|
J Biol Chem, Vol. 274, Issue 40, 28724-28729, October 1, 1999
Cloning and Characterization of cDNA Encoding Cardosin A, an
RGD-containing Plant Aspartic Proteinase*
Carlos
Faro §,
Miguel
Ramalho-Santos ¶ ,
Margarida
Vieira ¶,
Alexandra
Mendes ,
Isaura
Simões ¶,
Rita
Andrade ¶,
Paula
Veríssimo ¶,
Xin-li
Lin**,
Jordan
Tang**, and
Euclides
Pires
From the Departamento de Bioquímica,
Faculdade de Ciências e Tecnologia and Departamento Biologia
Molecular e Biotecnologia, Centro de Neurociências e Biologia
Celular, Universidade de Coimbra, 3000 Coimbra, Portugal and the
** Protein Studies Program, Oklahoma Medical Research Foundation,
Oklahoma City, Oklahoma 73104
 |
ABSTRACT |
Cardosin A is an abundant aspartic proteinase
from pistils of Cynara cardunculus L. whose milk-clotting
activity has been exploited for the manufacture of cheese. Here we
report the cloning and characterization of cardosin A cDNA. The
deduced amino acid sequence contains the conserved features of plant
aspartic proteinases, including the plant-specific insertion (PSI), and
revealed the presence of an Arg-Gly-Asp (RGD) motif, which is known to
function in cell surface receptor binding by extracellular proteins.
Cardosin A mRNA was detected predominantly in young flower buds but
not in mature or senescent pistils, suggesting that its expression is
likely to be developmentally regulated. Procardosin A, the single chain
precursor, was found associated with microsomal membranes of flower
buds, whereas the active two-chain enzyme generated upon removal of PSI
is soluble. This result implies a role for PSI in promoting the
association of plant aspartic proteinase precursors to cell membranes.
To get further insights about cardosin A, the functional relevance of
the RGD motif was also investigated. A 100-kDa protein that interacts
specifically with the RGD sequence was isolated from octyl glucoside
pollen extracts by affinity chromatography on cardosin A-Sepharose.
This result suggests that the 100-kDa protein is a cardosin A receptor
and indicates that the interaction between these two proteins is
apparently mediated through RGD recognition. It is possible therefore
that cardosin A may have a role in adhesion-mediated proteolytic
mechanisms involved in pollen recognition and growth.
 |
INTRODUCTION |
Aspartic proteinases (1) are widely distributed in the plant
kingdom, and they have been purified and characterized from several
species of monocotyledons, dicotyledons, and gymnosperms (2). In common
with most of the aspartic proteinases from retrovirus, bacteria, yeast,
fungi, and vertebrates, plant aspartic proteinases are inhibited by
pepstatin (a hexapeptide from Streptomyces), have an acid pH
optimum, and preferentially cleave peptide bonds between hydrophobic
residues. The amino acid sequences of some plant aspartic proteinases
have recently been deduced (3-7). As compared with those of mammalian
or microbial origins, they have an extra segment encoding about 100 amino acids known as the plant-specific insert
(PSI).1 This segment is
partially or totally removed from the precursors to render active
two-chain mature enzymes (8, 9). Although the molecular and
physiological relevance of this domain is not yet known, a significant
secondary structural similarity with saposins has been noted (10).
Several plant aspartic proteinases have been localized to the vacuoles
(11-14), and there is biochemical evidence that some of them are
secreted (15, 16). However, the biological functions of these
proteinases still remain to be elucidated.
We have previously reported the isolation and characterization of two
aspartic proteinases, cardosin A and cardosin B (17, 18), whose
milk-clotting activity has traditionally been used in Portugal for
cheese making. Both cardosins are two-chain glycosylated enzymes, which
are thought to have arisen by gene duplication (17). Although they
preferably cleave peptide bonds between residues with bulky hydrophobic
side chains, cardosin B displays a broader specificity and a higher
proteolytic activity (17, 18). Cardosin A, the more abundant one, is
accumulated to a high amount in protein storage vacuoles of the
stigmatic papillae and is also found in vacuoles of the epidermic cells
of style (11). These observations suggest that cardosin A may be
involved in pollen-pistil interaction and possibly in the defense
against pathogens or invasion (11). The evidence, however, is lacking to support these hypotheses.
To gain more insights about the possible biological function(s) of
cardosin A, we have cloned its cDNA. As will be described herein, a
unique feature of cardosin A, among plant aspartic proteinases, is the
presence of a functional RGD sequence. The RGD motif is well known as
an integrin-binding sequence in mammalian tissues in which it
facilitates many cell recognition functions such as adhesion,
migration, signaling, differentiation, and growth (19). Although these
events have been well studied in animals, little evidence is available
for the occurrence of integrin-like proteins and their ligands in
plants. Integrin-like proteins of plant origin have been identified
either by their binding to RGD-containing peptides (20-23) or by their
cross-reactivity to antibodies against integrin subunits (20, 24-27).
Similarly, vitronectin-like proteins, which are supposed to interact
with plant integrin-like proteins through their RGD sequence, were
detected in the extracellular matrix of several plant tissues (28-31).
However, the RGD-containing protein and its interacting receptor have
not both being identified in any case.
In the present paper, we described the cloning of cardosin A cDNA
and the identification of a 100-kDa receptor from pollen that interacts
specifically with the region of the proteinase that contains an RGD
cell attachment sequence. The physiological relevance of these
findings, in particular the possible involvement of a proteinase in
RGD-mediated molecular mechanisms in plants, is also discussed.
 |
EXPERIMENTAL PROCEDURES |
Plant Material--
Organs of Cynara cardunculus L. were collected from clones previously used for biochemical studies.
These plants were grown from seeds supplied by the Botanical Garden of
the University of Coimbra. In most cases, organs were collected, frozen
immediately in liquid nitrogen, and kept at 80 °C until use.
cDNA Cloning--
Total RNA was isolated from flower buds of
C. cardunculus L. essentially as described in
Ref. 32, and the poly(A) mRNA was isolated using a Poly(A)Tract
mRNA isolation kit (Promega). The RNA was used to generate
double-stranded cDNA, and upon ligation of the Marathon cDNA
adaptor, 5'- and 3'-RACE were performed using the Marathon cDNA
amplification kit (CLONTECH) according to the manufacturer's instructions. RACE was performed with
cardosinA-specific primers (card 1S, GAGTTGTGTGAACACTTATCCA; card 1R,
TGGATAAGTGTTCACACAACTC) and the adaptor primer AP1
(ACTCACTATAGGGCTCGAGCGGC). The PCR-amplified cDNA fragments were
cloned and sequenced. Based on these sequences, specific primers for
the 5'- (primer S, ATGGGTACCTCAATCAAAGCA) and 3'- (primer R,
TCAAGCTGCTTCTGCAAATCC) ends of the open reading frame were synthesized,
and full-length cDNAs of cardosin A were PCR-amplified from the
cDNA library. The PCR products were cloned, and both strands were
sequenced by automated DNA sequencing. DNA sequencing was performed in
a Vistra DNA Automatic Sequencer 725 (Amersham Pharmacia Biotech).
Primers were labeled with Texas Red using the 5'-oligonucleotide Texas
Red labeling kit (Amersham Pharmacia Biotech), and sequencing reactions
were carried out with the Thermo sequenase premixed cycle sequencing
kit (Amersham Pharmacia Biotech) using the dideoxynucleotide chain
termination method.
Northern Blotting--
Total RNA was isolated from 100 mg of
plant tissue using the RNeasy Plant Mini kit (Qiagen) according to the
manufacturer's instructions. RNA (5 µg) was separated on 1.2%
agarose gels containing formaldehyde and transferred to a positively
charged nylon membrane (Roche Molecular Biochemicals) by capilarity
overnight at 4 °C. RNA was cross-linked to the membrane by baking at
120 °C for 30 min, and prehybridization was performed in standard
hybridization buffer with formamide for 1 h at 50 °C. A
1.5-kilobase fragment of cardosin A cDNA corresponding to the
coding region was labeled with DIG High Prime (Roche Molecular
Biochemicals) by the random prime labeling technique and was used as a
probe. Hybridization was carried out in hybridization buffer overnight
at 50 °C, and detection was performed with the DIG luminescent
detection kit (Roche Molecular Biochemicals) according to the
manufacturer's instructions.
RT-PCR Analysis of Cardosin A mRNA Expression--
Total RNA
was isolated as described above for Northern blotting. RT-PCR was
performed with the Superscript RT-PCR kit (Life Technologies, Inc.)
using similar amounts of total RNA and the following primers (forward,
5'-CTC GGC CTT TCA TTT CAA ACG-3'; reverse, 5'-CGG GTT GTA TCT TAG ATC
GG-3'). PCR products were visualized on agarose gel as 437-base pair
cDNA fragments.
Expression in Escherichia coli and Production of an Antibody
Against Recombinant Procardosin A--
Two oligonucleotides containing
5'-flanking restriction site NheI (primer
Pro-NheI, GCTAGCTCCGATGACGGATTGATTCGA and primer 3'-NheI, GCTAGCTCAAGCTGCTTCTGCAAATCC) were used to PCR
amplify procardosin A. The resulting fragment, without the putative
signal sequence, was cloned into a TA vector and then subcloned into the NheI cloning site of the pEt11a expression vector. The
recombinant plasmid (pEt11a-PcardA) was transformed into E. coli strain BL21 cells, and expression was carried out under the
control of the T7 promoter. Induction, isolation of inclusion bodies,
refolding, and purification of recombinant procardosin A were carried
out essentially as described for canditropsin (33). The proteolytic activity was assayed using the chromogenic synthetic peptide
Lys-Pro-Ala-Glu-Phe-Phe(NO2)-Ala-Leu as substrate (17). For
antibody production, 100 µg of recombinant procardosin A was
emulsified with Freund's complete adjuvant and injected subcutaneously
into a New Zealand rabbit from which preimmune blood had been
collected. A second injection was made 3 weeks later using recombinant
procardosin A emulsified with Freund's incomplete adjuvant. The
antiserum was prepared from blood collected 3 weeks after this last injection.
Protein Extraction and Western Blotting Analysis--
Organs and
pistils at different stages of development were ground in a mortar and
pestle under liquid nitrogen and then homogenized at 20% (m/v) in 100 mM Tris-Bicine, 2% (m/v) SDS, 8 M urea.
Extracts obtained were centrifuged at 12,000 × g for
15 min at 4 °C, and samples of the supernatants containing about 10 µg of protein were loaded onto 15% polyacrylamide gels for SDS-PAGE.
Electrophoresis and transfer onto nitrocellulose membranes were
performed as described previously (19). For immunodetection, the
membranes were incubated in blocking solution, 0.5% (m/v) skim milk in
phosphate-buffered saline (PBS) containing 0.1% (v/v) Tween 20 for 45 min at room temperature and then incubated overnight with a 1:500
dilution of the recombinant cardosin A antibody in blocking solution.
The membranes were washed 3 times in blocking solution for 10 min and
incubated with a 1:1000 dilution of swine anti-rabbit IgG conjugated to
horseradish peroxidase for 1 h. The membranes were again washed 3 times in blocking solution for 10 min, and peroxidase activity was
developed by luminol chemiluminescence using the ECL method according
to the manufacturer's instructions (Amersham Pharmacia Biotech).
Microsomal Membrane Association Studies--
Young flower bud
extracts obtained in 8.0% sucrose, 2 mM EDTA, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl
fluoride, 20 mM Tris, 20 mM HEPES, pH 7.4, were
centrifuged at 10,000 × g for 15 min at 4 °C. The
supernatant was centrifuged at 100,000 × g for 1 h at 4 °C, and the resulting pellet was washed with extraction buffer and resuspended in SDS-PAGE loading buffer. SDS-PAGE,
electrotransference, and immunodetection were essentially performed as
described above except that a monospecific antibody for PSI (9) was
used as primary antibody at a 1:200 dilution.
Isolation of the Cardosin A-binding Protein--
Pollen (100 mg)
was ground in a mortar and pestle under liquid nitrogen, and pollen
proteins were extracted in 500 µl of 10 mM
Na2HPO4, 1.8 mM
KH2PO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 2 mM MgCl2 (PBS, pH 7.0) containing 3 mM phenylmethylsulfonyl fluoride, 1 µM
pepstatin A, and 200 mM octyl glucoside. The extract was
centrifuged at 12,000 × g for 15 min (4 °C), and
the supernatant (400 µl) was applied to a cardosin A-Sepharose column
(bead volume, 1 ml). The affinity matrix had been prepared by
incubating 1 mg of cardosin A purified from stigmas of C. cardunculus L. as described in Ref. 17 with 1 ml of CNBr-Sepharose
(Amersham Pharmacia Biotech), according to the manufacturer's
instructions. The extract was incubated with the resin overnight at
4 °C, and the column was then washed with 5 ml of PBS containing 3 mM phenylmethylsulfonyl fluoride, 1 µM
pepstatin A, and 50 mM octyl glucoside (column buffer) and
with 5 ml of column buffer containing 1% (v/v) dimethyl sulfoxide
(Me2SO). Elution was made with 4 ml of column buffer containing 1% (v/v) Me2SO and NHFRGDHT peptide (1 mg/ml).
Ligand Blotting Analysis--
The affinity-purified cardosin A
receptor (8 µg) in PBS was blotted onto a polyvinylidene difluoride
membrane in a TransVac apparatus (Hoeffer Pharmacia Biotech). The
membrane was blocked with 0.5% skim milk in PBS and then incubated
1 h at room temperature with 1.5 nmol of natural cardosin A in PBS
in the absence or presence of 20-fold molar excess of RGDS (Sigma).
After several washes with blocking buffer, the bound cardosin A was
detected using the antirecombinant cardosin A antibody (1:1000) as
described above for Western blot analysis.
 |
RESULTS |
Molecular Cloning of Cardosin A cDNA and Characterization of
the Deduced Amino Acid Sequence--
In the first stage, a
0.8-kilobase internal segment of the cardosin A cDNA was
PCR-amplified using degenerated primers encoding two amino acid
sequences previously determined by protein sequencing (17). Based upon
the sequence of this fragment, whose nature was confirmed by comparison
with the partial amino acid sequence of cardosin A, primers were
designed to amplify a full-length cDNA from a young flower bud
cDNA Marathon library. Most of the 5'-RACE-PCR fragments contained
a putative ATG start codon, whereas all 3'-RACE-PCR fragments contained
three stop codons plus the poly(A) sequence. The cardosin A cDNA
was finally obtained from the cDNA library using specific primers
for the 5'- and 3'-ends of the open reading frame. The nucleotide and
deduced amino acid sequences are shown in Fig.
1A. The 1515-base pair
cDNA sequence encodes a signal peptide of about 24 amino acids, a
prosegment of 42 residues, and a 438-amino acid-long polypeptide
containing the two chains of mature cardosin A. In common with other
plant aspartic proteinases, the cDNA-derived amino acid sequence of cardosin A also contains an internal segment of 104 amino acids, which
bears no homology with mammalian or microbial aspartic proteinases. This fragment known as PSI separates the two chains that occur in
mature form of cardosin A (Fig. 1B). Critical residues for aspartic proteinase activity can be identified in the sequence. They
include two catalytic triads (DTG and DSG) both located at the 31-kDa
chain and a conserved tyrosine residue (Tyr-75 in pepsin numbering)
present in the flap that overlies the active site cleft of aspartic
proteinases. Two putative N-glycosylation sites are found in
the sequence, at residues 139 and 432, one in each chain of the mature
enzyme. Interestingly, an internal RGD cell attachment motif typical of
integrin ligands is present within the cardosin A sequence between
residues 246 and 248.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 1.
A cDNA and deduced amino acid sequence of
cardosin A. A, the pre- and pro-sequences are in
italic. The PSI is underlined. This sequence is
removed during processing of cardosin A yielding a two-chain mature
enzyme with apparent molecular masses of 31 and 15 kDa. Putative
N-glycosylation sites are circled and the
catalytic aspartates are in bold. The RGD cell attachment
motif is boxed. B, domain organization of
cardosin A. The structure of cardosin A includes a signal peptide, a
prosegment, the 31-kDa domain containing the two catalytic triads and
the RGD sequence, the PSI domain whose predicted secondary structure
display similarity to saposins, and the 15-kDa domain, which
corresponds to the C-terminal domain of mature cardosin A. The putative
N-glycosylation sites, previously shown to be occupied (42),
are located in each chain of the active enzyme. The RGD sequence is
located at the C-terminal part of 31-kDa chain upstream of the PSI
domain
|
|
Developmental Expression of Cardosin A--
Because cardosin A was
isolated from flowers, expression of its mRNA was monitored by
Northern blot analysis at three different floral development stages
(closed, partially opened, and fully opened capitula). A single band
was detected on gel blots of total RNA from young flowers buds probed
with the cardosin A cDNA (Fig. 2A, lane 1). The
size of cardosin A mRNA is estimated to be 1.7 kilobases, which is
in agreement with the sequence data obtained from the RACE clones. The
highest level of expression was found in the closed capitula, and no
cardosin A mRNA was detected at the later stages of floral
development (Fig. 2A). To analyze the expression pattern at
the protein level throughout floral development, a polyclonal antibody
was raised against recombinant procardosin A produced in E. coli. As described under "Experimental Procedures" the
cDNA fragment encoding procardosin A (the first 25 amino acids corresponding to the signal peptide were deleted) was cloned into pET11
and expressed in E. coli BL21. The protein was recovered from inclusion bodies, and although most of the protein was probably misfolded after several refolding steps, some recombinant procardosin A
was purified by gel filtration followed by ion exchange chromatography on a Q Trap column. The recombinant procardosin A had no proteolytic activity when a series of synthetic peptides or -casein were used as
substrates. The recombinant procardosin A was therefore used to produce
a polyclonal antibody against the precursor form of the proteinase. The
antibody recognizes predominantly the 31-kDa chain of mature cardosin A
and a 67-kDa protein, which corresponds to procardosin A, the
PSI-containing precursor form. Western blot analysis revealed that the
levels of the precursor in the first stages of development correlate
positively with those of mRNA (Fig. 2B). Conversely, the
highest levels of mature cardosin A were observed in fully opened
capitula when no mRNA was detected. These results suggest that the
proteinase is expressed at the first stages of floral development,
converted into its mature form as the flower matures, and then
accumulated until the later stages of flower senescence.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 2.
Developmental expression of cardosin A
mRNA and its translational product in the flower of C. cardunculus L. Northern blot analysis (A) of
cardosin A mRNA expression and Western blot analysis (B)
of cardosin A using an antirecombinant procardosin A polyclonal
antibody are shown. Expression was monitored in pistils throughout
floral development at three different stages: closed (lane
1), partially opened (lane 2), and fully opened
(lane 3) capitula. RNA and protein were extracted at the
same stage of development as described under "Experimental
Procedures."
|
|
Organ Distribution--
Expression of cardosin A mRNA in
several organs of C. cardunculus L. was first investigated
by Northern blot analysis using the cardosin cDNA as a probe.
Cardosin mRNA was consistently not detected in several organs
tested other then young flower buds, suggesting that its expression is
highly restricted to this organ. Conversely, when RT-PCR was used to
study cardosin A mRNA expression in the same organs, besides being
detected in flower buds, expression was detected in seeds, pollen, and
bracteas but not in roots or leaves (Fig.
3). In this assay, cardosin A mRNA
was detected as a PCR-amplified fragment of about 450 base pairs. These
results suggest that cardosin A is likely to be expressed in these
organs at low levels that can only be detected when a more sensitive technique is used to examine its expression.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 3.
Organ-specific expression of cardosin A
mRNA. Total RNA was extracted from various organs of C. cardunculus L., and RT-PCR was performed using similar amounts of
RNA and primers specific for cardosin A. The source of mRNA is
indicated in each lane. bp, base pairs
|
|
Association of Procardosin A with Microsomal Membranes--
The
predicted secondary structure of PSI suggests that this extra domain of
plant aspartic proteinases has an amphipathic character (10). Because
proteins with such domains are known to interact with lipid membranes
it would be possible that PSI might promote association with cell
membranes. To test this hypothesis, fractionation studies were carried
out to determine whether the precursor form of cardosin A containing
the PSI domain (procardosin A) is soluble or membrane-associated.
Protein extracts of young flower buds were subjected to differential
centrifugation, and the resulting pellets were analyzed by
immunoblotting using an antibody raised against a peptide whose
sequence corresponds to a segment of PSI predicted to be exposed. As
shown in Fig. 4, procardosin A was
detected as a 67-kDa band in the pellet of the 100,000 × g fraction, indicating that the precursor form is associated with microsomal membranes. Conversely, the mature two-chain enzyme was
detected in supernatants of 10,000 and 100,000 × g
centrifuged samples. Therefore these results suggest that the PSI
domain may have a role in the membrane association of the precursor
form of cardosin A.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 4.
Association of procardosin A with microsomal
membranes. Young flower bud extracts were centrifuged at 10,000 and then at 100,000 × g. The resulting
fractions were then analyzed by immunoblotting using the
antirecombinant procardosin A polyclonal antibody (A) and an
anti-PSI monospecific antibody (B) (9). Lane 1,
100,000 × g supernatant; lane 2,
100,000 × g pellet. Procardosin A was detected as a
67-kDa band, whereas the 31-kDa band corresponds to the heavy chain of
the active cardosin A.
|
|
Identification of a 100-kDa Putative Cardosin A Receptor from
Pollen that Interacts Specifically with the RGD Sequence--
The
presence of the RGD cell attachment sequence raised the question of
whether it could be functionally active. To determine whether a
cardosin A-binding protein occurs in pollen, cardosin A was immobilized
in a Sepharose matrix and used for affinity chromatography of
detergent-extracted pollen (Fig. 5).
Elution was made with an RGD-containing synthetic peptide designed from the amino acid sequence of cardosin A. A pollen cardosin A-binding protein with an apparent molecular mass of 100 kDa was specifically eluted with 1 mM RGD-containing peptide (Fig. 5,
lanes 7 and 8). This 100-kDa protein was not
eluted when a nonrelated peptide was used (Fig. 5, lanes 5 and 6) or when the chromatography was performed in an
albumin-Sepharose column. Other proteins were released throughout the
wash fractions, but they were not influenced by the presence of the RGD
peptide in the elution buffer. Some of the 100-kDa protein appeared to
be gradually released during washing, indicating a low affinity binding
to cardosin A.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 5.
Identification of a putative cardosin A
receptor from pollen by cardosin A-Sepharose affinity
chromatography. An octyl glucoside extract of pollen was applied
to the cardosin A-Sepharose column, and a 100-kDa protein was
specifically eluted with buffer containing the peptide (NHFRGDHT) whose
sequence is identical to the putative cell attachment region of
cardosin A. Collected fractions were analyzed by SDS-PAGE on a 12.5%
Phastgel followed by silver staining. Lane 1, pollen extract
that was applied to the column; lanes 2-4, wash fractions;
lanes 5 and 6, fractions eluted with 1 mM CFHEKPSYQLQ; lanes 7 and 8,
fractions eluted with 1 mM NHFRGDHT. The arrow
indicates the pollen 100-kDa cardosin A-binding protein specifically
eluted with 1 mM NHFRGDHT peptide. In control experiments
the chromatography was performed in an albumin-Sepharose column. In
this case no protein was detected by SDS-PAGE analysis.
|
|
An additional experiment using ligand blotting analysis was performed
to confirm that the purified 100-kDa protein interacts with cardosin A. The purified 100-kDa protein was blotted onto polyvinylidene difluoride
membrane and incubated with cardosin A either in the absence or
presence of an excess of the RGDS peptide. As shown in Fig.
6, the antibody raised against
recombinant procardosin A recognizes bound cardosin A in the membrane
incubated in the absence of RGDS, whereas a very faint halo is observed
in the one incubated in the presence of RGDS. These results further
support the hypothesis that the interaction between cardosin A and its putative receptor is apparently mediated by the RGD sequence.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 6.
Ligand blotting analysis of the interaction
between cardosin A and its putative receptor. The affinity
purified receptor (8 µg) was blotted onto polyvinylidene difluoride
membrane and incubated with 1.5 nmol of natural cardosin A in the
absence (-RGD) or presence (+RGD) of 20-fold
molar excess of the RGDS peptide. Bound cardosin A was detected with
the antirecombinant procardosin A polyclonal antibody.
|
|
 |
DISCUSSION |
Plant aspartic proteinase precursors can easily be distinguished
from their animal and microbial counterparts by the presence of the PSI
domain. Although the molecular and physiological relevance of this
domain is still unknown, a structural similarity to saposins has been
noted (10). Based on this observation, it has been proposed that PSI
may function as a vacuolar-targeting signal (10) in a way similar to
the involvement of saposins in the co-transport of cathepsin D to the
lysosome. Our results suggest, however, that the primary function of
PSI is to facilitate the association of the precursors to the membrane,
most probably at the lumen of the endoplasmic reticulum. This
hypothesis is consistent with the predicted amphipathic nature of the
PSI domain and further supported by the membrane binding properties of
saposins and other saposin-like proteins such as NK-lysin and
surfactant B protein (34-36). It is possible that membrane association
is a prerequisite for signaling plant aspartic proteinases to the
vacuole. However, in the particular case of cardosin A, which is
overexpressed at the early stages of floral development, this seems to
be also a mechanism by which the proteinase is addressed to the cell
surface. As will be discussed below, the localization at the cell
surface therefore facilitates the interaction of cardosin A with its
putative pollen receptor.
We have shown previously that cardosin A is expressed abundantly in the
stigmatic papillae (11). Most of the protein was found accumulated in
protein storage vacuoles and some labeling was also found in the cell
wall. The results obtained in the present work clearly show that
although cardosin A is accumulated until the later stages of floral
senescence, expression of its mRNA occurs mainly at early stages.
These results suggest that expression of this enzyme is likely to be
developmentally regulated. Cardosin A mRNA was also found in other
organs of C. cardunculus L., namely in pollen and seeds, in
which the enzyme had not been identified, in previous studies. Western
blot analysis using a polyclonal antibody raised against recombinant
procardosin A and a more sensitive detection assay allowed the
detection of cardosin A in those organs, although at low
levels.2 Cardosin A mRNA
was not detected in mature leaves and roots, and thus its expression is
apparently and interestingly associated with organs or tissues that
undergo substantial morphological changes. In this respect, it is
worthwhile to note that expression of cardosin A mRNA in immature
pistils also precedes pistil growth and elongation suggesting an
involvement in such developmental processes.
Cardosin A is unique among plant aspartic proteinases for having an RGD
motif. The crystal structure of cardosin
A3 shows that this sequence
is located in a loop that connects two -strands and projects itself
above the molecular surface. A similar structure is found in
fibronectin (37), suggesting that cardosin A might be functionally
active in promoting binding to integrin or integrin-like proteins. This
hypothesis is further supported by the identification of the 100-kDa
protein from pollen that specifically interacts with the RGD sequence
in cardosin A. Similarly to the binding of integrins to their ligands
(19), the interaction between cardosin A and its putative receptor
seems to be of low affinity. We have at this point no information on
the distribution of the putative receptor in the plant, and further
studies will be required for substantiating its in vivo role
in cardosin A recognition.
The results herein described are the first evidence for the involvement
of a proteinase in RGD-dependent recognition in plants. In
animals, cell migration both during development and tumor invasion relies on adhesion to extracellular matrix proteins and often requires
proteolytic remodeling of the matrix by cell-bound metalloproteinases containing RGD sequences that promote their attachment to integrins (38-40). Plants may also use proteinases in a similar way in molecular events of cell growth and differentiation. Because cardosin A is
abundantly expressed in the stigmatic papillae and its putative receptor is present in pollen, it is likely that this
RGD-dependent recognition may be active in pollen-pistil
interaction. Lord and Sanders (41) have proposed a model for pollen
tube extension that predicts the existence and involvement of integrins
and extracellular matrix ligands. This process occurs by tip extension
in a way analogous to axonal growth and can be viewed as a special case of cell migration (41). It is thus possible that cardosin A participates in adhesion-mediated proteolytic mechanisms associated with pollen tube growth, very much in the way of integrin-bound proteases in cell proliferation and invasion. Further studies are
required to elucidate the involvement of this RGD-containing proteinase
in pollen-pistil interaction.
 |
FOOTNOTES |
*
This work was supported by Grant PRAXIS/PCNA/C/BIA/171/96
from the Junta Nacional de Investigação Científica
e Tecnológica (JNICT), Portugal.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ132884.
§
Recipient of a short term fellowship from the Fundação
Luso-Americana. To whom correspondence should be addressed:
Departamento de Bioquímica, Universidade de Coimbra, Apt. 3126, 3000 Coimbra, Portugal. Tel.: 351-39-480210; Fax: 351-39-853607.
¶
Recipient of a fellowship from the PRAXIS XXI program (JNICT).
Present address: Dept. of Molecular and Cellular Biology,
Harvard University, Cambridge, MA 02138.
2
P. Veríssimo and M. Vieira, unpublished results.
3
Frazao, C., Bento, I., Costa, J., Soares, C. M.,
Verissimo, P., Faro, C., Pires, E., Cooper, J., and Carrondo, M. A. (1999) J. Biol. Chem. 274, 27694-27701. The atomic
coordinates and structure factors (code 1B5F) are available from the
Protein Data Bank, Research Collaboratory for Structural
Bioinformatics, Rutgers University, New Brunswick, NJ.
 |
ABBREVIATIONS |
The abbreviations used are:
PSI, plant-specific
inserted sequence;
Me2SO, dimethyl sulfoxide;
PAGE, polyacrylamide gel electrophoresis;
PBS, phosphate-buffered saline;
RACE, rapid amplification of cDNA ends;
RT, reverse transcription;
PCR, polymerase chain reaction;
Bicine, N,N-bis(2-hydroxyethyl)glycine.
 |
REFERENCES |
| 1.
|
James, M.
(1998)
in
Aspartic Proteinases
(James, M., ed)
, Plenum Press, New York
|
| 2.
|
Kervinen, J.,
Törmäkangas, K.,
Runeberg-Roos, P.,
Guruprasad, K.,
Blundell, T.,
and Teeri, T. H.
(1995)
in
Aspartic Proteinases: Structure, Function, Biology and Biomedical Implications
(Takahashi, K., ed)
, pp. 241-254, Plenum Press, New York
|
| 3.
|
Runeberg-Roos, P.,
Törmäkangas, K.,
and Östman, A.
(1991)
Eur. J. Biochem.
202,
1021-1027[Medline]
[Order article via Infotrieve]
|
| 4.
|
Cordeiro, M. C.,
Xue, Z.-T.,
Pietrzak, M.,
Pais, M. S.,
and Brodelius, P. E.
(1994)
Plant Mol. Biol.
24,
733-741[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Asakura, T.,
Watanabe, H.,
Abe, K.,
and Arai, S.
(1995)
Eur. J. Biochem.
232,
77-83[Medline]
[Order article via Infotrieve]
|
| 6.
|
Schaller, A.,
and Ryan, C. A.
(1996)
Plant Mol. Biol.
31,
1073-1077[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
D'Hondt, K.,
Stack, S.,
Gutteridge, S.,
Vandekerckhove, J.,
Krebbers, E.,
and Gal, S.
(1997)
Plant Mol. Biol.
33,
187-192[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Glathe, S.,
Kervinen, J.,
Nimtz, M.,
Li, G. H.,
Tobin, G. J.,
Copeland, T. D.,
Ashford, D. A.,
Wlodawer, A.,
and Costa, J.
(1998)
J. Biol. Chem.
273,
31230-31236[Abstract/Free Full Text]
|
| 9.
|
Ramalho-Santos, M.,
Veríssimo, P.,
Cortes, L.,
Samyn, B.,
Van Beeumen, J.,
Pires, E.,
and Faro, C.
(1998)
Eur. J. Biochem.
255,
133-138[Medline]
[Order article via Infotrieve]
|
| 10.
|
Guruprasad, K.,
Törmäkangas, K.,
Kervinen, J.,
and Blundell, T. L.
(1994)
FEBS Lett.
352,
131-136[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Ramalho-Santos, M.,
Pissarra, J.,
Veríssimo, P.,
Pereira, S.,
Salema, R.,
Pires, E.,
and Faro, C. J.
(1997)
Planta (Berl.)
203,
204-212
|
| 12.
|
Mutlu, A.,
Pfeil, J. E.,
and Gal, S.
(1998)
Phytochemistry
47,
1453-1459[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Runeberg-Roos, P.,
Kervinen, J.,
Kovaleva, V.,
Raikhel, N. V.,
and Gal, S.
(1994)
Plant Physiol. (Bethesda)
105,
321-329[Abstract]
|
| 14.
|
Elpidina, E. N.,
Dunaevsky, Y. E.,
and Belozersky, M. A.
(1990)
J. Exp. Bot.
41,
969-977[Abstract/Free Full Text]
|
| 15.
|
Rodrigo, I.,
Vera, P.,
Van Loon, L. C.,
and Conejero, V.
(1991)
Plant Physiol. (Bethesda)
95,
616-622[Abstract/Free Full Text]
|
| 16.
|
Tokes, Z. A.,
Woon, W. C.,
and Chambers, S. M.
(1974)
Planta (Berl.)
119,
39-46
|
| 17.
|
Veríssimo, P.,
Faro, C.,
Moir, A. J. G.,
Lin, Y.,
Tang, J.,
and Pires, E.
(1996)
Eur. J. Biochem.
235,
762-768[Medline]
[Order article via Infotrieve]
|
| 18.
|
Ramalho-Santos, M.,
Veríssimo, P.,
Faro, C.,
and Pires, E.
(1996)
Biochim. Biophys. Acta
1297,
83-89[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Ruoslahti, E.
(1996)
Annu. Rev. Cell Dev. Biol.
12,
697-715[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Schindler, M.,
Meiners, S.,
and Cheresh, D. A.
(1989)
J. Cell Biol.
108,
1955-1964[Abstract/Free Full Text]
|
| 21.
|
Wayne, R.,
Staves, M. P.,
and Leopold, A. C.
(1992)
J. Cell Sci.
101,
611-623[Abstract/Free Full Text]
|
| 22.
|
Zhu, J.,
Shi, J.,
Singh, U.,
Wyatt, S. E.,
Bressan, R. A.,
Hasegawa, P. M.,
and Carpita, N. C.
(1993)
Plant J.
3,
637-646[CrossRef]
|
| 23.
|
Canut, H.,
Carrasco, A.,
Galaud, J.-P.,
Cassan, C.,
Bouyssou, H.,
Vita, N.,
Ferrara, P.,
and Pont-Lezica, R.
(1998)
Plant J.
16,
63-71[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Quatrano, R. S.,
Brian, L.,
Aldridge, J.,
and Schultz, T.
(1991)
Development
1 (suppl.),
11-16
|
| 25.
|
Gens, J. S.,
Reuzeau, C.,
Doolittle, K.,
McNally, J. G.,
and Pickard, B. G.
(1996)
Protoplasma
194,
215-230[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Katembe, W. J.,
Swatzell, L. J.,
Markaroff, A.,
and Kiss, J. Z.
(1997)
Physiol. Plant.
99,
7-14[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Faik, A.,
Labourè, A. M.,
Gulino, D.,
Mandaron, P.,
and Falconet, D.
(1998)
Eur. J. Biochem.
253,
552-559[Medline]
[Order article via Infotrieve]
|
| 28.
|
Sanders, L. C.,
Wang, C. S.,
Walling, L. L.,
and Lord, E. M.
(1991)
Plant Cell
3,
629-635[Abstract/Free Full Text]
|
| 29.
|
Wang, C. S.,
Walling, L. L.,
Gu, Y. Q.,
Ware, C. F.,
and Lord, E. M.
(1994)
Plant Physiol. (Bethesda)
104,
711-717[Abstract]
|
| 30.
|
Zhu, J.-K.,
Damsz, B.,
Kononowicz, A. K.,
Bressan, R. A.,
and Hasegawa, P. M.
(1994)
Plant Cell
6,
393-404[Abstract]
|
| 31.
|
Wagner, V. T.,
Brian, L.,
and Quatrano, R. S.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
3644-3648[Abstract/Free Full Text]
|
| 32.
|
Pawlowski, K.,
Kunze, R.,
deVries, S.,
and Bisseling, T.
(1994)
Plant Mol. Biol.
D5,
1-13
|
| 33.
|
Lin, X.,
Tang, J.,
Koelsch, G.,
Monod, M.,
and Foundling, S.
(1993)
J. Biol. Chem.
268,
20143-20147[Abstract/Free Full Text]
|
| 34.
|
Vaccaro, A. M.,
Ciaffoni, F.,
Tatti, M.,
Salvioli, R.,
Barca, A.,
Tognozzi, D.,
and Scersh, C.
(1995)
J. Biol. Chem.
270,
30576-30580[Abstract/Free Full Text]
|
| 35.
|
Liepinsh, E.,
Andersson, M.,
Ruysschaert, J-M.,
and Otting, G.
(1997)
Nat. Struct. Biol.
4,
793-795[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Andersson, M.,
Curstedt, T.,
Jornvall, H.,
and Johansson, J.
(1995)
FEBS Lett.
362,
328-332[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Leahy, D. J.,
Aukhil, I.,
and Erickson, H. P.
(1996)
Cell
84,
155-164[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Basbaum, C. B.,
and Werb, Z.
(1996)
Curr. Opin. Cell Biol.
8,
731-738[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Brooks, P. C.,
Stromblad, S.,
Sanders, L. C.,
von Schalscha, T. L.,
Aimes, R. T.,
Stetler-Stevenson, W. G.,
Quigley, J. P.,
and Cheresh, D. A.
(1996)
Cell
85,
683-693[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Rooke, J.,
Pan, D.,
Xu, T.,
and Rubin, G. M.
(1996)
Science
273,
1227-1231[Abstract]
|
| 41.
|
Lord, E. M.,
and Sanders, L. C.
(1992)
Dev. Biol.
153,
16-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Costa, J.,
Ashford, D. A.,
Nimtz, M.,
Bento, I.,
Frazão, C.,
Esteves, C. L.,
Faro, C. J.,
Kervinen, J.,
Pires, E.,
Veríssimo, P.,
Wlodawer, A.,
and Carrondo, M. A.
(1997)
Eur. J. Biochem.
243,
695-700[Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. Castanheira, B. Samyn, K. Sergeant, J. C. Clemente, B. M. Dunn, E. Pires, J. Van Beeumen, and C. Faro
Activation, Proteolytic Processing, and Peptide Specificity of Recombinant Cardosin A
J. Biol. Chem.,
April 1, 2005;
280(13):
13047 - 13054.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. C. Esteves, J. A. Lucey, T. Wang, and E. M. V. Pires
Effect of pH on the Gelation Properties of Skim Milk Gels Made From Plant Coagulants and Chymosin
J Dairy Sci,
August 1, 2003;
86(8):
2558 - 2567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Egas, N. Lavoura, R. Resende, R. M. M. Brito, E. Pires, M. C. P. de Lima, and C. Faro
The Saposin-like Domain of the Plant Aspartic Proteinase Precursor Is a Potent Inducer of Vesicle Leakage
J. Biol. Chem.,
December 1, 2000;
275(49):
38190 - 38196.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|