JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roberts, C. M.
Right arrow Articles by Bowditch, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roberts, C. M.
Right arrow Articles by Bowditch, R. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 41, 29251-29259, October 8, 1999


MDC-L, a Novel Metalloprotease Disintegrin Cysteine-rich Protein Family Member Expressed by Human Lymphocytes*

Charles M. RobertsDagger , Patricia H. TaniDagger , Lance C. BridgesDagger , Zoltan Laszik§, and Ron D. BowditchDagger

From the Departments of Dagger  Biochemistry and Molecular Biology and § Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73190

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The metalloprotease disintegrin cysteine-rich (MDC) proteins are a recently identified family of transmembrane proteins that function in proteolytic processing of cell surface molecules and in cell adhesion. Since lymphocytes must interact with a constantly changing environment, we hypothesized that lymphocytes would express unique MDC proteins. To identify MDC proteins expressed in human lymph node, a polymerase chain reaction-based strategy combined with degenerate oligonucleotide primers was employed. We report here the identification of MDC-L (ADAM 23), a novel member of the MDC protein family. The results obtained from cDNA cloning and Northern blot analysis of mRNA isolated from various lymphoid tissues indicate that a 2.8-kilobase mRNA encoding a transmembrane form, MDC-Lm, and a 2.2-kilobase mRNA encoding a secreted form, MDC-Ls, are expressed in a tissue-specific manner. MDC-L mRNA was shown to be predominantly expressed in secondary lymphoid tissues, such as lymph node, spleen, small intestine, stomach, colon, appendix, and trachea. Furthermore, immunohistochemical staining with an anti-MDC-L antibody demonstrated that cells with typical lymphocyte morphology are responsible for expression of the MDC-L antigen in these lymphoid tissues. MDC-Lm was found to be expressed on the surface of human peripheral blood lymphocytes and transformed B- and T-lymphocyte cell lines as an 87-kDa protein. Thus, we have identified a novel lymphocyte-expressed MDC protein family member.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

MDC,1 or ADAMs, are a family of transmembrane glycoproteins with a unique domain structure (1, 2). The prototypical MDC protein comprises pro, metalloprotease, disintegrin, cysteine-rich, EGF, transmembrane, and cytoplasmic domains. The metalloprotease domain is homologous to the reprolysins, members of the zinc binding metzincin superfamily that also includes the matrix metalloproteases (MMPs), the astacins, and serralysins (3). The prodomain regulates the activity of the metalloprotease by blocking access to the zinc ion; removal of the prodomain or inactivation of a conserved cysteine thiol group results in a gain of proteolytic activity. The disintegrin domains of MDC proteins are homologous to small nonenzymatic peptides isolated from the venom of snakes. Snake venom disintegrin peptides interfere with platelet aggregation by inhibiting binding of fibrinogen to the integrin alpha IIbbeta 3 (4). The functions previously attributed to the individual domains suggests roles for MDC proteins in cell adhesion and the proteolysis of extracellular proteins.

The first mammalian MDC proteins identified were the fertilins (5). These proteins function in the attachment and fusion of the sperm and egg during fertilization. A similar cell fusion function for the MDC protein meltrin-alpha (MDC-12) was shown for the formation of multinucleated myotubes (6). These MDC proteins have, in addition to the domains described above, a fusion peptide-like sequence not found in all members of the MDC protein family. However, the interaction of the fertilin disintegrin domain on the sperm surface with the integrin alpha 6beta 1 on the surface of the egg is also required for membrane adhesion and fusion (7-9). Additional evidence for the functionality of the disintegrin domain comes from studies using recombinantly expressed metargidin (MDC-15) disintegrin domain, which was shown to specifically interact with the integrin alpha vbeta 3 (10). Thus, the disintegrin domains of MDC proteins appear to be a new family of integrin ligands.

More recently, MDC proteins have been shown to function in ectodomain shedding of several cell surface proteins. Tissue necrosis factor-alpha converting enzyme (TACE; MDC-17) was the first mammalian MDC protein shown to have secretase activity (11-13). Additionally, meltrin-gamma (MDC-9) is involved in ectodomain shedding of membrane anchored heparin-binding EGF-like growth factor, and considerable evidence supports the proteolytic processing of notch by the Drosophila MDC protein Kuzbian (14-17). Many other proteins are shed from cell surfaces by metalloproteases, implicating other MDC proteins in proteolytic processing (18). Thus, MDC proteins may function in a variety of processes. First, they may control the release of ligands from the cell surface as in the case of tissue necrosis factor-alpha . Second, MDC proteins may rapidly regulate adhesive events by cleaving receptors or counter receptors from the cell surface, such as in the shedding of L-selectin (19, 20). Third, the similarity between membrane-bound MMPs and MDC proteins suggests a role in extracellular matrix proteolysis. Finally, MDC protein themselves may function as ligands for integrin receptors.

The work presented here describes MDC-L, a novel member of the MDC protein family, expressed by lymphocytes in the tissues examined. Two transcripts, one encoding a prototypical MDC protein and the other encoding a secreted form, demonstrated tissue specific regulation. The transmembrane form of MDC-L was expressed as an 87-kDa protein on the surface of peripheral blood lymphocytes and both B- and T-lymphocyte cell lines. We hypothesize that MDC-L may play a role in the adhesive and proteolytic events that occur during lymphocyte emigration or function in ectodomain shedding of lymphocyte proteins such as FasL, CD40L, or an as yet unidentified lymphocyte protein (21, 22).

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- The T-lymphocyte cell line A139.1 was obtained from Dr. H. Fickenscher (Universitaet Erlangen-Nuernberg, Erlangen, Germany) and cultured in 45% RPMI 1640, 45% AIM-V, 10% fetal calf serum (FCS) containing 100 units/ml IL-2 (23). The Epstein-Barr virus-transformed B-lymphocyte cell line RD105U was provided by Dr. W. Hildebrand (University of Oklahoma Health Sciences Center, Oklahoma City, OK) and cultured in RPMI 1640, 10% FCS, 1% L-glutamine, containing 1% penicillin/streptomycin. The T-lymphocyte cell line Hut78 was obtained from American Type Culture Collection (Rockville, MD) and grown in Iscove's modified Dulbecco's medium, 20% FCS, 4 mM L-glutamine, 1.5 g/liter NaHCO3.

Nested PCR-- Manipulation of recombinant DNA was by standard techniques (24). Restriction enzymes, T4 DNA ligase, and Taq polymerase were purchased from Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were synthesized by the Molecular Biology Resource Facility at the University of Oklahoma Health Sciences Center. The degenerate oligonucleotide primers used were B1 (GARGGNGARGAYTGYGAYTG), B2 (GGNGARGAYTGYGAYTGYGG), C1 (CARTAYTCNGGNARRTCRCA), and C2 (TAYTCNGGNARRTCRCAYTC) in which N signifies any deoxynucleotide, R signifies either A or G, and Y signifies either T or C (25). Nested PCR was performed as follows. For reaction 1, 500 ng of human lymph node cDNA (CLONTECH, Palo Alto, CA) was combined with 0.5 µg of primers B1 and C1 in a hot start PCR using the AmpliWax (Perkin Elmer) protocol. The PCR products were then separated from the oligonucleotides by centrifugal filtration. For reaction 2, the reaction 1 products were combined with 0.5 µg of primers B2 and C2 in a hot start PCR protocol. The PCR products obtained from reaction 2 were subcloned into pCRII-TOPO (Invitrogen, Carlsbad, CA) and the nucleotide sequence of both strands determined.

cDNA Cloning-- A 190-bp EcoRI fragment from a pCRII-TOPO MDC-L subclone was electroeluted from a 5% polyacrylamide gel (PAGE) and labeled with [alpha -32P]dCTP (Amersham Pharmacia Biotech) by the random primer method. After removal of the unincorporated nucleotides, the radiolabeled 190-bp EcoRI fragment was used to probe a lambda gt10 human lymph node cDNA library (CLONTECH). Positive plaques were isolated, plated at a lower density, and probed until all the plaques on a plate were positive. The cDNA from the positive phage were subcloned into pCRII-TOPO vector after PCR of a phage lysate with lambda gt10 forward and reverse primers (26). The nucleotide sequence of both strands was determined using universal and gene specific primers. The 5' rapid amplification of cDNA ends (RACE) was performed using Marathon-Ready cDNA (CLONTECH) as recommended by supplier with the primers AP1 and the gene-specific primer MET12 (CTGTCCATCCCGATGTATGGGGC). The PCR products obtained were separated from the primers by centrifugal filtration and subjected to a second PCR with the primers AP2 and MET12. The 600-bp product obtained was subcloned into pCRII-TOPO and both strands sequenced using universal and gene-specific primers.

Messenger RNA Analysis-- The multiple tissue northern and mRNA dot blot were purchased from CLONTECH. Hybridization of the mRNA dot blot was performed with the same probe used for cDNA cloning. The MDC-Lm-specific probe was a 790-bp BamHI/SalI (vector site) fragment from the 3' end of MDC-Lm cDNA that had been extracted from an agarose gel. The MDC-Ls-specific probe was a HindIII fragment from the 3'-untranslated region of MDC-Ls cDNA. All probes were radiolabeled with [alpha -32P]dCTP by the random primer method to a specific activity greater than 1 × 109 cpm/µg. Polyadenylated RNA transferred to nylon membranes were hybridized with the specified probe as described (27). The nylon membranes were exposed to x-ray film at -80 °C for 3 days. After exposure of the nylon membranes to film, the bound probe was stripped by heating at 95 °C for 10 min in 0.5% SDS, rinsing in H2O, and storing at -20 °C.

RT-PCR was carried out using the mRNA capture kit and Titan One Tube RT-PCR system (Roche Molecular Biochemicals) and the specified gene-specific primers. Primers used for RT-PCR of human lymph node mRNA were L1 (CGGGATCCGTTCAGGAACATGAG), Lm1 (GTCATCGCAGTCGGGAGGGATCC), and Ls1 (GTTTATGATCTTAGTAGGGTTGCC). Peripheral blood leukocytes were isolated by incubating fresh normal human blood with either anti-CD2, CD19, CD14, and CD16 monoclonal antibodies (Caltag Laboratories, Burlingame, CA), then adding sheep anti-mouse IgG magnetic beads (Dynal, Oslo, Norway), and separating the cells with a magnet. The isolated cells were quantitated, and 1 × 105 cells were used for RT-PCR. Primers used for leukocyte RT-PCR were L2 (TCTGGTCCTGGATAATGGTGAGTT), Lm2 (CACACTCATTCCCTGCAAAGCAAA), Ls2 (TGGTTTTAGGGTTGCTAGATTTAG), Actin1 (GGCATCCTCACCCTGAAGTACCCC), and Actin2 (CGTCATACTCCTGCTTGCTGATCC). Nested PCR was performed using a standard 30-cycle PCR reaction with 2 µl of the initial RT-PCR reaction as template and the primers L3 (TCCATTGCCTACAGATATCATATCC) and L4 (CCCCACAGCTCTGTCCACTGC). The products were verified by gel electrophoresis and cleavage with the restriction enzymes BamHI, HindIII, and DraI.

Purification of MDC-L Fusion Proteins-- The MDC-L disintegrin domain (residues Gly418-Glu476) was PCR-amplified from the lambda gt10 subclone 2.2.5 with the oligonucleotides MDC-01 (CGGGATCCGGTGAGGACTGCGACTGCGGG) and MDC-02 (AACTGCAGTTATTCAGGCAGGTCGCACTC), digested with BamHI and PstI, subcloned into the hexahistidine (H6) expression vector pQE30 (Qiagen Inc., Valencia, CA), and transformed into Eschericia coli M15[pREP4]. Cells harboring the pQE30 MDC-L disintegrin domain recombinant plasmid were grown in SB media plus 100 µg/ml ampicillin and 50 µg/ml kanamycin at 37 °C to an A600 nm of 0.5-0.7. Isopropyl-beta -D-thiogalactopyranoside was added to a final concentration of 2 mM, and the cells were further incubated at 37 °C for 2 h. The cell culture was centrifuged at 4,000 × g for 10 min, and the pellet was resuspended in sonication buffer (50 mM sodium phosphate, pH 7.8, 300 mM NaCl, 5 mM 2-mercaptoethanol) and stored at -80 °C. The thawed cell suspension was sonicated, centrifuged at 11,000 × g for 20 min at 4 °C, the supernatant diluted 1:3 in sonication buffer, and affinity-purified on Ni-NTA agarose. Material bound to the Ni-NTA-agarose was washed with 50 mM sodium phosphate, pH 6.0, 300 mM NaCl, 5 mM 2-mercaptoethanol, 10% glycerol and then eluted with the same buffer at pH 4.0. The purified fusion protein was dialyzed in phosphate-buffered saline (PBS) and examined by 15% Tris-Tricine PAGE. The correct amino acid composition was verified by electrospray mass spectrometry. The MDC-Lm EGF domain (residues Thr627-Ser666) was PCR amplified from the lambda gt10 subclone 4.2.2 with the oligonucleotides MDC-E1 (TCAGAATTCACCAATTGCTCATCCAAG) and MDC-E2 (CAATCTAGACTAGGAGAAGTGGAAGACCAC), digested with EcoRI and XbaI, and subcloned into the malE gene fusion vector pMALc2 (New England Biolabs, Beverly, MA). Maltose-binding protein-MDC-L fusion proteins were purified and analyzed as described (28).

Polyclonal Antiserum-- For the production of polyclonal antibodies, two rabbits were hyperimmunized with either purified H6-MDC-L disintegrin domain or maltose-binding protein-MDC-L EGF domain fusion proteins following standard techniques (29). Purified immunoglobulin was obtained by protein A-Sepharose affinity chromatography (Amersham Pharmacia Biotech). Affinity-purified anti-MDC-L disintegrin domain antibody was obtained by incubating 5 mg of purified immunoglobulin with the disintegrin domain affinity resin overnight at 4 °C, washing extensively with PBS, and eluting with 0.1 M glycine, pH 3.0, 0.5 M NaCl. Eluted antibody was immediately neutralized with 0.1 M Tris, pH 8.0, and then dialyzed in PBS.

Immunochemistry-- SDS-PAGE was performed under reducing and non-reducing conditions (30). Immunoblots were performed by the transfer of SDS-PAGE separated proteins to nitrocellulose (Micron Separations Inc., Westborough, MA), blocking in 2% Blotto, and incubating with polyclonal antiserum at a 1:10,000 dilution. The bound antibody was detected by subsequent incubation with a biotinylated secondary antibody, incubation with avidin-conjugated peroxidase (Vector Laboratories, Inc., Burlingame, CA), and visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech). Peripheral blood lymphocytes were isolated from normal donors by centrifugation through Ficoll-Paque plus (Amersham Pharmacia Biotech). Whole cell lysates were prepared by incubating saline-washed cell pellets in lysis buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 50 mM beta -octyl-D-glucopyranoside, 1 mM Pefabloc (Roche Molecular Biochemicals), 10 mM leupeptin, 1 mg/ml ethylmaleimide).

Immunoprecipitations were performed by surface biotinylation of 2 × 107 cells with 0.5 mg of sulfo-NHS-biotin (Pierce) in PBS for 2 h. The cells were then washed three times in PBS and lysed on ice for 30 min in 0.5 ml of radioimmune precipitation buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholic acid, 0.1% SDS). After centrifugation at 16,000 × g for 10 min, 100 µl of the supernatant was incubated with 5 µl of protein A-Sepharose pre-armed with the specified antiserum for 1 h on ice. The resin was washed three times with radioimmune precipitation buffer, boiled in SDS-PAGE loading buffer, centrifuged, subjected to SDS-PAGE, transferred to nitrocellulose, and biotinylated proteins detected as described above.

Immunohistochemistry-- Human tissues were obtained from either normal portions of surgical specimens or from autopsy specimens at University Hospital and Children's Hospital of the University of Oklahoma Health Sciences Center and were procured according to institutional guidelines. Tissues were fixed in 10% paraformaldehyde, processed, paraffin-embedded, and sectioned using conventional techniques. Snap-frozen tonsil and stomach were used to evaluate possible antigen loss when studying paraformaldehyde-fixed, paraffin-embedded tissues. Tissue sections were treated as described (31). Briefly, deparaffinized sections were treated with 1.25% H2O2 in methanol for 30 min to block endogenous peroxidase activity. Immunohistochemical staining for MDC-L antigen was performed using standard strepavidin biotin peroxidase methodology at room temperature. The slides were incubated with PBS containing 5% swine serum to inhibit nonspecific antibody binding, followed by addition of the primary affinity-purified antibody diluted in PBS containing 1% bovine serum albumin for 60 min. Biotin-conjugated swine anti-rabbit secondary antibody was applied for 20 min, followed by strepavidin-horseradish peroxidase(Dako Corp., Carpinteria, CA) for 30 min. Diaminobenzidine (Sigma) was used as chromogen. Hematoxylin was used for nuclear counterstaining.

General Procedures-- Protein concentrations were determined by the BCA assay (Pierce). The MDC-L disintegrin domain affinity column was generated by cross-linking 2.6 mg of H6-MDC-L disintegrin domain in 0.1 M NaHCO3, pH 8.0, 0.5 M NaCl to 0.3 g of CNBr-activated Sepharose. The affinity matrix was then incubated in 0.1 M Tris, pH 8.0, 500 mM NaCl for 2 h at room temperature, washed several times with alternating 0.1 M glycine, pH 3.0, 0.5 M ,NaCl and 0.1 M Tris, pH 8.0, 0.5 M NaCl, and stored in PBS at 4 °C. Data base searches were performed using the National Center for Biotechnology Information's BLAST sequence similarity searching program. Molecular modeling were performed using the SWISS-MODEL protein modeling server (32).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Identification of a Novel Disintegrin Domain from Human Lymph Node-- To determine whether lymphocytes express any MDC protein family members, human lymph node cDNA was subjected to two consecutive rounds of PCR with two sets of internally nested degenerate oligonucleotide primers. These degenerate primers were based on the coding sequence of conserved regions within the disintegrin domains of MDC proteins (25). A 165-171-bp product was obtained after the secondary PCR (Fig. 1a). The PCR products were subcloned and the nucleotide sequences determined. Identified among the PCR subclones were sequences encoding the disintegrin domains of human MDC-9 (6, 34) and MDC-20 (35) (Fig. 1b). However, 8 of the 10 inserts examined possessed an open reading frame encoding a unique polypeptide with significant homology to many of the cellular and snake venom disintegrins (Fig. 1b). Data base searches using GenBank BLAST (33) indicated that this novel disintegrin domain was greater than 60% identical to the disintegrin domains of human sperm maturation-related glycoprotein GP-83 and the macaque epididymal apical protein I (GenBank accession nos. AF090327 and X66139, respectively). These results suggest that a novel MDC family member, which we have designated MDC-L (ADAM 23), may be expressed within the human lymph node.


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 1.   Identification of a novel disintegrin domain. Two pairs of degenerate oligonucleotide primers were used in a nested PCR approach (see "Materials and Methods") to amplify cDNA encoding disintegrin domains from a human lymph node cDNA library. Panel a, 5% PAGE of the PCR products obtained with the first set of primers (lane 1), PCR products obtained with the second set of primers (lane 2), and 1-kb molecular size standards (Life Technologies, Inc.) (lane 3). The expected size of DNA encoding a disintegrin domain ranges from 165 to 171 bp (arrow). Panel b, a comparison of the predicted disintegrin domain sequences obtained from lymph node. Identities are shown in shaded boxes. The PCR products obtained were subcloned and 10 recombinant plasmids sequenced. Two disintegrin domains from previously characterized MDC proteins (MDC-9 and MDC-20) were identified. The remaining eight encoded a novel disintegrin domain (MDC-L).

Cloning of MDC-L cDNA-- Using the isolated cDNA encoding the putative MDC-L disintegrin domain as a probe, a human lymph node cDNA library (6 × 105 plaques) was screened and 29 positive phage were isolated. The cDNA from eight phage that contained inserts larger than 1 kb were subcloned and the nucleotide sequence determined. None of these overlapping partial cDNAs contained the 5' end of the MDC-L cDNA. Therefore, the missing MDC-L cDNA was acquired by 5'-RACE reactions using human lymph node cDNA. The cDNA clones obtained resulted in the reconstruction of two distinct full-length cDNAs with identical 5' nucleotide sequences through bp 1608; however, the two cDNAs diverged beyond this point (Fig. 2). Neither cDNA sequence was found in data base searches using GenBank BLAST. The 2,786-bp cDNA form contained an open reading frame encoding a polypeptide with the typical domain structure of other MDC family members, including a signal peptide, as well as pro, metalloprotease, disintegrin, cysteine-rich, EGF, and transmembrane domains (1, 25, 36, 37) (Fig. 2). We have designated this putative transmembrane protein MDC-Lm (Fig. 3). The 2,087-bp cDNA form contains an open reading frame encoding a protein with a signal peptide, pro, metalloprotease, and disintegrin domains identical to the deduced MDC-Lm protein; however, the cysteine-rich domain differed in sequence and contained a stop codon midway through (Fig. 2).The putative secreted form of this protein has been designated MDC-Ls (Fig. 3). Both MDC-L cDNA forms contain consensus Kozak (38) and polyadenylation signal sequences (39), suggesting that these mRNAs are synthesized and translated (Fig. 2).


View larger version (77K):
[in this window]
[in a new window]
  		Fig. 2.   Sequence of human MDC-L. The nucleotide and deduced protein sequence of human MDC-Lm (GenBank accession no. AF137334) and MDC-Ls (GenBank accession no. AF137335). The MDC-Ls sequence is shown from the point of divergence (down-arrow ) from MDC-Lm. Consensus sequences for Kozak sequence (underlined nucleic acids), putative "cysteine switch" (C), zinc binding site and catalysis HEXXHXXGXXH (underlined residues), disintegrin loop (double underlined), transmembrane domain (dotted underline), N-linked glycosylation (dagger ), and polyadenylation signal (boldface) are shown. Arrows indicate domain boundaries.


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 3.   Two forms of MDC-L. Comparison of the domain structures of MDC-Lm and MDC-Ls. The signal sequence (black), prodomain (white), metalloprotease (hatched), disintegrin domain (diagonal stripes), cysteine-rich domain (dots), EGF domain (horizontal stripes), transmembrane domain (diamonds), and cytoplasmic domain (vertical stripes) are depicted. Also shown are the putative zinc binding site (Zn) and integrin recognition site (AKDE).

Examination of the deduced MDC-L amino acid sequences revealed that the metalloprotease domain has the sequence H339EMGHNFGMFHD350 and C361VMDK365, which fits the consensus sequences for zinc binding, catalytic activity, and the structurally important Met turn motif (3). Molecular modeling demonstrated that the histidines required for zinc ion coordination, catalytic glutamic acid, and Met turn could all be placed correctly within the tertiary structure (data not shown). The prodomain also possessed a "cysteine switch" pattern, S167TCGM171, typically found in MMPs (40). The sequence K195DRK198 exists at the predicted boundary between the prodomain and the metalloprotease domain. This sequence does not fit with the furin-like enzyme cleavage site identified in some MDC and MMP family members (40). The disintegrin domain has the sequence K469DEC472 within the putative integrin recognition loop (2) (Fig. 2). Additionally, the deduced MDC-Lm protein has six potential N-linked glycosylation sites, while the MDC-Ls form has three potential N-linked glycosylation sites. The motifs identified suggest that MDC-L has a catalytically active metalloprotease and a non-RGD integrin recognition site.

MDC-L mRNA Expression-- Messenger RNA from several lymphoid tissues were examined for expression of MDC-Lm and MDC-Ls (Fig. 4). As shown in Fig. 4a, an mRNA of 2.8 kb in lymph node and spleen hybridized to the MDC-Lm probe. Longer exposures also revealed a 2.8-kb mRNA band in the peripheral blood leukocyte mRNA (data not shown). When the same blot was screened with a probe specific for MDC-Ls, a 2.2-kb band was seen in spleen mRNA, but not in lymph node or the other tissues examined (Fig. 4a). Since the MDC-Ls cDNA was originally isolated from lymph node, mRNA from this tissue was used in a more sensitive RT-PCR analysis using one primer common to both cDNAs and another specific for each MDC-L mRNA. As shown in Fig. 4b, PCR products of the expected size were produced in both reactions, and their identity was verified by cleavage at restriction sites unique to each MDC-L cDNA (results not shown). As predicted from the Northern blot results, the MDC-Lm mRNA appeared to be more prevalent. These results indicate that two forms of MDC-L mRNA are expressed in a tissue-specific manner.


View larger version (57K):
[in this window]
[in a new window]
  		Fig. 4.   MDC-Lm and MDC-Ls mRNA are expressed in human lymphoid tissues. Panel a, Northern blot analysis of mRNA (2 µg/lane) from human spleen, lymph node, thymus, peripheral blood leukocytes (Leukocytes), bone marrow, and fetal liver hybridized with probes specific for MDC-Lm, MDC-Ls, and beta -actin. RNA molecular size markers are shown on the left. Panel b, agarose gel (1%) analysis of products obtained from RT-PCR with human lymph node mRNA. One-kb molecular size markers (Life Technologies, Inc.) (lane 1), PCR product obtained with MDC-L 5' primer, L1, and MDC-Lm specific primer, Lm1 (lane 2), and PCR product obtained with MDC-L 5' primer, L1, and MDC-Ls specific primer, Ls1 (lane 3).

The results obtained above prompted us to further examine the tissue specificity of MDC-L expression. Polyadenylated RNA isolated from 50 human tissues were analyzed by mRNA dot blotting with a probe common to both MDC-L forms. MDC-L mRNA was predominantly expressed in secondary lymphoid tissues (Fig. 5). No significant expression was seen in any of the fetal tissues or controls, with the exception of the E. coli DNA control. A comparison of the MDC-L cDNA sequences with the E. coli genome identified a 23-bp region of untranslated E. coli DNA that identically matched 23 bp from the MDC-L probe used. Thus, we believe that the hybridization of the MDC-L probe with the E. coli DNA was artifactual. Since MDC-L mRNA appeared to be specific for secondary lymphoid tissues, we suspected that it was the lymphocyte population in these tissues that express MDC-L.


View larger version (30K):
[in this window]
[in a new window]
  		Fig. 5.   Tissue expression of MDC-L mRNA. A dot blot of polyadenylated RNA isolated from various human adult tissues (A1-F4 and black bars), fetal tissues (G1-G8 and hatched bars), and controls (H1-H8 and white bars) was hybridized with a 190-bp probe spanning the disintegrin domain coding sequence of MDC-L. The resulting autoradiograph (upper left-hand corner) is shown. The relative amount of bound probe (relative intensity) for each tissue was determined by scanning densitometry.

Lymphocyte Expression of MDC-L-- Peripheral blood leukocytes were further analyzed for the presence of MDC-Lm and MDC-Ls mRNA. Biomagnetic separation was used to isolate anti-CD2, CD19, CD14, and CD16 positive cells from normal whole blood. Each of these was then analyzed by nested RT-PCR for the presence of MDC-Lm and MDC-Ls mRNA (Fig. 6a). Both T- and B-lymphocytes, CD2 and CD19 positive cells, respectively, expressed MDC-Lm and MDC-Ls mRNA. MDC-L mRNA was also seen in the CD14 and CD16 positive populations. Although Northern blot analysis suggested that MDC-Lm mRNA was synthesized in peripheral blood leukocytes at low levels, results from RT-PCR indicate that mRNA from both forms of MDC-L are expressed.


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 6.   Expression of MDC-L by peripheral blood lymphocytes. Panel a, polyacrylamide gel (5%) analysis of RT-PCR products obtained from mRNA isolated from CD2, CD19, CD14, and CD16 positive peripheral blood cells. Shown are the PCR products obtained from the secondary PCR of MDC-Lm (5 µl) and MDC-Ls (5 µl), and the primary RT-PCR results for beta -actin (10 µl). Panel b, Western blot of peripheral blood lymphocyte whole cell lysates (200 µg/lane) after separation on a 7.5% SDS-PAGE under non-reducing (NR) or reducing (R) conditions. The anti-MDC-L disintegrin domain (Anti-Disintegrin) and control pre-immune serum (Pre-Immune) were used at a 1:10,000 dilution. The molecular sizes of the anti-MDC-L disintegrin domain reactive proteins are shown on the left.

MDC-L protein expression in peripheral blood lymphocytes was examined by immunoblotting whole cell lysates (200 µg/lane) with an anti-MDC-L disintegrin domain polyclonal serum. Under non-reducing conditions, two bands of 87 and 67 kDa were specifically recognized (Fig. 6b). Similar results were typically obtained under reduced conditions except the 87-kDa species migrated at 92 kDa. These molecular sizes approximate those predicted from the cDNA (MDC-Lm = 85,359 Da and MDC-Ls = 59,427 Da). However, these results could not distinguish whether the 67-kDa protein was the MDC-Ls protein or a processed form of the MDC-Lm protein lacking the prodomain. These results did indicate that the MDC-Lm, and possibly the MDC-Ls, proteins are expressed by peripheral blood lymphocytes.

To determine which cell types within the lymphoid tissue were expressing the MDC-L protein, the anti-MDC-L disintegrin domain antiserum was used for immunohistochemical staining of sections from human lymph node, small intestine, colon, stomach, spleen, thymus, and appendix. The results for lymph node, small intestine, and stomach are shown in Fig. 7. Cells with typical lymphocyte morphology were specifically recognized by the anti-MDC-L antibody in all the tissues examined. The majority of the lymph node MDC-L positive (MDC-L+) lymphocytes were seen in the cortex and paracortex; only a few MDC-L+ cells were localized within the follicles (Fig. 7a). MDC-L+ lymphocytes were also found in white pulp of the spleen and thymus, although the percentage of lymphocytes that were MDC-L+ appeared to be much lower in these tissues compared with lymph node and appendix (data not shown). MDC-L+ lymphocytes of the small intestine and colon were found intraepithelially and within the lamina propria (Fig. 7b). Examination of stomach showed MDC-L+ staining of lymphocytes in the lamina propria, muscularis mucosa, and lymphoid aggregates (Fig. 7, c and d). These results demonstrate that a fraction of the lymphocyte population was specifically recognized by the anti-MDC-L.


View larger version (130K):
[in this window]
[in a new window]
  		Fig. 7.   Lymphocyte expression of MDC-L in tissues. Immunohistochemical staining of tissue sections from human lymph node (a), small intestine (b), and stomach (c and d) stained with affinity-purified anti-MDC-L disintegrin domain antibody. Bound antibody was disclosed using the immunoperoxidase method and the sections counterstained with hematoxylin (see "Experimental Procedures"). Note the follicle (F) and lymphoid aggregate (L) in lymph node and stomach, respectively (a and d). MDC-L positive lymphocytes (arrows) show dark brown staining.

Expression of MDC-L by T- and B-lymphocyte Cell Lines-- Since the RT-PCR and immunohistochemical studies indicated that both T- and B-lymphocytes were MDC-L+, the T-cell lines HuT78 (alpha beta T-cell receptor) and A139.1 (gamma delta T-cell receptor), as well as the B-cell line RD105U were examined for the expression of MDC-L. A protein of 87 kDa was specifically recognized in all three cell lines by an anti-MDC-L disintegrin domain antiserum in immunoblots of whole cell lysates (Fig. 8a). A single protein of 87 kDa was also specifically immunoprecipitated from surface-labeled cells (Fig. 8b). The specificity of the anti-disintegrin domain antibody was verified by immunoblotting and immunoprecipitation of an 87-kDa protein with a polyclonal antibody that recognizes the EGF domain of MDC-L (Fig. 8, c and d). Neither antiserum specifically recognized any protein in Western blots of the erythroleukemic cell line K562 or human umbilical vein endothelial cells (data not shown). These findings indicate that, at least in the transformed state, both T- and B-lymphocytes express the transmembrane form of MDC-L on the cell surface.


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 8.   Expression of MDC-Lm on the surface of transformed lymphocytes. For Western blot, whole cell lysates (25 µg/lane) from HuT78 (panel a) and RD105U (panel c) cells were Western blotted with anti-MDC-L EGF domain (Anti-EGF), pre-immune (Control), and anti-MDC-L disintegrin domain (Anti-Dis) antiserum after separation on a 7.5% SDS-PAGE under non-reducing conditions. Immunoprecipitation: HuT78 (panel b) and RD105U (panel d) cells were surface-biotinylated, lysed, and proteins immunoprecipitated with anti-MDC-L EGF domain, pre-immune, and anti-disintegrin domain antiserum. Arrows indicate location of 87-kDa protein. Locations of molecular markers are also shown.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study describes a novel member of the MDC protein family, which we have named MDC-L (ADAM 23) because of its expression in human lymphocytes. Two distinct transcripts that encoded a transmembrane, MDC-Lm, and potentially secreted, MDC-Ls, form of the protein were identified. MDC-L mRNA was predominantly localized to secondary lymphoid tissues, and further examination demonstrated that the lymphocyte population was responsible for MDC-L expression in these tissues.

A PCR approach using degenerate oligonucleotides was used to identify MDC protein family members expressed in human lymph node. Disintegrin domain sequences encoded by MDC-9 and MDC-20 were found; however, the overwhelming majority of the inserts encoded the disintegrin domain of MDC-L. Although it is tempting to propose that MDC-L is the major MDC protein expressed by lymphocytes, PCR approaches such as this may tend to select for a particular cDNA species. Therefore, other disintegrin domain containing proteins may not have shown up in our study. Two MDC family members have been shown to be expressed within lymph node: decysin and TACE (41, 42). Decysin, which is expressed by germinal center dendritic cells, possesses a truncated disintegrin domain and does not have a typical MDC protein domain structure. The disintegrin domain of TACE lacks the carboxyl-terminal conserved residues incorporated in the design of the degenerate oligonucleotides. Thus, TACE would not have been expected to produce a PCR product under the experimental conditions used in this study (11, 12). It is not surprising MDC-9 was identified in this study, since this protein is a widely expressed secretase (14). Interestingly, MDC-20 was previously reported as a testis-specific protein (35). The presence of MDC-20 observed here may be due to genomic DNA contamination of the cDNA library or expression of MDC-20 at low levels within other tissues such as human lymph node.

MDC-Lm possessed a prototypical MDC or ADAM family domain structure. Consensus sequences for zinc binding and catalytic activity were present, suggesting that MDC-L may have a proteolytic function. Several MDC proteins have been shown to have an active metalloprotease. MDC-9, TACE, and KUZ function in ectodomain shedding (11, 12, 14, 16), MADM (MDC-10) has type IV collagenase activity (43, 44), and meltrin-alpha (MDC-12) recognizes alpha 2-macroglobulin (45). The metalloprotease domain of MDC-L was most homologous to the hemorrhagic metalloproteases fibrolase and jararhagin found in the venom of Agkistrodon contortrix and Bothrops jararaca, respectively (46, 47). Since both of these snake venom metalloproteases have fibrinolytic activity, the MDC-L metalloprotease may have a MMP-like activity. However, a role in ectodomain shedding of a lymphocyte surface target proteins, such as FasL or CD40L, has not been ruled out. MDC-L also possessed a consensus sequence for a cysteine switch found to regulate proteolytic activity in some MDC and MMP protein family members. However, MDC-L did not contain a consensus cleavage sequence for a furin-type endopeptidase at the prodomain-metalloprotease boundary. Several proteolytically active MMPs also lack a consensus sequence for furin cleavage, suggesting that another mechanism for removal of the prodomain may exist for MDC-L (40). The sequence motifs noted here suggest that MDC-L may be synthesized as a zymogen that becomes enzymatically active upon maturation.

Snake venom disintegrin peptides function as antagonists of integrin receptor function (4, 48). The integrin recognition site in several of these disintegrin peptides has been localized to an RGD sequence within an extended loop of the peptide. Integrin recognition of mammalian MDC disintegrin domains has only been demonstrated for MDC-15 and the fertilins (7, 9, 10). In the case of MDC-15, an RGD sequence located within a region similar to that of the snake venom peptides is recognized by the integrin alpha vbeta 3 (10). A synthetic peptide derived from the same region within the mouse fertilin-beta disintegrin domain, AQDE, has been shown to inhibit sperm-egg adhesion and cell fusion (7, 8). Evidence suggests that this peptide is blocking sperm binding to the mouse egg integrin alpha 6beta 1 (9). MDC-L contains a sequence at this site, AKDE, similar to that found in fertilin-beta , suggesting the possibility that MDC-L may also be recognized by the integrin alpha 6beta 1.

Two distinct MDC-L transcripts were identified in this study. These may arise from alternative splicing or gene duplication. The precedent for alternative splicing of another MDC protein family member exists. Similar to the results shown here for MDC-L, MDC-12 is also expressed as transmembrane and secreted forms (49). MDC-L and MDC-12 differ with respect to the point of divergence between the transmembrane and secreted forms. The two forms of MDC-L diverge midway through the cysteine-rich domain, whereas the two MDC-12 forms diverge at the start of the transmembrane domain. MDC-Lm and MDC-Ls were observed to differ in tissue expression. MDC-Ls was preferentially expressed in spleen, although it could also be detected in lymph node using RT-PCR techniques. This suggests that each of the forms of MDC-L has unique functions.

Northern, RT-PCR, and immunoblot results indicated that MDC-Lm is expressed by peripheral blood lymphocytes at low levels. Although none of these results are quantitative, the increase in mRNA expression observed in lymphoid tissues suggests that MDC-L expression may be up-regulated during or after lymphocyte extravasation. The RT-PCR results demonstrated the presence of MDC-Lm and MDC-Ls transcripts in peripheral blood T- and B-lymphocytes. In addition, MDC-Lm mRNA was present in the CD14 and CD16 positive populations. These results suggest that other leukocytes may express MDC-L. Alternatively, the CD14 and CD16 populations, which are predominantly made up of monocytes and neutrophils, respectively, may also contain B-lymphocytes and NK cells, respectively. Further studies are required to clearly quantitate MDC-Lm expression on the surface of specific peripheral blood leukocyte lineages.

MDC-Lm was expressed as an 87-kDa protein on the surface of both T- and B-lymphocyte cell lines and peripheral blood lymphocytes. The identity of MDC-Lm was confirmed by immunoblot and immunoprecipitation with a polyclonal anti-MDC-L EGF domain antiserum. Since this domain was not present in MDC-Ls, the anti-MDC-L EGF antiserum would be expected to specifically recognize the MDC-Lm protein. Only a single protein of 87 kDa was immunoprecipitated with both anti-MDC-L disintegrin domain and anti-MDC-L EGF antiserum, suggesting that MDC-Lm does not covalently associate with other lymphocyte cell surface proteins. Attempts to immunoprecipitate a secreted form of MDC-L from conditioned media or from human plasma were unsuccessful (results not shown); thus, we were unable to demonstrate translation of the MDC-Ls transcript. Peripheral blood lymphocytes did express a 62-kDa anti-MDC-L disintegrin domain reactive protein. Whether this band was a processed form of MDC-Lm lacking the prodomain or cell-associated MDC-Ls was not determined.

At present there are 22 members of the MDC or ADAM protein family. While the in vivo function of only a few have been determined, the roles established are both diverse and important to the development and life of an organism. One of the first identified roles for MDC proteins was in sperm-egg fusion. These MDC proteins all possess a characteristic fusion peptide, which was not present in either of the MDC-L cDNA sequences (5). However, this does not rule out a role in cell adhesion for MDC-L.

The identification of an MDC protein expressed by lymphocytes suggests that MDC-L may have an important immunological function. FasL is shed from the surface of cytotoxic T-cells by an unknown metalloprotease, and sFasL has been proposed to function in protection of neighbor cells from apoptosis (21). An unknown metalloprotease is also implicated in the shedding of CD40L from the surface of T-lymphocytes (22). MDC-L may also function in a similar fashion to MMPs, which are required for emigration of lymphocytes from the vasculature. The expression pattern observed in this study indicates that MDC-L is expressed by both mature T- and B-lymphocytes. With the aid of anti-MDC-L monoclonal antibodies and the many well characterized lymphocyte surface markers, it should be possible to determine the temporal and leukocyte lineage expression pattern of MDC-L. This information should provide valuable insight into the in vivo function of this novel MDC protein.

    ACKNOWLEDGEMENTS

We thank Dr. George Dale and Dr. Richard Cummings for helpful discussions and suggestions on the manuscript. We also thank Scott M. Hough for excellent technical assistance.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant GM51616 and the Oklahoma Center for the Advancement of Science and Technology.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF137334 and AF137335.

To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, BRC 417, P. O. Box 26901, Oklahoma City, OK 73190. Tel.: 405-271-5992; Fax: 405-271-3910; E-mail: ron-bowditch@ouhsc.edu.

    ABBREVIATIONS

The abbreviations used are: MDC, metalloprotease disintegrin cysteine-rich protein; ADAM, a disintegrin and metalloprotease; EGF, epidermal growth factor; MMP, matrix metalloprotease; TACE, tissue necrosis factor-alpha -converting enzyme; PCR, polymerase chain reaction; RACE, 5'-rapid amplification of cDNA ends; RT, reverse transcriptase; PAGE, polyacrylamide gel electrophoresis; kb, kilobase(s); bp, base pair(s); PBS, phosphate-buffered saline; FCS, fetal calf serum; Tricine, N-tris(hydroxymethyl)methylglycine.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Blobel, C. P. (1997) Cell 90, 589-592[CrossRef][Medline] [Order article via Infotrieve]
2. Wolfsberg, T. G., and White, J. M. (1996) Dev. Biol. 180, 389-401[CrossRef][Medline] [Order article via Infotrieve]
3. Stocker, W., Grams, F., Baumann, U., Reinemer, P., Gomis-Ruth, F.-X., McKay, D. B., and Bode, W. (1995) Protein Sci. 4, 823-840[Abstract]
4. Niewiarowski, S., McLane, M. A., Kloczewiak, M., and Stewart, G. J. (1994) Semin. Hematol. 31, 289-300[Medline] [Order article via Infotrieve]
5. Blobel, C. P., Wolfsberg, T. G., Turck, C. W., Myles, D. G., Primakoff, P., and White, J. M. (1992) Nature 356, 248-252[CrossRef][Medline] [Order article via Infotrieve]
6. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y.-i., and Fujisawa-Sehara, A. (1995) Nature 377, 652-656[CrossRef][Medline] [Order article via Infotrieve]
7. Myles, D. G., Kimmel, L. H., Blobel, C. P., White, J. M., and Primakoff, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4195-4198[Abstract/Free Full Text]
8. Yuan, R., Primakoff, P., and Myles, D. G. (1997) J. Cell Biol. 137, 105-112[Abstract/Free Full Text]
9. Almeida, E. A. C., Huovila, A.-P. J., Sutherland, A. E., Stephens, L. E., Calarco, P. G., Shaw, L. M., Mercurio, A. M., Sonnenberg, A., Primakoff, P., Myles, D. G., and White, J. M. (1995) Cell 81, 1095-1104[CrossRef][Medline] [Order article via Infotrieve]
10. Zhang, X.-P., Kamata, T., Yokoyama, K., Puzon-Mclaughlin, W., and Takada, Y. (1998) J. Biol. Chem. 273, 7345-7350[Abstract/Free Full Text]
11. Black, R. A., Rauch, C. T., Kozlosky, C. J., Peschon, J. J., Slack, J. L., Wolfson, M. F., Castner, B. J., Stocking, K. L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K. A., Gerhart, M., Davis, R., Fitzner, J. N., Johnson, R. S., Paxton, R. J., March, C. J., and Cerretti, D. P. (1997) Nature 385, 729-733[CrossRef][Medline] [Order article via Infotrieve]
12. Moss, M. L., Jin, S.-L. C., Milla, M. E., Burkhart, W., Carter, H. L., Chen, W.-J., Clay, W. C., Didsbury, J. R., Hassler, D., Hoffman, C. R., Kost, T. A., Lambert, M. H., Leesnitzer, M. A., McCauley, P., McGeehan, G., Mitchell, J., Moyer, M., Pahel, G., Rocque, W., Overton, L. K., Schoenen, F., Seaton, T., Su, J.-L., Warner, J., Willard, D., and Becherer, J. D. (1997) Nature 385, 733-736[CrossRef][Medline] [Order article via Infotrieve]
13. Peschon, J. J., Slack, J. L., Reddy, P., Stocking, K. L., Sunnarborg, S. W., Lee, D. C., Russell, W. E., Castner, B. J., Johnson, R. S., Fitzner, J. N., Boyce, R. W., Nelson, N., Kozlosky, C. J., Wolfson, M. F., Rauch, C. T., Cerretti, D. P., Paxton, R. J., March, C. J., and Black, R. A. (1998) Science 282, 1281-1284[Abstract/Free Full Text]
14. Izumi, Y., Hirata, M., Hasuwa, H., Iwamoto, R., Umata, T., Miyado, K., Tamai, Y., Kurisaki, T., Sehara-Fujisawa, A., Ohno, S., and Mekada, E. (1998) EMBO J. 17, 7260-7272[CrossRef][Medline] [Order article via Infotrieve]
15. Rooke, J., Pan, D., Xu, T., and Rubin, G. M. (1996) Science 272, 1227-1231[CrossRef]
16. Pan, D., and Rubin, G. M. (1997) Cell 90, 271-280[CrossRef][Medline] [Order article via Infotrieve]
17. Qi, H., Rand, M. D., Wu, X., Sestan, N., Wang, W., Rakic, P., Xu, T., and Artavanis-Tsakonas, S. (1999) Science 283, 91-94[Abstract/Free Full Text]
18. Hooper, N. M., Karran, E. H., and Turner, A. J. (1997) Biochem. J. 321, 265-279
19. Kahn, J., Ingraham, R. H., Shirley, F., Migaki, G. I., and Kishimoto, T. K. (1994) J. Cell Biol. 125, 461-470[Abstract/Free Full Text]
20. Freehan, C., Darlak, K., Kahn, J., Walcheck, B., Spatola, A. F., and Kishimoto, T. K. (1996) J. Biol. Chem. 271, 7019-7024[Abstract/Free Full Text]
21. Tanaka, M., Itai, T., Adachi, M., and Nagata, S. (1998) Nat. Med. 4, 31-36[CrossRef][Medline] [Order article via Infotrieve]
22. Pietravalle, F., Lecoanet-Henchoz, S., Blasey, H., Aubry, J.-P., Elson, G., Edgerton, M. D., Bonnefoy, J.-Y., and Gauchat, J.-F. (1996) J. Biol. Chem. 271, 5965-5967[Abstract/Free Full Text]
23. Fickenscher, H., Bokel, C., Knappe, A., Biesinger, B., Meinl, E., Fleischer, B., Fleckenstein, B., and Broker, B. M. (1997) J. Virol. 71, 2252-2263[Abstract]
24. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
25. Weskamp, G., and Blobel, C. P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2748-2751[Abstract/Free Full Text]
26. Herrmann, J., Lee, P., Saya, H., and Nakajima, M. (1990) BioTechniques 8, 376-378[Medline] [Order article via Infotrieve]
27. Verca, G. D., Northemann, W., Shiels, B. R., Widera, G., and Broome, S. (1990) BioTechniques 8, 370-371[Medline] [Order article via Infotrieve]
28. Bowditch, R. D., Halloran, C. E., Aota, S., Obara, M., Plow, E. F., Yamada, K. M., and Ginsberg, M. H. (1991) J. Biol. Chem. 266, 23323-23328[Abstract/Free Full Text]
29. Harlow, E., and Lane, D. (1988) Antibodies , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
30. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
31. Laszik, Z., Jansen, P. J., Cummings, R. D., Tedder, T. F., McEver, R. P., and Moore, K. L. (1996) Blood 88, 3010-3021[Abstract/Free Full Text]
32. Guex, N., and Peitsch, M. C. (1997) Electrophoresis 18, 2714-2723[CrossRef][Medline] [Order article via Infotrieve]
33. Madden, T. L., Tatusov, R. L., and Zhang, J. (1996) Methods Enzymol. 266, 131-141[Medline] [Order article via Infotrieve]
34. Weskamp, G., Kratzchmar, J., Reid, M. S., and Blobel, C. P. (1996) J. Cell Biol. 132, 717-726[Abstract/Free Full Text]
35. Hooft van Huijsduijnen, R. (1998) Gene (Amst.) 206, 273-282[CrossRef][Medline] [Order article via Infotrieve]
36. Wolfsberg, T. G., Straight, P. D., Gerna, R. L., Huovila, A.-P. J., Primakoff, P., Myles, D. G., and White, J. M. (1995) Dev. Biol. 169, 378-383[CrossRef][Medline] [Order article via Infotrieve]
37. Wolfsberg, T. G., Primakoff, P., Myles, D. G., and White, J. M. (1995) J. Cell Biol. 131, 275-278[Free Full Text]
38. Kozak, M. (1984) Nucleic Acids Res. 12, 857-872[Abstract/Free Full Text]
39. Fitzgerald, M., and Shenk, T. (1981) Cell 24, 251-260[CrossRef][Medline] [Order article via Infotrieve]
40. Massova, I., Kotra, L. P., Fridman, R., and Mobashery, S. (1998) FASEB J. 12, 1075-1095[Abstract/Free Full Text]
41. Patel, I. R., Attur, M., G., Patel, R. N., Stuchin, S. A., Abagyan, R. A., Abramson, S. B., and Amin, A. R. (1998) J. Immunol. 160, 4570-4579[Abstract/Free Full Text]
42. Mueller, C. G. F., Rissoan, M.-C., Salinas, B., Ait-Yahia, S., Ravel, O., Bridon, J.-M., Briere, F., Lebecque, S., and Liu, Y.-J. (1997) J. Exp. Med. 186, 655-663[Abstract/Free Full Text]
43. Howard, L., Lu, X., Mitchell, S., Griffiths, S., and Glynn, P. (1996) Biochem. J. 317, 45-50
44. Millichip, M. I., Dallas, D. J., Wu, E., Dale, S., and McKie, N. (1998) Biochem. Biophys. Res. Commun. 245, 594-598[CrossRef][Medline] [Order article via Infotrieve]
45. Loechel, F., Gilpin, B. J., Envall, E., Albrechtsen, R., and Wewer, U. M. (1998) J. Biol. Chem. 273, 16993-16997[Abstract/Free Full Text]
46. Kamiguti, A. S., Slupsky, J. R., Zuzel, M., and Hay, C. R. (1994) Thromb. Res. 72, 244-249
47. Retzios, A. D., and Markland, F. S. J. (1988) Thromb. Res. 52, 541-552[CrossRef][Medline] [Order article via Infotrieve]
48. McLane, M. A., Marcinkiewicz, C., Vijay-Kumar, S., Wierbicka-Patynowski, I., and Niewiarowski, S. (1998) Soc. Exp. Biol. Med. 219, 109-119[Abstract]
49. Gilpin, B. J., Loechel, F., Mattei, M.-G., Engvall, E., Albrechtsen, R., and Wewer, U. M. (1998) J. Biol. Chem. 273, 157-166[Abstract/Free Full Text]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. Shimoda, G. Hashimoto, S. Mochizuki, E. Ikeda, N. Nagai, S. Ishida, and Y. Okada
Binding of ADAM28 to P-selectin Glycoprotein Ligand-1 Enhances P-selectin-mediated Leukocyte Adhesion to Endothelial Cells
J. Biol. Chem., August 31, 2007; 282(35): 25864 - 25874.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
C. Frohlich, R. Albrechtsen, L. Dyrskjot, L. Rudkjaer, T. F. Orntoft, and U. M. Wewer
Molecular Profiling of ADAM12 in Human Bladder Cancer
Clin. Cancer Res., December 15, 2006; 12(24): 7359 - 7368.
[Abstract] [Full Text] [PDF]