Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pomiès, P.
Right arrow Articles by Beckerle, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pomiès, P.
Right arrow Articles by Beckerle, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 41, 29242-29250, October 8, 1999


Purification and Characterization of an alpha -Actinin-binding PDZ-LIM Protein That Is Up-regulated during Muscle Differentiation*

Pascal Pomiès, Teresita Macalma, and Mary C. BeckerleDagger

From the Department of Biology, University of Utah, Salt Lake City, Utah 84112

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

alpha -Actinin is required for the organization and function of the contractile machinery of muscle. In order to understand more precisely the molecular mechanisms by which alpha -actinin might contribute to the formation and maintenance of the contractile apparatus within muscle cells, we performed a screen to identify novel alpha -actinin binding partners present in chicken smooth muscle cells. In this paper, we report the identification, purification, and characterization of a 36-kDa smooth muscle protein (p36) that interacts with alpha -actinin. Using a variety of in vitro binding assays, we demonstrate that the association between alpha -actinin and p36 is direct, specific, and saturable and exhibits a moderate affinity. Furthermore, native co-immunoprecipitation reveals that the two proteins are complexed in vivo. p36 is expressed in cardiac muscle and tissues enriched in smooth muscle. Interestingly, in skeletal muscle, a closely related protein of 40 kDa (p40) is detected. The expression of p36 and p40 is dramatically up-regulated during smooth and skeletal muscle differentiation, respectively, and p40 colocalizes with alpha -actinin at the Z-lines of differentiated myotubes. We have established the relationship between p36 and p40 by molecular cloning of cDNAs that encode both proteins and have determined that they are the products of a single gene. Both proteins display an identical N-terminal PDZ domain and an identical C-terminal LIM domain; an internal 63-amino acid sequence present in p36 is replaced by a unique 111-amino acid sequence in p40. Analysis of the sequences of p36 and p40 suggest that they are the avian forms of the actinin-associated LIM proteins (ALPs) recently described in rat (Xia, H., Winokur, S. T., Kuo, W.-L., Altherr, M. R., and Bredt, D. S. (1997) J. Cell Biol. 139, 507-515). The expression of the human ALP gene has been postulated to be affected by mutations that cause facioscapulohumeral muscular dystrophy; thus, the characterization of ALP function may ultimately provide insight into the mechanism of this disease.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In vertebrates, there are three types of muscle: skeletal, cardiac, and smooth, that contract by an actin- and myosin-dependent mechanism. Locomotion depends on the ability of skeletal muscle to contract rapidly, blood circulation depends on cardiac muscle contraction, and involuntary movements such as peristalsis of the gastrointestinal tract depend on smooth muscle function. In skeletal and cardiac muscle cells, the contractile apparatus is organized into functional units called sarcomeres, each of which is bordered by a structure known as the Z-disc. The Z-discs serve to anchor the actin filaments at the ends of the sarcomere. In smooth muscle cells, the actin- and myosin-rich contractile machinery is organized quite differently; rather than appearing in semicrystalline sarcomeric arrays, the contractile elements are obliquely organized. The smooth muscle contractile apparatus exhibits no Z-discs but instead has two other structures, dense bodies and dense plaques, that are thought to anchor and integrate the actin filaments within the muscle cells (2). Z-discs, dense bodies, and dense plaques thus appear to play parallel, central roles in muscle cytoarchitecture and function. Perhaps not surprisingly, given their similar roles in different muscle types, Z-discs, dense bodies and dense plaques are all enriched in alpha -actinin, a major structural protein present in all muscle cells (3, 4).

alpha -Actinin is an actin filament cross-linking protein that exists as an antiparallel homodimer in muscle and nonmuscle cells (5, 6). In nonmuscle cells, alpha -actinin is found periodically along the actin stress fibers, where it is thought to be involved in bundling actin thin filaments into stress fibers (7). Nonmuscle alpha -actinin is also present at the ends of the stress fibers, in focal adhesions, where it binds the cytoplasmic domain of the integrin beta 1 subunit, an observation that suggests a molecular mechanism by which alpha -actinin might link microfilaments to the cell membrane (8, 9). alpha -Actinin also appears to play a key role in organizing the actin machinery in muscle; for example, high resolution electron microscopic analyses have illustrated that, in the Z-discs of striated muscle, alpha -actinin forms cross-links that anchor actin filaments (10, 11).

Genetic studies have clarified substantially the central role of alpha -actinin in muscle structure and function. In Drosophila, alpha -actinin loss-of-function mutations perturb Z-disc integrity and disrupt myofibrillar attachments to tendon cells (12, 13). These structural abnormalities are associated with reduced muscle function and lead to progressive paralysis and larval lethality (12). Certain weaker alpha -actinin alleles affect the morphology and function of thoracic muscles, leading to a flightless phenotype (12). It appears that, in Drosophila, alpha -actinin is not absolutely required for the assembly of the contractile machinery during development, since embryogenesis proceeds normally. Rather, alpha -actinin appears to play a critical role in anchoring and stabilizing the contractile filaments against the forces of muscle contraction.

alpha -Actinin-rich structures also perform critical functions in muscle of the nematode Caenorhabditis elegans. In C. elegans, actin filaments of the body wall muscle cells are attached to the plasma membrane through alpha -actinin-rich structures called dense bodies (14). The function of the dense bodies resembles that of the Z-lines and the dense plaques of the vertebrate striated and smooth muscles, respectively. Although mutations in the C. elegans gene encoding alpha -actinin have not been described, mutations that affect other dense body constituents have been characterized. For example, nematode dense bodies contain vinculin and worms that lack vinculin function display disorganized muscle and are paralyzed (15). Thus, a defect in the organization of the alpha -actinin-rich dense bodies compromises muscle cytoarchitecture and function.

Despite the well established and apparently universal importance of alpha -actinin-rich structures for the subcellular organization and function of diverse muscle types, little is known about other proteins that cooperate with alpha -actinin in the establishment and maintenance of the contractile machinery. In order to better understand the molecular mechanism by which alpha -actinin participates in the stabilization of the contractile elements during muscle contraction, we sought to identify novel alpha -actinin-binding partners. Here we report the identification, purification, and characterization of a 36-kDa alpha -actinin-binding partner (p36) that is expressed in cardiac and smooth muscle. By a variety of binding studies, we demonstrate that the association of p36 with alpha -actinin is direct, specific, and saturable. We have also identified a higher molecular weight isoform, called p40, that is expressed exclusively in skeletal muscle and is colocalized with alpha -actinin at the Z-lines. Furthermore, the expression of both p36 and p40 is induced upon muscle differentiation, raising the possibility that these cytoskeletal PDZ-LIM proteins play a critical role in the organization of actin filament arrays within muscle cells. Characterization of the domain structures of p36 and p40 has revealed the presence of an N-terminal PDZ domain (16) and a C-terminal LIM domain (17) in each protein. Sequence analysis revealed that the proteins described here are likely to be the avian homologues of the actinin-associated LIM protein (ALP),1 a candidate for the protein affected in facioscapulohumeral muscular dystrophy (1).

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Protein Purification and Microsequencing-- Frozen chicken gizzards were used to extract avian smooth muscle proteins as described previously (18). Proteins present in the extract were precipitated with increasing amounts of ammonium sulfate: 0-15%, 15-27%, 27-34%, 34-43%, and 43-61% saturation. alpha -Actinin was purified from the 27-34% ammonium sulfate precipitate (19).

The 36-kDa alpha -actinin-binding partner, called p36, was purified from the 15-27% ammonium sulfate precipitate. All the different purification steps were performed at 4 °C. The ammonium sulfate precipitate was resuspended in 20 ml of buffer B10 (20 mM Tris acetate, pH 7.6, 10 mM NaCl, 0.1 mM EDTA, 0.1% 2-mercaptoethanol) and dialyzed overnight against buffer B10. The mixture of proteins was loaded on an 11 × 2-cm DEAE-cellulose column (Whatman) equilibrated with buffer B10. The proteins that fail to bind the matrix were applied to a 9 × 2-cm CM-cellulose column (Whatman) equilibrated in buffer B10. The bound proteins were eluted with a 200-ml linear gradient of 0-300 mM KCl prepared in buffer B10.

Purified p36 was electrophoresed on 15% polyacrylamide gels and transferred to polyvinylidine difluoride membranes (Immobilon-P, Millipore Corp., Bedford, MA). Ponceau S-stained, excised p36 bands were prepared and subjected to proteolytic cleavage using trypsin according to the procedure described by Fernandez et al. (20). The proteolytic peptides were resolved by high pressure liquid chromatography using a reverse phase C-18 column (Waters Chromatography Division, Milford, MA). Sequence analysis of intact p36 or individual peptides was performed on a 477A protein sequencer (Applied Biosystems, Inc., Foster City, CA).

Protein Radioiodination and Blot Overlay Assay-- Purified alpha -actinin was radiolabeled using Na125I (ICN Pharmaceuticals Inc., Costa Mesa, CA) as described previously (19, 21). The purity of the radioiodinated protein was evaluated by SDS-PAGE followed by autoradiography.

Blot overlay assays were performed using the method described previously (19). Briefly, proteins were resolved by SDS-PAGE and transferred to nitrocellulose, and the nitrocellulose strips were incubated for 4 h in the presence of 250,000 cpm/ml of [125I]alpha -actinin. In the competition experiment using radioiodinated alpha -actinin, a 2,000-fold molar excess of competing protein (alpha -actinin or BSA) was added to the blot overlay buffer. Nitrocellulose membranes were then subjected to autoradiography at -80 °C with an intensification screen.

Gel Electrophoresis and Western Immunoblotting-- Protein fractions were separated by SDS-PAGE according to the method of Laemmli (22) except with a bisacrylamide concentration of 0.13%. 12.5 or 15% polyacrylamide gels were used in this paper.

For Western immunoblotting, proteins were resolved by SDS-PAGE and transferred to nitrocellulose. Rabbit polyclonal antibodies raised against chicken p36 (K55) or chicken alpha -actinin (provided by K. Burridge) were used, followed by horseradish peroxidase linked to protein A (Amersham Pharmacia Biotech). Immunodetection was enhanced using chemiluminescent techniques (ECL, Amersham Pharmacia Biotech).

Solid-phase Binding Assay-- Solid-phase binding experiments were performed in removable microtiter wells as described previously (21), except that the wells were coated with purified chicken p36 at 0.1 mg/ml. The [125I]alpha -actinin used in these experiments was radioiodinated to a specific activity of 23.5 × 106 cpm/µg. A constant amount of [125I]alpha -actinin (0.09 pmol) was incubated for 2.5 h in p36-coated wells with increasing amounts of competing proteins, unlabeled alpha -actinin, or BSA. After washes, the bound counts were determined using a Packard Multi-Prias 1 gamma -counter (Packard Instrument Co. Inc., Meriden, CT).

Determination of Stokes' Radius and Relative Sedimentation Coefficient-- The Stokes' radius of the purified chicken p36 was estimated by calibrated gel filtration chromatography. The purified protein or the gel filtration standards were applied to a Sepharose CL-6B (Amersham Pharmacia Biotech) column (1 m × 1.2 cm), equilibrated in buffer B+ (20 mM Tris acetate, pH 7.6, 140 mM NaCl, 0.1 mM EDTA, 0.1% 2-mercaptoethanol). The gel filtration standards used to calibrate the column were albumin (3.55 nm), ovalbumin (3.05 nm), and myoglobin (1.91 nm) from Amersham Pharmacia Biotech.

The relative sedimentation coefficient of the purified chicken p36 was determined by sucrose density gradient centrifugation as described previously (18). The sucrose gradients were prepared in buffer B+. The standard proteins used in these experiments were albumin (4.3 S), ovalbumin (3.6 S), and carbonic anhydrase (2.8 S) from Bio-Rad.

The native molecular mass and the frictional ratio of p36 were calculated as described by Siegel and Monty (23) using a value of 0.711 cm3/g for the partial specific volume; the partial specific volume of p36 was calculated based on the protein's amino acid sequence described below.

Cell Culture-- Chicken embryo fibroblasts (CEF) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. The C2C12 myogenic cell line was grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 10% horse serum (growth medium). C2C12 differentiation was induced by transferring the cells into Dulbecco's modified Eagle's medium supplemented with 2% horse serum (differentiation medium).

Antibody Production and Confocal Immunofluorescence Microscopy-- The rabbit polyclonal antibody, K55, was raised against purified chicken p36. Double label indirect immunofluorescence of CEF cells was performed as described previously (24). CEF cells were cultured either on glass coverslips for 24 h (spread cells) or on fibronectin-coated glass coverslips for 15 min (spreading cells). For immunostaining, we used the anti-p36 polyclonal antibody (K55) followed by an FITC-conjugated goat anti-rabbit secondary antibody (Jackson Immunoresearch Laboratories Inc., West Grove, PA) and an anti-alpha -actinin monoclonal antibody (ICN Pharmaceuticals Inc.) followed by a Texas Red-conjugated goat anti-mouse secondary antibody (Jackson Immunoresearch Laboratories). C2C12 cells were cultured on glass coverslips for 6 days in differentiation medium, and immunocytochemistry was performed as described by Arber et al. (25). The same primary and secondary antibodies used for immunostaining of the CEF cells were used for the C2C12 cells, except that alpha -actinin was detected with a monoclonal anti-sarcomeric alpha -actinin antibody (Sigma). Cells were observed on a confocal laser scanning microscope (Bio-Rad) with an optical section height of 1 µm.

Immunoprecipitation-- Immunoprecipitation experiments were performed as described previously (21). Briefly, CEF cells were lysed in radioimmune precipitation buffer (10 mM Tris, pH 8, 140 mM NaCl, 1% Triton X-100, 0.2% deoxycholate, 0.02% SDS, 0.1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, 1 µg/ml pepstatin A, 1 µg/ml phenantholine) and scraped off the dish. After a 30-min incubation on ice, the lysate was centrifuged at 10,000 rpm for 10 min. The supernatant was incubated with protein A-agarose beads (Sigma) for 1 h at 4 °C and centrifuged for 2 min at 2,000 rpm. The supernatant was then incubated for 1 h at 4 °C with either 3 µl of the anti-p36 antibody (K55) or 3 µl of the corresponding preimmune serum, followed by a 1.5-h incubation with protein A-agarose beads. The beads were washed five times with the lysis buffer, resuspended in 30 µl of 2× Laemmli sample buffer, and boiled for 5 min. The immunoprecipitated proteins were resolved by SDS-PAGE and analyzed by Western immunoblotting.

Embryonic Chicken Tissue Lysate Preparation-- Protein extracts were obtained from chicken embryo tissues as described previously (24, 26). Protein samples from 19-day-old chicken embryos were used in the tissue distribution experiment, whereas arteries from 11-, 13-, 15-, and 18-day old chicken embryos were used in the developmental time course experiment. Briefly, 5 ml of distilled H2O plus 1 mM phenylmethylsulfonyl fluoride was used to homogenized 1 g of each tissue (wet weight). Samples were resuspended in 2× Laemmli sample buffer, and the DNA was sheared. Samples were then boiled for 4 min, and 10 µl of each were loaded onto a gel.

Isolation of Chicken p36 and p40 cDNAs-- mRNA was isolated from CEF cells using the Oligotex Direct mRNA kit (Quiagen Inc., Santa Clarita, CA). First strand cDNAs were generated from the CEF mRNAs using the T-Primed First-Strand kit (Amersham Pharmacia Biotech). Two degenerate primers were synthesized based on two peptide sequences, GIDFNQ (aa 20-25) and FKPIGTA (aa 112-118), obtained by microsequencing of the purified chicken p36. These degenerate primers were used to amplify a 296-bp DNA fragment from the cDNAs. Bases on the sequence of this fragment, two new primers (CCAGCCTTTGATCATAACCAGG and GCTTGAATTCCTGTGGTTCAGC) that corresponded to internal sequence were synthesized and were used to amplify a 269-bp DNA fragment from the 296-bp fragment. Using the 269-bp DNA fragment, we screened 1,000,000 recombinant phage from a total chicken embryo cDNA library (CLONTECH Laboratories Inc., Palo Alto, CA) and obtained five positive clones. Two of the five positive plaques were isolated, purified, and sequenced on both strands. Sequence analysis reveals that the two cDNAs encode proteins that are identical, except in a central region of the proteins; we conclude that the two cDNAs encode the p36 and p40 isoforms that we have detected immunologically.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A Direct and Specific Interaction between alpha -Actinin and a 36-kDa Protein-- In order to understand more precisely the cellular mechanisms involved in the assembly of the actin-based cytoskeleton during myogenesis, we have initiated an effort to identify alpha -actinin-binding partners in muscle cells using a blot overlay assay. Proteins extracted from avian smooth muscle were fractionated by precipitation with increasing amounts of ammonium sulfate (0-15, 15-27, 27-34, 34-43, and 43-61% saturation). Proteins present in each of these fractions were resolved by SDS-PAGE (Fig. 1A). A similar gel was transferred to nitrocellulose and probed with radioiodinated alpha -actinin (Fig. 1B). The radioiodinated alpha -actinin interacts directly with two proteins. The 23-kDa protein present primarily in the 34-43% ammonium sulfate precipitate (Fig. 1B, lane 4') is CRP1, a LIM protein that we have previously characterized as a binding partner for alpha -actinin (21, 27). A second polypeptide identified in the screen is present in the 15-27% precipitate (Fig. 1B, lane 2') and migrates at a molecular mass of 36 kDa (hereafter called p36). The purity of the alpha -actinin probe used in this experiment is shown in Fig. 1C.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1.   A direct and specific interaction between alpha -actinin and a 36-kDa protein. A, a Coomassie Blue-stained gel showing the molecular mass markers (M) and the protein composition of a 0-15% (lane 1), a 15-27% (lane 2), a 27-34% (lane 3), a 34-43% (lane 4), and a 43-61% (lane 5) ammonium sulfate precipitate from an avian smooth muscle extract. B, autoradiograph of a parallel gel transferred to nitrocellulose and probed with [125I]alpha -actinin. The radioiodinated alpha -actinin binds to CRP1 and to a 36-kDa protein (p36) present in the 15-27% precipitate. C, autoradiograph showing the radioiodinated alpha -actinin probe. D, a Coomassie Blue-stained gel showing the molecular mass markers (M) and the 15-27% ammonium sulfate precipitate containing p36. Autoradiographs of similar gels transferred to nitrocellulose strips and probed with [125I]alpha -actinin in the absence of competing protein (E) or in the presence of a 2,000-fold molar excess of unlabeled alpha -actinin (F) or BSA (G). alpha -A, alpha -actinin.

In an effort to analyze the specificity of the alpha -actinin-p36 interaction, we performed a competition experiment. The smooth muscle-derived proteins contained in the 15-27% precipitate were resolved by SDS-PAGE (Fig. 1D). Similar gels were transferred to nitrocellulose, and the nitrocellulose strips were incubated with radioiodinated alpha -actinin in the absence of competing protein (Fig. 1E) or in the presence of an excess of unlabeled alpha -actinin (Fig. 1F) or BSA (Fig. 1G). As shown in Fig. 1B, the radioiodinated alpha -actinin interacts directly with p36. Furthermore, the binding of [125I]alpha -actinin to p36 is effectively eliminated in the presence of unlabeled alpha -actinin but not in presence of an equimolar amount of BSA. Taken together, these experiments show a direct and specific interaction between the actin-binding protein, alpha -actinin, and a 36-kDa protein expressed in smooth muscle cells.

Purification and Properties of p36 from Avian Smooth Muscle-- In order to characterize the properties of p36 in greater detail, we developed a method for purifying native protein from smooth muscle. A 15-27% ammonium sulfate precipitate from an avian smooth muscle extract, which is enriched in p36 (see Fig. 1), was used as starting material for the purification of p36. Briefly, proteins present in the 15-27% ammonium sulfate precipitate (Fig. 2A, lane 1) were applied to a DEAE-cellulose column, and the proteins that fail to bind this matrix (Fig. 2A, lane 2) were subjected to chromatography on CM-cellulose. The bound proteins were eluted with a linear gradient of NaCl, and the fractions containing p36 were pooled (Fig. 2A, lane 3). The p36 was purified to apparent homogeneity at this stage. To verify that the 36-kDa protein obtained after these conventional chromatographic techniques was the alpha -actinin-binding protein we sought, we performed a blot overlay assay using radioiodinated alpha -actinin. A similar gel to that shown in Fig. 2A was transferred to nitrocellulose, and the nitrocellulose was incubated with [125I]alpha -actinin. The autoradiograph revealed that the radioiodinated alpha -actinin bound to the purified 36-kDa protein. Starting with 400 g of chicken gizzards, this protocol allowed us to obtain 3-4 mg of purified p36.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 2.   Purification of p36 from avian smooth muscle. A, a Coomassie Blue-stained gel showing steps in the purification of p36 from an avian smooth muscle extract: the 15-27% ammonium sulfate precipitate loaded on the DEAE-cellulose column (lane 1); proteins that fail to bind the DEAE-cellulose column (lane 2); and pooled fractions containing the purified p36 eluted from a CM-cellulose column (lane 3). A parallel gel was transferred to nitrocellulose and probed with [125I]alpha -actinin. B, the resulting autoradiograph demonstrates that the purified 36-kDa protein is able to bind alpha -actinin. The position of the molecular mass markers is indicated on the left in kDa.

In order to determine whether p36 exists in a monomeric or multimeric state, we characterized some of the biophysical properties of the purified protein (Table I). The Stokes' radius of the purified avian smooth muscle p36 was estimated by calibrated gel filtration chromatography (28). Three independent experiments revealed a Stokes' radius of 3.1 ± 0.1 nm (mean ± S.E.) for p36 at physiological ionic strength (140 mM NaCl). We have also performed the gel filtration assay in 20 mM NaCl and have obtained similar results (data not shown). A relative sedimentation coefficient of 2.1 ± 0.1 S (mean ± S.E., n = 3) was determined for p36 by sucrose density gradient centrifugation (29). The method of Siegel and Monty (23) was employed to estimate a native molecular mass of 25.5 kDa for p36. This value suggests that under our conditions p36 is monomeric. The experimentally determined frictional ratio (f/f0) of 1.6 suggests that p36 is an asymmetric protein.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Biophysical properties of purified p36

A Moderate Affinity Interaction between alpha -Actinin and p36-- In order to calculate the dissociation constant of the alpha -actinin-p36 interaction we used a solid-phase binding assay to characterize the interaction under nondenaturing conditions. Briefly, purified p36 was immobilized in microtiter wells and was then exposed to a constant amount of radioiodinated alpha -actinin in the presence of increasing amounts of unlabeled alpha -actinin or BSA as competing proteins. The amount of bound [125I]alpha -actinin was determined by gamma -counting. As can be seen in Fig. 3A, unlabeled alpha -actinin but not an equivalent molar amount of BSA is able to compete with the radioiodinated alpha -actinin for binding to p36. From this competition experiment showing the specificity of the interaction under nondenaturing conditions, we were able to plot the moles of bound [125I]alpha -actinin against the moles of free [125I]alpha -actinin (Fig. 3B). This curve corresponds to an interaction between two proteins at a single binding site, and in this particular experiment half-maximal binding occurs at 0.20 µM free ligand. An average Kd of 0.18 ± 0.04 µM (mean ± S.E.) corresponding to a moderate affinity interaction between alpha -actinin and p36 was calculated from three independent experiments.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3.   Direct and specific interaction between alpha -actinin and p36 using a solid-phase binding assay. A, microtiter wells were coated with purified p36 and then blocked with BSA. A constant amount of [125I]alpha -actinin was incubated in the wells in the presence of increasing concentrations of unlabeled competing proteins: alpha -actinin (+ alpha -A) or BSA (+ BSA). The amount of bound [125I]alpha -actinin was determined by gamma  counting. In this particular experiment, the maximal specific binding of the radioiodinated alpha -actinin to the p36-coated wells in the absence of competing protein corresponds to 3,950 cpm. The data are expressed as a percentage of the maximum counts bound in the absence of competing protein. B, from the graph shown in A, we have plotted the concentration of bound [125I]alpha -actinin against the concentration of free [125I]alpha -actinin. The calculated dissociation constant (Kd) obtained from this experiment was 0.20 µM. From three different experiments, a mean Kd of 0.18 ± 0.04 µM (mean ± S.E.) was calculated.

Colocalization of alpha -Actinin and p36 in CEF Cells-- As shown above, we have demonstrated a high specificity, moderate affinity interaction between alpha -actinin and p36 in vitro. If these proteins also interact with each other in vivo, we should observe a colocalization of these two proteins in cells. In order to examine this possibility, we have generated polyclonal antibodies against purified smooth muscle p36. As shown in Fig. 4B, by Western immunoblot analysis the polyclonal antibodies specifically recognize p36 in a CEF cell lysate (Fig. 4B, lane 1'), in an avian smooth muscle extract (Fig. 4B, lane 2'), and after purification (Fig. 4B, lane 3'). No signal was detected using the preimmune serum under the same conditions (Fig. 4C).


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4.   Characterization of the p36-antibody. A, Coomassie Blue-stained gel showing the molecular mass markers (M), the total proteins from a CEF lysate (lane 1), the proteins present in the 15-27% ammonium sulfate precipitate from an avian smooth muscle extract (lane 2), and p36 purified from this avian smooth muscle extract (lane 3). Corresponding Western immunoblots probed with the polyclonal antibody (K55) raised against p36 (B) or the corresponding preimmune serum (C) demonstrate the specificity of the p36 antibody. The amount of proteins loaded in lanes 2', 2", 3', and 3" was 100 times lower than the amount loaded in lanes 2 and 3.

We used the specific anti-p36 antibody to compare the subcellular localizations of alpha -actinin and p36 in CEF cells. Double-label indirect immunofluorescence reveals that p36 and alpha -actinin colocalize extensively along the actin stress fibers (Fig. 5, A-C), consistent with the view that they might also interact in vivo. In order to evaluate if p36 is also present in the focal adhesions at the end of the stress fibers, we performed double label indirect immunofluorescence using anti-p36 antibodies and antibodies directed against vinculin, a well characterized component of focal adhesions. As can be seen in Fig. 5, D-F, p36 is found along the actin cytoskeleton as well as in the focal adhesions, where its distribution overlaps with vinculin. Using interference reflection microscopy, we have also observed the localization of p36 in the focal adhesions (data not shown). Given the fact that p36 associates with the actin-binding protein alpha -actinin, we examined the possibility that p36 also colocalizes with alpha -actinin in lammellipodia, structures enriched in alpha -actinin and actin, where polymerization of actin occurs during cell spreading. A striking colocalization of alpha -actinin and p36 is observed in the leading lammellipodia of spreading fibroblasts (Fig. 5, G-I). No specific staining is observed with the preimmune serum (data not shown). Collectively, these experiments illustrate a striking coincidence in the subcellular distributions of alpha -actinin and p36.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 5.   Subcellular localization of p36 in CEF cells. CEF cells were fixed and double-labeled for confocal indirect immunofluorescence microscopy with the polyclonal anti-p36 antibody (A, D, and G), and monoclonal antibodies raised against alpha -actinin (B and H) or vinculin (E). The merged image appears in the right column (C, F, and I). alpha -Actinin and p36 are colocalized along the actin stress fibers of well spread cells (C) and in the lammellipodia of cells that have been plated on fibronectin for 15 min (I). The p36 staining also overlaps with the vinculin staining at the end of the actin stress fibers in the focal adhesions (F). Bar, 30 µM.

Evidence for an Interaction between alpha -Actinin and p36 in Vivo-- In an effort to confirm the ability of alpha -actinin to associate with p36 in vivo, we performed coimmunoprecipitation experiments in CEF cells using the anti-p36 antibody or the corresponding preimmune serum. The bound material was eluted and resolved by SDS-PAGE, transferred to nitrocellulose, and probed with anti-p36 or anti-alpha -actinin antibodies. Fig. 6A shows that under nondenaturing conditions, p36 can be immunoprecipitated by the anti-p36 antibody but not by the corresponding preimmune serum. Under the same conditions, Western immunoblot analysis of the immunoprecipitated proteins reveals that alpha -actinin is coimmunoprecipitated with p36 (Fig. 6B). No signal corresponding to alpha -actinin was detected when the immunoprecipitation was performed using the preimmune serum (Fig. 6B). These experiments illustrate that alpha -actinin and p36 are present in the same molecular complex in vivo in CEF cells.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6.   Coimmunoprecipitation of alpha -actinin with p36 in CEF cells. Proteins were immunoprecipitated from a CEF lysate in radioimmune precipitation buffer with the anti-p36 antibody (anti-p36) or the corresponding preimmune serum (PI). Immunoprecipitated proteins were revealed by Western immunoblotting using the anti-p36 antibody (A) or a polyclonal antibody raised against alpha -actinin (B). Western immunoblot analysis shows that alpha -actinin is immunoprecipitated with p36 under nondenaturing conditions when the anti-p36 antibody, but not the preimmune serum, is used. The positions of the molecular mass markers are indicated in kDa as well as the positions of alpha -actinin (alpha -A), p36 (p36), and the IgG heavy chain (Ig).

Tissue-specific Expression of p36 Isoforms-- To determine the expression pattern of p36, we performed a Western immunoblot analysis using different tissues derived from 19-day-old chicken embryos. The anti-p36 antibody was used to screen the proteins extracted from brain, heart, arteries, stomach, gizzard, intestine, skeletal muscle, liver, lung, and blood. A Coomassie Blue-stained gel of the protein extracts from each tissue is shown in Fig. 7A. A similar gel was transferred to nitrocellulose and probed with the anti-p36 antibody (Fig. 7B). p36 is expressed in heart and in tissues enriched in smooth muscle including arteries, stomach, gizzard, intestine, and lung. A second, lower molecular mass immunoreactive band of 33 kDa was detected in heart; at present, it is not clear whether this 33-kDa polypeptide is a proteolytic fragment of p36, is the product of an alternatively spliced transcript, or is a related protein. No signal was detected in brain, liver, or whole blood. Surprisingly, a single protein that exhibits an apparent molecular mass of 40 kDa (p40) was prominent in skeletal muscle, suggesting the presence of a larger isoform in skeletal muscle cells. No proteins were detected when the preimmune serum was used in this Western immunoblot analysis (data not shown). These immunoblot results revealed the existence of at least two immunologically related proteins that display distinct patterns of muscle-specific expression.


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 7.   Tissue distribution of p36. A, a Coomassie Blue-stained gel showing the proteins extracted from different tissues derived from 19-day-old chicken embryos. B, corresponding Western immunoblot probed with the anti-p36 antibody reveals that p36 is expressed in heart and in tissues enriched in smooth muscle (arteries, stomach, gizzard, intestine, and lung), whereas a 40-kDa isoform of p36 is found in skeletal muscle. The position of the molecular mass markers is indicated on the left in kDa.

Up-regulation of p36 and p40 Expression during Myogenic Differentiation-- In order to examine a possible role of p36 during myogenesis, we evaluated the expression level of p36 in arteries, a tissue enriched in smooth muscle, during embryogenesis (Fig. 8A). The level of p36 in arteries increases dramatically as a function of developmental time between day 11 and day 15 (Fig. 8B). A similar result but with a less striking increase was also observed during the development of another smooth muscle-rich organ, the gizzard, from 11-18-day-old chicken embryos (data not shown).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 8.   Up-regulation of p36 expression in differentiated smooth muscle cells. A, Coomassie Blue-stained gel showing the proteins extracted from arteries derived from 11-day (11d), 13-day (13d), 15-day (15d), and 18-day old (18d) chicken embryos. B, a parallel gel was transferred to nitrocellulose and analyzed by Western immunoblotting using the anti-p36 antibody. The expression level of p36 in arteries increases markedly during development. The position of the molecular mass markers is indicated on the left in kDa.

In parallel studies, we used the myogenic C2C12 cell line to examine the expression of p40 during striated muscle development (Fig. 9). C2C12 myoblasts proliferate in the presence of high serum and are induced to differentiate upon removal of growth factors. Proteins present in undifferentiated and differentiated C2C12 cells were resolved by SDS-PAGE (Fig. 9A). By Western immunoblot analysis, no p40 is detected in undifferentiated myoblasts, but p40 expression is induced upon differentiation (Fig. 9B). An immunoreactive polypeptide with an apparent molecular mass of 35 kDa is also detected in the differentiated C2C12 lysate. The significance of this band is unknown, but it was not detected by Western immunoblot in the skeletal muscle extract from chicken embryo shown in Fig. 7. The up-regulated expression of p36 and p40 in smooth and skeletal muscle is consistent with the possibility that these proteins have specialized roles within differentiated muscle. The subcellular distribution of p40 in differentiated C2C12 myotubes was evaluated by double label indirect immunofluorescence and compared with the distribution of alpha -actinin. As can be seen in Fig. 9, C-E, p40 colocalizes precisely with alpha -actinin at the Z-lines of the myotubes.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 9.   Up-regulation of p40 expression in differentiated C2C12 myotubes. A, Coomassie Blue-stained gel showing the total proteins from undifferentiated C2C12 cells (undiff. cells) and differentiated C2C12 cells (diff. cells). The positions of the molecular mass markers are indicated on the left in kDa. B, Western immunoblot analysis of the proteins extracted from the C2C12 myogenic cell line using the K55 antibody raised against p36. Under proliferation conditions no p40 is detected in the lysate of undifferentiated myoblasts (undiff. cells), whereas under differentiation conditions p40 expression is induced in myotubes (diff. cells). Differentiated C2C12 cells were double-labeled using the polyclonal K55 antibody raised against p36 (C) and a monoclonal antibody raised against sarcomeric alpha -actinin (D). p40 staining (green) and alpha -actinin staining (red) are also shown after merging (E). Overlapping regions appearing in yellow reveal that p40 colocalizes with alpha -actinin at the Z-lines of the differentiated myotubes. Bar, 20 µm.

Molecular Cloning of cDNAs Encoding Chicken p36 and p40-- The relationship between the p36 and the p40 proteins was defined by analysis of cDNAs that encode the two proteins (Fig. 10). In an effort to isolate cDNAs encoding p36, we obtained peptide sequence from the purified protein. The N terminus as well as several peptides derived by endoproteolytic cleavage were sequenced. By this approach, we obtained 147 aa of peptide sequence, an estimated 47% of the total protein sequence. Degenerate primers were designed based on these p36-derived sequences. These primers were used to amplify a fragment of 296 bp from first strand CEF cDNA; the deduced amino acid sequence of the resulting product extended bona fide p36 sequence beyond what was encoded by the primers, confirming the relationship of the polymerase chain reaction product to a p36 transcript. Based on the nucleotide sequence of this fragment, two internal primers were synthesized and used to generate a transcript-specific nucleotide probe. One million recombinants from a total chicken embryo cDNA library were screened with the p36 probe. Five positive plaques were isolated and purified. Two of the five isolates, clone 1 and clone 8, were sequenced in entirety on both strands.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 10.   Sequence analysis of chicken p36 and p40 cDNAs. A, the nucleotide sequence (numbered on the right) of clone 1 and the deduced amino acid sequence (numbered on the left) corresponding to p36 are shown. The amino acid sequence corresponding to the PDZ domain is boxed, whereas cysteine and histidine residues contributing to the LIM motif are circled. The unique amino acid sequence of p36 is shaded. The peptide sequences obtained by microsequencing of p36 are underlined. An asterisk indicates the two amino acids present in p36 (at positions 81 and 178) that are different amino acids in p40 based on the nucleotide sequences of clone 1 and clone 8, respectively (see "Results" for details). B, the unique amino acid sequence of p40 is shaded. C, model showing the domain structure of p36.

The clone 1 cDNA insert is 1280 bp in length. The nucleotide sequence reveals a potential initiation codon (ATG) at nucleotides 47-49, and a stop codon (TAG) at nucleotides 992-994. A Kozak consensus initiation sequence (GCCACG) is present just before the initiation codon (30), and a polyadenylation signal (AATAAA) is found at the 3'-end of the cDNA (31). An open reading frame of 945 bp encodes a protein of 315 amino acids with a predicted molecular mass of 34.2 kDa. Analysis of the protein sequence shown in Fig. 10A reveals the presence of two protein-binding motifs: a PDZ domain at the N terminus and a LIM domain at the C terminus. All eight peptide sequences obtained by microsequence analysis of the purified p36 are found in the deduced 315-amino acid protein sequence (Fig. 10A), demonstrating unambiguously that the cDNA we have cloned encodes p36.

We also isolated another cDNA insert from clone 8 that encodes a partial protein product of 298 aa with a high degree of identity to p36. The nucleotide sequence and deduced amino acid sequence are essentially identical to that of clone 1 except in the central region, where 189 nucleotides (encoding 63 aa) of clone 1 are replaced by 333 nucleotides (encoding 111 aa) of unique sequence in clone 8 (Fig. 10B). This change is sufficient to account for the molecular weight difference between p36 and p40. Thus, we believe that we have cloned a cDNA encoding the skeletal muscle p40 isoform. Further, it appears that transcripts encoding p36 and p40 are derived by alternative splicing of the same precursor RNA.

Although the nucleotide sequence of p36 cDNA is nearly identical to that of p40 cDNA, except in the central unique region described above, we did observe four examples of nucleotide substitutions when comparing the common regions of p36 and p40 cDNAs. There are two nucleotide substitutions that affect the amino acid sequence (Fig. 10A). The GAG codon at nucleotides 287-289 coding for a glutamic acid at position 81 in p36 is replaced by the AAG codon coding for a lysine in p40. A second substitution replaces the GCG codon at nucleotides 578-580 coding for an alanine at position 178 in p36 by the ACG codon coding for a threonine at position 226 in p40. As will be discussed further below, these changes could reflect polymerase errors that occurred during the production of the library or they could represent RNA editing events mediated by adenosine deamination (32). In addition, we observed two substitutions (a cytosine at position 268 and a thymine at position 604 in the clone encoding p36 are replaced by a thymine and a cytosine, respectively, in the cDNA encoding p40) that are probably due to polymorphisms at the locus.

Analysis of the predicted amino acid sequences of avian p36 and p40 revealed a high degree of similarity to recently described rat and human muscle proteins called the ALPs (1). Thus, we believe that the proteins we have described here represent the 36- and 40-kDa avian isoforms of ALP. We suggest calling the p36-ALP isoform smALP (smooth muscle ALP), based on its prevalence in smooth muscle, and the p40-ALP isoform skALP (skeletal muscle ALP), based on its presence in skeletal muscle.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this paper, we describe the identification, purification, and characterization of avian smALP, a cardiac and smooth muscle protein that interacts with the actin-binding protein, alpha -actinin. We have developed a method for purifying smALP from avian smooth muscle and have characterized its biophysical properties. A variety of binding assays were employed to demonstrate a direct, specific, and saturable interaction between smALP and alpha -actinin. SmALP and alpha -actinin display a moderate affinity interaction in vitro with an average calculated Kd of 0.18 µM. Moreover, we have used native immunoprecipitation to demonstrate that smALP and alpha -actinin are present in the same molecular complex in vivo. Further support for the in vivo relevance of the smALP-alpha -actinin interaction comes from their co-localization within cells.

In the course of these studies, we also identified skALP, a 40-kDa protein that is closely related to smALP and that is expressed exclusively in skeletal muscle. Thus, all three vertebrate muscle types exhibit expression of an ALP isoform. Other than fibroblasts, which typically express a protein repertoire reminiscent of smooth muscle, muscle cells appear to be the primary site of ALP expression in the chick. The fact that neither smALP nor skALP appear to be expressed substantially in nonmuscle derivatives suggests that their physiological role may be related to some differentiated function of muscle. In further support of this notion, we observed that ALP expression levels increase during smooth muscle and skeletal muscle differentiation. Moreover, skALP is localized to the Z-line of differentiated myotubes, suggesting a role for ALP isoforms in muscle organization and/or function.

The rat skeletal muscle form of ALP was described recently by Xia et al. (1), who identified the protein in the course of a search for PDZ domain proteins in skeletal muscle and described an interaction between ALP and alpha -actinin using a two-hybrid screen. Of particular interest, Xia and colleagues performed chromosomal mapping studies to show that the gene encoding ALP maps to human chromosome 4q35 (1), close to a region of heterochromatin that is deleted in individuals afflicted with facioscapulohumeral muscular dystrophy, the third most common form of inherited muscle disease (33). It has been postulated that the heterochromatin deletion alters the expression of some nearby gene that is essential for some aspect of muscle function (34). Thus, the ALP gene has emerged as a candidate for the gene affected in facioscapulohumeral muscular dystrophy. As might be expected for a protein that plays an important role in muscle function, Xia et al. (1) showed that rat skALP displays dramatically up-regulated expression during skeletal muscle differentiation. Our work on the avian ALPs confirms and extends the findings of Xia et al. by presenting a method for isolation of native ALP from muscle, the characterization of its biophysical properties and association with alpha -actinin, and the demonstration of a smooth muscle isoform of ALP. The availability of purified ALP will allow detailed analysis of its biochemical role in muscle.

Molecular cloning and analysis of the cDNAs encoding chicken smALP and skALP has confirmed their relationship to each other. The N-terminal and C-terminal regions of the proteins are identical in sequence. However, the two isoforms differ in an internal sequence; 63 aa present in smALP are replaced by a unique sequence of 111 aa in skALP. Based on the absolute identity of the cDNA sequences outside this central region, it appears that p36 and p40 are encoded by transcripts derived by alternative splicing. We speculate that the unique central domains in the ALP isoforms confer some functional specificity, perhaps reflecting the distinct properties of the different muscle subtypes in which they are exclusively expressed. Additional work will be required to define the physiological relevance of these novel domains.

In addition to the differences in the central regions of smALP and skALP, we also observed two nucleotide substitutions that are predicted to affect the amino acid sequence of the proteins, changing the glutamate codon (GAG) at position 81 in smALP to lysine (AAG) and the alanine codon (GCG) at position 178 in smALP to threonine (ACG). In both cases, we observe an A in the skeletal muscle skALP cDNA and a G in the smALP cDNA. It is possible that these differences occurred during the production of the cDNA library and have no physiological significance or that they reflect polymorphisms. Alternatively, these differences could be the result of RNA editing. RNA-specific adenosine deaminases convert adenosine to inosine, which would result in an A to G nucleotide change in the coding strand of a cDNA and can thus modulate protein structure and function (32). RNA-specific adenosine deaminases are present at very low levels in skeletal muscle (35), consistent with the observation that the skALP cDNA that is derived from a skeletal muscle transcript exhibits an adenine nucleotide. Also, the positions of the nucleotide differences are near an apparent intron-exon boundary, as commonly occurs for RNA-specific adenosine deaminase-dependent changes, since double-stranded RNA is required for the activity (32). The peptide sequence obtained by microsequencing of smALP (aa 165-181) shows that the amino acid at position 178 in our preparation of smALP is a threonine; thus, if site-specific deamination did occur, it must not be complete or could be developmentally regulated. Genomic sequencing will be required to establish whether the difference reflected at the level of the cDNAs has physiological relevance.

The domain structures of both smALP and skALP suggest their ability to dock multiple protein partners. The two proteins each display an identical N-terminal PDZ domain and C-terminal LIM domain. PDZ domains are 80-100-amino acid motifs that mediate specific protein-protein interaction (16). LIM motifs are cysteine-rich domains approximately 60 amino acids in length (36) that coordinate two zinc atoms (37) and also serve as protein binding interfaces (17). The presence of these two protein binding domains in smALP and skALP suggests that the proteins could act as a linker or adaptor molecules within the contractile machinery of muscle cells. Insight into the nature of the alpha -actinin binding site of ALP has recently emerged; domain analysis revealed that it is the PDZ domain of skALP that interacts with alpha -actinin (1). Because LIM domains also represent protein binding interfaces, it will be of importance in the future to determine what protein partner or partners associate with the LIM domain present in ALP.

The findings that ALP isoforms are expressed specifically in muscle cells, are up-regulated during muscle differentiation, and are associated with alpha -actinin at key sites for muscle cytoarchitecture raise the possibility that these PDZ-LIM proteins may cooperate with alpha -actinin to stabilize and/or strengthen the contractile machinery of muscle cells. Given this hypothesis and the human genetic mapping data that suggest the ALP gene as a candidate for the gene that is critically affected in facioscapulohumeral muscular dystrophy (1), it will be of particular interest to assess the involvement of ALP in facioscapulohumeral muscular dystrophy and to define its role in muscle structure and function.

    ACKNOWLEDGEMENTS

We thank the members of the Beckerle laboratory for helpful discussions and in particular S. Pronovost for help with protein purification and J. Yi for contributions early in these studies. We are particularly grateful to V. Fowler (Scripps Research Institute, La Jolla, CA) for helpful discussions, K. Burridge (University of North Carolina, Chapel Hill, NC) for providing the alpha -actinin antibody, M. Robertson (University of Utah DNA sequencing facility, Salt Lake City, UT) for DNA sequencing, B. Schackmann (Huntsman Cancer Institute DNA/peptide facility, Salt Lake City, UT) for the smALP microsequencing, and E. King (University of Utah, Salt Lake City, UT) for helpful discussions regarding confocal immunofluorescence microscopy.

    FOOTNOTES

* This research was supported by National Institutes of Health (NIH) Grant HL60591 (to M. C. B.) and by a grant from the Philippe Foundation, Inc. (to P. P.). The work performed at the University of Utah DNA sequencing facility and at the Huntsman Cancer Institute DNA/peptide facility was supported by NCI, NIH, Grant CA42014.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ249218 and AJ249219.

Dagger Recipient of a Faculty Research Award from the American Cancer Society. To whom correspondence should be addressed: Dept. of Biology, University of Utah, 257 South 1400 East, Salt Lake City, UT 84112-0840. Tel.: 801-581-4485; Fax: 801-581-4668; E-mail: beckerle@bioscience.utah.edu.

    ABBREVIATIONS

The abbreviations used are: ALP, actinin-associated LIM protein; aa, amino acids; CEF, chicken embryo fibroblasts; PAGE, polyacrylamide gel electrophoresis; BSA, bovine serum albumin; bp, base pair(s).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Xia, H., Winokur, S. T., Kuo, W.-L., Altherr, M. R., and Bredt, D. S. (1997) J. Cell Biol. 139, 507-515[Abstract/Free Full Text]
2. Small, J. V. (1995) BioEssays 17, 785-792[CrossRef][Medline] [Order article via Infotrieve]
3. Masaki, T., Endo, M., and Ebashi, S. (1967) J. Biochem. (Tokyo) 62, 630-632[Free Full Text]
4. Geiger, B., Dutton, A. J., Tokuyasu, K. T., and Singer, S. J. (1981) J. Cell Biol. 91, 614-628[Abstract/Free Full Text]
5. Burridge, K., and Feramisco, J. R. (1981) Nature 294, 565-567[CrossRef][Medline] [Order article via Infotrieve]
6. Endo, T., and Masaki, T. (1982) J. Biochem. (Tokyo) 92, 1457-1468[Abstract/Free Full Text]
7. Lazarides, E., and Burridge, K. (1975) Cell 6, 289-298[CrossRef][Medline] [Order article via Infotrieve]
8. Otey, C. A., Pavalko, F. M., and Burridge, K. (1990) J. Cell Biol. 111, 721-729[Abstract/Free Full Text]
9. Pavalko, F. M., and Burridge, K. (1991) J. Cell Biol. 114, 481-491[Abstract/Free Full Text]
10. Cheng, N., and Deatherage, J. F. (1989) J. Cell Biol. 108, 1761-1774[Abstract/Free Full Text]
11. Deatherage, J. F., Cheng, N., and Bullard, B. (1989) J. Cell Biol. 108, 1775-1782[Abstract/Free Full Text]
12. Fyrberg, E., Kelly, M., Ball, E., Fyrberg, C., and Reedy, M. C. (1990) J. Cell Biol. 110, 1999-2011[Abstract/Free Full Text]
13. Roulier, E. M., Fyrberg, C., and Fyrberg, E. (1992) J. Cell Biol. 116, 911-922[Abstract/Free Full Text]
14. Francis, G. R., and Waterston, R. H. (1985) J. Cell Biol. 101, 1532-1549[Abstract/Free Full Text]
15. Barstead, R. J., and Waterston, R. H. (1991) J. Cell Biol. 114, 715-724[Abstract/Free Full Text]
16. Ponting, C. P., Phillips, C., Davies, K. E., and Blake, D. J. (1997) BioEssays 19, 469-479[CrossRef][Medline] [Order article via Infotrieve]
17. Schmeichel, K. L., and Beckerle, M. C. (1994) Cell 79, 211-219[CrossRef][Medline] [Order article via Infotrieve]
18. Crawford, A. W., and Beckerle, M. C. (1991) J. Biol. Chem. 266, 5847-5853[Abstract/Free Full Text]
19. Crawford, A. W., Michelsen, J. W., and Beckerle, M. C. (1992) J. Cell Biol. 116, 1381-1393[Abstract/Free Full Text]
20. Fernandez, J., DeMott, M., Atherton, D., and Mische, S. M. (1992) Anal. Biochem. 201, 255-264[CrossRef][Medline] [Order article via Infotrieve]
21. Pomiès, P., Louis, H. A., and Beckerle, M. C. (1997) J. Cell Biol. 139, 157-168[Abstract/Free Full Text]
22. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
23. Siegel, L. M., and Monty, K. J. (1965) Biochim. Biophys. Acta 112, 346-362
24. Beckerle, M. C. (1986) J. Cell Biol. 103, 1679-1687[Abstract/Free Full Text]
25. Arber, S., Halder, G., and Caroni, P. (1994) Cell 79, 221-231[CrossRef][Medline] [Order article via Infotrieve]
26. Louis, H. A., Pino, J. D., Schmeichel, K. L., Pomiès, P., and Beckerle, M. C. (1997) J. Biol. Chem. 272, 27484-27491[Abstract/Free Full Text]
27. Crawford, A. W., Pino, J. D., and Beckerle, M. C. (1994) J. Cell Biol. 124, 117-127[Abstract/Free Full Text]
28. Nozaki, Y., Schechter, N. M., Reynolds, J. A., and Tanford, C. (1976) Biochemistry 15, 3884-3890[CrossRef][Medline] [Order article via Infotrieve]
29. Martin, R. G., and Ames, B. N. (1961) J. Biol. Chem. 236, 1372-1379[Free Full Text]
30. Kozak, M. (1986) Cell 44, 283-292[CrossRef][Medline] [Order article via Infotrieve]
31. Proudfoot, N. J., and Brownlee, G. G. (1976) Nature 263, 211-214[CrossRef][Medline] [Order article via Infotrieve]
32. Bass, B. L. (1997) Trends Biochem. Sci. 22, 157-162[CrossRef][Medline] [Order article via Infotrieve]
33. van Deutekom, J. C., Wijmenga, C., van Tienhoven, E. A., Gruter, A. M., Hewitt, J. E., Padberg, G. W., van Ommen, G. J., Hofker, M. H., and Frants, R. R. (1993) Hum. Mol. Genet. 2, 2037-2042[Abstract/Free Full Text]
34. Altherr, M. R., Bengtsson, U., Markovich, R. P., and Winokur, S. T. (1995) Muscle Nerve 2, S32-S38[CrossRef][Medline] [Order article via Infotrieve]
35. Paul, M. S., and Bass, B. L. (1998) EMBO J. 17, 1120-1127[CrossRef][Medline] [Order article via Infotrieve]
36. Freyd, G., Kim, S. K., and Horvitz, R. (1990) Nature 344, 876-879[CrossRef][Medline] [Order article via Infotrieve]
37. Michelsen, J. W., Schmeichel, K. L., Beckerle, M. C., and Winge, D. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4404-4408[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
H.-F. Han and M. C. Beckerle
The ALP-Enigma Protein ALP-1 Functions in Actin Filament Organization to Promote Muscle Structural Integrity in Caenorhabditis elegans
Mol. Biol. Cell, May 1, 2009; 20(9): 2361 - 2370.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. Sharma, T. Tran, G. L. Stelmack, K. McNeill, R. Gosens, M. M. Mutawe, H. Unruh, W. T. Gerthoffer, and A. J. Halayko
Expression of the dystrophin-glycoprotein complex is a marker for human airway smooth muscle phenotype maturation
Am J Physiol Lung Cell Mol Physiol, January 1, 2008; 294(1): L57 - L68.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
K. Jani and F. Schock
Zasp is required for the assembly of functional integrin adhesion sites
J. Cell Biol., December 31, 2007; 179(7): 1583 - 1597.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. Pomies, M. Pashmforoush, C. Vegezzi, K. R. Chien, C. Auffray, and M. C. Beckerle
The Cytoskeleton-associated PDZ-LIM Protein, ALP, Acts on Serum Response Factor Activity to Regulate Muscle Differentiation
Mol. Biol. Cell, May 1, 2007; 18(5): 1723 - 1733.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. M. Smolock, T. Wang, J. K. Nolt, and R. S. Moreland
siRNA knock down of casein kinase 2 increases force and cross-bridge cycling rates in vascular smooth muscle
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C876 - C885.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. Loughran, N. C. Healy, P. A. Kiely, M. Huigsloot, N. L. Kedersha, and R. O'Connor
Mystique Is a New Insulin-like Growth Factor-I-regulated PDZ-LIM Domain Protein That Promotes Cell Attachment and Migration and Suppresses Anchorage-independent Growth
Mol. Biol. Cell, April 1, 2005; 16(4): 1811 - 1822.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Torrado, V. V. Senatorov, R. Trivedi, R. N. Fariss, and S. I. Tomarev
Pdlim2, a Novel PDZ-LIM Domain Protein, Interacts with {alpha}-Actinins and Filamin A
Invest. Ophthalmol. Vis. Sci., November 1, 2004; 45(11): 3955 - 3963.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Inoue, T. Otsuki, A. Hirasawa, I. Imoto, Y. Matsuo, S. Shimizu, M. Taniwaki, and J. Inazawa
Overexpression of PDZK1 within the 1q12-q22 Amplicon Is Likely To Be Associated with Drug-Resistance Phenotype in Multiple Myeloma
Am. J. Pathol., July 1, 2004; 165(1): 71 - 81.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Klaavuniemi, A. Kelloniemi, and J. Ylanne
The ZASP-like Motif in Actinin-associated LIM Protein Is Required for Interaction with the {alpha}-Actinin Rod and for Targeting to the Muscle Z-line
J. Biol. Chem., June 18, 2004; 279(25): 26402 - 26410.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Lange, D. Auerbach, P. McLoughlin, E. Perriard, B. W. Schafer, J.-C. Perriard, and E. Ehler
Subcellular targeting of metabolic enzymes to titin in heart muscle may be mediated by DRAL/FHL-2
J. Cell Sci., March 14, 2003; 115(24): 4925 - 4936.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. K. Greene, S. Tumova, J. R. Couchman, and A. Woods
Syndecan-4 Associates with alpha -Actinin
J. Biol. Chem., February 21, 2003; 278(9): 7617 - 7623.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Vallenius and T. P. Makela
Clik1: a novel kinase targeted to actin stress fibers by the CLP-36 PDZ-LIM protein
J. Cell Sci., May 15, 2002; 115(10): 2067 - 2073.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J.-P. Chambon, J. Soule, P. Pomies, P. Fort, A. Sahuquet, D. Alexandre, P.-H. Mangeat, and S. Baghdiguian
Tail regression in Ciona intestinalis (Prochordate) involves a Caspase-dependent apoptosis event associated with ERK activation
Development, January 7, 2002; 129(13): 3105 - 3114.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
Q. Zhou, P.-H. Chu, C. Huang, C.-F. Cheng, M. E. Martone, G. Knoll, G. D. Shelton, S. Evans, and J. Chen
Ablation of Cypher, a PDZ-LIM domain Z-line protein, causes a severe form of congenital myopathy
J. Cell Biol., November 12, 2001; 155(4): 605 - 612.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Mills, N. Yang, R. Weinberger, D. L. Vander Woude, A. H. Beggs, S. Easteal, and K. North
Differential expression of the actin-binding proteins, {{alpha}}-actinin-2 and -3, in different species: implications for the evolution of functional redundancy
Hum. Mol. Genet., June 1, 2001; 10(13): 1335 - 1346.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Jo, B. Rutten, R. C. Bunn, and D. S. Bredt
Actinin-Associated LIM Protein-Deficient Mice Maintain Normal Development and Structure of Skeletal Muscle
Mol. Cell. Biol., March 1, 2001; 21(5): 1682 - 1687.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Takada, D. L. Vander Woude, H.-Q. Tong, T. G. Thompson, S. C. Watkins, L. M. Kunkel, and A. H. Beggs
Myozenin: An alpha -actinin- and gamma -filamin-binding protein of skeletal muscle Z lines
PNAS, February 1, 2001; (2001) 41609698.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. G. Ghosh, D. A. Thompson, and R. J. Weigel
PDZK1 and GREB1 Are Estrogen-regulated Genes Expressed in Hormone-responsive Breast Cancer1, 2
Cancer Res., November 1, 2000; 60(22): 6367 - 6375.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
S. Kang, H. Xu, X. Duan, J.-J. Liu, Z. He, F. Yu, S. Zhou, X.-Q. Meng, M. Cao, and G. C. Kennedy
PCD1, a Novel Gene Containing PDZ and LIM Domains, Is Overexpressed in Several Human Cancers
Cancer Res., September 1, 2000; 60(18): 5296 - 5302.
[Abstract] [Full Text]


Home page
JCBHome page
M. M. Parast and C. A. Otey
Characterization of Palladin, a Novel Protein Localized to Stress Fibers and Cell Adhesions
J. Cell Biol., August 7, 2000; 150(3): 643 - 656.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Takada, D. L. V. Woude, H.-Q. Tong, T. G. Thompson, S. C. Watkins, L. M. Kunkel, and A. H. Beggs
Myozenin: An alpha -actinin- and gamma -filamin-binding protein of skeletal muscle Z lines
PNAS, February 13, 2001; 98(4): 1595 - 1600.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pomiès, P.
Right arrow Articles by Beckerle, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pomiès, P.
Right arrow Articles by Beckerle, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement