decreased glucose responsiveness
of a L-PK/Luc construct directed by three copies of the MM GlRE mutant
with decreased affinity for COUP-TF and increased affinity for USF
(Fig. 6B). Although a (LL)3-96-PK/Luc construct (directed by three copies of the wild-type GlRE upstream of the L-PK
HNF1-binding site) (16) was activated 26 ± 6-fold by glucose in
hepatocytes, the MM construct was only activated 3.2 ± 1.2-fold. This decreased glucose responsiveness was due to a strong residual MM
promoter activity under low glucose conditions.
| |
DISCUSSION |
The most intensively investigated glucose/carbohydrate response
elements are the GlRE of the L-PK gene promoter (8-10, 12, 39) and the
ChoRE located 1448 bp upstream of the S14 gene (12, 24). Both are able
to bind USF transactivators, but this property alone does not easily
explain the glucose responsiveness because USF-binding sites exist in
regulatory regions of numerous genes insensitive to nutrient
regulation. Moreover, Kaytor et al. (24) reported that a
mutant ChoRE that had lost its ability to bind USFs still retained its
glucose responsiveness. However, in our hands, this mutant conserved a
clearly detectable affinity for USFs.2 In any case, affinity
for USFs is clearly not parallel to the efficacy as a glucose response
element. Although our results in cell culture (19) and in
vivo in knock-out mice indicate that endogenous USFs are important
for a kinetically normal activation of various
dietary-dependent genes by glucose (20-22), they cannot explain by themselves the transcriptional regulation of
glucose-responsive genes by glucose. Because both S14 and L-PK gene
ChoRE/GlRE have the same structure, characterized by two more or less
degenerated E boxes separated by a 5-bp spacer, it could be
hypothesized that this unique arrangement was needed for binding of
both USF dimers and other components of a multimolecular glucose sensor
component. Therefore, we undertook a search for additional GlRE-binding
proteins that could act as components of the glucose sensor system.
COUP-TFII Binds to the GlRE, in Vivo and in Vitro--
Our
one-hybrid screen in yeast allowed us to detect two GlRE-binding
proteins: USF2, starting from an adult rat liver cDNA library, and
COUP-TFII from a mouse embryo cDNA library. The liver-derived library was constructed using oligo(dT) as the primer for first strand
cDNA synthesis, which probably explains why COUPTF-TII was not
found here. Indeed, the DNA-binding domain for this factor is very
upstream from the poly(A) tail in the mRNA and was therefore highly
under-represented in the liver library. In contrast, the embryo library
was derived from cDNAs primed with random hexamers, such that
cDNAs for 5' parts of the messengers had more chance to be present.
COUP-TFII protein synthesized in a cell-free transcription-translation
system binds efficiently to the GlRE and also to the S14 ChoRE (data
not shown). EMSA of the GlRE incubated with liver nuclear extracts
revealed complexes displaced by a DR1 oligonucleotide in excess and
supershifted by anti-COUP-TF antibody. Finally, footprinting
experiments localize two COUP-TF DNA-binding sites within the GlRE that
overlap the E boxes: a DR1 in 5' (that does not bind HNF4; data not
shown) and a DR7 in 3'. Both contained a common central half-site (Fig.
2C).
In addition to USF and COUP-TF-containing complexes, the GlRE also gave
Sp1-type complexes displaced by a Sp1-specific oligonucleotide competitor. Because binding of Sp1 has been proposed to be involved in
the response of the ACC gene to glucose in cultured adipocyte cell line
(40), we asked whether Sp1 binding might be a component of the
GlRE/ChoRE. In fact, the S14 ChoRE has no affinity for Sp1, and we
never cloned Sp1-cDNAs in our one-hybrid screen, which could
indicate that in vivo, in yeast, the GlRE does not interact with members of the Sp1 family. In addition, we previously showed that
a GlRE construct devoid of the Sp1 site conserved its property to
mediate the glucose responsiveness (19). Finally, the putative GC-rich
Sp1-binding site in the L-PK GlRE is not conserved between rat, human,
and mouse (GenBankTM accession numbers are X05684 for rat
and Z18922 for Homo sapiens; for mouse, the sequence is
unpublished data).
COUP-TF II Counteracts Transactivation by USF--
COUP-TF
proteins are orphan nuclear receptors that are most generally
considered to be transcription inhibitors (27). Accordingly, COUP-TFI
has been shown to interact with corepressors such as N-CoR and SMRT
(41). COUP-TF can also inhibit gene transcription by heterodimerization
with RXR, the common partner of several nuclear receptors, and by
competing with them for binding to common sites (27). However, several
reports also show that COUP-TFs act as gene activators, either by
directly binding to DNA elements and cooperating with contiguous
factors (27, 42, 43) or by interacting with other transcription factors
(e.g. HNF4 or Sp1) through protein-protein contacts (44,
45). COUP-TFII is widely expressed, in particular in hepatocytes (46);
its defect in knock-out mice results in embryonic lethality because of
inappropriate angiogenesis and heart development (47). COUP-TFI is
abundant in the central nervous system, and its defect is associated with abnormal development of glossopharyngeal ganglion and defective axonal projection and arborization, resulting in perinatal death (48).
When COS cells are co-transfected with COUP-TFII and USF2a expression
vectors, USF-dependent transactivation through the GlRE was
inhibited. Footprinting experiments demonstrate that COUP-TF-binding sites overlap E boxes and therefore are expected to compete with basic
helix-loop-helix/leucine zipper family proteins for binding to the
GlRE. Accordingly, there is competition between USF2 and COUP-TFII for
binding to this element in EMSA experiments. However, at high
concentration of recombinant COUP-TFII and USF2 proteins, a ternary
complex consisting of the GlRE binding both factors could be
documented; it is likely that in this complex, USF binds the downstream
E box while COUP-TFII binds the upstream one overlapping with the DR1
site. It is noteworthy that we were unable to detect any direct
protein-protein interaction between USF2a and COUP-TFII in a two-hybrid
test in yeast (data not shown).
COUP-TFII Inhibits the Glucose Responsiveness of the L-PK
Promoter--
The 183 L-PK promoter confers a good glucose
responsiveness on a reporter gene in hepatocytes in primary culture.
Overexpression of COUP-TFII in these cells inhibited the glucose
response. This inhibition was found again on an artificial promoter in
which three GlRE motifs were oligomerized upstream of the minimal L-PK promoter. This indicates that COUP-TFII acts through the GlRE and not
through the contiguous L3 HNF4-binding site. In vitro, L3 is
a relatively strong COUP-TF-binding site, but we hypothesize that the
high HNF4 content of hepatocytes precludes any significant interaction
of this type in hepatocytes. ARP-1/COUP-TFII was reported to bind to
the C3P element of the apolipoprotein CIII gene promoter (46) with a
Kd value = 13.4 nM. We have
confirmed this result with recombinant COUP-TFII and found that
COUP-TFII had about 3-fold less affinity for the L3 site and 4-fold
less for the GlRE site than for the C3P site (data not shown).
Accordingly, the L3-dependent reporter activity was not
significantly affected by COUP-TFII overexpression, and HNF4
overexpression, although improving the glucose response in the absence
of COUP-TF expression vector, did not relieve
COUP-TFII-dependent inhibition of this response as would
have been expected if COUP-TFII and HNF4 competed for binding to L3.
We have identified a mutant GlRE that lost its ability to bind
COUP-TFII but conserved and even increased its affinity for USF. This
mutant was called MM to refer to Diaz Guerra et al. (10). In
the context of the natural L-PK promoter and thus in association with
the element L3, this MM mutant GlRE was able to maintain glucose
responsiveness (10). However, we show here that when oligomerized in
front of the minimal L-PK promoter, the MM element conferred a
dramatically decreased glucose responsiveness in hepatocytes. This was
explained by increased activity of the MM-dependent
reporter gene under low glucose condition. This result was precisely
the expected one if we consider that COUP-TFII binding under low
glucose conditions could contribute to counteract the transactivating
effect of a transactivator responsible for glucose-induced transcriptional stimulation.
Is COUP-TF II a Component of the Glucose Sensor?--
COUP-TFII
binds to the L-PK GlRE in vivo in yeast as well as in
vitro. In vitro, it also binds to the S14 ChoRE (data not shown).
In EMSA, liver nuclear extracts gave with the GlRE two fast migrating
complexes displaced by a DR1 oligonucleotide competitor and
supershifted by anti-COUP-TFII antibodies. The faster one exhibited
approximately the same migration as COUP-TFII homodimers synthesized in
COS cells transfected with a COUP-TFII expression vector (data not
shown). The slower complex might correspond either to a heterodimer
with an undetermined partner or to a post-translational modification of
COUP-TF. In fact, O'Malley and co-workers (49) discussed the fact that
orphan steroid receptors may be activated independently of any ligand
fixation through external cues acting on membrane receptors and
intracellular signaling pathway, resulting in receptor phosphorylation.
Accordingly, COUP-TFII activity could be modulated by
post-translational modifications induced by nutrient or hormonal
regulations, e.g. through PKA or 5' AMP-activated protein
kinase (11).
In transient transfection experiments, overexpression of COUP-TFII
counteracts the transactivating effect of USF and inhibits the glucose
response of the L-PK promoter in hepatocytes in primary culture; in
addition, intact COUP-TFII DNA-binding site is required for correct
glucose response. Therefore, COUP-TFII is obviously a very good
candidate to participate in the transcriptional regulation by glucose.
Recently, different groups reported new data concerning GlRE
DNA-binding proteins. Hasegawa et al. (25) reported that
carbohydrate refeeding resulted in increase of a GlRE binding activity
in the liver and cultured hepatocytes and excluded USF, Sp1, and c-Myc factors as being involved in this activity. These assumptions were
based exclusively on the use of commercial antibodies. We reproduced
the results of these authors and found that under their described
nuclear extract preparations (precipitation by 25% polyethylene glycol, eventually after discarding of the 10% polyethylene glycol precipitate and use of the nuclear extract precipitates without dialysis) and EMSA conditions, Sp1 family members, USF, and
COUP-TF-containing complexes were the only GlRE-binding proteins
detected (Fig. 5B). In the proteins precipitating between 10 and 25% polyethylene glycol, we found that the major GlRE binding
activity was USF, displaced by anti-USF1, anti-USF2 antibodies, and an
excess of the MLP USF-binding site. We are currently determining with a large number of nuclear extract samples, conditions which may modulate
these binding activities.
Yamada et al. (50) described two novel purified GlRE-binding
proteins that are different from USF. The DNA binding activity of these
24- and 26-kDa proteins disappeared after preincubation for 5 min at
60 °C. We found that COUP-TFII either translated in vitro
or from liver nuclear extract is labile after a preincubation at
60 °C for 5 min, whereas USFs were stable. Yamada et al.
(50) observed that the binding profile of their purified proteins was apparently migrating faster than that from the starting materials and
indicated that purification of this GlRE binding activity was very
difficult because it corresponded to an extremely unstable protein. All
these results suggest that this novel activity is proteolytically
unstable as described for COUP-TF (26). Therefore, we propose that this
novel GlRE binding activity could be COUP-TFII.
Finally, Ferré and co-workers (51) recently proposed that the
basic helix-loop-helix/leucine zipper family SREBP-1c/ADD1 factor could
be responsible for the transcriptional activation of lipogenic genes,
including the L-PK gene, by glucose. However, the SREBP gene is
activated by insulin, regardless of the presence of glucose (51) and
binds very poorly to the L-PK GlRE.2 In fact, we have shown
that SREBP-1c was a very inefficient transactivator of a reporter gene
directed by oligomerized GlREs in hepatoma mhAT3F cells (38).
The regulation of the transcriptional activity by glucose through the
GlRE could be due to competition between glucose-inducible activators
and the inhibitor COUP-TFII for binding to the response element. This
hypothesis is in line with the observation that under low glucose
conditions the GlRE behaves rather as a negative cis-acting element,
probably because it binds mainly COUP-TFII, which could be displaced by
activators upon glucose refeeding. Such an alternative binding of
COUP-TFII or basic helix-loop-helix activators on the GlRE E boxes
could still explain why this element seems to be always occupied in
in vivo footprinting experiments in fasted as well as refed
animals.3 In addition, the
increased activity at low glucose and the decreased activation by
glucose conferred by the oligomerized GlRE mutant consisting of two
canonical E boxes with high affinity for USF and very low affinity for
COUP-TFII are also consistent with our hypothesis.
The putative role of COUP-TFII in the glucose response complex as a
binding competitive inhibitor of glucose-dependent
activators is reminiscent of its reported capability to antagonize
different members of the nuclear receptor family, either
ligand-dependent (estrogen receptor) (52, 53),
peroxisome-proliferator-activated receptor (54, 55) or still orphan but
sensitive to cAMP (steroidogenic factor) (56). In conclusion, although
we are aware that confirmation or invalidation of these hypotheses
still require extensive studies, we have demonstrated in this paper
that COUP-TFII does bind to the L-PK GlRE and inhibits the glucose
response and is therefore likely to be an important player of the
glucose sensor system of glucose sensitive genes.
§¶,
,
TOP
ABSTRACT
INTRODUCTION
Fellow of the Ministère de l'Education Nationale de
l'Enseignement Supérieur et de la Recherche.
