J Biol Chem, Vol. 274, Issue 40, 28301-28307, October 1, 1999
Human 70-kDa SHP-1L Differs from 68-kDa SHP-1 in Its C-terminal
Structure and Catalytic Activity*
Yong-Jiu
Jin
§,
Chao-Lan
Yu¶, and
Steven J.
Burakoff
From the
Department of Pediatric Oncology,
Dana-Farber Cancer Institute and the ¶ Department of Pediatrics,
Harvard Medical School, Boston, Massachusetts 02115
 |
ABSTRACT |
The tyrosine phosphatase SHP-1 functions as a
negative regulator in hematopoietic cell development, proliferation,
and receptor-mediated cellular activation. In Jurkat T cells, a major
68-kDa band and a minor 70-kDa band were immunoprecipitated by a
monoclonal antibody against the SHP-1 protein-tyrosine phosphatase
domain, while an antibody against the SHP-1 C-terminal 19 amino acids
recognized only the 68-kDa SHP-1. The SDS-gel-purified 70-kDa protein
was subjected to tryptic mapping and microsequencing, which was
followed by molecular cloning. It revealed that the 70-kDa protein,
termed SHP-1L, is a C-terminal alternatively spliced form of SHP-1.
SHP-1L is 29 amino acids longer than SHP-1, and its 66 C-terminal amino acids are different from SHP-1. The C terminus of SHP-1L contains a
proline-rich motif PVPGPPVLSP, a potential Src homology 3 domain-binding site. In contrast to SHP-1, tyrosine phosphorylation of
SHP-1L is not detected upon stimulation in Jurkat T cells. This is
apparently due to the lack of a single in vivo tyrosine
phosphorylation site, which only exists in the C terminus of SHP-1
(Y564). COS cell-expressed glutathione S-transferase-SHP-1L
can dephosphorylate tyrosine-phosphorylated ZAP70. At pH 7.4, SHP-1L
was shown to be more active than SHP-1 in the dephosphorylation of
ZAP70. At pH 5.4, SHP-1L and SHP-1 exhibited similar catalytic
activity. It is likely that these two isoforms play different roles in
the regulation of hematopoietic cell signal transduction.
 |
INTRODUCTION |
SHP-1 (also called HCP, SHPTP1, and PTP1c) is a 68-kDa,
non-transmembrane protein-tyrosine phosphatase
(PTP)1 containing two tandem
Src homology (SH2) domains, a catalytic domain, and a C-terminal tail
of about 100 amino acid residues (1-4). Two types of SH2 containing
PTPs have been found: SHP-1 and SHP-2 (5-7). SHP-1 and SHP-2 are
approximately 60% homologous in overall protein sequence but distinct
in their biological functions (6-12). SHP-1 is expressed primarily in
hematopoietic cells and usually functions as a negative regulator in
signal transduction. SHP-2 is expressed ubiquitously and functions
predominantly as a positive regulator.
SHP-1 plays a critical biological role in the regulation of
hematopoietic cell growth and development. Motheaten mice
(me/me) and viable motheaten mice
(mev/mev) are natural
genetic models of mammals lacking the expression of functional SHP-1
(13, 14). These mice suffer from chronic macrophage and neutrophil
activation, and abnormal B cell development, as well as T and B cell
depletion and dysfunction. In me/me mice, hematopoietic
cells hyper-proliferate in response to growth factor stimulation, which
results in the enormous overexpansion of multiple hematopoietic
cell lineages. The elevated proliferation and accumulation of myeloid
cells appears to be responsible for the early death of the
me/me mice (6, 8, 15).
SHP-1 has been reported to interact with a number of receptors and
protein-tyrosine kinases, including ZAP70 (16, 17), CD3
, CD5 (18),
and interleukin-2R (19) in T cells; interleukin-3R (20), erythropoietin
receptor (21, 22) in hematopoietic cells; CD22 (23-26), B cell
receptor (27), SLP76 (28), and CD72 (29) in B cells; and the killer
cell inhibitory receptor in natural killer cells (30-34). These
interactions appear to exert primarily inhibitory effects on their
signaling cascades (35, 36). For example, thymocytes from
me/me mice hyper-proliferate in response to TCR stimulation
(18, 35). Jurkat T cells expressing a dominant negative SHP-1 (C453S)
have increased tyrosine phosphorylation upon TCR stimulation (16). Also
in Jurkat T cells, T cell receptor cross-linking or pervanadate
treatment induced the association of SHP-1 with ZAP70 kinase, resulting
in the decrease of ZAP70 kinase activity. Co-expression of SHP-1 with
ZAP70 in Sf9 cells also resulted in a dephosphorylation of ZAP70
(17).
The structures of SHP-1 and SHP-2 are similar (37, 38). The catalytic
domains are conserved in all PTPs. The tandem N-SH2 and C-SH2 domains
of SHP-1 and SHP-2 provide the docking sites for phosphorylated
tyrosine residues. Several reports have shown that a truncation of
35-49 amino acids from the C terminus of SHP-1 dramatically increases
its catalytic activity by 20-40-fold (39, 40). Interestingly,
truncation of 60 amino acids from the C terminus of SHP-1 had no affect
on SHP-1 catalytic activity. It has been hypothesized that the entire
C-terminal domain of SHP-1 contains two regions with the N-region 50 amino acid residues being critical for the activation of SHP-1, which
is blocked by the C-region 30-40 residues. On the other hand, the
catalytic activity of SHP-1 and SHP-2 is known to be negatively
regulated through an intramolecular interaction between the SH2
domain(s) and catalytic domain (37, 38). It has been shown that the engagement of the SH2 domain with an exogenous phosphotyrosyl peptide
or truncation of the SH2 domain(s) activates SHP-1 and SHP-2 (40-44).
It has also been shown that the catalytic activity of SHP-1 displays a
distinctive pH dependence (40). Escherichia coli-expressed
SHP-1 is nearly inactive at pH 7.4 as determined in vitro
using PNPP as a substrate, but is active at pH 5.4 (40). This suggests
that a more open conformation of p-nitrophenyl phosphate SHP-1 may be formed at pH 5.4. The recently published crystal structure
of the catalytic domain of SHP-1 suggests that SHP-1 needs to change
from the half-open conformation to the open conformation before it can
bind substrates (38). The full-length SHP-2 crystal structure reveals a
"closed" domain arrangement in which the two SH2 domains contour
around the catalytic domain with the N-terminal domain directly
blocking the active site (37). It is not clear whether the C-terminal
tail is involved in the folding of SHP-2, since the crystal structure
of SHP-2 is missing 66 amino acids from the C terminus. It has been
observed that, when the C-terminal 35 amino acids were truncated, SHP-1
was not further activated by phosphotyrosine peptide engagement. These
data suggest that a C-terminal truncation alone is sufficient to
activate the PTPs (40).
In this report, we described the identification of SHP-1L, a splice
isoform of SHP-1. SHP-1L contains a distinctive C terminus of 66 amino
acid residues and exhibits a high catalytic activity at physiological
pH. Thus, we suggest that this isoform may, unlike SHP-1, function in
resting cells.
 |
EXPERIMENTAL PROCEDURES |
Cells and Antibodies--
The Jurkat T cell line J77, a variant
of clone E6-1 (ATCC) was cultured in RPMI 1640 medium, and COS cells
were cultured in minimal essential medium, supplemented with 10% fetal
calf serum at 37 °C in a 5% CO2 humidified atmosphere.
Anti-phosphotyrosine (RC20), anti-SHP-1-PTP domain mAb, anti-SHP-2 mAb,
and anti-ZAP70 mAb were purchased from Transduction Laboratories
(Lexington, KY). Anti-SHP-1 C-terminal 19 AA, an anti-SHP-1 polyclonal
antibody raised to the 19 C-terminal amino acid, was purchased from
Santa Cruz Biotechnology (Santa Cruz, CA). When not specified, the mAb against the SHP-1 PTP domain was used. Anti-CD3 antibody (OKT3) was
prepared from a hybridoma obtained from the ATCC.
Immunoprecipitation and Immunoblot Analysis--
Jurkat T cells
(2 × 107) were washed and resuspended in 1 ml of PBS.
For CD3 stimulation, cells were incubated with OKT3 (2 µg/ml) for 5 min on ice, cross-linked by rabbit anti-mouse IgG (5 µg/ml) on ice
for another 5 min, then incubated at 37 °C for 3 min. For
pervanadate stimulation, cells were incubated with 1 µM
pervanadate at 37 °C for 3 min. Pervanadate was prepared by mixing
20 µl of 1 M vanadate with 11 µl of 30%
H2O2 and 69 µl of double-distilled
H2O, which was incubated at room temperature for 15 min
before use. After washing with PBS, cells were lysed in 1 ml of Nonidet
P-40 lysis buffer (1% Nonidet P-40, 150 mM NaCl, 20 mM Tris, pH 7.4, 0.5% sodium deoxycholate, 50 mM NaF, 1 mM PMSF, 1 µg/ml leupeptin, 2 µg/ml antipain) at 4 °C for 30 min. The Nonidet P-40 lysate was
centrifuged at 12,000 × g for 15 min at 4 °C.
Immunoprecipitations were carried out at 4 °C overnight or at room
temperature for 4 h with protein A-Sepharose beads. The beads were
washed twice with 0.1% Triton X-100/TBS and once with TBS. Proteins
were eluted from the beads by boiling for 5 min in 50 µl of Laemmli
reducing SDS sample buffer. Proteins from about 107 cells
were subjected to SDS-PAGE and transferred to polyvinylidene difluoride
membranes. Membrane were blocked with 3% bovine serum albumin/TBST and
incubated with antibodies in TBST for 2 h at room temperature.
Following four 15-min washes with TBST, the membranes were incubated
with second antibody for 30 min, washed three times for 5 min each with
TBST, and developed by ECL (Amersham Pharmacia Biotech).
Subcellular Fractionation of Jurkat T Cells--
After washing
in PBS, Jurkat cells (2 × 108) were incubated in 2 ml
of hypotonic buffer (42 mM KCl, 10 mM Hepes, pH
7.4, 5 mM MgCl2) for 15 min at 4 °C. The
cells were passed through a 30-gauge needle 10 times. The extract was
centrifuged at 250 × g for 10 min to remove the nuclei
and intact cells. The postnuclear supernatant was centrifuged at
150,000 × g for 30 min at 4 °C to separate the
cytoplasm from the membrane fraction.
Isolation of SHP-1L and SHP-1 Protein from Jurkat T
Cells--
Pellets from 10 liters of Jurkat T cell culture were lysed
in 50 ml of Nonidet P-40 lysis buffer. After centrifugation, the supernatants were mixed with 5 ml of ThioBond resin (PAO-agarose) pretreated according to manufacturer's instruction (Invitrogen, Carlsbad, CA). The mixture was incubated at 4 °C for 1 h, then packed into a mini-column of 20 ml. The affinity resin was then washed
with 100 ml of washing buffer (150 mM NaCl, 100 mM Tris, pH 7.4). Thio-resin-bound protein was eluted with
10 ml of the above buffer containing 200 mM
-mercaptoethanol. Column eluates were dialyzed against TBS three
times for 30 min each and adjusted to 0.5% Nonidet P-40. SHP-1 was
then immunoprecipitated by adding 100 µl of anti-SHP-1 (Transduction
Laboratories), and 200 µl of protein A beads. Immunoprecipitates were
separated in 8% SDS-PAGE and briefly stained with Coomassie Blue
before excising for microsequencing.
Tryptic Digestion, High Performance Liquid Chromatography (HPLC)
Separation, and Microsequencing--
All procedures were carried out
by the Harvard Microchemistry Facility. After in gel reduction and
S-carboxyamidomethylation, the band(s) were subjected to in
gel tryptic digestion (Promega) and a single 10% aliquot was analyzed
by mass spectrometry. Sequence information was determined by
microcapillary (75 µm × 10-cm column, packed-in house)
reverse-phase chromatography, coupled to the electrospray ionization
source of a quadrupole ion trap mass spectrometer (Finnigan LC, San
Jose, CA). The remainder (90%) of the peptide mixture was separated by
microbore high performance liquid chromatography using a Zorbax C18 1.0 mm × 150-mm reverse-phase column coupled to a Hewlett-Packard
1090 HPLC/1040 diode array detector. Optimum fractions were chosen
based on differential UV absorbance at 205, 277, and 292 nm, peak
symmetry, and resolution; then further screened for length and
homogeneity by matrix-assisted laser desorption time-of-flight mass
spectrometry. Tryptic peptides were submitted for automated Edman
degradation on a Perkin Elmer/Applied Biosystems 494A cLC protein
sequencer (Foster City, CA).
Molecular Cloning of SHP-1L--
A human Jurkat leukemia T-cell
cDNA library from CLONTECH (HL5008b) was
screened for SHP-IL cDNA, using the oligonucleotide gcttggagtctagtgcagggaccgtgg as the probe. Filters were hybridized at
52 °C in QuikHyb solution (Stratagene), washed twice by 2 × SSC, 0.1% SDS, and washed once with 0.2 × SSC, 0.1% SDS for 30 min each at 55 °C. From a total of 2 × 105 phage
plaques, 11 positive clones were obtained. The EcoRI insert was subcloned into pBluescript. Two clones containing 2.2 kilobases of
full-length cDNA were submitted for sequencing.
Construction of GST-SHP-1L Fusion Plasmid and Expression in COS
Cells--
To construct GST-SHP-1L and GST-SHP-1 fusion genes,
cDNAs encoding SHP-1 and SHP-1L were amplified by PCR with
NotI sites in both 3' and 5' primers. The PCR products were
subcloned in frame into the NotI site of pEBG. The fusion
gene structures were then confirmed by sequencing. The pEBG fusion
plasmids were transfected into COS cells by using the DEAE/dextran
method. Cells were cultured for 48 h before harvest. To isolate
the expressed GST fusion proteins, cells were washed with PBS,
incubated with hypotonic buffer for 10 min at 4 °C, and then removed
from the culture dishes. These cells were further lysed by passing
through the 30-gauge needle for 10 times. After 30 min of
centrifugation at 15,000 × g, the supernatants were
added to glutathione-Sepharose beads to absorb GST fusion protein. The
GST-SHP-1L and GST-SHP-1 proteins were eluted by 20 mM
glutathione, dialyzed, concentrated, and quantitated by UV spectrometer.
PTP Activity of GST-SHP-1L and GST-SHP-1--
To prepare
tyrosine-phosphorylated ZAP70, 200 × 106 Jurkat T cells were
treated with pervanadate, lysed, and immunoprecipitated with anti-ZAP70
mAb plus protein A beads. ZAP70 kinase/protein A-Sepharose beads were
diluted with two volumes of Sepharose beads and divided into aliquots
for dephosphorylation assay. To study the kinetics of
dephosphorylation, purified GST-SHP-1L or GST-SHP-1 was mixed with
ZAP70/protein A beads in 25 µl of pH 7.4 buffer (100 mM
Hepes, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM
-mercaptoethanol (BME) or pH 5.4 buffer (100 mM sodium acetate, pH 5.4, 150 mM NaCl, 1 mM EDTA, 1 mM BME). The reaction was stopped by
adding 1 ml of cold TBS. The beads were pelleted and boiled in SDS
sample buffer. The results were obtained by anti-Tyr(P) (RC20) immunoblotting.
 |
RESULTS |
Identification of a 70-kDa Molecule in Jurkat T Cells
Immunoprecipitated by Anti-SHP-1--
Jurkat T cell lysates were
immunoprecipitated with a mAb against the PTP domain of human SHP-1.
Two proteins with apparent molecular masses of 68 and 70 kDa were
detected upon immunoblotting (Fig.
1A). When similar
immunoprecipitations were carried out by using a polyclonal Ab raised
against the C-terminal 19 amino acids of human SHP-1, only the major
68-kDa SHP-1 band was detected. This suggested that the 70-kDa protein
might differ from the 68-kDa SHP-1 at the C terminus. To purify the
70-kDa protein, we adapted a novel approach using ThioBond resin
originally designed for affinity purification of thioredoxin fusion
proteins. The resin consists of an agarose-based support to which
phenylarsine oxide (PAO) is covalently bound. PAO is a PTP inhibitor,
which may oxidize and bind to the thiolate anion of the cysteine
residue in the PTP-reactive center, blocking the formation of a
phosphoryl-cysteine intermediate, a critical step in dephosphorylation
(45). Based on the x-ray structure of Yersinia PTP
co-crystallized with vanadate, a specific PTP inhibitor, the PTP
inhibitors are able to covalently bind to the cysteine residue in the
PTP-reactive center (46). To determine whether SH2 containing PTPs will
bind to a PAO column, Nonidet P-40 lysates of Jurkat T cells were
passed through the PAO column. Column-bound proteins were eluted by BME
and analyzed by immunoblotting. Both SHP-1 and the 70-kDa protein were
found to be in the column bound protein mixture by anti-SHP-1
immunoblotting (Fig. 1B). When re-blotted with anti-SHP-2,
SHP-2 was determined to migrate slightly slower than the 70-kDa protein
(Fig. 1B). The results indicated that SHP-1, the 70-kDa
protein, and SHP-2 all covalently bound to a PAO column and were eluted
by BME. The PAO affinity-purified protein mixture was further purified
by anti-SHP-1 immunoprecipitation (Fig. 1C). When the
relative amount of 70-kDa protein immunoprecipitated from the T cell
lysates (Fig. 1A) was compared with that
immunoprecipitated from the PAO column elutes (Fig. 1C), it
was found that the 70-kDa protein appeared to be enriched by the PAO
affinity purification, suggesting that the 70-kDa protein might have a
higher affinity than SHP-1 for PAO. The binding of SHP-1 and the 70-kDa
protein to PAO was not affected by stimulation of Jurkat T cells via
CD3 cross-linking (Fig. 1C). To determine the intracellular
localization of the 70-kDa protein, Jurkat T cells were fractionated
into membrane and cytoplasm fractions, lysed, and purified on a PAO
column, followed by SDS-PAGE and immunoblotting with anti-SHP-1. The
results showed that both SHP-1 and the 70-kDa proteins appear
predominantly in the cytosol (Fig. 1D).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
Identification and characterization of the
70-kDa protein immunoprecipitated with anti-SHP-1 Abs.
A, immunoprecipitation of SHP-1 and the 70-kDa protein from
Jurkat T cell lysates with Abs against PTP domain and against the C
terminus of SHP-1. B, immunoblot analysis of PAO column
affinity-purified proteins. The blot was first immunoblotted by using
anti-SHP-1 Ab. The same blot was then probed with anti-SHP-2.
C, immunoprecipitation of SHP-1 and the 70-kDa protein from
PAO column affinity-purified proteins. Jurkat T cells were unstimulated
( ) or stimulated by CD3 cross-linking (CD3). D,
immunoprecipitation of SHP-1 and the 70-kDa protein from subcellular
fractions of Jurkat T cells. The membrane and cytosolic fractions were
lysed in Nonidet P-40 lysis buffer, purified by PAO column, then
immunoprecipitated with anti-SHP-1. The results (A,
C, and D) were obtained by immunoblotting using
anti-SHP-1 mAb.
|
|
The 70-kDa Protein Is a C-terminal Alternatively Spliced Form of
SHP-1--
To isolate the 70-kDa protein, lysates from 10 liters of
cultured Jurkat T cells were PAO affinity-purified, then
immunoprecipitated with anti-SHP-1. Both the 68-kDa SHP-1 and 70-kDa
protein bands were excised from SDS-PAGE and subjected to trypsin
digestion. The tryptic peptides were analyzed by HPLC (Fig.
2A). The HPLC profiles from
68-kDa SHP-1 and from the 70-kDa protein appeared to be quite similar,
except that several peaks from the 70-kDa protein were distinctive.
Similar results were also obtained by mass spectrometry (data not
shown). Three peaks from HPLC and two from mass spectrometry were
collected and microsequenced (Fig. 2B). The sequencing
results showed that two distinctive peaks from the 70-kDa protein did
not match the SHP-1 sequence, whereas the other three peaks from
the 70-kDa protein matched different regions of SHP-1 (Fig.
3, A and B). These
results indicated that the 70-kDa protein shared some common regions
with SHP-1 but also contained unique regions not present in SHP-1
molecule. A GenBank search found that the DNA sequence encoding the
unique region of the 70-kDa protein is located on human chromosome
12p12-p13 connected to exon 16 of SHP-1 and that the 70-kDa protein is
generated by alternatively splicing and a reading frameshift in exon 16 of SHP-1 (Fig. 3, A and B) (2). We termed the
70-kDa protein SHP-1L, since its molecular mass appears larger than
SHP-1.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
HPLC mapping and microsequencing of tryptic
peptides from SHP-1L. A, comparison of HPLC profiles of
tryptic peptides from SHP-1 and SHP-1L. Peaks 86 and 119 of SHP-1L are
unique. B, the sequences of SHP-1L obtained from
microsequencing. +, sequence found in SHP-1; , not found in
SHP-1.
|
|

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 3.
A, schematic map of alternative splicing
between SHP-1 and SHP-1L. B, alternative splicing sites in
exon 16 of genomic SHP-1. The number 172621 indicates the
position of listed sequence in chromosome 12P12-13P locus. The
splicing sites are indicated by arrows. The C-terminal
protein sequence of SHP-1 is in italic letters.
The peptide revealed by microsequencing is underlined.
C, full-length SHP-1L protein sequence predicted by cloned
SHP-1L cDNA. The regions that have been microsequenced are in
bold letters. The unique C terminus of SHP-1L is
underlined.
|
|
To isolate the cDNA coding SHP-1L, a Jurkat cDNA library was
screened by using an oligonucleotide probe specific for the SHP-1L unique sequence. Two identical clones were identified and DNA sequenced
(GenBank accession no. AF178946). The cloned SHP-1L cDNA is
identical to human SHP-1 cDNA except for a 144-nucleotide insertion
between nucleotides 1785 and 1786 generated by alternative splicing.
Sequencing revealed the alternative splice sites of exon 16 (Fig.
3B). Due to the reading frameshift, the amino acid sequence
encoded by exon 16 of SHP-1L is entirely different from the sequence
encoded by exon 16 of SHP-1 (Fig. 3, B and C).
The cDNA predicted full-length SHP-1L amino acid sequence is shown in Fig. 3C. The open reading frame of the SHP-1L cDNA
encodes a protein of 624 amino acids, which is 29 amino acids longer
than SHP-1. The N-terminal 558 amino acids of SHP-1L are identical to
SHP-1, and the C-terminal 66 amino acids are distinct. The SHP-1L
cDNA predicts a PTP containing two contiguous SH2 domains and a PTP
domain identical to that of SHP-1. There is no sequence homology
between the C terminus of SHP-1 and SHP-1L. The C terminus of SHP-1 is
lysine-rich, whereas SHP-1L is arginine-rich. The last three amino
acids of SHP-1L are RRK, similar to the KRK of SHP-1. Within the unique
C-terminal region of SHP-1L, there exists a proline-rich motif,
PVPGPPVLSP, constituting a potential SH3 binding site, whereas it lacks
the tyrosine phosphorylation site, EDVYE, a potential SH2 domain
binding motif that exists in the C terminus of SHP-1 (47).
SHP-1L Is Predominantly Expressed in Human Hematopoietic
Tissues--
To study the cellular expression of SHP-1L, RT-PCR
analysis was carried out using two sets of oligo primers. The PCR
amplification using SHP-1L-specific primers (primer 1L) will generate a
365-bp PCR product specific for SHP-1L, while SHP-1 primer (primer I) will generate a 308-bp PCR product for SHP-1 and a 452-bp PCR product
for SHP-1L (Fig. 4A). The PCR
amplification of human Jurkat T cells and Daudi B cells generated
products with predicted sizes for SHP-1 and SHP-1L (Fig.
4B). The ratio of PCR products between SHP-1 and SHP-1L was
approximately 5 to 1. The identities of some larger PCR products
generated by the SHP-1L-specific primers are unknown. No
SHP-1L-specific PCR product was generated by SHP-1L-specific primer
(1L) from murine LSTRA T cells and WEHI B cells. Using SHP-1 primer
(I), PCR amplification from murine cell lines generated two main
products: a small 308-bp product, which is most likely from SHP-1; and
another 500-bp product, which is larger than the PCR product from human
SHP-1L. These results suggest that the alternative splicing of murine
SHP-1 mRNA may be different from that of human SHP-1.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 4.
Cellular distribution of SHP-1L in human and
murine tissues. A, schematic map of primers used in PCR
amplification for SHP-1 and SHP-1L. We used the same forward primer
5'-ctccaccaagggcctggac-3' and two different reverse primers: 1L (for
SHP-1L), 5'-ggtgcaggtcaggagacagcacaggg-3'; I (for both SHP-1 and
SHP-1L), 5'-ctcctccctcttgttcttagtgtgc-3'. B, RT-PCR
amplification of total RNAs from various human and murine cell lines.
Total RNA was prepared from 2 × 107 cultured cells
using TRIzol reagent (Life Technologies, Inc.). The reverse
transcription was done using the Superscript preamplification system
following the manufacturer's instructions (Life Technologies, Inc.).
The PCR condition was as follows: 30 s at 94 °C, 1 min at
65 °C, and 1 min at 72 °C for 30 cycles. The DNA marker used is
the 1-kilobase DNA ladder (Life Technologies, Inc.; catalog no
15615-016). C, PCR amplification of the first strand
cDNA from various human tissues. The cDNA was purchased from
CLONTECH. The PCR condition is the same as in
B, using 3' primer 1L. D, SHP-1
immunoprecipitation and immunoblot analysis of proteins from various
hematopoietic cells. mAb specific for the PTP domain of SHP-1 was used
in both immunoprecipitation and immunoblotting.
|
|
To determine the distribution of SHP-1L in various human and murine
tissues, PCR amplification was conducted using the SHP-1L-specific primers. The PCR product of 452 bp (bottom band) was generated from human peripheral blood leukocyte, spleen, and thymus tissues but
not from human colon, ovary, prostate, small intestine, and testis
tissues (Fig. 4C). Consistent with the results of PCR
amplification using the murine cell lines, SHP-1L-specific PCR product
was not amplified from various murine tissues including thymus, bone
marrow, spleen, liver, and kidney. Similar results were obtained using tissues from normal mice and from motheaten mice (data not shown).
The protein expression of SHP-1L was detected in all human
hematopoietic cell lines examined, including Jurkat T cells, Daudi B
cells, and HL60 myeloid cells. However, it was not detected in all
murine cell lines examined, including LSTRA T cells, WEHI B cells, and
BAF-3 myeloid cells, by anti-SHP-1 immunoprecipitation and immunoblot
analysis. SHP-1 protein was detected in all six cell lines
described above (Fig. 4D). It is very interesting that, in
addition to SHP-1 and SHP-1L, several other proteins of varying sizes
were co-immunoprecipitated with anti-SHP-1 from both human and murine
hematopoietic cell lysates. These co-immunuprecipitated proteins were
detected by immunoblotting with anti-SHP-1 mAb. Thus, both PCR
amplification and SHP-1 immunoprecipitation suggest the presence of
additional isoforms or family members of SHP-1/SHP-1L with distinctive
distribution in human and murine tissues.
SHP-1L Is Not Tyrosine-phosphorylated by Pervanadate Treatment in
Jurkat T Cells--
We previously reported that SHP-1 can be
tyrosine-phosphorylated at Tyr-564 by CD3 cross-linking in BYDP but not
in Jurkat T cells (47). Tyr-564 is absent in SHP-1L (Fig.
3C). Four additional tyrosine resides including Tyr-536, an
in vitro tyrosine phosphorylation site of SHP-1, are still
present in the C-terminal 129 amino acids of SHP-1L. To determine
whether SHP-1L is tyrosine-phosphorylated upon stimulation, Jurkat T
cells were stimulated either by CD3 cross-linking or by pervanadate.
After immunoprecipitation, an anti-phosphotyrosine blot indicated that
SHP-1 was not tyrosine-phosphorylated when Jurkat T cells were
stimulated by CD3 cross-linking, consistent with our previous report
(data not shown) (47). However, SHP-1 was strongly
tyrosyl-phosphorylated in Jurkat T cells when treated with 10 µM pervanadate (Fig. 5). In
contrast, SHP-1L was not tyrosine-phosphorylated in Jurkat T cells
either by CD3 cross-linking or by pervanadate treatment. Anti-SHP-1
blots indicated that both SHP-1L and SHP-1 were immunoprecipitated.
Since Tyr-564 is the only tyrosine residue missing in SHP-1L, the
results strongly suggest that Tyr-564 is the site phosphorylated
in vivo by pervanadate treatment of Jurkat T cells.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 5.
Determination of tyrosine phosphorylation of
SHP-1 and SHP-1L. The pervanadate-treated (+) or untreated ( )
Jurkat T cell lysates were PAO affinity-purified, immunoprecipitated
with anti-SHP-1, then either immunoblotted with anti-SHP-1 or with
anti-phosphotyrosine (RC20).
|
|
COS-expressed GST-SHP-1L Is More Active at pH 7.4 than SHP-1 in the
Dephosphorylation of ZAP70--
GST-SHP-1L and GST-SHP-1 fusion
plasmids were constructed using the vector pEBG, and then transfected
into COS cells. COS cells expressing GST fusion proteins were
precipitated by glutathione-Sepharose beads, eluted, and analyzed by
immunoblotting with anti-SHP-1 Abs (Fig.
6A). GST-SHP-1L appears as a
97-kDa protein, which is slightly larger than GST-SHP-1.
Tyrosine-phosphorylated ZAP-70 was used as a substrate in a
dephosphorylation assay. Its interaction with and dephosphorylation by
SHP-1 have been reported previously (16). Immunoprecipitated ZAP70 was
mixed with GST-SHP-1L (0.25 mg/ml). After incubation at 37 °C,
dephosphorylation of ZAP70 was measured by an anti-phosphotyrosine
immunoblot. Phosphorylation of ZAP70 was found to decrease rapidly
during the course of incubation (Fig. 5B). This decrease in
anti-phosphotyrosine blots was not due to the lost of ZAP70 protein, as
shown by anti-ZAP-70 immunostaining of the same blot (Fig.
6B). SHP-1 has been reported to have low activity in
vitro at pH 7.4 and is 20-30-fold more active at pH 5.4 (40). We
sought to determine whether SHP-1L is also more active at pH 5.4 than
at pH 7.4. The results were compared with that of SHP-1 (Fig.
6C). We were surprised to find that the kinetics of ZAP70
dephosphorylation by SHP-1L was similar at pH 5.4 and at pH 7.4, while
the dephosphorylation of ZAP70 by SHP-1 was found to be much faster at
pH 5.4 than at pH 7.4. In other words, SHP-1L and SHP-1 have a
comparable catalytic activity at pH 5.4, but SHP-1L is more active than
SHP-1 at pH 7.4. These data suggest that SHP-1L may be constitutively
active in vivo, and therefore may play a different role from
SHP-1 in the negative regulation of hematopoietic signal transduction
pathways.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 6.
Expression of GST-SHP-1L and GST-SHP-1 in COS
cells and the determination of their PTP activity at pH 7.4 and
5.4. A, the COS cell-expressed fusion proteins were
precipitated with glutathione beads and immunoblotted with
anti-SHP-1. B, dephosphorylation of ZAP70 by
GST-SHP-1L. Tyrosine-phosphorylated ZAP70 was immunoprecipitated, then
mixed with SHP-1L (0.25 mg/ml). After incubation at 37 °C, the
decrease of tyrosine phosphorylation of ZAP70 was determined by
anti-Tyr(P) (RC20) immunoblotting. The blot was stripped and re-blotted
with anti-ZAP70. C, comparison of dephosphorylation of ZAP70
by GST-SHP-1L (0.1 µg/ml) and by GST-SHP-1 (0.1 µg/ml) at pH 7.4 and 5.4. Experiments were carried as in B.
|
|
 |
DISCUSSION |
Here we report the identification, isolation, and cloning of a
human SHP-1 isoform that we term SHP-1L. Analysis of SHP-1L cDNA
and the genomic DNA of SHP-1 reveals that SHP-1L is generated by
alternative splicing of SHP-1 in exon 16 within chromosome 12p12-13p
locus (Fig. 3). The cloned SHP-1L cDNA predicts a protein of 614 amino acids, which is 29 amino acids longer than SHP-1, in agreement
with the 70-kDa molecular mass of SHP-1L as determined by SDS-PAGE
(Fig. 1). The N-terminal 548 amino acid residues of SHP-1L are
identical to that of SHP-1, while the C-terminal 66 amino acid residues
of SHP-1L are unique. Both SHP-1 and SHP-1L are cytosolic proteins
(Fig. 1). SHP-1L is detected predominantly in human hematopoietic
tissues and cell lines. Therefore, SHP-1L is a cytoplasmic
protein-tyrosine phosphatase expressed predominantly in human
hematopoietic tissues.
Based on its cDNA structure, SHP-1L contains two contiguous SH2
domains and a PTP domain identical to SHP-1. This predicts that SHP-1L
possesses PTP activity similar to SHP-1. The C-terminal 66 amino acids
of SHP-1L are distinct and contain a potential SH3 binding motif
PVPGPPVLSP (Fig. 3). It is known that the truncation of 35-49 amino
acids from the C terminus of SHP-1 increased the catalytic activity of
SHP-1 by 20-40-fold (39, 40). This is the region where SHP-1 and
SHP-1L diverge, suggesting that the catalytic activity of SHP-1L and
SHP-1 may be regulated differentially. Indeed, we found that SHP-1L is
more active than SHP-1 at physiological pH and that the catalytic
activity of SHP-1L is unaffected by pH change, in contrast to SHP-1
activity (Fig. 6). Whereas the mechanism of such regulation is unknown,
it is possible that the C-terminal region affects the folding between
the SH2 domain and the catalytic domain. However, SHP-1 activity is
unaffected by a larger truncation of 60 amino acids from the C terminus
(40). In trying to reconcile this observation, it has been hypothesized that the C-terminal tail of SHP-1 may be further divided into a
N-region activation motif and a C-region inhibitory motif. The C
terminus of SHP-1L contains the same putative N-region motif of SHP-1
but a different C-region motif. This may explain why the catalytic
activity of SHP-1L and SHP-1 are regulated differently.
The catalytic mechanism of PTPs involves the formation of a
phosphoryl-cysteine intermediate. The active cysteine is also the
target site of PTP inhibitors (45, 46). Our results showed that SHP-1L
was relatively enriched compared with SHP-1 after PAO affinity column
purification, suggesting that SHP-1 has a higher affinity than SHP-1
toward the protein phosphatase inhibitor PAO. This is consistent with
the observation that SHP-1L is more active than SHP-1 at pH 7.4, and
implies that SHP-1L has a different conformation from that of
SHP-1.
In Jurkat T cells, SHP-1 becomes tyrosine-phosphorylated upon
pervanadate treatment but not by CD3 cross-linking (Fig. 5). SHP-1L
lacks a potential tyrosyl phosphorylation site at Tyr-564 and is not
tyrosine-phosphorylated by either CD3 cross-linking or pervanadate
treatment. Previously, it has been demonstrated that Tyr-564 is the
only site phosphorylated in vivo in a T cell hybridoma by
co-cross-linking of CD3 with CD4 or CD8, and that the second potential
tyrosine phosphorylation site Tyr-536 could only be
tyrosine-phosphorylated in vitro by Lck (47). SHP-1L, containing Tyr-536, does not become tyrosyl-phosphorylated by pervanadate treatment, suggesting that Tyr-564 of SHP-1 is also the
only site to be tyrosyl-phosphorylated in T cells by pervanadate treatment. Recently, we reported that the tyrosine phosphorylation of
CD3-
and several protein kinases Lck, Fyn, ZAP70, and Syk was
induced by inhibition of PTPs (48). Here we provide an additional example that inhibition of PTPs triggers SHP-1 tyrosine phosphorylation.
Numerous proteins involved in the regulation of cellular signaling
contain SH2 and SH3 domains, which serve as non-catalytic modules that
regulate cellular processes by the formation of protein-protein interactions (6-12). The difference between SHP-1L and SHP-1 at their
C terminus implies that they may interact with different proteins. The phosphorylation of Tyr-564 could mediate the interaction between SHP-1 and other SH2 containing signaling molecules. The surrounding sequence of Tyr-564 is quite similar to that seen in other
signaling molecules such as the ITAM motifs of CD3
and CD3
in
which acidic (Asp, Glu) and nonpolar (Leu, Val) amino acids are
C-terminal to the phosphotyrosine. Recently a 30/32-kDa protein was
shown to associate with the C terminus of SHP-1(49). In SHP-2,
tyrosine-phosphorylated Tyr-542 and Tyr-580 in the C-terminal tail can
bind to Grb2 and the SH2 domain of SHIP (50, 51). In SHP-1L, this
region contains a proline-rich, potential SH3 domain binding motif
PVPGPPVLSP with a consensus sequence similar to the motif
PLPPLPXP preferred by the SH3 domains of Src and
Lyn (52). SHP-2 also contains a potential C-terminal SH3 binding motif
PLPPCTPTPP. The motifs found in SHP-1L and SHP-2 are similar in that
both stretch for 10 amino acids and contain five or six proline
residues, one leucine residue, and seven or eight hydrophobic residues.
It is possible that the SH3 binding motif contributes to SHP signaling
and/or specificity.
Evidence from cDNA and genomic sequencing suggest that multiple
isoforms of SH2-containing PTPs may be generated by alternative splicing of RNA transcripts. For example, a non-hematopoietic form of
SHP-1 cDNA predicts a protein containing M-L-S-R-G at its N terminus (5). This differs from the N-terminal sequence M-V-R of
hematopoietic SHP-1/SHP-1L. These two different forms were reported to
be generated by alternative usage of promoters and exon skipping (53).
Multiple isoforms of SHP-2 cDNA have also been reported (5). A
splice variant of SHP-2, found by cDNA cloning, occurs at amino
acids 549-593 (5). The expression of multiple isoforms of CD45, a
transmembrane leukocyte PTP, is highly regulated in cellular
differentiation and activation, which implies that the pattern of
isoforms expressed, is functionally important (54). Our results
demonstrate the presence of a novel isoform of SHP-1 in human
hematopoietic tissues but not in murine tissues. This raises the
question whether murine tissues have an isoform like SHP-1 that may
have similar biological function to human SHP-1.Our results from RT-PCR
amplification, anti-SHP immunoprecipitation, and immunoblotting all
suggested that SHP-1 could be alternatively spliced in murine
hematopoietic tissues, too (Fig. 4). A 66-kDa protein was detected by
anti-SHP-1 immunoprecipitation and immunoblotting in several human and
murine cell lines (Fig. 4D). Our preliminary experiments
indicated that this 66-kDa protein was not detected by immunoblotting
using the antibody against the C-terminal 19 amino acids of SHP-1 (data
not shown). Therefore, this 66-kDa protein could be a C-terminal
alternatively spliced form of SHP-1 present in both human and murine
tissues. For the first time, our report provides the direct evidence
that SHP-1 is alternatively spliced in C terminus. Further
investigation of the alternative splicing of SHP-1 may help us to
understand how the catalytic activity of SHP-1 is regulated in
hematopoietic tissues.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Benjamin G. Neel for suggesting
the use of ThioBond resin to isolate protein-tyrosine phosphatases and
for the critical reading of the manuscript. We also thank Drs. Jeff
Friedman and Bernard Callus for reading the manuscript and for helpful discussions.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant RO1 CA 70758.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF178946.
§
To whom correspondence should be addressed: Dept. of Pediatric
Oncology, Rm. M654, Dana-Farber Cancer Institute, 44 Binney St.,
Boston, MA 02115. Tel.: 617-632-5123; E-mail:
yong-jiu_jin@dfci.harvard.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
PTP, protein-tyrosine phosphatase;
SH, Src homology;
bp, base pair(s);
GST, glutathione S-transferase;
HPLC, high performance liquid
chromatography;
TBST, Tris-buffered saline with Tween 20;
mAb, monoclonal antibody;
Ab, antibody;
PAGE, polyacrylamide gel
electrophoresis;
RT, reverse transcription;
PCR, polymerase chain
reaction;
PAO, phenylarsine oxide;
BME,
-mercaptoethanol;
TBS, Tris-buffered saline;
TCR, T cell receptor;
PBS, phosphate-buffered
saline.
 |
REFERENCES |
| 1.
|
Shen, S. H.,
Bastien, L.,
Posner, B. I.,
and Chretien, P.
(1991)
Nature
352,
736-739[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Matthews, R. J.,
Bowne, D. B.,
Flores, E.,
and Thomas, M. L.
(1992)
Mol. Cell. Biol.
12,
2396-2405[Abstract/Free Full Text]
|
| 3.
|
Plutzky, J.,
Neel, B. G.,
and Rosenberg, R. D.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
1123-1127[Abstract/Free Full Text]
|
| 4.
|
Yi, T. L.,
Cleveland, J. L.,
and Ihle, J. N.
(1992)
Mol. Cell. Biol.
12,
836-846[Abstract/Free Full Text]
|
| 5.
|
Feng, G. S.,
and Pawson, T.
(1994)
Trends Genet.
10,
54-58[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Neel, B. G.
(1993)
Semin. Cell Biol.
4,
419-432[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Scharenberg, A. M.,
and Kinet, J. P.
(1996)
Cell
87,
961-964[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Bignon, J. S.,
and Siminovitch, K. A.
(1994)
Clin. Immunol. Immunopathol.
73,
168-179[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Neel, B. G.
(1997)
Curr. Opin. Immunol.
9,
405-420[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Neel, B. G.,
and Tonks, N. K.
(1997)
Curr. Opin. Cell Biol.
9,
193-204[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Streuli, M.
(1996)
Curr. Opin. Cell Biol.
8,
182-188[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Tonks, N. K.,
and Neel, B. G.
(1996)
Cell
87,
365-368[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Shultz, L. D.,
Schweitzer, P. A.,
Rajan, T. V.,
Yi, T.,
Ihle, J. N.,
Matthews, R. J.,
Thomas, M. L.,
and Beier, D. R.
(1993)
Cell
73,
1445-1454[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Tsui, H. W.,
Siminovitch, K. A.,
de Souza, L.,
and Tsui, F. W.
(1993)
Nat. Genet.
4,
124-129[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Tsui, F. W.,
and Tsui, H. W.
(1994)
Immunol. Rev.
138,
185-206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Plas, D. R.,
Johnson, R.,
Pingel, J. T.,
Matthews, R. J.,
Dalton, M.,
Roy, G.,
Chan, A. C.,
and Thomas, M. L.
(1996)
Science
272,
1173-1176[Abstract]
|
| 17.
|
Raab, M.,
and Rudd, C. E.
(1996)
Biochem. Biophys. Res. Commun.
222,
50-57[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Pani, G.,
Fischer, K. D.,
Mlinaric-Rascan, I.,
and Siminovitch, K. A.
(1996)
J. Exp. Med.
184,
839-852[Abstract/Free Full Text]
|
| 19.
|
Migone, T. S.,
Cacalano, N. A.,
Taylor, N.,
Yi, T.,
Waldmann, T. A.,
and Johnston, J. A.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
3845-3850[Abstract/Free Full Text]
|
| 20.
|
Yi, T.,
Mui, A. L.,
Krystal, G.,
and Ihle, J. N.
(1993)
Mol. Cell. Biol.
13,
7577-7786[Abstract/Free Full Text]
|
| 21.
|
Klingmuller, U.,
Lorenz, U.,
Cantley, L. C.,
Neel, B. G.,
and Lodish, H. F.
(1995)
Cell
80,
729-738[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Yi, T.,
Zhang, J.,
Miura, O.,
and Ihle, J. N.
(1995)
Blood
85,
87-95[Abstract/Free Full Text]
|
| 23.
|
Lankester, A. C.,
van Schijndel, G. M. W.,
and van Lier, R. A. W.
(1995)
J. Biol. Chem.
270,
20305-20308[Abstract/Free Full Text]
|
| 24.
|
Doody, G. M.,
Justement, L. B.,
Delibrias, C. C.,
Matthews, R. J.,
Lin, J.,
Thomas, M. L.,
and Fearon, D. T.
(1995)
Science
269,
242-244[Abstract/Free Full Text]
|
| 25.
|
Campbell, M. A.,
and Klinman, N. R.
(1995)
Eur. J. Immunol.
25,
1573-1579[Medline]
[Order article via Infotrieve]
|
| 26.
|
Law, C. L.,
Sidorenko, S. P.,
Chandran, K. A.,
Zhao, Z.,
Shen, S. H.,
Fischer, E. H.,
and Clark, E. A.
(1996)
J. Exp. Med.
183,
547-560[Abstract/Free Full Text]
|
| 27.
|
Pani, G.,
Kozlowski, M.,
Cambier, J. C.,
Mills, G. B.,
and Siminovitch, K. A.
(1995)
J. Exp. Med.
181,
2077-2084[Abstract/Free Full Text]
|
| 28.
|
Mizuno, K.,
Katagiri, T.,
Hasegawa, K.,
Ogimoto, M.,
and Yakura, H.
(1996)
J. Exp. Med.
184,
457-463[Abstract/Free Full Text]
|
| 29.
|
Adachi, T.,
Flaswinkel, H.,
Yakura, H.,
Reth, M.,
and Tsubata, T.
(1998)
J. Immunol.
160,
4662-4665[Abstract/Free Full Text]
|
| 30.
|
Burshtyn, D. N.,
Scharenberg, A. M.,
Wagtmann, N.,
Rajagopalan, S.,
Berrada, K.,
Yi, T.,
Kinet, J. P.,
and Long, E. O.
(1996)
Immunity
4,
77-85[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Campbell, K. S.,
Dessing, M.,
Lopez-Botet, M.,
Cella, M.,
and Colonna, M.
(1996)
J. Exp. Med.
184,
93-100[Abstract/Free Full Text]
|
| 32.
|
Fry, A. M.,
Lanier, L. L.,
and Weiss, A.
(1996)
J. Exp. Med.
184,
295-300[Abstract/Free Full Text]
|
| 33.
|
Olcese, L.,
Lang, P.,
Vely, F.,
Cambiaggi, A.,
Marguet, D.,
Blery, M.,
Hippen, K. L.,
Biassoni, R.,
Moretta, A.,
Moretta, L.,
Cambier, J. C.,
and Vivier, E.
(1996)
J. Immunol.
156,
4531-4534[Abstract]
|
| 34.
|
Binstadt, B. A.,
Brumbaugh, K. M.,
Dick, C. J.,
Scharenberg, A. M.,
Williams, B. L.,
Colonna, M.,
Lanier, L. L.,
Kinet, J. P.,
Abraham, R. T.,
and Leibson, P. J.
(1996)
Immunity
5,
629-638[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Lorenz, U.,
Ravichandran, K. S.,
Burakoff, S. J.,
and Neel, B. G.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
9624-9629[Abstract/Free Full Text]
|
| 36.
|
Cornall, R. J.,
Cyster, J. G.,
Hibbs, M. L.,
Dunn, A. R.,
Otipoby, K. L.,
Clark, E. A.,
and Goodnow, C. C.
(1998)
Immunity
8,
497-508[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Hof, P.,
Pluskey, S.,
Dhe-Paganon, S.,
Eck, M. J.,
and Shoelson, S. E.
(1998)
Cell
92,
441-450[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Yang, J.,
Liang, X.,
Niu, T.,
Meng, W.,
Zhao, Z.,
and Zhou, G. W.
(1998)
J. Biol. Chem.
273,
28199-28207[Abstract/Free Full Text]
|
| 39.
|
Zhao, Z.,
Bouchard, P.,
Diltz, C. D.,
Shen, S. H.,
and Fischer, E. H.
(1993)
J. Biol. Chem.
268,
2816-2820[Abstract/Free Full Text]
|
| 40.
|
Pei, D.,
Lorenz, U.,
Klingmuller, U.,
Neel, B. G.,
and Walsh, C. T.
(1994)
Biochemistry
33,
15483-15493[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Lechleider, R. J.,
Sugimoto, S.,
Bennett, A. M.,
Kashishian, A. S.,
Cooper, J. A.,
Shoelson, S. E.,
Walsh, C. T.,
and Neel, B. G.
(1993)
J. Biol. Chem.
268,
21478-21481[Abstract/Free Full Text]
|
| 42.
|
Lechleider, R. J.,
Freeman, R. M., Jr.,
and Neel, B. G.
(1993)
J. Biol. Chem.
268,
13434-13438[Abstract/Free Full Text]
|
| 43.
|
Sugimoto, S.,
Wandless, T. J.,
Shoelson, S. E.,
Neel, B. G.,
and Walsh, C. T.
(1994)
J. Biol. Chem.
269,
13614-13622[Abstract/Free Full Text]
|
| 44.
|
Townley, R.,
Shen, S. H.,
Banville, D.,
and Ramachandran, C.
(1993)
Biochemistry
32,
13414-13418[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Denu, J. M.,
Stuckey, J. A.,
Saper, M. A.,
and Dixon, J. E.
(1996)
Cell
87,
361-364[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Lorenz, U.,
Ravichandran, K. S.,
Pei, D.,
Walsh, C. T.,
Burakoff, S. J.,
and Neel, B. G.
(1994)
Mol. Cell. Biol.
14,
1824-1834[Abstract/Free Full Text]
|
| 47.
|
Denu, J. M.,
Lohse, D. L.,
Vijayalakshmi, J.,
Saper, M. A.,
and Dixon, J. E.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2493-2498[Abstract/Free Full Text]
|
| 48.
|
Jin, Y. J.,
Friedman, J.,
and Burakoff, S. J.
(1998)
J. Immunol.
161,
1743-1750[Abstract/Free Full Text]
|
| 49.
|
Yang, W.,
Tabrizi, M.,
Berrada, K.,
and Yi, T.
(1998)
Blood
91,
3746-3755[Abstract/Free Full Text]
|
| 50.
|
Xiao, S.,
Rose, D. W.,
Sasaoka, T.,
Maegawa, H.,
Burke, T. R., Jr.,
Roller, P. P.,
Shoelson, S. E.,
and Olefsky, J. M.
(1994)
J. Biol. Chem.
269,
21244-21248[Abstract/Free Full Text]
|
| 51.
|
Yamauchi, K.,
Milarski, K. L.,
Saltiel, A. R.,
and Pessin, J. E.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
664-668[Abstract/Free Full Text]
|
| 52.
|
Rickles, R. J.,
Botfield, M. C.,
Weng, Z.,
Taylor, J. A.,
Green, O. M.,
Brugge, J. S.,
and Zoller, M. J.
(1994)
EMBO J.
13,
5598-5604[Medline]
[Order article via Infotrieve]
|
| 53.
|
Banville, D.,
Stocco, R.,
and Shen, S. H.
(1995)
Genomics
27,
165-173[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Trowbridge, I. S.,
and Thomas, M. L.
(1994)
Annu. Rev. Immunol.
12,
85-116[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.