HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Miki, K. Articles by Eddy, E. M. Search for Related Content PubMed PubMed Citation Articles by Miki, K. Articles by Eddy, E. M. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 41, 29057-29062, October 8, 1999

Single Amino Acids Determine Specificity of Binding of Protein Kinase A Regulatory Subunits by Protein Kinase A Anchoring Proteins^*

Kiyoshi Miki and Edward M. Eddy

From the Gamete Biology Section, Laboratory of Reproductive and Developmental Toxicology, NIEHS, National Institutes of Health, Research Triangle Park, North Carolina 27709

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cyclic AMP-dependent protein kinase is tethered to protein kinase A anchoring proteins (AKAPs) through regulatory subunits (R) by RI-specific, RII-specific, or RI/RII dual-specific binding. Ala- and Val-scanning mutagenesis determined that hydrophobic amino acids at three homologous positions are required for binding of RI to FSC1/AKAP82 domain B and RII to AKAP Ht31. A mutation at the middle position reversed the binding specificity of both AKAPs, and mutations at this same position of the dual-specific domain A of FSC1/AKAP82 converted it into either an RI or RII binding domain. This suggests that hydrophobic amino acids at three conserved positions within the primary sequence and an amphipathic helix of AKAPs are required for cyclic AMP-dependent protein kinase binding, with the size of the aliphatic side chain at the middle position determining RI or RII binding specificity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

An important problem for the cell is how to produce a localized response to a freely diffusable signal transduction product. This is particularly true when the response involves activating one of the many protein kinases, such as a member of the cAMP-dependent protein kinase (PKA)¹ family. The PKAs usually exist as inactive tetramers containing a regulatory (R) subunit dimer and two catalytic subunits, and genes encoding four R subunits and three catalytic subunits have been identified (1-4). The type I (RI)  and type II (RII)  subunits are distributed ubiquitously, whereas RI and RII are present mainly in brain. Many hormones and other signals act through receptors to generate cAMP that binds to the R subunits of PKA, thereby releasing and activating the catalytic subunits to phosphorylate proteins.

The way cells produce a localized response to cAMP has been determined for some PKAs. They are tethered through their RII dimer to protein kinase A anchoring proteins (AKAPs) that place them in close proximity to specific organelles or cytoskeletal components (5, 6). More than 20 AKAPs have been identified that bind RII in overlay assays and localize to different subcellular compartments. The 10-14 residues comprising RII anchoring domains of AKAPs vary substantially in primary sequence, but secondary structure predictions indicate they are likely to form an amphipathic helix (7, 8). Analysis of the domain on AKAP75 by Ala-scanning mutagenesis suggested that hydrophobic amino acids with a long aliphatic side chain (e.g. Val, Leu, or Ile) participate in the binding to RII (9). NMR studies of the RII dimerization/docking domain suggested that a hydrophobic surface associates with the amphipathic helix on AKAP Ht31 (10). These and other findings (11-13) strongly suggest that hydrophobic interactions have a key role in the interactions between AKAPs and RII dimers.

Overlay assays failed to detect binding by other PKA subunits to AKAPs, but indirect evidence suggested that RI could bind to AKAPs. Comparison of the dimerization/docking domains of RI and RII indicated striking similarities (14-16), and PKA appeared to be localized by RI in skeletal muscle of RII knockout mice (17). Other studies suggested that RI could associate with the plasma membrane (18), neuromuscular junctions (19), and the sperm flagellum (20). In addition, yeast two-hybrid assays indicate that D-AKAP1/S-AKAP84 (21, 22) and D-AKAP2 (23) interact with both RI and RII.

The first direct evidence of RI binding to an AKAP was found in recent studies that identified RI-specific and RI/RII dual specificity PKA anchoring domains on FSC1/AKAP82 (24). Deletion mutagenesis and yeast two-hybrid assays were used to map the RI-specific domain to a 10-amino acid sequence likely to form an amphipathic helix. It has little significant sequence homology to RII anchoring domains and a low content of hydrophobic amino acids with a long aliphatic side chain. The binding of RI was not affected by substitution of Ser for Val³³⁹, the only hydrophobic amino acid with a long aliphatic side chain in the RI-specific domain. The sequences flanking the 10 amino acids of this domain were not essential for RI binding in the yeast two-hybrid system, strongly suggesting that the domain contains all of the information necessary to confer RI-specific binding (24). The RI/RII dual specificity domain mapped to a 14-amino acid sequence that contains 5 hydrophobic amino acids with a long aliphatic side chain, residues which frequently appear in RII anchoring domains (24).

The demonstration that RI could tether PKA to RI-specific or RI/RII dual specificity domains raised important questions about the primary and secondary structural features that determine the nature and specificity of PKA anchoring domains on AKAPs. The present studies used scanning mutagenesis of the RI-specific domain of FSC1/AKAP82 (domain B) and the putative RII-specific domain of Ht31 to demonstrate that single amino acid residues in these domains determine RI and RII binding specificity. Furthermore, point mutations introduced into the RI/RII dual specificity domain of FSC1/AKAP82 (domain A) converted it into an RI or RII preferential binding domain. These results lead us to propose that the degree and specificity of PKA binding to anchoring domains on AKAPs are determined by the size of the aliphatic side chain at a consensus position within the amphipathic helix.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Point Mutagenesis of AKAPs-- The Ht31 (GenBank^TM accession number, M90360) fragment (residues 418-540) containing the RII anchoring domain was amplified by polymerase chain reaction using a 5'-primer containing a BamHI site (CCGGGATCCATGGGTGACGCTGAGGAAGCCCA), a 3'-primer containing a SalI site (CCGGTCGACTCTCTAGTCCTTTAGTGAGAGGAC), and the HT31 cDNA cloned in pET 11d (gift of Dr. Daniel W. Carr, Veterans Affairs Medical Center, Portland, OR) as a template (24). The reaction products were digested with BamHI and SalI, ligated into plasmid pGEX-4T-1 (Amersham Pharmacia Biotech) digested with BamHI and SalI, and then transformed in Escherichia coli DH5-competent cells (Life Technologies, Inc.). This plasmid and pGEX plasmids containing FSC1 coding sequence residues 202-334 or 237-361 (24) were used as templates to introduce point mutations using the QuikChange^TM site-directed mutagenesis kit (Stratagene). Numbering of the amino acid sequence of FSC1 was that of Fulcher et al. (25). Sequencing of the targeted sites was carried out using a dRhodamine Terminator Cycle Sequencing kit (PE Biosystems) to verify that the correct mutations occurred.

In Vitro Binding Assay of PKA Regulatory Subunits-- The pull-down experiments using glutathione-Sepharose (Amersham Pharmacia Biotech) and the glutathione S-transferase (GST) expression tag system were performed as described previously (24) with the following minor changes. Testis crude extracts corresponding to 1.5 mg of protein were used for incubation with GST-FSC1 or GST-Ht31 fusion proteins immobilized on resin. Each lane of the gels received 0.5 mg of protein from the testis extracts that bound to GST-FSC1 or GST-Ht31, whereas control lanes received 5 µg of total testis extract protein. Regulatory subunits of PKA were detected by Western blotting using a monoclonal antibody against mouse RI (1:250 dilution; Transduction Laboratories, catalog number P19920) or a rabbit antiserum to mouse RII (1:1000 dilution; Santa Cruz Biotechnology, catalog number sc-909). Secondary antibodies were horseradish peroxidase-conjugated goat antiserum to mouse IgG (1:30000 dilution; Sigma) or goat antiserum to rabbit IgG (1:30000 dilution; Santa Cruz Biotechnology). All other procedures for Western blotting and chemiluminescence were performed as described previously (24).

Yeast Two-hybrid System-- The Ht31 fragment (residue 418-540) containing the RII anchoring domain was amplified as described above except the 5'-primer contained an EcoRI site (CCGGAATTCATGGGTGACGCTGAGGAAGCCCAAAT) instead of a BamHI site. The reaction products were digested with EcoRI and SalI, ligated into plasmid pAS2-1 (CLONTECH) digested with EcoRI and SalI, and then transformed in E. coli DH5-competent cells (Life Technologies, Inc.). The yeast two-hybrid system was used for analysis of interactions between an Ht31 fragment containing the RII anchoring domain and a full-length RI sequence (FC9) cloned into pGAD10 (CLONTECH) as described before (24). Transactivation of his3 and lacZ was used for the detection of protein-protein interaction.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of the Amino Acids in Domain B Responsible for RI-specific Binding-- RII binding is believed to occur by forming hydrophobic interactions (15), and domain B of FSC1/AKAP82 has similarities to RII binding domains of other AKAPs. However, the only hydrophobic amino acid present with a long aliphatic side chain (Val³³⁹) is not necessary for RI binding (24). We hypothesized that other hydrophobic amino acids in domain B (Ala, Tyr, and Met) are used to form the amphipathic helix and are involved in RI binding. This was tested using in vitro pull-down assays in conjunction with Val-scanning and Ala-scanning mutagenesis. These substitutions were made for each hydrophobic amino acid in domain B except Met³⁴⁴, where Ile was introduced. GST-FSC1 fusion proteins (residues 237-361) containing each mutation were immobilized on glutathione-Sepharose resin and incubated with crude extracts of testis to determine if they bound RI or RII.

RI binding to domain B was lost or reduced with Y335V, A336V, and A340V mutations but retained with M343V/M344I double mutations (Fig. 1a). Alanine-scanning mutagenesis done in parallel resulted in loss of RI binding with Y335A and M344A mutations but not with V339A or M343A mutations. In addition, it was found that the A340V mutation resulted in RII binding (Fig. 1a). These results have three significant implications. First, the same amino acid sequence can allow both RI and RII binding. Second, one of the four hydrophobic amino acids important for RI binding (Ala³⁴⁰) determines the specificity for RI binding. Third, the size of the hydrophobic side chains is a key factor affecting the binding and specificity of RI and RII subunits of PKA.

View larger version (46K): [in this window] [in a new window]   Fig. 1.   Critical amino acids on FSC1/AKAP82 domain B and AKAP Ht31 responsible for isoform-specific binding to RI and RII. Site-directed mutations were introduced into Fsc1 (a) and Ht31 (b) cDNA fragments containing the regulatory subunit anchoring domains. GST-tagged intact or mutant proteins were immobilized on glutathione-Sepharose resin and incubated with testis crude extracts. The proteins that bound were eluted from the resin, and 0.5-mg aliquots were separated by SDS-polyacrylamide gel electrophoresis and then analyzed by Western blotting using antisera to RI (upper panel) or RII (middle panel). Eluted proteins were visualized by Coomassie staining (lower panel). The control lanes received 5 µg of testis crude extracts not subjected to the binding assay. The position of the original and substituted amino acids are indicated in the top margin. One-letter amino acid designations are used, with the 1st letter indicating the original amino acid, the number indicating its position in the protein, and the final letter indicating the substituted amino acid. The A340P mutation that abolishes RI binding (24) is used as a negative control to demonstrate lack of nonspecific binding in this experimental system.

Identification of the Amino Acids in AKAP Ht31 Essential for RII-specific Binding-- The RII anchoring domain of Ht31 (residues 494-507) contains six amino acids with a long aliphatic side chain. We supposed that some of these amino acids function in RII-specific binding as do those of AKAP75 (9). We used Ala-scanning mutagenesis and in vitro pull-down assays to determine which of these residues are essential for RII binding and if any mutations result in RI binding (Fig. 1b). The I502A, V503A, and I507A mutations abolished RII binding. Val-scanning mutagenesis demonstrated that Ala⁴⁹⁹ also is important for RII binding. In addition, the V503A mutation resulted in RI binding, whereas binding was detected with the L494A, A498V, and V506A mutants after longer exposure to x-ray film (data not shown). RI binding to the intact Ht31 domain (Fig. 2b) was verified using a yeast two-hybrid assay (data not shown). These results indicate that significant differences occur between the amino acids required for isoform-specific binding on domain B and Ht31. However, replacement of Ala³⁴⁰ with Val resulted in RII binding to domain B, and conversely the replacement of Val⁵⁰³ with Ala resulted in RI binding to Ht31, indicating the importance of individual residues in determining isoform-specific binding.

View larger version (45K): [in this window] [in a new window]   Fig. 2.   Characterization of amino acids that determine isoform-specific binding in FSC1/AKAP82 domain B and AKAP Ht31. Point mutations were introduced into Ala340 of domain B and Val503 of Ht31, the residues that determine isoform-specific binding for domain B (a) and Ht31 (b), respectively. The degree and specificity of binding were analyzed with an in vitro pull-down assay and Western blotting, as indicated in the legend for Fig. 1.

Identification of the Amino Acid Differences Responsible for Determining Isoform-specific Binding-- The next set of studies examined the basis for differences between the amino acids required for isoform-specific binding on domain B and Ht31. Point mutagenesis and in vitro pull-down assays were used to determine if other amino acids could be substituted at the sites critical for isoform-specific binding. The binding of RI to domain B was reduced and RII binding initiated when Ala³⁴⁰ was replaced with Val or Ile (Fig. 2a). The substitution of Leu resulted in loss of binding of RI and slight RII binding. The replacement of Ala with Phe, a hydrophobic amino acid containing an aromatic side chain, or with Lys, a hydrophilic amino acid with a bulky side chain, abolished RI binding and did not lead to RII binding. These results indicate that RII binding to domain B occurs when hydrophobic amino acids with a long aliphatic side chain (e.g. Val, Ile, or Leu) are positioned at the critical location in the amphipathic helix.

Amino acid substitution was also used to analyze the critical site (Val⁵⁰³) for RII binding specificity on Ht31 (Fig. 2b). The only substitution for this amino acid that increased RI binding was Ala (V503A), whereas substitution of Ser (V503S) abolished both RII binding and the weaker RI binding. This suggests that RI binding is determined by a hydrophobic amino acid with a small side chain (e.g. Ala) at this site. Substitution of Ile (V503I) did not have a major effect on RI or RII binding, but substitution of Leu (V503L) substantially reduced RII binding. These findings and the results of mutagenesis studies on Ala³⁴⁰ of domain B indicate that RII binding occurs best when Val and Ile are present in the critical sites. These results lead us to hypothesize that binding specificity is determined by the size of the aliphatic side chain at the critical amino acid, with a small side chain specifying RI binding and a large side chain specifying RII binding.

Consensus Sequence and Secondary Structure of RI and RII Anchoring Domains-- These results allowed us to determine the consensus amino acid sequence (Fig. 3a) and predicted secondary structure (Fig. 3b) of the domain B and Ht31-anchoring sites for RI and RII. The consensus primary sequence (Fig. 3a) was determined by aligning Ala³⁴⁰ of domain B and Val⁵⁰³ of Ht31 at position 6 (shown by circles). This resulted in positions 2 and 10 containing two of the three hydrophobic amino acid residues (shown by squares) important for RI or RII binding on domain B or Ht31. Both anchoring domains contain Ala at position 2, whereas position 10 contains a hydrophobic amino acid with a bulk side chain (Met or Ile).

View larger version (33K): [in this window] [in a new window]   Fig. 3.   Comparison of the location in the peptide sequences of amino acids essential for isoform-specific binding in different AKAPs. a, the amino acids involved in RI anchoring to FSC1 domain B are aligned with those in the RII anchoring domain of Ht31. Ala340 on domain B and Val503 on Ht31 are placed at position 6. The amino acids of FSC1 domain A are also aligned with these sequences by placing Val221 at position 2. The relative position of the amino acids in the peptide sequences is indicated at the top. The position of the first and last amino acid in each peptide is indicated at the side of each sequence. The circles and squares indicate the amino acids that determine isoform specificity of binding or enhance binding, respectively. The triangle indicates the amino acid that produced greater binding to FSC1 domain A after Ala substitution. The diamond indicates the amino acid that determined RI- or RII-preferential binding to FSC1 domain A after Ala or Val substitution, respectively. b, the helical wheel projections of FSC1 domains A and B, and the AKAP domain of Ht31. The sequences were drawn as an -helix with 3.6 amino acid residues/turn, and the helix is viewed from the amino end. Hydrophobic amino acids are underlined. The relative positions of the amino acids in the peptide sequences are indicated by the numbers at the perimeter of the helical wheel projection.

The predicted secondary structure was determined using a computer software program (DNASIS^TM). A helical wheel projection of the amino acids at positions 1-10 on domain B and Ht31 was used to display their relative positions within an amphipathic helix (Fig. 3b). For an -helix viewed from the amino end, residue positions 2, 6, and 10 are seen to form a cluster. Alanine at position 2 and the hydrophobic amino acid with a bulk side chain at position 10 embrace the key residue at position 6 that determines isoform-specific binding. An additional hydrophobic amino acid with a bulk side chain is located peripherally, at position 1 for domain B and position 5 for Ht31. This suggests that positions 2, 6, and 10 on the amphipathic helix form the core of the common RI and RII binding domain, whereas the additional hydrophobic amino acids with a bulk side chain at variable peripheral positions also are required for regulatory subunit binding to each AKAP domain.

Identification of Amino Acids in Domain A Involved in RI and RII Binding-- Domain A of FSC1/AKAP82 binds both RI and RII (24, 26). This domain was analyzed next to determine the features responsible for the RI/RII dual binding capabilities and to relate them to the features of RI-specific domain B and the RII-specific Ht31 domain. A fragment of FSC1/AKAP82 (residues 202-334) containing domain A was analyzed by a combination of point mutagenesis and in vitro pull-down assays to identify the key amino acids that participate in the dual binding ability (Fig. 4). Domain A contains an Ala, but it is located at the C terminus of the putative RII binding domain (26) and seems unlikely to determine binding specificity (Fig. 3a). Therefore Ala-scanning mutagenesis was used to modify other selected hydrophobic amino acid residues in domain A. As shown in Fig. 4a, the I229A mutation abolished RII binding and did not lead to an increase but rather a slight decrease in RI binding (Fig. 4a).

View larger version (55K): [in this window] [in a new window]   Fig. 4.   Conversion of FSC1 domain A from dual-specific into RI- or RII-preferential binding domains. a and b, Ala-scanning and Val-scanning mutagenesis of FSC1 domain A were used to identify the amino acids important for RI and RII binding. Further analysis was focused on Val221 and Ser225 to verify their roles in determining binding specificity. These studies used in vitro pull-down assays and Western blotting as described in the legend for Fig. 1.

However, substitution of Ala for Val²²¹ (V221A) dramatically increased both RI and RII binding, whereas the Y220A and L227A mutations slightly increased binding by RII or both subunits, respectively. Substitution of Ser for Val²²¹ (V221S) produced a moderate increase in both RI and RII binding (Fig. 4b). These results indicate that when residue 221 is a hydrophobic amino acid with a small side chain, it enables binding of RI and RII subunits to domain A.

This information was used to compare domain A with the binding sequences determined for domain B and Ht31 (Fig. 3a). Val²²¹ was placed at position 2 on the amphipathic helix (shown by a triangle), the position of the residue critical for RI binding to domain B and RII binding to Ht31. This alignment placed Ile²²⁹ at position 10 (shown by a square), where our results indicate that a hydrophobic amino acid with a bulk side chain is required for strong RI binding to domain B or RII binding to Ht31. The alignment also placed Ser²²⁵ at position 6 (shown by a diamond, Fig. 3, a and b) where a hydrophobic amino acid (Ala, Val, Ile, or Leu) was required for isoform-specific binding to domain B or Ht31. Substitutions for Ser²²⁵ verified that this position is involved in determining isoform-specific binding (Fig. 4b). Replacement of Ser²²⁵ with Ala (S225A) did not increase RI binding, whereas replacement with Val (S225V) resulted in some RII binding.

We replaced Val²²¹ with Ala (V221A) in domain A to enhance RI and RII binding prior to further analyzing isoform specificity. A double mutation that included substitution of Ala for Ser²²⁵ (V221A/S225A) reduced RII binding, but RI binding was little changed compared with the V221A mutation (Fig. 4b). However, substitution of Val for Ser²²⁵ (V221A/S225V) dramatically enhanced RII binding and abolished RI binding induced by the V221A mutation. These results indicate that Ser²²⁵ is the key position for determining isoform-specific binding to domain A. They also demonstrate that replacement of Ser²²⁵ with Ala or Val converts the anchoring domain from one of dual specificity to an RI- or RII-preferential anchoring domain, respectively.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isoform-specific Binding and the "Three Amino Acid Rule"-- The AKAPs had been shown only to anchor PKAs by RII subunit dimers until an RI-specific and a dual binding domain for RI and RII were identified recently (21, 23, 24). This added a new dimension to the role of AKAPs in the localization and function of different PKAs at specific subcellular sites. It also raised the question of the basis for the specificity of binding of different PKA isozymes. A prominent difference between the RI and RII anchoring domains is that the RI domain has a lower content of amino acids with a long aliphatic side chain (Val, Leu, or Ile). This led us in the present study to analyze isoform-specific binding by Val- and Ala-scanning mutagenesis. We found the following: (i) hydrophobic amino acids in the anchoring domains are essential for isoform-specific binding; (ii) two amino acids required for binding are located at consensus positions 2 and 10 of an amphipathic helix, and an amino acid required for isoform-specific binding is located at consensus position 6; (iii) the amino acid at position 2 has a small side chain, and the amino acid at position 10 has a hydrophobic amino acid with a bulk side chain; and (iv) binding specificity is determined by the size of the hydrophobic side chain at position 6, with amino acids bearing a small side chain necessary for RI binding and those with a long aliphatic side chain necessary for RII binding (Fig. 5). In addition, each of the AKAP anchoring domains analyzed required distinctive hydrophobic amino acids at other positions for PKA binding. The specific requirements at positions 2, 6, and 10 indicate that these three amino acids form the basis of regulatory subunit binding. We refer to this arrangement as the three amino acid rule. However, this arrangement is necessary but not sufficient for PKA binding, and additional hydrophobic amino acids located at other position(s) are required for subunit anchoring.

View larger version (16K): [in this window] [in a new window]   Fig. 5.   Schematic model indicating the primary and secondary structural features involved in the binding of AKAPs and regulatory subunits of PKA. Strong binding is maintained by hydrophobic amino acids with a small and a bulk side chain at positions 2 and 10, respectively. Binding specificity is determined by the amino acid at position 6, where a small or a long aliphatic side chain specify RI or RII binding, respectively. This model demonstrates the basis of the three amino acid rule.

The three amino acid rule is applicable to other AKAPs. RII anchoring was eliminated by substitution of Ala for Ile⁴⁰⁵ on AKAP75 and Ala for Ile²⁴⁸ on AKAP_CE (9, 27). An alignment that places these residues at position 10 locates Ala at position 2 for both AKAPs. Furthermore, AKAP75 has a Val at position 6 as does Ht31, and AKAP_CE has a Ser at position 6 as occurs in domain A. Vijayaraghavan et al. (28) aligned AKAP110 with 14 other AKAPs and identified a consensus sequence that is consistent with the three amino acid rule. However, there are a few exceptions, including the presence of Val, a hydrophobic amino acid with a long aliphatic side chain at position 2 of domain A. Substitution of Ala at this position (V221A) dramatically increased RI and RII binding to domain A (Fig. 4), as predicted by the three amino acid rule.

Categories of AKAPs with PKA Regulatory Subunit Binding Specificity-- Ht31 was considered to be an RII-specific AKAP (29), but we found that Ht31 binds RII preferentially and RI weakly. We have also observed that AKAP79 binds RI as well as RII.² This suggests that if an anchoring domain has a hydrophobic amino acid with a long aliphatic side chain at position 6, it has RII-preferential, dual-specific binding (RII > RI). However, RI and RII showed comparable binding to domain A. We refer to this type of dual-specific binding as "neutral specificity" (RI  RII). RII-preferential, dual-specific binding may occur with D-AKAP1 and D-AKAP2, as occurs with Ht31. The neutral specificity of domain A appears to be due to the presence of Ser at position 6 instead of an Ala, Val, Ile, or Leu residue present at this position in other AKAPs.

A Key Role for Hydrophobic Interactions between AKAPs and PKA Regulatory Subunits-- The structural features of the binding site on RI and RII dimers that associate with AKAPs have been examined recently by NMR and x-ray crystallography. RI and RII have limited sequence homology, but both possess an -helical region at the N terminus that is responsible for regulatory subunit dimer formation and for docking the dimer to AKAPs (14, 15). An NMR study of the N-terminal region of RII (residues 1-44) indicated that a four-helix bundle dimerization motif with an extended hydrophobic face defined the AKAP-binding site (10). Studies using point mutagenesis of the dimerization/docking domain of RI, RII, and RII have indicated that hydrophobic amino acids with bulk side chains are required for binding to AKAPs without abolishing dimerization (11, 12, 16). These results are in agreement with our data indicating that hydrophobic interactions are a crucial factor for association between AKAPs and PKA regulatory subunits. However, Newlon et al. (10) observed NMR chemical shift changes not only for hydrophobic but also for hydrophilic amino acid residues corresponding to the dimerization/docking domain of RII upon addition of a peptide containing the Ht31 anchoring domain. Although the chemical shift changes could result from structural changes upon binding of the Ht31 peptide, we cannot exclude the possibility that hydrophilic amino acids of AKAP anchoring domains have direct contact with regulatory subunits and modulate binding affinity and/or specificity.

An Amphipathic Helix Can Represent a Hydrophobic Surface for Specific Binding-- Protein-protein binding depends upon different molecular interactions, including ionic, hydrophilic, and hydrophobic interactions. Alanine-scanning mutagenesis is widely used to evaluate the function of intermolecular and intramolecular hydrophobic interactions (9, 30, 31). When protein interactions are disturbed by an Ala substitution, they are likely due to hydrophobic interactions. An unexpected finding of the present study was that Val-scanning mutagenesis revealed indispensable functions of Ala residues other than forming hydrophobic bonds. These results indicated that (i) protein interactions can be defined by the nature of the hydrophobic face, (ii) binding specificity can be determined by a single amino acid based on the size of the side chain, (iii) and Val-scanning mutagenesis is useful for identifying the function of a small hydrophobic side chain on an amphipathic helix.

Hydrophobic protein interactions also occur between leucine zipper motifs, with the hydrophobic amino acids arrayed in an -helix that forms a line of long aliphatic groups (32). An amphipathic helix has a similar secondary structure but bears a hydrophobic face rather than a hydrophobic line. It appears that an advantage of the amphipathic helix is that it provides the opportunity for a variety of protein interactions to occur with different affinities and specificities. The isoform-specific binding of AKAPs leads us to hypothesize that the selection of a binding partner to an amphipathic helix is due to modulation of the binding surface by a change in the combination of hydrophobic amino acids with differently sized residues.

AKAPs and the Localization and Function of PKA Isozymes-- Although more than 20 AKAPs have been reported in different tissues and species, there are still many questions about their roles in cells. In most cases the target proteins of the PKAs anchored by AKAPs are unknown, other proteins associated with AKAPs have not been identified, isoform-specific functions for RI and RII have not been determined, and the reasons for specific binding of RI or RII to AKAPs remain to be determined. The information gained in the current study should be useful for addressing some of these questions. The three amino acid rule forms the basis for testing the role of anchoring domains in other AKAPs. It will be informative to determine if the introduction of point mutations to abolish binding or to modify binding specificity of particular AKAPs in vivo causes physiological changes or different response to hormones and growth factors. This approach in conjunction with NMR and x-ray crystallography can be expected to give insight into the nature and role of interactions between AKAPs and PKA regulatory subunits at specific times and locations within cells and organisms.

	ACKNOWLEDGEMENTS

We thank Dr. Daniel W. Carr for providing the Ht31 cDNA. We also thank Dr. Yoshimitsu Kakuta and Deborah R. Blizard for helpful discussions.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: LRDT, MD C4-01, NIEHS, National Institutes of Health, 111 T. W. Alexander Dr., Research Triangle Park, NC 27709. Tel.: 919-541-3015; Fax: 919-541-3800; E-mail: eddy@niehs.nih.gov.

² K. Miki and E. M. Eddy, unpublished results.

	ABBREVIATIONS

The abbreviations used are: PKA, cAMP-dependent protein kinase; R, regulatory; RI, regulatory subunit type I; RII, regulatory subunit type II; AKAP, A-kinase anchoring protein; GST, glutathione S- transferase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				F. Kuroda, J. Moss, and M. Vaughan Regulation of brefeldin A-inhibited guanine nucleotide-exchange protein 1 (BIG1) and BIG2 activity via PKA and protein phosphatase 1{gamma} PNAS, February 27, 2007; 104(9): 3201 - 3206. [Abstract] [Full Text] [PDF]

				L. L. Burns-Hamuro, Y. Hamuro, J. S. Kim, P. Sigala, R. Fayos, D. D. Stranz, P. A. Jennings, S. S. Taylor, and V. L. Woods Jr. Distinct interaction modes of an AKAP bound to two regulatory subunit isoforms of protein kinase A revealed by amide hydrogen/deuterium exchange Protein Sci., December 1, 2005; 14(12): 2982 - 2992. [Abstract] [Full Text] [PDF]

				Z. Huang, P. R. Somanath, R. Chakrabarti, E. M. Eddy, and S. Vijayaraghavan Changes in Intracellular Distribution and Activity of Protein Phosphatase PP1{gamma}2 and Its Regulating Proteins in Spermatozoa Lacking AKAP4 Biol Reprod, February 1, 2005; 72(2): 384 - 392. [Abstract] [Full Text] [PDF]

				G. K. Carnegie and J. D. Scott A-kinase anchoring proteins and neuronal signaling mechanisms Genes & Dev., July 1, 2003; 17(13): 1557 - 1568. [Full Text] [PDF]

				P. R. Brown, K. Miki, D. B. Harper, and E. M. Eddy A-Kinase Anchoring Protein 4 Binding Proteins in the Fibrous Sheath of the Sperm Flagellum Biol Reprod, June 1, 2003; 68(6): 2241 - 2248. [Abstract] [Full Text] [PDF]

				N. M. Alto, S. H. Soderling, N. Hoshi, L. K. Langeberg, R. Fayos, P. A. Jennings, and J. D. Scott Bioinformatic design of A-kinase anchoring protein-in silico: A potent and selective peptide antagonist of type II protein kinase A anchoring PNAS, April 15, 2003; 100(8): 4445 - 4450. [Abstract] [Full Text] [PDF]

				S. Kammerer, L. L. Burns-Hamuro, Y. Ma, S. C. Hamon, J. M. Canaves, M. M. Shi, M. R. Nelson, C. F. Sing, C. R. Cantor, S. S. Taylor, et al. Amino acid variant in the kinase binding domain of dual-specific A kinase-anchoring protein 2: A disease susceptibility polymorphism PNAS, April 1, 2003; 100(7): 4066 - 4071. [Abstract] [Full Text] [PDF]

				H. Li, R. Adamik, G. Pacheco-Rodriguez, J. Moss, and M. Vaughan Protein kinase A-anchoring (AKAP) domains in brefeldin A-inhibited guanine nucleotide-exchange protein 2 (BIG2) PNAS, February 18, 2003; 100(4): 1627 - 1632. [Abstract] [Full Text] [PDF]

				A. Affaitati, L. Cardone, T. de Cristofaro, A. Carlucci, M. D. Ginsberg, S. Varrone, M. E. Gottesman, E. V. Avvedimento, and A. Feliciello Essential Role of A-kinase Anchor Protein 121 for cAMP Signaling to Mitochondria J. Biol. Chem., January 31, 2003; 278(6): 4286 - 4294. [Abstract] [Full Text] [PDF]

				P. L. Kultgen, S. K. Byrd, L. E. Ostrowski, and S. L. Milgram Characterization of an A-Kinase Anchoring Protein in Human Ciliary Axonemes Mol. Biol. Cell, December 1, 2002; 13(12): 4156 - 4166. [Abstract] [Full Text] [PDF]

				R. L. Brown, T. Ord, S. B. Moss, and C. J. Williams A-Kinase Anchor Proteins as Potential Regulators of Protein Kinase A Function in Oocytes Biol Reprod, September 1, 2002; 67(3): 981 - 987. [Abstract] [Full Text] [PDF]

				K. Miki and E. M. Eddy Tumor Necrosis Factor Receptor 1 Is an ATPase Regulated by Silencer of Death Domain Mol. Cell. Biol., April 15, 2002; 22(8): 2536 - 2543. [Abstract] [Full Text] [PDF]

				H. Li, B. Degenhardt, D. Tobin, Z.-x. Yao, K. Tasken, and V. Papadopoulos Identification, Localization, and Function in Steroidogenesis of PAP7: A Peripheral-Type Benzodiazepine Receptor- and PKA (RI{alpha})-Associated Protein Mol. Endocrinol., December 1, 2001; 15(12): 2211 - 2228. [Abstract] [Full Text] [PDF]