J Biol Chem, Vol. 274, Issue 40, 28762-28770, October 1, 1999
The N-terminal Anchor Sequences of 11
-Hydroxysteroid
Dehydrogenases Determine Their Orientation in the Endoplasmic Reticulum
Membrane*
Alex
Odermatt
,
Peter
Arnold,
Anita
Stauffer,
Brigitte M.
Frey, and
Felix J.
Frey
From the Division of Nephrology and Hypertension, Department of
Medicine, University of Berne, 3010 Berne, Switzerland
 |
ABSTRACT |
11
-Hydroxysteroid dehydrogenase enzymes
(11- HSD) regulate the ratio of active endogenous glucocorticoids
to their inactive keto-metabolites, thereby controlling the access of
glucocorticoids to their cognate receptors. In this study, the topology
and intracellular localization of 11-HSD1 and 11-HSD2 have been
analyzed by immunohistochemistry and protease protection assays of
in vitro transcription/translation products. 11-HSD
constructs, tagged with the FLAG epitope, were transiently expressed in
HEK-293 cells. The enzymatic characteristics of tagged and native
enzymes were indistinguishable. Fluorescence microscopy demonstrated
the localization of both 11-HSD1 and 11-HSD2 exclusively to the
endoplasmic reticulum (ER) membrane. To examine the orientation of
tagged 11-HSD enzymes within the ER membrane, we stained selectively
permeabilized HEK-293 cells with anti-FLAG antibody.
Immunohistochemistry revealed that the N terminus of 11-HSD1 is
cytoplasmic, and the catalytic domain containing the C terminus is
protruding into the ER lumen. In contrast, the N terminus of 11-HSD2
is lumenal, and the catalytic domain is facing the cytoplasm. Chimeric
proteins where the N-terminal anchor sequences of 11-HSD1 and
11-HSD2 were exchanged adopted inverted orientation in the ER
membrane. However, both chimeric proteins were not catalytically
active. Furthermore, mutation of a tyrosine motif to alanine in the
transmembrane segment of 11-HSD1 significantly reduced
Vmax. The subcellular localization of
11-HSD1 was not affected by mutations of the tyrosine motif or of a
di-lysine motif in the N terminus. However, residue Lys5,
but not Lys6, turned out to be critical for the topology of
11-HSD1. Mutation of Lys5 to Ser inverted the
orientation of 11-HSD1 in the ER membrane without loss of catalytic
activity. Our results emphasize the importance of the N-terminal
transmembrane segments of 11-HSD enzymes for their proper function
and demonstrate that they are sufficient to determine their orientation
in the ER membrane.
| |
INTRODUCTION |
Sequence alignment and molecular modeling of human
11-HSD11 and human
11-HSD2, using the known three-dimensional structures of human
dihydropteridine reductase and Streptomyces hydrogenans 20-HSD as templates, indicated that the structures of these members of the short chain dehydrogenase reductase family of proteins are very
similar, despite only 18% sequence identity between their entire
sequences (1). Although both 11-HSD enzymes control the conversion
of biologically active glucocorticoids (cortisol in humans and
corticosterone in rats and mice) to their inactive 11-keto forms
(cortisone and 11-dehydrocorticosterone), there are important
functional differences such as cofactor specificity, substrate
affinity, or direction of the reaction.
The isoform 11-HSD1 is expressed in a wide array of tissues, with
highest levels in the liver, from where it was purified originally (2).
It catalyzes both the oxidation and reduction of glucocorticoids but
acts predominantly as an oxidoreductase, thereby increasing the
concentration of active glucocorticoids (3-8). Studies on the purified
protein demonstrated glycosylation and existence of a disulfide bond,
suggesting that the bulk of 11-HSD1 is oriented to the ER lumen (9).
By converting 11-keto- into 11-hydroxyglucocorticoids, 11-HSD1
plays an important role in the glucocorticosteroid receptor-mediated
anti-inflammatory response of glucocorticoids (10). Mice deficient in
11-HSD1 were found to resist hyperglycemia provoked by obesity or
stress (11). Other investigators provided evidence that 11-HSD1
plays a role in detoxification processes (12) and in the reductive metabolism of xenobiotics (13).
The isoform 11-HSD2 is expressed at high levels in mineralocorticoid
target cells such as the renal collecting duct cells (14-17).
11-HSD2 catalyzes exclusively the dehydrogenation of 11-hydroxyglucocorticoids, utilizes NAD+ as a cofactor,
and has a nanomolar Km for glucocorticoids (14-18).
By inactivating biologically active glucocorticoids before they occupy
mineralocorticoid receptors (MR), 11-HSD2 confers aldosterone
selectivity for the MR (19, 20). In the syndrome of apparent
mineralocorticoid excess (21-23) or in mice lacking 11-HSD2 (24),
deficiency of 11-HSD2 allows glucocorticoids to bind to the MR in
the distal tubule, leading to sodium retention, hypokalemia, and severe
hypertension. Reports on the intracellular localization of 11-HSD2
are controversial. Whereas 11-HSD2 has been reported to be a
microsomal enzyme (15, 25) with exclusive localization to the ER
membrane and the protein facing the cytoplasm (26-28), evidence for
nuclear localization was also presented (29-34).
To understand the differences in the physiological functions of
11-HSD1 and 11-HSD2, it is of great interest to know the exact
topology and intracellular localization of these enzymes. Therefore, we
evaluated the role of the N-terminal anchor sequences of 11-HSD1 and
11-HSD2 on their topology, intracellular localization, and catalytic
activity. Our results demonstrate that the N-terminal sequences are
critical for proper function of 11-HSD enzymes and that they
determine their orientation in the ER membrane.
| |
MATERIALS AND METHODS |
Constructs for Expression--
For cloning into and expression
from the pcDNA3 plasmid (Invitrogen), the 5' end of both the human
11-HSD type 1 gene (35) and the type 2 gene (18) was modified first
by the introduction of a BamHI site and second by changing
the context 5' to the initiator ATG codon to a "Kozak" consensus
sequence (36). At the 3' end, an XbaI site was introduced
immediately 3' of the stop codon. Thus, the 11-HSD1 gene was
modified to 5' GAGGATCCGCCATGGCTTTT 3'
to 5' AAGTAGGATCTAGATT 3' and the 11-HSD2
gene was changed to 5' GAGGATCCGCCATGGAGCGC 3'
to 5' GCTCGGTGAGCCATCTAGATT 3'
(restriction endonuclease sites, initiator, and stop codons are
underlined). 11-HSD1 was cloned by reverse transcriptase-PCR from
total RNA isolated from primary culture cells of human aortic smooth
muscle, a kind gift of Dr. K. Plüss (37, 38). 11-HSD2 was
amplified by PCR from the original clone kindly provided by Dr.
Z. S. Krozowski (see Ref. 18). The clone used for expression of
the mineralocorticoid receptor (MR) was a generous gift of Dr. R. M. Evans (see Ref. 39).
A sequence coding for the FLAG epitope (Sigma) was attached either to
the N terminus (F1 and F2), creating the N-terminal sequence
NH2-MDYKDDDD-M1, or to the C terminus (1F and
2F), creating the C-terminal sequence -MDYKDDDD-COOH. Attachment was
through the polymerase chain reaction (PCR) using primers with
5'-add-on sequences containing a restriction endonuclease site and a
sequence coding the FLAG epitope.
Chimeric constructs, where the N-terminal domain containing the
transmembrane segment was exchanged, were obtained by PCR amplification. Sequences were exchanged at the beginning of the conserved Rossmann-fold motif (40, 41) by introducing a
PinAI restriction endonuclease site at the conserved
threonine and glycine residues, not affecting the amino acid sequence
(11-HSD1, Thr40Gly41, ACCGGC to
ACCGGT; 11-HSD2: Thr88Gly89,
ACAGGG to ACCGGT). The chimeric proteins were
tagged with the FLAG epitope at the C terminus to allow facilitated
detection. Constructs 1F and 2F were further subjected to site-directed
mutagenesis using the Quick Change Mutagenesis kit from Stratagene. All
constructs were verified by sequencing.
Immunostaining--
HEK-293 cells, grown to a confluence of 70%
in DMEM with 10% fetal calf serum, 4.5 g/liter glucose, 50 units/ml
penicillin/streptomycin, 2 mM glutamine, were split 1:15
and transferred onto glass coverslips placed in six-well plates. In
experiments where cells were cotransfected with 2F and MR, the molar
ratio was 3:1, 1:1, or 1:3, respectively, with a total amount of 3 µg
of DNA per well. The medium was replaced 14 h later, and cells
were transfected with 2.5 µg of the corresponding DNA per well. Eight
hours later, the medium was replaced to remove the
Ca2+-phosphate precipitate. Immunostaining was performed
72 h post-transfection. The cells were fixed for 10 min at
25 °C using 3.7% paraformaldehyde in NAPS buffer (100 mM sodium phosphate, pH 7.4, 120 mM sucrose), washed three times, and incubated for 30 min at 25 °C with NAPS buffer containing 1% milk powder and 0.5% Triton X-100. Incubation with monoclonal antibody M2 raised against the FLAG epitope (Sigma) was
for 1 h at 25 °C. Glass coverslips were washed three times, followed by incubation with fluorescein-conjugated goat anti-mouse IgG
(Molecular Probes). After three wash steps, the cells were mounted
using the Slow Fade Antifade kit (Molecular Probes). For selective
permeabilization of the plasma membrane, Triton X-100 was replaced by
digitonin at a concentration of 25 µM or by 0.05% saponin. Samples were analyzed on a LSM 400 confocal microscope (Carl
Zeiss). Images were analyzed using NIH Image 1.60b7 software.
To assess the percentage of stained cells in Triton X-100
versus digitonin-permeabilized cells, fields of well spread
cells were chosen by using the transmitted light, total cells were
counted, and the number of fluorescent cells was determined under
UV light. Data represent mean ± S.D. of at least five
experiments from independent transfections.
Assay for 11-HSD--
HEK-293 cells were transfected
according to the calcium phosphate precipitation method (42). The
medium was replaced by charcoal-treated DMEM 48 h later, and cells
were harvested 72 h post-transfection. The cells were washed once
with phosphate-buffered saline and centrifuged. The cell pellet was
subjected to a freeze/thaw cycle and resuspended in TG1 buffer (20 mM Tris-HCl, pH 7.4; 100 mM NaCl; 1 mM EGTA; 1 mM EDTA; 1 mM
MgCl2; 20% glycerol), and activity assays were started immediately.
Oxidative activity of 11-HSD enzymes was measured by determining the
rate of conversion of corticosterone to 11-dehydrocorticosterone in the
presence of NADP+ to analyze 11-HSD1 derivatives, or
NAD+, for 11-HSD2 derivatives. The reaction was started
by mixing cell extract corresponding to 2-10 µg of total proteins
with 10 µl of reaction mixture. The assay was performed in a final
volume of 20 µl containing 400 µM NADP+, 30 nCi of [3H]corticosterone, and corticosterone at
different concentrations ranging from 25 nM to 2 µM. Samples were incubated for 10-30 min at 37 °C.
The reaction was stopped by adding methanol and an excess of unlabeled
steroids. Corticosterone and 11-dehydrocorticosterone were separated
by thin layer chromatography and analyzed as described (10). In
measurements using whole cells, TG1 buffer was replaced by
charcoal-treated DMEM. The cells were washed and resuspended in
prewarmed (37 °C) charcoal-treated DMEM. No cofactor was added for
the whole cell assay. When measuring reductive activity of 11-HSD
enzymes, NADPH (only in assays using extracts),
[3H]11-dehydrocorticosterone, and
dehydrocorticosterone were used.
Enzyme kinetics were analyzed by the Eadie-Hofstee linear
transformation of the Michaelis-Menten equation. Km
and Vmax values, calculated using the
Lineweaver-Burk plot, were in line with the values obtained from the
Eadie-Hofstee transformation. Constants were calculated by unweighted
linear regression analysis with mean values of at least three
experiments from independent transfections. Only conversion rates
between 10 and 75% have been considered for calculation. Significance
was tested by Student's unpaired t test.
Immunoblotting--
To compare the expression level of the
different constructs, cells were extracted with 0.5% Triton X-100 for
15 min on ice, centrifuged to remove debris, and an amount of 50 µg
of total proteins was separated by 12.5% SDS-PAGE. Proteins were
transferred electrophoretically to nitrocellulose and incubated with
the monoclonal antibody M2 raised against the FLAG epitope (Sigma).
Antibody binding was visualized using the ECL Western detection system (Amersham Pharmacia Biotech). The data were analyzed by scanning densitometry using NIH Image 1.60b7 software.
In Vitro Transcription/Translation and Protease Protection
Assay--
The pcDNA3 plasmids carrying the relevant constructs
were subjected to in vitro transcription by T7 RNA
polymerase and translation in reticulocyte lysate in the presence of
dog pancreas microsomes (TNT Quick system, Promega). In a typical
assay, 500 ng of linearized plasmid DNA, 20 µCi of
[35S]methionine (Amersham Pharmacia Biotech), and 3 µl
of canine pancreatic microsomal membranes (Promega) were incubated for
60 min at 30 °C in a final volume of 25 µl. The reaction was
chilled on ice, followed by addition of 10 mM
Tris-CaCl2, pH 8.0. Translocation of polypeptides to the
lumenal side of the microsomes was assayed by proteinase K treatment.
An aliquot of 8 µl from the in vitro transcription/translation product was incubated for 30 min on ice with
0.2 mg/ml proteinase K (Roche Molecular Biochemicals) in the presence
or absence of 0.5% Triton X-100. Proteinase K was inactivated by the
addition of 1 mM phenylmethylsulfonyl fluoride and
subsequent boiling for 5 min. Proteins were subjected to 12.5% SDS-PAGE and analyzed by autoradiography and scanning. Data were analyzed using the NIH Image software (version 1.60b7).
| |
RESULTS |
Intracellular Localization of 11-HSD1 and 11-HSD2--
In
order to investigate the intracellular localization of 11-HSD
enzymes and to analyze whether 11-HSD2 is also expressed in the
nucleus, we extended earlier studies (9, 15, 25-34) by transiently
expressing C-terminally FLAG epitope-tagged 11-HSD1 (1F) and
11-HSD2 (2F) in HEK-293 cells and analyzing their localization by
confocal laser scanning microscopy.
Immunostaining using monoclonal antibody M2 specific for the FLAG
epitope and FITC-labeled goat anti-mouse IgG revealed a pattern typical
for localization to the ER membrane for both 11-HSD1 (1F) and
11-HSD2 (2F) (Fig. 1.). There was no
indication of nuclear staining or staining at the plasma membrane.
Cells were analyzed by confocal laser scanning microscopy 72 h
post-transfection. There was no difference in the expression pattern
when cells were stained 96 or 120 h post-transfection (data not
shown). Densitometric analysis of over 100 transfected cells revealed
that the fluorescent light from the area inside the nucleus was only
2.0 ± 1.5% that of the light detected from the area containing
the ER. A similar level of background staining was obtained in previous
experiments using the same technique with the sarcoendoplasmic
reticulum Ca2+-ATPase (SERCA1) and sarcolipin, two proteins
known to be expressed exclusively in the ER membrane, with nuclear
signals ranging from 1 to 3% (43). Furthermore, coexpression of
11-HSD2 and mineralocorticoid receptor in the presence of 5 nM aldosterone or 25 nM cortisol did not result
in an increase of nuclear signal, with 1.8 ± 1.4 and 2.0 ± 1.6% of the signal detected from the area containing the ER,
respectively (data not shown).
View larger version (49K):
[in this window]
[in a new window]
|
Fig. 1.
Localization of
11-HSD1 and 11-HSD2
to the endoplasmic reticulum membrane. HEK-293 cells were
transfected with 11-HSD1 tagged with the FLAG epitope at the C
terminus (1F) (A) or with C-terminally FLAG-tagged
11-HSD2 (2F) (B). Immunostaining was performed 72 h
post-transfection. The cells were labeled with mouse anti-FLAG antibody
against the C-terminally attached FLAG epitope in the presence of 0.5%
Triton X-100. Expression was visualized using FITC-conjugated goat
anti-mouse IgG, and FITC fluorescence was detected at 525 nm.
|
|
Orientation of 11-HSD1 and 11-HSD2 in the ER
Membrane--
To determine the topology of 11-HSD enzymes, we
immunostained cells expressing constructs with a FLAG epitope attached
either to the N terminus (F1 and F2) or to the C terminus (1F and 2F). Expression was detected using anti-FLAG antibody (M2) and FITC-labeled secondary antibody. Approximately 32% of total cells were stained after complete permeabilization of cells using 0.5% Triton X-100 (Fig.
2, A and C). The
transfection efficiency was 32 ± 2% (Table I). About the same number of fluorescent
cells expressing constructs F1 (not shown) or 2F (Fig. 2D)
were detected with anti-FLAG antibody after treatment with 25 µM digitonin to permeabilize the plasma membrane
selectively, leaving the ER membrane intact. Under these conditions
anti-FLAG antibody was unable to interact with the FLAG epitope
attached to the C terminus of 11-HSD1 (1F, see Fig. 2B)
or to the N terminus of 11-HSD2 (F2, not shown), suggesting lumenal
orientation of the FLAG epitope in 1F and F2 (Table I). Selective
permeabilization of the plasma membrane was achieved at digitonin
concentrations between 10 and 75 µM (43). Similar results
were obtained in experiments where the plasma membrane was selectively
permeabilized with 0.05% saponin (data not shown). These results
strongly suggest that the N-terminal sequence of 11-HSD1 faces the
cytoplasm and the C-terminal part protrudes into the lumen of the ER.
In contrast, the N terminus of 11-HSD2 is directed toward the
lumenal compartment and the C terminus containing the catalytic moiety
is facing the cytoplasm.
View larger version (96K):
[in this window]
[in a new window]
|
Fig. 2.
Orientation of the C terminus of
11-HSD1 and 11-HSD2
in the ER membrane. HEK-293 cells were transfected with
C-terminally FLAG-tagged 11-HSD1, 1F (A and
B), or with C-terminally FLAG-tagged 11-HSD2, 2F
(C and D). Immunostaining was carried out as
indicated in Fig. 1. Cells were either completely permeabilized with
0.5% Triton X-100 (A and C) or the plasma
membrane was selectively permeabilized using 25 µM
digitonin (B and D), allowing restricted access
of the antibody to the cytosolic compartment.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Topology of 11-HSD enzymes and chimeric constructs
Transfected HEK-293 cells were either completely permeabilized with
0.5% Triton X-100, or the plasma membrane was selectively
permeabilized with 25 µM digitonin, allowing restricted
access of the antibody to the cytosolic compartment. Cells were
incubated with an antibody against the FLAG epitope. Immunostaining was
carried out as described under "Materials and Methods." Numbers
represent the percentage of fluorescent cells relative to total cells
from five independent experiments. In a typical experiment 300-500
cells were counted. The transfection efficiency was 32 ± 2%.
Data represent mean ± S.D.
|
|
The fluorescence signal observed from construct F1 in the presence of
Triton X-100 was considerably weaker than that from other constructs
analyzed (not shown). Also, F1 could barely be detected in
immunoblotting (Fig. 3.). In contrast,
the fluorescence signal intensity in the presence of digitonin was
comparable to that from other constructs. In addition, the enzyme
activity per mg of total protein of homogenates from cells expressing
F1 was similar to that of 1F or wild type 11-HSD1 (Table
II). A possible explanation could be that
interaction of detergent molecules like Triton X-100 or SDS with the
hydrophobic amino acids in the N terminus of 11-HSD1 may prevent
proper epitope recognition by the anti-FLAG antibody.
View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of epitope-tagged
11-HSD enzymes and chimeric proteins in
HEK-293 cells. 11-HSD enzymes with a FLAG epitope attached to
the N terminus (F1 and F2) or to the C terminus (1F, 2F, 12F, and 21F)
were expressed in HEK-293 cells. An aliquot corresponding to 50 µg of
total proteins was separated by 12.5% SDS-PAGE and subjected to
immunoblotting with anti-FLAG antibody. The positions of protein size
markers (kDa) are indicated on the left. The positions of
11-HSD1 and 11-HSD2 are indicated by an arrow on the
right.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Oxidation of corticosterone by 11-HSD enzymes and chimeric
constructs
Metabolism of corticosterone by homogenates of HEK-293 cells
transfected with 11-HSD constructs (for description see Table I) was
determined as described under "Materials and Methods." Oxidative
activities are expressed in terms of Km and
Vmax. Data are obtained from 3 to 6 independent
experiments and are presented as mean ± S.D.
|
|
Attachment of the FLAG epitope to either the N or the C terminus did
not affect the activity of 11-HSD1 or 11-HSD2 (Table II, Fig.
3.). Furthermore, all four constructs showed a pattern typical for
localization to the ER membrane and thus did not affect intracellular localization.
The N-terminal Anchor Sequences of 11-HSD Enzymes Determine
Their Orientation in the ER Membrane--
To investigate if the N
terminus of 11-HSD1 or 11-HSD2 is sufficient to determine its
orientation in the ER membrane, we constructed chimeric proteins where
the first 39 amino acids of 11-HSD1 and the first 87 amino acids of
11-HSD2 were exchanged. For the site of exchange we have chosen the
two conserved residues threonine and glycine, whereby the latter is the
first residue of the Gly-(Xaa)3-Gly-Xaa-Gly motif highly
conserved in all members of the short chain dehydrogenase reductase
family (41).
Analysis by confocal microscopy revealed that anti-FLAG antibody no
longer recognized the FLAG epitope attached to the C terminus of the
chimeric protein 12F, consisting of the N-terminal 39 amino acids of
11-HSD1 and amino acids 88-405 of 11-HSD2, in cells where the
plasma membrane was selectively permeabilized by 25 µM
digitonin (Table I). The FLAG epitope of 12F was accessible in the
presence of Triton X-100. These experiments suggest that the C terminus
of 12F, unlike that of 2F, is protruding into the lumen of the ER. The
FLAG epitope of construct 21F, consisting of the N-terminal 87 amino
acids of 11-HSD2 followed by amino acids 40-292 of 11-HSD1, was
accessible in the presence of 25 µM digitonin, suggesting
cytoplasmic orientation. This is different from construct 1F, where the
C terminus is protected by the ER membrane.
To confirm further these findings, we performed protease protection
assays of constructs that were in vitro transcribed and translated in the presence of dog pancreas microsomes (Fig.
4). Constructs 2F and F2 showed a band at
44 kDa, as expected, that was completely degraded after incubation with
proteinase K. For both constructs 1F and F1 a band at 29 kDa and three
additional bands of higher molecular mass (31, 33, and 35 kDa),
corresponding to glycosylated products, were detected. 11-HSD1
contains three putative N-glycosylation sites at amino acids
Asn123, Asn162, and Asn207. The
contribution of each site to the observed glycosylated products was not
investigated; however, in the absence of microsomes or after treatment
with endo--N-acetylglucosaminidase H (7 milliunits, 30 min, 37 °C) only the 29-kDa band could be detected (data not shown).
The protein products of 1F and F1 were resistant to degradation when
the microsomes were treated with proteinase K. After disruption of the
microsomes with the detergent Triton X-100, no protease-resistant material remained. The chimeric protein 12F was protected from degradation by proteinase K, whereas 21F was completely degraded.
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 4.
The orientation of
11-HSD1 and 11-HSD2
in the ER membrane is determined by the N-terminal anchor
sequence. FLAG epitope-tagged 11-HSD1 (1F and F1), 11-HSD2
(2F and F2), and chimeric constructs (12F and 21F) were expressed
in vitro in rabbit reticulocyte lysate in the presence of
dog pancreas microsomes. Subsequently, microsomes were incubated in the
absence ( ) or presence (+) of 0.2 mg/ml proteinase K (PK)
and 0.5% Triton X-100 (T). Proteins were separated on
12.5% SDS-PAGE, and dried gels were subjected to autoradiography. The
positions of protein size markers (kDa) are indicated on the
left (upper panel). Models showing the
orientation of 11-HSD enzymes in the ER membrane are given in the
bottom panel. 11-HSD1 consists of six amino acids facing
the cytoplasm (Cyt) followed by one transmembrane spanning
helix and the catalytic moiety which protrudes into the ER lumen
(Lum). The three glycosylation sites at Asn123,
Asn162, and Asn207 are indicated. 11-HSD2
consists of three amino acids on the luminal side, followed by a
segment with three membrane spanning helices and the catalytic domain
which faces the cytoplasm. The N-terminal anchor sequences of
11-HSD1 and 11-HSD2 are exchanged in chimeric proteins 12F and
21F and determine their orientation in the ER membrane. The FLAG
epitope is indicated (F). A, constructs F2, 2F,
and 12F; B, constructs 21F, 1F, and F1.
|
|
These findings confirm the results obtained from confocal microscopy
experiments that the N-terminal anchor of 11-HSD1 is sufficient to
determine the orientation of the catalytic domain toward the ER lumen.
In contrast, the N-terminal sequence of 11-HSD2 directs its
catalytic moiety to the cytoplasm.
Expression of chimeric proteins 12F and 21F in HEK-293 cells yielded
the expected size of bands at 39 and at 33 kDa, respectively (Fig. 3.).
However, both constructs were catalytically inactive in measurements of
oxidation and reduction of corticosterone using cell homogenates or in
whole cell assays. These data support the finding of previous
investigators that the N-terminal sequence is important for proper
function of 11-HSD enzymes (44-46).
The Effect of Mutations in the N Terminus of 11-HSD1 on Its
Topology and Intracellular Localization--
We investigated whether
the tyrosine motif in the transmembrane helix of 11-HSD1 which is
also present in a microsomal 50-kDa esterase/N-deacetylase
(47) acts as an ER lumenal targeting sequence. Tyrosine residues 18-21
of 11-HSD1 were mutated either to phenylalanine (Y18-21F), to
alanine (Y18-21A), or the second and fourth tyrosine of the motif were
mutated in an alternating way to alanine (Y19A,Y21A). Fig.
5 shows that all mutants were expressed
in HEK-293 cells to a level comparable to that of 11-HSD1 (1F) or
11-HSD2 (2F). Analysis of the catalytic activity to oxidize corticosterone revealed no significant difference between mutant Y18-21F and 1F. However, the Vmax of both
mutant Y18-21A and mutant Y19A,Y21A was reduced to about 20% compared
with 1F, whereas the Km was unaltered (Table
III).
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
Expression of mutants of
11-HSD1 in HEK-293 cells. Mutants of
11-HSD1 with a FLAG epitope attached to the C terminus were
expressed in HEK-293 cells, and immunoblotting was carried out as
indicated in Fig. 3.
|
|
View this table:
[in this window]
[in a new window]
|
Table III
Oxidation of corticosterone by mutants of 11-HSD1
Enzyme activities were measured on homogenates and calculated as
indicated in Table II. Expression of 11-HSD1 mutants is shown in
Fig. 5.
|
|
By using confocal laser scanning microscopy, all three tyrosine mutants
showed an expression pattern typical for localization to the ER
membrane, and anti-FLAG antibody did not recognize the C-terminally
attached epitope in the presence of 25 µM digitonin as
observed before for 11-HSD1 (1F). Furthermore, the tyrosine mutants
were indistinguishable from 1F in protease protection assays, with the
catalytic domain protruding into the microsomes (data not shown).
In order to investigate the role of the two positively charged amino
acids Lys5 and Lys6 in the short cytoplasmic
tail of 11-HSD1 on the topology and the intracellular localization,
we replaced them by Ser or Arg. The expression level of all six mutants
in HEK-293 cells was similar to that of 1F (Fig. 5). All mutants showed
localization to the ER membrane and did not affect intracellular
localization (not shown). The catalytic activity of homogenates from
cells expressing the mutants was comparable to that of 1F, except that
mutant K6R, for unknown reasons, had an increased Km
(Table III). The activities of the lysine mutants were not
significantly different from that of 1F when oxidation of
corticosterone was measured on whole cells or when reduction of
11-dehydrocorticosterone was determined (Table
IV).
View this table:
[in this window]
[in a new window]
|
Table IV
Metabolism of corticosterone and 11-dehydrocorticosterone by whole
cells expressing wild type 11-HSD1 and mutant K5S
Metabolism of corticosterone and 11-dehydrocorticosterone by intact
HEK-293 cells transfected with cDNA for wild type 11-HSD1 or
mutant K5S was determined as described under "Materials and
Methods." Activities are expressed in terms of Km
and Vmax. Data are obtained from six (oxidation) or
four (oxoreductase) independent experiments and are presented as
mean ± S.D.
|
|
Next, we analyzed if mutation of these lysines affects the orientation
of 11-HSD1 in the ER membrane in HEK-293 cells. The cells were
either completely permeabilized with 0.5% Triton X-100 or the plasma
membrane was selectively permeabilized using 25 µM
digitonin. The orientation of the catalytic moiety of 11-HSD1 mutants was determined by detection of the FLAG epitope attached to the
C terminus using confocal microscopy (Table
V). Replacement of residue
Lys6 to Ser or Arg had no effect on the orientation of
11-HSD1, and the epitope was not accessible to anti-FLAG antibody in
the presence of digitonin. Also, mutation of Lys5 to Arg or
a double mutant where both lysines were changed to arginine (K5R,K6R)
did not have any effect on the orientation. In contrast, anti-FLAG
antibody recognized its epitope in mutants K5S and K5S,K6S, indicating
cytoplasmic orientation of the catalytic domain. We further
investigated these findings by in vitro transcription of
mutant cDNA, translation in the presence of microsomes, and subsequent subjection to protease protection assays (Fig.
6.). Mutants K5S and K5S,K6S were
completely degraded, and the bands from the glycosylated proteins were
missing, confirming the cytoplasmic orientation of the catalytic domain
observed in immunohistochemistry. In contrast to the findings from
microscopy experiments, both mutants K5R and K5R,K6R were mostly
degraded, suggesting inversion of the orientation of the catalytic
domain toward the cytoplasm. However, both mutants were partially
protected, indicated by the presence of glycosylated proteins and by
protected proteins upon treatment with proteinase K. A rough estimation
of the amount of protected protein from mutants K5R and K5R,K6R was
obtained by densitometric analysis from three independent experiments
and was in the range of 10-30%. Mutants K6S and K6R were, like
11-HSD1, protected by the microsomal membrane from degradation by
proteinase K, suggesting lumenal orientation.
View this table:
[in this window]
[in a new window]
|
Table V
Effect of mutations on the topology of 11-HSD1
Transfected HEK-293 cells were permeabilized with 0.5% Triton-X 100 or
25 µM digitonin and immunostaining was carried out as indicated in
table I. All mutants were epitope-tagged at the C-terminus and detected
by an antibody against the FLAG epitope.
|
|
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 6.
Mutation of residue Lys5 to Ser
causes 11-HSD1 to insert with an inverted
Next-Ccyt topology into microsomes.
Mutants of 11-HSD1 tagged with the FLAG epitope at the C terminus
were expressed in vitro in rabbit reticulocyte lysate in the
presence of dog pancreas microsomes. Microsomes were incubated in the
absence () or presence (+) of 0.2 mg/ml proteinase K (PK)
and 0.5% Triton X-100 (T). Proteins were separated by
12.5% SDS-PAGE. Protein size markers (kDa) are indicated on the
left of the autoradiograph (upper panel). Mutants
K6S and K6R adopt wild type topology, with the catalytic domain facing
the ER lumen (Lum) and showing the typical glycosylation
products. Cyt, cytochrome. In contrast, mutants K5S and
K5S,K6S show inverted insertion into the ER membrane (bottom
panel). A, mutants K6S, K5S, and K5S,K6S. The mutation
of Lys to Ser is indicated by a square. B,
mutants K6R, K5R, and K5R,K6R. The mutation of Lys to Arg is indicated
by a circle.
|
|
| |
DISCUSSION |
Human embryonic kidney cells (HEK-293) have proven to be a
suitable system for the transient expression of epitope-tagged constructs of 11-HSD enzymes, since there is no endogenous
11-HSD1 or 11-HSD2 activity (<1% of transfected cells, see Ref.
33). Conditions to permeabilize the plasma membrane of HEK-293 cells selectively by the use of digitonin or saponin were established previously, and it was shown that the antibody raised against the FLAG
epitope did not recognize any other proteins in untransfected cells
(43).
Immunostaining of HEK-293 cells transfected with 11-HSD1 or
11-HSD2 tagged with the FLAG epitope at the C terminus revealed very
similar expression patterns for both proteins, with high expression in
the ER membrane system and the nuclear envelope but no expression in
the nucleus or at the plasma membrane (Fig. 1). This expression pattern
is highly similar to that observed in an earlier study for the
sarcoendoplasmic reticulum Ca2+-ATPase (SERCA1) and for
sarcolipin (43), two proteins known to localize exclusively to the ER
membrane. Restricted expression of 11-HSD1 to the ER membrane is in
line with the finding that 11-HSD1 activity was detected only in
microsomal but not nuclear fractions obtained from human decidua (34).
However, reports on the subcellular localization of 11-HSD2 are controversial.
Naray Fejes-Toth et al. (26) reported exclusive localization
to the ER membrane and to the nuclear envelope in microscopy studies
using a 11-HSD2 green fluorescent protein chimera that was expressed
in either Chinese hamster ovary cells or in Madin-Darby canine kidney
cells or in a study using a mouse polyclonal 11-HSD2 antibody to
stain rabbit kidney sections (28). In contrast, Stewart and co-workers
(32, 33) reported that approximately 40% of the total immunostaining
observed in renal collecting ducts and colonic epithelial cells is
nuclear in origin and has an intranuclear localization. In
fractionation assays they found 11-HSD2 activity in the nuclear
fraction of colon, an MR target tissue, but not placenta (34). They
suggest that the MR may be responsible for the intranuclear
localization of 11-HSD2. However, we did not observe any difference
in 11-HSD2 localization to the ER membrane in our experiments where
MR and 11-HSD2 were coexpressed in HEK-293 cells in the absence or
presence of aldosterone or cortisol. The presence of 11-HSD2 in the
nuclear fraction of cell fractionation assays can be attributed to the
expression of 11-HSD2 in the outer nuclear membrane, especially in
the early stage of protein synthesis. We have, however, no explanation
for their observation of soluble 11-HSD2 inside the nucleus. Our
results demonstrate clearly that the N-terminal sequences of both
11-HSD1 and 11-HSD2 traverse the ER membrane. The bulk of
11-HSD1 is oriented to the ER lumen, whereas its N terminus is
cytoplasmic. 11-HSD2 adopts an opposite topology with the N terminus
on the lumenal side and the catalytic domain of the protein on the
cytoplasmic side. This is supporting a model of 11-HSD2 with three
transmembrane helices (45, 48). If 11-HSD2 were to be soluble inside
the nucleus, cleavage of the N-terminal anchor would have to occur. In
that case, we would expect staining of the ER membrane and nuclear
envelope with our construct F2, but nuclear staining should be
detectable with the C-terminally tagged construct 2F. Also, attempts to
make a truncated construct without the N-terminal transmembrane part to
achieve better solubility of 11-HSD2 for the purpose of purification
failed so far, since these constructs lost activity (45,
46).2 An influence of the
FLAG epitope on the intracellular localization is unlikely since almost
identical staining patterns were observed, no matter if the FLAG
epitope was attached to the N or to the C terminus.
The signals that direct 11-HSD1 and 11-HSD2 to the ER membrane
are still unknown, and none of the two proteins contains typical ER
retrieval signals. ER retention signals often consist of a cluster of
basic residues, e.g. in C-terminal di-lysine motifs or in
N-terminal di-arginine motifs (for a review see Ref. 49). 11-HSD2
contains three regions that may be of interest, residues 278-280
(KRK), 333-337 (RPRRR), and 359-361 (RRR). Mutation of Arg337 to Cys, which was found in apparent
mineralocorticoid excess patients (21) and whose functional defect is
not understood yet, did not affect subcellular
localization.2
A study by Ozols (47) proposed that a tyrosine motif present in the
transmembrane helix of 11-HSD1 and of a 50-kDa
esterase/N-deacetylase could act as a ER-targeting signal.
When we replaced tyrosine residues 18-21 by either phenylalanine
or alanine, targeting to the ER was not affected, indicating that the
tyrosine motif is not essential for targeting.
11-HSD1 contains a di-lysine motif, consisting of residues
Lys5 and Lys6, that is in a distance from the N
terminus typically found in di-arginine motifs of type II membrane
proteins (49). Therefore, we investigated whether these two basic
residues could act as an ER-targeting signal. Mutation of
Lys5 or Lys6 to Ser did not affect subcellular
localization, showing that the di-lysine motif of 11-HSD1 does not
act as an ER-targeting signal. This is supported by the fact that the
FLAG epitope in F1 did not change the ER localization pattern even
though it changes the distance of the di-lysine motif to the N terminus
(which is critical for the function of di-arginine motifs). The ER
retention signals known to date reside on the cytoplasmic face of
proteins. However, since neither the di-lysine motif nor the tyrosine
motif seem to be essential for localization to the ER membrane, we
propose that the ER-targeting signal of 11-HSD1 is on the lumenal side.
Our experiments using selectively permeabilized cells and
immunostaining together with protease protection assays demonstrated that 11-HSD1 and 11-HSD2 insert with an opposite topology into the ER membrane. Using chimeric proteins, where the membrane anchors of
both proteins were exchanged just upstream of the beginning of the
conserved cofactor binding site, demonstrated that the transmembrane
regions are sufficient to determine their topology. The chimeric
protein 12F became protected by the ER membrane-like 1F, whereas the
domain of 21F adopted cytoplasmic orientation, like 2F. This is
supported by the lack of glycosylation products of 21F. Although
11-HSD2 contains a putative Asn-Xaa-Ser motif at position 394-396
that could serve as a glycosylation site, no glycosylation products
were detected for 12F, suggesting that this site is not accessible in
the native conformation.
According to the generally accepted "positive inside" rule
(50-54), the topology of 11-HSD2 is probably determined by the three positively charged arginine residues in the short cytoplasmic loop between the proposed helices 1 and 2 and by the three arginine residues following the third transmembrane helix. 11-HSD1 has only a
single N-terminal transmembrane segment, and it represents a suitable
model to study the determinants of membrane protein topology. The
charge distribution at the membrane suggests that the two positively
charged lysine residues on the cytoplasmic side and the two negatively
charged glutamate residues are critical for the orientation of
11-HSD1 in the ER membrane. To evaluate the importance of residues
Lys5 and Lys6, we studied mutants where lysine
was changed either to arginine, leaving the positive charge intact, or
to serine. Mutation of Lys6 did not affect the topology of
11-HSD1. In contrast, mutant K5S and K5S,K6S adopted an inverted
orientation in the ER membrane. This is shown by the accessibility of
the FLAG epitope at the C terminus of the catalytic domain to its
antibody in cells where the plasma membrane was selectively
permeabilized with digitonin (Table V). In addition, the bulk of the
protein K5S or K5S,K6S was no longer protected by the microsomal
membrane in protease protection assays. The cytoplasmic orientation of
mutants K5S and K5S,K6S is supported by the lack of glycosylation
products upon in vitro transcription and translation in the
presence of microsomes. Mutant K5R and double mutant K5R,K6R expressed
in HEK-293 cells were directed to the ER lumen, and immunostaining patterns were similar to that of 1F. However, protease protection assays revealed only partial protection of mutants K5R and K5R,K6R by
the microsomal membrane. The protected bands represented approximately 10-30% of the total protein synthesized, indicating that mutant proteins were inserted in both orientations but predominantly adopted
cytoplasmic orientation. As a possible explanation for that
discrepancy, a mechanism that controls insertion into the membrane may
exist in HEK-293 cells which is absent or not fully functional in the
rabbit reticulocyte lysate.
Our results suggest that residue Lys5 is a critical
determinant of the topology of 11-HSD1. Arginine can only partially
complement the effect of lysine, indicating that both the charge and
the side chain of Lys5 are essential for proper insertion
into the membrane. It is interesting to note that mutation of
Lys6 had no effect on the topology. Whereas
Lys5 of 11-HSD1 is conserved in all different species
known to date, Lys6 is replaced in squirrel monkey by a
threonine residue accompanied by a histidine residue. That basic
residues have a clear effect on membrane orientation of a number of
proteins with a single N-terminal transmembrane segment has been shown
by other investigators (55-63). All mutants of the di-lysine motif
showed catalytic activity comparable to that of the wild type enzyme,
except that mutant K6R had a slightly increased Km
for the oxidation of corticosterone (Table III).
Since K5S and K5S,K6S are oriented to the cytoplasm and are not
glycosylated, we also measured dehydrogenase and oxidoreductase activity using the substrates corticosterone and
11-dehydrocorticosterone in whole cell assays (Table IV). Although
previous reports indicated that 11-HSD1 functions predominantly as
an oxidoreductase in vivo (6-8), the dehydrogenase showed,
for unknown reasons, lower Km values than the
oxidoreductase in the HEK-293 expression system. The activity of mutant
K5S was similar to that of the wild type enzyme (Table IV). These
results suggest that glycosylation does not significantly alter the
activity of 11-HSD1, which is supported by the report of Ozols (9)
that endo--N-acetylglucosaminidase H treatment of
purified 11-HSD1 did not significantly affect activity. On the other
hand, other investigators reported decreased 11-HSD1 activity
following incubation with tunicamycin, an inhibitor of glycosylation,
or of proteins containing mutated glycosylation sites (4, 64).
In our experiments using intact HEK-293 cells, inversion of the
orientation of the 11-HSD1 mutant K5S did not significantly alter
its Km value (Table IV), suggesting that similar concentrations of glucocorticoids were reached in the cytoplasm and in
the ER lumen in these cells. This may be different in a specific
tissue, in vivo, where mechanisms may exist for the control of intracellular glucocorticoid concentrations. The fact that the
catalytic activity in mutants K5S and K5S,K6S was not affected by
inversion of the orientation in the ER membrane also indicates that the
membrane itself does not have an important impact on the activity of
11-HSD1. Recently, 11-HSD1 was expressed in yeast (65) and
11-HSD2 in bacteria (46). In both cases the composition of the
membrane differs from that of the corresponding native tissue, but the
kinetic parameters were not significantly different.
Furthermore, our results emphasize that the transmembrane region is
critical for 11-HSD function. The N termini of 11-HSD1 and
11-HSD2, when exchanged immediately upstream of the conserved cofactor binding site, could not functionally complement each other,
and both chimera were inactive. N-terminal deletion mutants of
11-HSD2 and a translation product of a short transcript of 11-HSD1, starting at Met27 were not catalytically active
(44). Also, mutation of the tyrosine residues in the transmembrane
segment of 11-HSD1 to alanine resulted in a loss of
Vmax. These results emphasize the essential role of the N-terminal membrane spanning region for proper function.
The impact of the differential topology of 11-HSD1 and 11-HSD2
and their restricted localization to the ER membrane on their biological functions is not fully understood. The mineralocorticoid aldosterone and the glucocorticoids cortisol and corticosterone have
similar affinities to bind to the MR (8, 66, 67). Activation of the
receptor occurs at low nanomolar concentrations. 11-HSD2 mediates
access of aldosterone to the MR by inactivating glucocorticoids in the
low nanomolar range (Km about 5 nM). One
might anticipate that for efficient protection of the MR from
glucocorticoid binding, 11-HSD2 should be localized in close
proximity to the MR and should adopt a cytoplasmic orientation. Mutations that would alter intracellular localization or topology could, therefore, lead to a loss of the protective function of 11-HSD2 on the MR even if the catalytic activity of 11-HSD2 would
not be significantly affected. On the other hand, 11-HSD1 should not
be able to modulate access of glucocorticoids to the MR efficiently,
since its catalytic domain is facing the ER lumen. In addition, the
Km of 11-HSD1 for glucocorticoids is in the high
nanomolar to micromolar range. Such high concentrations may be reached
in tissues where glucocorticoids are metabolized, like in the liver
where 11-HSD1 is highly expressed. The catalytic domain of
11-HSD1 is protruding into the ER lumen where glucocorticoids may be
metabolized and concentrated for subsequent secretion.
| |
ACKNOWLEDGEMENTS |
We are grateful to Dr. K. Plüss for the
generous gift of total RNA extracted from human aortic smooth muscle
cells. We thank Dr. Z. S. Krozowski for the gift of the human
11-HSD2 clone and to Dr. R. M. Evans for the human MR clone. We
thank Martina Hofer for excellent technical assistance and Dr. Kurt
Baltensperger for helpful advice in confocal microscopy.
| |
FOOTNOTES |
*
This work was supported by Grant 3200-050820.97 from the
Swiss National Foundation (to F. J. F.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Div. of Nephrology and
Hypertension, Dept. of Medicine, University of Berne, 3010 Berne,
Switzerland. Tel.: 41 31 632 9438; Fax: 41 31 632 9444; E-mail:
alex.odermatt@dkf2.unibe.ch.
2
A. Odermatt and P. Arnold, unpublished observations.
| |
ABBREVIATIONS |
The abbreviations used are:
11-HSD, 11-hydroxysteroid dehydrogenase;
ER, endoplasmic reticulum;
HEK, human embryonic kidney;
MR, mineralocorticoid receptor;
PAGE, polyacrylamide gel electrophoresis;
PCR, polymerase chain reaction;
DMEM, Dulbecco's modified Eagle's medium;
FITC, fluorescent
isothiocyanate.
| |
REFERENCES |
| 1.
|
Tsigelny, I.,
and Baker, M. E.
(1995)
J. Steroid Biochem. Mol. Biol.
55,
589-600[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Lakshmi, V.,
and Monder, C.
(1988)
Endocrinology
123,
2390-2398[Abstract]
|
| 3.
|
Agarwal, A. K.,
Monder, C.,
Eckstein, B.,
and White, P. C.
(1989)
J. Biol. Chem.
264,
18939-18943[Abstract/Free Full Text]
|
| 4.
|
Agarwal, A. K.,
Tusie-Luna, M. T.,
Monder, C.,
and White, P. C.
(1990)
Mol. Endocrinol.
4,
1827-1832[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Monder, C.
(1991)
FASEB J.
5,
3047-3054[Abstract]
|
| 6.
|
Voice, M. W.,
Seckl, J. R.,
Edwards, C. R. W.,
and Chapman, K. E.
(1996)
Biochem. J.
317,
621-625
|
| 7.
|
Gao, H. B.,
Ge, R. S.,
Lakshmi, V.,
Marandici, A.,
and Hardy, M. P.
(1997)
Endocrinology
138,
156-161[Abstract/Free Full Text]
|
| 8.
|
White, P. C.,
Mune, T.,
and Agarwal, A. K.
(1997)
Endocr. Rev.
18,
135-156[Abstract/Free Full Text]
|
| 9.
|
Ozols, J.
(1995)
J. Biol. Chem.
270,
2305-2312[Abstract/Free Full Text]
|
| 10.
|
Escher, G.,
Galli, I.,
Vishwanath, S.,
Frey, B. M.,
and Frey, F. J.
(1997)
J. Exp. Med.
186,
189-198[Abstract/Free Full Text]
|
| 11.
|
Kotelevtsev, Y.,
Holmes, M. C.,
Burchell, A.,
Houston, P. M.,
Schmoll, D.,
Jamieson, P.,
Best, R.,
Brown, R.,
Edwards, C. R.,
Seckl, J. R.,
and Mullins, J. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
14924-14929[Abstract/Free Full Text]
|
| 12.
|
Maser, E.,
and Oppermann, U. C.
(1997)
Eur. J. Biochem.
249,
365-369[Medline]
[Order article via Infotrieve]
|
| 13.
|
Oppermann, U. C.,
Netter, K. J.,
and Maser, E.
(1995)
Eur. J. Biochem.
227,
202-208[Medline]
[Order article via Infotrieve]
|
| 14.
|
Naray Fejes-Toth, A.,
Watlington, C. O.,
and Fejes-Toth, G.
(1991)
Endocrinology
129,
17-21[Abstract]
|
| 15.
|
Rusvai, E.,
and Naray Fejes-Toth, A.
(1993)
J. Biol. Chem.
268,
10717-10720[Abstract/Free Full Text]
|
| 16.
|
Mercer, W. R.,
and Krozowski, Z. S.
(1992)
Endocrinology
130,
540-543[Abstract]
|
| 17.
|
Escher, G.,
Vogt, B.,
Beck, T.,
Guntern, D.,
Frey, B. M.,
and Frey, F. J.
(1998)
Endocrinology
139,
1533-1539[Abstract/Free Full Text]
|
| 18.
|
Albiston, A. L.,
Obeyesekere, V. R.,
Smith, R. E.,
and Krozowski, Z. S.
(1994)
Mol. Cell. Endocrinol.
105,
R11-R17[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Edwards, C. R.,
Stewart, P. M.,
Burt, D.,
Brett, L.,
McIntyre, M. A.,
Sutanto, W. S.,
de Kloet, E. R.,
and Monder, C.
(1988)
Lancet
ii,
986-989
|
| 20.
|
Funder, J. W.,
Pearce, P. T.,
Smith, R.,
and Smith, A. J.
(1988)
Science
242,
583-585[Abstract/Free Full Text]
|
| 21.
|
Wilson, R. C.,
Krozowski, Z. S.,
Li, K.,
Obeyesekere, V. R.,
Razzaghy-Azar, M.,
Harbison, M. D.,
Wei, J. Q.,
Shackleton, C. H.,
Funder, J. W.,
and New, M. I.
(1995)
J. Clin. Endocrinol. & Metab.
80,
2263-2266[Abstract]
|
| 22.
|
Wilson, R. C.,
Harbison, M. D.,
Krozowski, Z. S.,
Funder, J. W.,
Shackleton, C. G. L.,
Hanauske-Abel, H. M.,
Wei, H. Q.,
Hertecant, J.,
Moran, A.,
Neiberger, R. E.,
Balfe, J. W.,
Fattah, A.,
Daneman, D.,
Licholai, T.,
and New, M. I.
(1995)
J. Clin. Endocrinol. & Metab.
80,
3145-3150[Abstract]
|
| 23.
|
Mune, T.,
Rogerson, F. M.,
Nikkila, H.,
Agarwal, A. K.,
and White, P. C.
(1995)
Nat. Genet.
10,
394-399[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Kotelevtsev, Y.,
Brown, R. W.,
Fleming, S.,
Kenyon, C.,
Edwards, C. R. W.,
Seckl, J. R.,
and Mullins, J. J.
(1999)
J. Clin. Invest.
103,
683-689[Medline]
[Order article via Infotrieve]
|
| 25.
|
Brown, R. W.,
Chapman, K. E.,
Edwards, C. R.,
and Seckl, J. R.
(1993)
Endocrinology
132,
2614-2621[Abstract]
|
| 26.
|
Naray-Fejes-Toth, A.,
and Fejes-Toth, G.
(1996)
J. Biol. Chem.
271,
15436-15442[Abstract/Free Full Text]
|
| 27.
|
Naray-Fejes-Toth, A.,
Colombowala, I. K.,
and Fejes-Toth, G.
(1998)
J. Steroid Biochem. Mol. Biol.
65,
311-316[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Naray-Fejes-Toth, A.,
and Fejes-Toth, G.
(1998)
Endocrinology
139,
2955-2959[Abstract/Free Full Text]
|
| 29.
|
Morita, H.,
Zhou, M.,
Foecking, M. F.,
Gomez-Sanchez, E. P.,
Cozza, E. N.,
and Gomez-Sanchez, C. E.
(1996)
Endocrinology
137,
2308-2314[Abstract]
|
| 30.
|
Mune, T.,
and White, P. C.
(1996)
Hypertension
27,
1193-1199[Abstract/Free Full Text]
|
| 31.
|
Gomez-Sanchez, E. P.,
Cox, D.,
Foecking, M.,
Ganjam, V.,
and Gomez-Sanchez, C. E.
(1996)
Steroids
61,
110-115[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Shimojo, M.,
Ricketts, M. L.,
Petrelli, M. D.,
Moradi, P.,
Johnson, G. D.,
Bradwell, A. R.,
Hewison, M.,
Howie, A. J.,
and Stewart, P. M.
|
TOP
ABSTRACT
INTRODUCTION
