HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Faro, C. Articles by Pires, E. Search for Related Content PubMed PubMed Citation Articles by Faro, C. Articles by Pires, E. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 40, 28724-28729, October 1, 1999

Cloning and Characterization of cDNA Encoding Cardosin A, an RGD-containing Plant Aspartic Proteinase^*

Carlos Faro^§, Miguel Ramalho-Santos^¶, Margarida Vieira^¶, Alexandra Mendes, Isaura Simões^¶, Rita Andrade^¶, Paula Veríssimo^¶, Xin-li Lin^**, Jordan Tang^**, and Euclides Pires

From the  Departamento de Bioquímica, Faculdade de Ciências e Tecnologia and Departamento Biologia Molecular e Biotecnologia, Centro de Neurociências e Biologia Celular, Universidade de Coimbra, 3000 Coimbra, Portugal and the ^** Protein Studies Program, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 73104

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cardosin A is an abundant aspartic proteinase from pistils of Cynara cardunculus L. whose milk-clotting activity has been exploited for the manufacture of cheese. Here we report the cloning and characterization of cardosin A cDNA. The deduced amino acid sequence contains the conserved features of plant aspartic proteinases, including the plant-specific insertion (PSI), and revealed the presence of an Arg-Gly-Asp (RGD) motif, which is known to function in cell surface receptor binding by extracellular proteins. Cardosin A mRNA was detected predominantly in young flower buds but not in mature or senescent pistils, suggesting that its expression is likely to be developmentally regulated. Procardosin A, the single chain precursor, was found associated with microsomal membranes of flower buds, whereas the active two-chain enzyme generated upon removal of PSI is soluble. This result implies a role for PSI in promoting the association of plant aspartic proteinase precursors to cell membranes. To get further insights about cardosin A, the functional relevance of the RGD motif was also investigated. A 100-kDa protein that interacts specifically with the RGD sequence was isolated from octyl glucoside pollen extracts by affinity chromatography on cardosin A-Sepharose. This result suggests that the 100-kDa protein is a cardosin A receptor and indicates that the interaction between these two proteins is apparently mediated through RGD recognition. It is possible therefore that cardosin A may have a role in adhesion-mediated proteolytic mechanisms involved in pollen recognition and growth.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Aspartic proteinases (1) are widely distributed in the plant kingdom, and they have been purified and characterized from several species of monocotyledons, dicotyledons, and gymnosperms (2). In common with most of the aspartic proteinases from retrovirus, bacteria, yeast, fungi, and vertebrates, plant aspartic proteinases are inhibited by pepstatin (a hexapeptide from Streptomyces), have an acid pH optimum, and preferentially cleave peptide bonds between hydrophobic residues. The amino acid sequences of some plant aspartic proteinases have recently been deduced (3-7). As compared with those of mammalian or microbial origins, they have an extra segment encoding about 100 amino acids known as the plant-specific insert (PSI).¹ This segment is partially or totally removed from the precursors to render active two-chain mature enzymes (8, 9). Although the molecular and physiological relevance of this domain is not yet known, a significant secondary structural similarity with saposins has been noted (10). Several plant aspartic proteinases have been localized to the vacuoles (11-14), and there is biochemical evidence that some of them are secreted (15, 16). However, the biological functions of these proteinases still remain to be elucidated.

We have previously reported the isolation and characterization of two aspartic proteinases, cardosin A and cardosin B (17, 18), whose milk-clotting activity has traditionally been used in Portugal for cheese making. Both cardosins are two-chain glycosylated enzymes, which are thought to have arisen by gene duplication (17). Although they preferably cleave peptide bonds between residues with bulky hydrophobic side chains, cardosin B displays a broader specificity and a higher proteolytic activity (17, 18). Cardosin A, the more abundant one, is accumulated to a high amount in protein storage vacuoles of the stigmatic papillae and is also found in vacuoles of the epidermic cells of style (11). These observations suggest that cardosin A may be involved in pollen-pistil interaction and possibly in the defense against pathogens or invasion (11). The evidence, however, is lacking to support these hypotheses.

To gain more insights about the possible biological function(s) of cardosin A, we have cloned its cDNA. As will be described herein, a unique feature of cardosin A, among plant aspartic proteinases, is the presence of a functional RGD sequence. The RGD motif is well known as an integrin-binding sequence in mammalian tissues in which it facilitates many cell recognition functions such as adhesion, migration, signaling, differentiation, and growth (19). Although these events have been well studied in animals, little evidence is available for the occurrence of integrin-like proteins and their ligands in plants. Integrin-like proteins of plant origin have been identified either by their binding to RGD-containing peptides (20-23) or by their cross-reactivity to antibodies against integrin subunits (20, 24-27). Similarly, vitronectin-like proteins, which are supposed to interact with plant integrin-like proteins through their RGD sequence, were detected in the extracellular matrix of several plant tissues (28-31). However, the RGD-containing protein and its interacting receptor have not both being identified in any case.

In the present paper, we described the cloning of cardosin A cDNA and the identification of a 100-kDa receptor from pollen that interacts specifically with the region of the proteinase that contains an RGD cell attachment sequence. The physiological relevance of these findings, in particular the possible involvement of a proteinase in RGD-mediated molecular mechanisms in plants, is also discussed.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Plant Material-- Organs of Cynara cardunculus L. were collected from clones previously used for biochemical studies. These plants were grown from seeds supplied by the Botanical Garden of the University of Coimbra. In most cases, organs were collected, frozen immediately in liquid nitrogen, and kept at 80 °C until use.

cDNA Cloning-- Total RNA was isolated from flower buds of C. cardunculus L. essentially as described in Ref. 32, and the poly(A) mRNA was isolated using a Poly(A)Tract mRNA isolation kit (Promega). The RNA was used to generate double-stranded cDNA, and upon ligation of the Marathon cDNA adaptor, 5'- and 3'-RACE were performed using the Marathon cDNA amplification kit (CLONTECH) according to the manufacturer's instructions. RACE was performed with cardosinA-specific primers (card 1S, GAGTTGTGTGAACACTTATCCA; card 1R, TGGATAAGTGTTCACACAACTC) and the adaptor primer AP1 (ACTCACTATAGGGCTCGAGCGGC). The PCR-amplified cDNA fragments were cloned and sequenced. Based on these sequences, specific primers for the 5'- (primer S, ATGGGTACCTCAATCAAAGCA) and 3'- (primer R, TCAAGCTGCTTCTGCAAATCC) ends of the open reading frame were synthesized, and full-length cDNAs of cardosin A were PCR-amplified from the cDNA library. The PCR products were cloned, and both strands were sequenced by automated DNA sequencing. DNA sequencing was performed in a Vistra DNA Automatic Sequencer 725 (Amersham Pharmacia Biotech). Primers were labeled with Texas Red using the 5'-oligonucleotide Texas Red labeling kit (Amersham Pharmacia Biotech), and sequencing reactions were carried out with the Thermo sequenase premixed cycle sequencing kit (Amersham Pharmacia Biotech) using the dideoxynucleotide chain termination method.

Northern Blotting-- Total RNA was isolated from 100 mg of plant tissue using the RNeasy Plant Mini kit (Qiagen) according to the manufacturer's instructions. RNA (5 µg) was separated on 1.2% agarose gels containing formaldehyde and transferred to a positively charged nylon membrane (Roche Molecular Biochemicals) by capilarity overnight at 4 °C. RNA was cross-linked to the membrane by baking at 120 °C for 30 min, and prehybridization was performed in standard hybridization buffer with formamide for 1 h at 50 °C. A 1.5-kilobase fragment of cardosin A cDNA corresponding to the coding region was labeled with DIG High Prime (Roche Molecular Biochemicals) by the random prime labeling technique and was used as a probe. Hybridization was carried out in hybridization buffer overnight at 50 °C, and detection was performed with the DIG luminescent detection kit (Roche Molecular Biochemicals) according to the manufacturer's instructions.

RT-PCR Analysis of Cardosin A mRNA Expression-- Total RNA was isolated as described above for Northern blotting. RT-PCR was performed with the Superscript RT-PCR kit (Life Technologies, Inc.) using similar amounts of total RNA and the following primers (forward, 5'-CTC GGC CTT TCA TTT CAA ACG-3'; reverse, 5'-CGG GTT GTA TCT TAG ATC GG-3'). PCR products were visualized on agarose gel as 437-base pair cDNA fragments.

Expression in Escherichia coli and Production of an Antibody Against Recombinant Procardosin A-- Two oligonucleotides containing 5'-flanking restriction site NheI (primer Pro-NheI, GCTAGCTCCGATGACGGATTGATTCGA and primer 3'-NheI, GCTAGCTCAAGCTGCTTCTGCAAATCC) were used to PCR amplify procardosin A. The resulting fragment, without the putative signal sequence, was cloned into a TA vector and then subcloned into the NheI cloning site of the pEt11a expression vector. The recombinant plasmid (pEt11a-PcardA) was transformed into E. coli strain BL21 cells, and expression was carried out under the control of the T7 promoter. Induction, isolation of inclusion bodies, refolding, and purification of recombinant procardosin A were carried out essentially as described for canditropsin (33). The proteolytic activity was assayed using the chromogenic synthetic peptide Lys-Pro-Ala-Glu-Phe-Phe(NO₂)-Ala-Leu as substrate (17). For antibody production, 100 µg of recombinant procardosin A was emulsified with Freund's complete adjuvant and injected subcutaneously into a New Zealand rabbit from which preimmune blood had been collected. A second injection was made 3 weeks later using recombinant procardosin A emulsified with Freund's incomplete adjuvant. The antiserum was prepared from blood collected 3 weeks after this last injection.

Protein Extraction and Western Blotting Analysis-- Organs and pistils at different stages of development were ground in a mortar and pestle under liquid nitrogen and then homogenized at 20% (m/v) in 100 mM Tris-Bicine, 2% (m/v) SDS, 8 M urea. Extracts obtained were centrifuged at 12,000 × g for 15 min at 4 °C, and samples of the supernatants containing about 10 µg of protein were loaded onto 15% polyacrylamide gels for SDS-PAGE. Electrophoresis and transfer onto nitrocellulose membranes were performed as described previously (19). For immunodetection, the membranes were incubated in blocking solution, 0.5% (m/v) skim milk in phosphate-buffered saline (PBS) containing 0.1% (v/v) Tween 20 for 45 min at room temperature and then incubated overnight with a 1:500 dilution of the recombinant cardosin A antibody in blocking solution. The membranes were washed 3 times in blocking solution for 10 min and incubated with a 1:1000 dilution of swine anti-rabbit IgG conjugated to horseradish peroxidase for 1 h. The membranes were again washed 3 times in blocking solution for 10 min, and peroxidase activity was developed by luminol chemiluminescence using the ECL method according to the manufacturer's instructions (Amersham Pharmacia Biotech).

Microsomal Membrane Association Studies-- Young flower bud extracts obtained in 8.0% sucrose, 2 mM EDTA, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 20 mM Tris, 20 mM HEPES, pH 7.4, were centrifuged at 10,000 × g for 15 min at 4 °C. The supernatant was centrifuged at 100,000 × g for 1 h at 4 °C, and the resulting pellet was washed with extraction buffer and resuspended in SDS-PAGE loading buffer. SDS-PAGE, electrotransference, and immunodetection were essentially performed as described above except that a monospecific antibody for PSI (9) was used as primary antibody at a 1:200 dilution.

Isolation of the Cardosin A-binding Protein-- Pollen (100 mg) was ground in a mortar and pestle under liquid nitrogen, and pollen proteins were extracted in 500 µl of 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl₂, 2 mM MgCl₂ (PBS, pH 7.0) containing 3 mM phenylmethylsulfonyl fluoride, 1 µM pepstatin A, and 200 mM octyl glucoside. The extract was centrifuged at 12,000 × g for 15 min (4 °C), and the supernatant (400 µl) was applied to a cardosin A-Sepharose column (bead volume, 1 ml). The affinity matrix had been prepared by incubating 1 mg of cardosin A purified from stigmas of C. cardunculus L. as described in Ref. 17 with 1 ml of CNBr-Sepharose (Amersham Pharmacia Biotech), according to the manufacturer's instructions. The extract was incubated with the resin overnight at 4 °C, and the column was then washed with 5 ml of PBS containing 3 mM phenylmethylsulfonyl fluoride, 1 µM pepstatin A, and 50 mM octyl glucoside (column buffer) and with 5 ml of column buffer containing 1% (v/v) dimethyl sulfoxide (Me₂SO). Elution was made with 4 ml of column buffer containing 1% (v/v) Me₂SO and NHFRGDHT peptide (1 mg/ml).

Ligand Blotting Analysis-- The affinity-purified cardosin A receptor (8 µg) in PBS was blotted onto a polyvinylidene difluoride membrane in a TransVac apparatus (Hoeffer Pharmacia Biotech). The membrane was blocked with 0.5% skim milk in PBS and then incubated 1 h at room temperature with 1.5 nmol of natural cardosin A in PBS in the absence or presence of 20-fold molar excess of RGDS (Sigma). After several washes with blocking buffer, the bound cardosin A was detected using the antirecombinant cardosin A antibody (1:1000) as described above for Western blot analysis.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Molecular Cloning of Cardosin A cDNA and Characterization of the Deduced Amino Acid Sequence-- In the first stage, a 0.8-kilobase internal segment of the cardosin A cDNA was PCR-amplified using degenerated primers encoding two amino acid sequences previously determined by protein sequencing (17). Based upon the sequence of this fragment, whose nature was confirmed by comparison with the partial amino acid sequence of cardosin A, primers were designed to amplify a full-length cDNA from a young flower bud cDNA Marathon library. Most of the 5'-RACE-PCR fragments contained a putative ATG start codon, whereas all 3'-RACE-PCR fragments contained three stop codons plus the poly(A) sequence. The cardosin A cDNA was finally obtained from the cDNA library using specific primers for the 5'- and 3'-ends of the open reading frame. The nucleotide and deduced amino acid sequences are shown in Fig. 1A. The 1515-base pair cDNA sequence encodes a signal peptide of about 24 amino acids, a prosegment of 42 residues, and a 438-amino acid-long polypeptide containing the two chains of mature cardosin A. In common with other plant aspartic proteinases, the cDNA-derived amino acid sequence of cardosin A also contains an internal segment of 104 amino acids, which bears no homology with mammalian or microbial aspartic proteinases. This fragment known as PSI separates the two chains that occur in mature form of cardosin A (Fig. 1B). Critical residues for aspartic proteinase activity can be identified in the sequence. They include two catalytic triads (DTG and DSG) both located at the 31-kDa chain and a conserved tyrosine residue (Tyr-75 in pepsin numbering) present in the flap that overlies the active site cleft of aspartic proteinases. Two putative N-glycosylation sites are found in the sequence, at residues 139 and 432, one in each chain of the mature enzyme. Interestingly, an internal RGD cell attachment motif typical of integrin ligands is present within the cardosin A sequence between residues 246 and 248. 

View larger version (42K): [in this window] [in a new window]   Fig. 1.   A cDNA and deduced amino acid sequence of cardosin A. A, the pre- and pro-sequences are in italic. The PSI is underlined. This sequence is removed during processing of cardosin A yielding a two-chain mature enzyme with apparent molecular masses of 31 and 15 kDa. Putative N-glycosylation sites are circled and the catalytic aspartates are in bold. The RGD cell attachment motif is boxed. B, domain organization of cardosin A. The structure of cardosin A includes a signal peptide, a prosegment, the 31-kDa domain containing the two catalytic triads and the RGD sequence, the PSI domain whose predicted secondary structure display similarity to saposins, and the 15-kDa domain, which corresponds to the C-terminal domain of mature cardosin A. The putative N-glycosylation sites, previously shown to be occupied (42), are located in each chain of the active enzyme. The RGD sequence is located at the C-terminal part of 31-kDa chain upstream of the PSI domain

Developmental Expression of Cardosin A-- Because cardosin A was isolated from flowers, expression of its mRNA was monitored by Northern blot analysis at three different floral development stages (closed, partially opened, and fully opened capitula). A single band was detected on gel blots of total RNA from young flowers buds probed with the cardosin A cDNA (Fig. 2A, lane 1). The size of cardosin A mRNA is estimated to be 1.7 kilobases, which is in agreement with the sequence data obtained from the RACE clones. The highest level of expression was found in the closed capitula, and no cardosin A mRNA was detected at the later stages of floral development (Fig. 2A). To analyze the expression pattern at the protein level throughout floral development, a polyclonal antibody was raised against recombinant procardosin A produced in E. coli. As described under "Experimental Procedures" the cDNA fragment encoding procardosin A (the first 25 amino acids corresponding to the signal peptide were deleted) was cloned into pET11 and expressed in E. coli BL21. The protein was recovered from inclusion bodies, and although most of the protein was probably misfolded after several refolding steps, some recombinant procardosin A was purified by gel filtration followed by ion exchange chromatography on a Q Trap column. The recombinant procardosin A had no proteolytic activity when a series of synthetic peptides or -casein were used as substrates. The recombinant procardosin A was therefore used to produce a polyclonal antibody against the precursor form of the proteinase. The antibody recognizes predominantly the 31-kDa chain of mature cardosin A and a 67-kDa protein, which corresponds to procardosin A, the PSI-containing precursor form. Western blot analysis revealed that the levels of the precursor in the first stages of development correlate positively with those of mRNA (Fig. 2B). Conversely, the highest levels of mature cardosin A were observed in fully opened capitula when no mRNA was detected. These results suggest that the proteinase is expressed at the first stages of floral development, converted into its mature form as the flower matures, and then accumulated until the later stages of flower senescence.

View larger version (54K): [in this window] [in a new window]   Fig. 2.   Developmental expression of cardosin A mRNA and its translational product in the flower of C. cardunculus L. Northern blot analysis (A) of cardosin A mRNA expression and Western blot analysis (B) of cardosin A using an antirecombinant procardosin A polyclonal antibody are shown. Expression was monitored in pistils throughout floral development at three different stages: closed (lane 1), partially opened (lane 2), and fully opened (lane 3) capitula. RNA and protein were extracted at the same stage of development as described under "Experimental Procedures."

Organ Distribution-- Expression of cardosin A mRNA in several organs of C. cardunculus L. was first investigated by Northern blot analysis using the cardosin cDNA as a probe. Cardosin mRNA was consistently not detected in several organs tested other then young flower buds, suggesting that its expression is highly restricted to this organ. Conversely, when RT-PCR was used to study cardosin A mRNA expression in the same organs, besides being detected in flower buds, expression was detected in seeds, pollen, and bracteas but not in roots or leaves (Fig. 3). In this assay, cardosin A mRNA was detected as a PCR-amplified fragment of about 450 base pairs. These results suggest that cardosin A is likely to be expressed in these organs at low levels that can only be detected when a more sensitive technique is used to examine its expression.

View larger version (49K): [in this window] [in a new window]   Fig. 3.   Organ-specific expression of cardosin A mRNA. Total RNA was extracted from various organs of C. cardunculus L., and RT-PCR was performed using similar amounts of RNA and primers specific for cardosin A. The source of mRNA is indicated in each lane. bp, base pairs

Association of Procardosin A with Microsomal Membranes-- The predicted secondary structure of PSI suggests that this extra domain of plant aspartic proteinases has an amphipathic character (10). Because proteins with such domains are known to interact with lipid membranes it would be possible that PSI might promote association with cell membranes. To test this hypothesis, fractionation studies were carried out to determine whether the precursor form of cardosin A containing the PSI domain (procardosin A) is soluble or membrane-associated. Protein extracts of young flower buds were subjected to differential centrifugation, and the resulting pellets were analyzed by immunoblotting using an antibody raised against a peptide whose sequence corresponds to a segment of PSI predicted to be exposed. As shown in Fig. 4, procardosin A was detected as a 67-kDa band in the pellet of the 100,000 × g fraction, indicating that the precursor form is associated with microsomal membranes. Conversely, the mature two-chain enzyme was detected in supernatants of 10,000 and 100,000 × g centrifuged samples. Therefore these results suggest that the PSI domain may have a role in the membrane association of the precursor form of cardosin A. 

View larger version (48K): [in this window] [in a new window]   Fig. 4.   Association of procardosin A with microsomal membranes. Young flower bud extracts were centrifuged at 10,000 and then at 100,000 × g. The resulting fractions were then analyzed by immunoblotting using the antirecombinant procardosin A polyclonal antibody (A) and an anti-PSI monospecific antibody (B) (9). Lane 1, 100,000 × g supernatant; lane 2, 100,000 × g pellet. Procardosin A was detected as a 67-kDa band, whereas the 31-kDa band corresponds to the heavy chain of the active cardosin A.

Identification of a 100-kDa Putative Cardosin A Receptor from Pollen that Interacts Specifically with the RGD Sequence-- The presence of the RGD cell attachment sequence raised the question of whether it could be functionally active. To determine whether a cardosin A-binding protein occurs in pollen, cardosin A was immobilized in a Sepharose matrix and used for affinity chromatography of detergent-extracted pollen (Fig. 5). Elution was made with an RGD-containing synthetic peptide designed from the amino acid sequence of cardosin A. A pollen cardosin A-binding protein with an apparent molecular mass of 100 kDa was specifically eluted with 1 mM RGD-containing peptide (Fig. 5, lanes 7 and 8). This 100-kDa protein was not eluted when a nonrelated peptide was used (Fig. 5, lanes 5 and 6) or when the chromatography was performed in an albumin-Sepharose column. Other proteins were released throughout the wash fractions, but they were not influenced by the presence of the RGD peptide in the elution buffer. Some of the 100-kDa protein appeared to be gradually released during washing, indicating a low affinity binding to cardosin A. 

View larger version (60K): [in this window] [in a new window]   Fig. 5.   Identification of a putative cardosin A receptor from pollen by cardosin A-Sepharose affinity chromatography. An octyl glucoside extract of pollen was applied to the cardosin A-Sepharose column, and a 100-kDa protein was specifically eluted with buffer containing the peptide (NHFRGDHT) whose sequence is identical to the putative cell attachment region of cardosin A. Collected fractions were analyzed by SDS-PAGE on a 12.5% Phastgel followed by silver staining. Lane 1, pollen extract that was applied to the column; lanes 2-4, wash fractions; lanes 5 and 6, fractions eluted with 1 mM CFHEKPSYQLQ; lanes 7 and 8, fractions eluted with 1 mM NHFRGDHT. The arrow indicates the pollen 100-kDa cardosin A-binding protein specifically eluted with 1 mM NHFRGDHT peptide. In control experiments the chromatography was performed in an albumin-Sepharose column. In this case no protein was detected by SDS-PAGE analysis.

An additional experiment using ligand blotting analysis was performed to confirm that the purified 100-kDa protein interacts with cardosin A. The purified 100-kDa protein was blotted onto polyvinylidene difluoride membrane and incubated with cardosin A either in the absence or presence of an excess of the RGDS peptide. As shown in Fig. 6, the antibody raised against recombinant procardosin A recognizes bound cardosin A in the membrane incubated in the absence of RGDS, whereas a very faint halo is observed in the one incubated in the presence of RGDS. These results further support the hypothesis that the interaction between cardosin A and its putative receptor is apparently mediated by the RGD sequence.

View larger version (42K): [in this window] [in a new window]   Fig. 6.   Ligand blotting analysis of the interaction between cardosin A and its putative receptor. The affinity purified receptor (8 µg) was blotted onto polyvinylidene difluoride membrane and incubated with 1.5 nmol of natural cardosin A in the absence (-RGD) or presence (+RGD) of 20-fold molar excess of the RGDS peptide. Bound cardosin A was detected with the antirecombinant procardosin A polyclonal antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Plant aspartic proteinase precursors can easily be distinguished from their animal and microbial counterparts by the presence of the PSI domain. Although the molecular and physiological relevance of this domain is still unknown, a structural similarity to saposins has been noted (10). Based on this observation, it has been proposed that PSI may function as a vacuolar-targeting signal (10) in a way similar to the involvement of saposins in the co-transport of cathepsin D to the lysosome. Our results suggest, however, that the primary function of PSI is to facilitate the association of the precursors to the membrane, most probably at the lumen of the endoplasmic reticulum. This hypothesis is consistent with the predicted amphipathic nature of the PSI domain and further supported by the membrane binding properties of saposins and other saposin-like proteins such as NK-lysin and surfactant B protein (34-36). It is possible that membrane association is a prerequisite for signaling plant aspartic proteinases to the vacuole. However, in the particular case of cardosin A, which is overexpressed at the early stages of floral development, this seems to be also a mechanism by which the proteinase is addressed to the cell surface. As will be discussed below, the localization at the cell surface therefore facilitates the interaction of cardosin A with its putative pollen receptor.

We have shown previously that cardosin A is expressed abundantly in the stigmatic papillae (11). Most of the protein was found accumulated in protein storage vacuoles and some labeling was also found in the cell wall. The results obtained in the present work clearly show that although cardosin A is accumulated until the later stages of floral senescence, expression of its mRNA occurs mainly at early stages. These results suggest that expression of this enzyme is likely to be developmentally regulated. Cardosin A mRNA was also found in other organs of C. cardunculus L., namely in pollen and seeds, in which the enzyme had not been identified, in previous studies. Western blot analysis using a polyclonal antibody raised against recombinant procardosin A and a more sensitive detection assay allowed the detection of cardosin A in those organs, although at low levels.² Cardosin A mRNA was not detected in mature leaves and roots, and thus its expression is apparently and interestingly associated with organs or tissues that undergo substantial morphological changes. In this respect, it is worthwhile to note that expression of cardosin A mRNA in immature pistils also precedes pistil growth and elongation suggesting an involvement in such developmental processes.

Cardosin A is unique among plant aspartic proteinases for having an RGD motif. The crystal structure of cardosin A³ shows that this sequence is located in a loop that connects two -strands and projects itself above the molecular surface. A similar structure is found in fibronectin (37), suggesting that cardosin A might be functionally active in promoting binding to integrin or integrin-like proteins. This hypothesis is further supported by the identification of the 100-kDa protein from pollen that specifically interacts with the RGD sequence in cardosin A. Similarly to the binding of integrins to their ligands (19), the interaction between cardosin A and its putative receptor seems to be of low affinity. We have at this point no information on the distribution of the putative receptor in the plant, and further studies will be required for substantiating its in vivo role in cardosin A recognition.

The results herein described are the first evidence for the involvement of a proteinase in RGD-dependent recognition in plants. In animals, cell migration both during development and tumor invasion relies on adhesion to extracellular matrix proteins and often requires proteolytic remodeling of the matrix by cell-bound metalloproteinases containing RGD sequences that promote their attachment to integrins (38-40). Plants may also use proteinases in a similar way in molecular events of cell growth and differentiation. Because cardosin A is abundantly expressed in the stigmatic papillae and its putative receptor is present in pollen, it is likely that this RGD-dependent recognition may be active in pollen-pistil interaction. Lord and Sanders (41) have proposed a model for pollen tube extension that predicts the existence and involvement of integrins and extracellular matrix ligands. This process occurs by tip extension in a way analogous to axonal growth and can be viewed as a special case of cell migration (41). It is thus possible that cardosin A participates in adhesion-mediated proteolytic mechanisms associated with pollen tube growth, very much in the way of integrin-bound proteases in cell proliferation and invasion. Further studies are required to elucidate the involvement of this RGD-containing proteinase in pollen-pistil interaction.

	FOOTNOTES

^* This work was supported by Grant PRAXIS/PCNA/C/BIA/171/96 from the Junta Nacional de Investigação Científica e Tecnológica (JNICT), Portugal.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AJ132884.

^§ Recipient of a short term fellowship from the Fundação Luso-Americana. To whom correspondence should be addressed: Departamento de Bioquímica, Universidade de Coimbra, Apt. 3126, 3000 Coimbra, Portugal. Tel.: 351-39-480210; Fax: 351-39-853607.

^¶ Recipient of a fellowship from the PRAXIS XXI program (JNICT).

Present address: Dept. of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138.

² P. Veríssimo and M. Vieira, unpublished results.

³ Frazao, C., Bento, I., Costa, J., Soares, C. M., Verissimo, P., Faro, C., Pires, E., Cooper, J., and Carrondo, M. A. (1999) J. Biol. Chem. 274, 27694-27701. The atomic coordinates and structure factors (code 1B5F) are available from the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ.

	ABBREVIATIONS

The abbreviations used are: PSI, plant-specific inserted sequence; Me₂SO, dimethyl sulfoxide; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; RACE, rapid amplification of cDNA ends; RT, reverse transcription; PCR, polymerase chain reaction; Bicine, N,N-bis(2-hydroxyethyl)glycine.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				P. Castanheira, B. Samyn, K. Sergeant, J. C. Clemente, B. M. Dunn, E. Pires, J. Van Beeumen, and C. Faro Activation, Proteolytic Processing, and Peptide Specificity of Recombinant Cardosin A J. Biol. Chem., April 1, 2005; 280(13): 13047 - 13054. [Abstract] [Full Text] [PDF]

				C. L. C. Esteves, J. A. Lucey, T. Wang, and E. M. V. Pires Effect of pH on the Gelation Properties of Skim Milk Gels Made From Plant Coagulants and Chymosin J Dairy Sci, August 1, 2003; 86(8): 2558 - 2567. [Abstract] [Full Text] [PDF]

				C. Egas, N. Lavoura, R. Resende, R. M. M. Brito, E. Pires, M. C. P. de Lima, and C. Faro The Saposin-like Domain of the Plant Aspartic Proteinase Precursor Is a Potent Inducer of Vesicle Leakage J. Biol. Chem., December 1, 2000; 275(49): 38190 - 38196. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Faro, C. Articles by Pires, E. Search for Related Content PubMed PubMed Citation Articles by Faro, C. Articles by Pires, E. Social Bookmarking                      What's this?