HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zumbihl, R. Articles by Heesemann, J. Search for Related Content PubMed PubMed Citation Articles by Zumbihl, R. Articles by Heesemann, J. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 41, 29289-29293, October 8, 1999

The Cytotoxin YopT of Yersinia enterocolitica Induces Modification and Cellular Redistribution of the Small GTP-binding Protein RhoA^*

Robert Zumbihl, Martin Aepfelbacher, Andreas Andor, Christoph A. Jacobi, Klaus Ruckdeschel, Bruno Rouot^§, and Jürgen Heesemann

From the Max von Pettenkofer Institut für Hygiene und Mikrobiologie, Pettenkoferstrasse 9a, 80336 Munich, Germany and the ^§ INSERM U431, Université Montpellier II, 34095 Montpellier, France

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Pathogenic Yersinia enterocolitica produces two virulence plasmid-encoded cytotoxins, YopE and YopT, that are translocated into target cells where they disrupt the actin cytoskeleton. Here we show that infection of cells with wild type Y. enterocolitica and a yopE mutant, but not with a yopT mutant, induces an increase in the electrophoretic mobility of the small GTPase RhoA. As tested by isoelectric focusing, YopT-dependent modification resulted in an acidic shift of RhoA. Furthermore, RhoA modification induced by YopT was accompanied by redistribution of membrane-bound RhoA toward the cytosol. Finally, a yopE mutant of Y. enterocolitica expressing the cytotoxic activity of YopT specifically disrupted RhoA-controlled actin stress fibers. These findings provide evidence for inactivation of RhoA by the translocated Y. enterocolitica cytotoxin YopT and suggest a novel inhibitory modification of RhoA by a bacterial virulence factor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Pathogenic species of the genus Yersinia (Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia pestis) are able to resist the nonspecific immune defense of the host. This common feature of all three species of Yersinia is dependent on the presence of a 70-kilobase virulence plasmid, called pYV in Y. enterocolitica. The genes on the pYV plasmid encode (i) about 30 proteins that together form a type III secretion apparatus, (ii) about six proteins considered to be translocator Yops¹, (iii) six proteins designated effector Yops (1). Upon binding of Yersinia to the surface of the eukaryotic target cell, the effector Yops are translocated in a polarized fashion into the cell cytoplasm through a complex machinery involving the type III secretion system and the translocator Yops (2). The current idea is that once inside the host cell the effector Yops engage in signal transduction pathways with the aim to subvert host cell defense. In this regard it has been shown that important immune cell functions such as phagocytosis, superoxide anion production, and tumor necrosis factor- production can be blocked by the effector Yops (1).

The six effector Yops of Y. enterocolitica known to date include YopM, YopH, YopO (called YpkA in Y. pseudotuberculosis), YopP (called YopJ in Y. pseudotuberculosis), YopE, and YopT. So far no cellular phenotype due to YopM has been reported. YopH is a tyrosine phosphatase that was shown to dephosphorylate p130^Cas and FAK in HeLa cells leading to disruption of peripheral focal complexes (3, 4). YopP/YopJ is crucial for Yersinia's ability to induce apoptosis in macrophages (5) and works most probably by inhibition of NFB activation in combination with inhibition of mitogen-activated protein kinases (6, 7). YpkA/YopO shares extensive homology with mammalian serine/threonine kinases and, when overexpressed by Y. pseudotuberculosis, causes a contractile phenotype in HeLa cells (8). Finally, YopE and YopT have been designated cytotoxins because a yopE mutant of Y. pseudotuberculosis lost its ability to disrupt the actin cytoskeleton (9) and a Y. enterocolitica mutant expressing only YopT, but not YopM, YopE, YopH, YopO, and YopP, was able to disrupt actin structures in HeLa cells (10). Except for YopH, no target molecules have been reported for the effector Yops.

A variety of bacterial exotoxins can disrupt the actin cytoskeleton by inhibiting small GTP-binding proteins of the Rho family (11). Rho GTPases such as Rho, Rac, and CDC42Hs are central regulators of actin polymerization in all cells (12). Rho is necessary for stress fiber formation, Rac regulates ruffles, and CDC42Hs produces filopodia/microspikes. To date known enzyme activities responsible for covalent modification and inhibition of Rho proteins are ADP-ribosyltransferases (C3 from Clostridium botulinum) (13), monoglucosyltransferases (Clostridium difficile toxins A and B, Clostridium sordellii LT), or N-acetylglucosaminetransferases (Clostridium novyi -toxin) (14-17). Another group of toxins, CNF1 from enterotoxigenic Escherichia coli or dermonecrotizing toxin from Bordetella bronchiseptica, deamidate glutamine residue 63 of Rho, which constitutively activates Rho (18-20).

In this study we addressed the question whether the intracellularly translocated Yersinia cytotoxins YopE or YopT act through modification of Rho. We demonstrate a specific modification and inactivation of RhoA by Y. enterocolitica YopT.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Bacterial Strains-- Bacterial strains used in this study are listed in Table I. For inactivation of YopT we employed the suicide plasmid pGP704, where the ampR gene was replaced by the catR gene giving pGPCAT.

An internal polymerase chain reaction product of YopT (forward primer, GACTAGGTACCATGCTGGATAGAAAGT; reverse primer, GACTAGAGCTCAAATAAGCTTTGGCCC) was ligated into the KpnI/SalI-site of the suicide vector pGPCAT generating pGPCATT and transformed into E. coli strain SM10  pir. The suicide hybrid plasmid was integrated into the yopT gene of WA-C(pYVO8) after conjugation and homologous recombination, resulting in WA-C(pYVO8T). Insertional inactivation of the yopT gene was checked by Southern blot analysis. A Y. enterocolitica yopE mutant strain WA-C(pYVO8E) was constructed by transposon mutagenesis using the TnMax mini-transposon system as described previously (21). The Y. enterocolitica pYVO:8 virulence plasmid cointegrated in vector pRK290 was mobilized in E. coli strain E131 to serve as target plasmid. Transposon mutagenesis was performed by using TnMax25, which transfers resistance to chloramphenicol. Transposition under control of the inducible Ptrc promotor was induced by growth in the presence of 1 mM isopropyl--D-thiogalactopyranoside. Transposon-carrying target plasmids were separated by conjugation into the virulence plasmid-cured Y. enterocolitica strain WAC. We analyzed the pattern of Yops released by single colonies under Ca²⁺-deprived conditions to detect mutants that are defective in the secretion of YopE (22).

Infection Experiment, Cell Extract Preparation, ADP-ribosylation, Two-dimensional Gel Electrophoresis, and Western Blot Analysis-- Bacteria were grown overnight in Luria broth medium at 27 °C under antibiotic selection. COS-7 cells grown in standard Dulbecco's modified Eagle's medium were seeded in 175-cm² flasks the day before the infection experiment to give a subconfluent monolayer. For infection, the medium was removed and replaced by prewarmed Dulbecco's modified Eagle's medium without antibiotics supplemented with 5% fetal calf serum. COS-7 cells were infected with the Yersiniae at a m.o.i. of 50 for 2 h. Cells were recovered by scraping, washed twice with ice-cold PBS, once in 20 mM Tris-HCl, pH 7.5, 3 mM MgCl₂, 1 mM EGTA (buffer A), and lysed with the same buffer containing 0.1% Triton X-100. Membrane and cytosolic fractions were prepared in buffer A using a Dounce homogenizer. Postnuclear supernatant was centrifuged at 100,000 × g for 30 min at 4 °C in a TLA-100 (Beckman) bench top centrifuge. The supernatant, containing the cytosolic fraction was removed, and the crude membrane fraction was once washed in buffer A and then dissolved in buffer A. The protein content in the membrane, cytosolic, or Triton X-100-soluble fraction was measured by the Bradford assay from Bio-Rad using bovine serum albumin as a standard. For the ADP-ribosylation reaction, equal amounts (50 µg) of protein from the different fractions were incubated in a reaction buffer containing 1 mM dithiothreitol, 1 mM EGTA, 10 mM thymidine, 0.05% Triton X-100, 1 µg/ml C3 toxin (Calbiochem), 20 mM Tris-HCl, pH 7.5, 3 mM MgCl₂, 1 µCi of [³²P]NAD (final concentration) (Amersham Pharmacia Biotech, Freiburg, Germany). The reaction was performed at 30 °C for 30 min and stopped by adding sample buffer before analysis by 15% SDS-PAGE. For the two-dimensional gel electrophoresis we used an immobilized pH gradient (IPG) as described elsewhere (25). In each experiment, 200-µg aliquots of cytosolic proteins were precipitated by 6 volumes of cold acetone, dissolved in two-dimensional sample buffer, and subjected to isoelectric focusing followed by SDS-PAGE. Western blots were performed as described previously (6) using the monoclonal antibody 26C4 raised against RhoA. The isoelectric point (pI) of RhoA was calculated after plotting the linear pH gradient of the gel strip versus length of the gel strip and determination of the position of the protein in the gel strip. All experiments were repeated at least three times and representative results are shown.

Immunofluorescence-- Fluorescence staining with rhodamine phalloidin of HUVEC infected with different Yersinia strains was done exactly as described previously (26). Briefly, HUVEC grown on collagen coated glass coverslips were infected at a m.o.i. of 50. After 90 min cells were washed gently with PBS, fixed with 3.7% formaldehyde in PBS for 10 min, permeabilized for 5 min in cold acetone, and air-dried. Coverslips were then incubated for 20 min with rhodamine phalloidin and mounted in Mowiol containing p-phenylenediamine as antifading agent.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

YopT-dependent Modification of RhoA in Cells Infected with Y. enterocolitica-- In most reports, covalent modification of Rho by bacterial cytotoxins induces a change in the electrophoretic mobility of Rho (18, 19). To test whether the translocated Yersinia cytotoxins modify Rho, we infected COS-7 cells with different Y. enterocolitica strains (summarized in Table I). Thereafter, Triton X-100-soluble COS-7 cell extracts were prepared, and Rho proteins were labeled by addition of [³²P]NAD and C3-transferase of C. botulinum. C3 transfers the [³²P]ADP-ribosyl group of [³²P]NAD to the asparagine residue 41 of RhoA, RhoB, and RhoC (13). After SDS-PAGE and transfer, autoradiography showed appearance of a faster migrating form of ³²P-ADP-ribosylated Rho in cells infected with the virulence plasmid-carrying Y. enterocolitica O8 strain (WA-C(pYVO8)) (Fig. 1A). Infection of cells with strain WA-C (plasmid-cured Y. enterocolitica O8) strain or a lcrD mutant deficient in Yop secretion (WA-C(pYV-515)) did not produce the faster migrating form of Rho. We next infected cells with a Y. enterocolitica mutant in which either the yopE gene (WA-C(pYVO8E)) or the yopT gene was knocked out (WA-C(pYVO8T)). The results clearly show that WA-C(pYVO8T) was unable to produce the faster migrating form of Rho, whereas WA-C(pYVO8E) behaved like WA-C(pYVO8). As expected, complemented strain WA-C(pYVO8T/+T) restored the appearance of the faster migrating form of Rho. We also infected cells with wild type Yersinia containing single disruptions of the genes for YopP, YopO, YopM, or YopH (6). All of these strains were able to induce the increase in electrophoretic mobility of Rho, indicating that none of these effector Yops played a role in the YopT-dependent Rho modification (data not shown). Interestingly, incorporation of [³²P]ADP-ribose was consistently more efficient in WA-C(pYVO8) infected cells than in control cells, suggesting that the YopT-modified Rho protein was a better substrate for the C3-transferase or that the modification increased the amount of Rho available as substrate. Western blot of the ³²P-ADP-ribosylated proteins of Fig. 1A developed with a specific anti-RhoA antibody revealed that the ³²P-ADP-ribosylated protein bands were RhoA (Fig. 1B). In lysates of control cells or cells infected with Yersinia strains unable to induce the RhoA modification, the antibody revealed an additional band migrating at higher mobility. This RhoA band was not ³²P-ADP-ribosylated, presumably because it was protected by binding to another protein like the guanine nucleotide dissociation inhibitor of Rho, Rho-GDI. In agreement with this, the presence of phosphatidylinositol bisphosphate (a lipid known to dissociate Rho-GDI from Rho (27)) during the ADP-ribosylation reaction suppressed this additional immunoreactive band (data not shown). Interestingly, in all cell lysates containing YopT-modified RhoA this non-³²P-ADP-ribosylated band was absent, further suggesting better accessibility of modified RhoA to the C3-transferase. Western blot analysis using specific antibodies against other Rho GTPases did not reveal any change in the electrophoretic mobility of CDC42Hs, RhoB or Rac upon cell infection with WA-C(pYVO8) (data not shown). Taken together, these data indicate a specific modification of RhoA by the intracellularly translocated Yersinia cytotoxin YopT.

View larger version (45K): [in this window] [in a new window]   Fig. 1.   C3 ADP-ribosylation and RhoA-Western blot analysis of Triton X-100 extracts of Yersinia-infected cells. Subconfluent COS-7 cells were not infected (Control) or infected with WA-C, WA-C(pYVO8), WA-C(pYVO8E), WA-C(pYV-515), WA-C(pYVO8T), WA-C(pYVO8T/+T), and WA-C(pYVO8) for 2 h at a m.o.i. of 50. Thereafter, cells were lysed in buffer containing 0.1% Triton X-100. 50 µg of proteins were ADP-ribosylated and separated by 15% SDS-PAGE. The proteins were electrotransferred, and the resulting PVDF membrane was dried for autoradiography (A). The same membrane was immunoblotted with the 26C4 monoclonal antibody specific for RhoA (B) as described under "Experimental Procedures."

YopT-dependent Modification of RhoA Is Associated with an Acidic Shift in Isoelectric Focusing-- The pI of a protein is chemically well defined by the charge of the amino acids in the protein in contrast to protein mobility in SDS-PAGE, which depends on less precisely defined structural determinants. We performed two-dimensional electrophoresis using an IPG in the first dimension and SDS-PAGE in the second dimension to further characterize the YopT-modified form of RhoA (Fig. 2). When cytosol of uninfected cells was subjected to 2D electrophoresis, anti-RhoA Western blot revealed one spot migrating at a pI value of 6.3. Consistently, a minor spot of RhoA could be detected migrating at a more acidic pI of 5.9. In lysates of cells infected with WA-C(pYVO8) or WA-C(pYVO8E) two RhoA spots were detectable, which included the original spot at pI 6.3 and an additional spot at pI 5.9. The more acidic RhoA spot at pI 5.9 usually represented around 60-70% of total RhoA protein. This suggests that the band detected with SDS-PAGE (Fig. 1) is a mixture of modified and unmodified RhoA. In agreement with only partial modification of RhoA, when the YopT gene was cloned under the control of a stronger promoter and the YopT protein was transferred into target cells a complete shift of RhoA corresponding to the acidic form was detectable with the two-dimensional gel system. The migration behavior of this completely modified form was the same as the one observed in the Fig. 1 (data not shown). Not surprisingly, appearance of this acidic spot was abolished in cells infected with WA-C(pYVO8T) and restored in cells infected with the YopT complemented strain. Furthermore, none of the known Rho-modifying toxins, C3-transferase of C. botulinum, C. difficile toxin A or CNF of E. coli, produced such an acidic shift of RhoA (data not shown). These data suggest a novel YopT-dependent modification of RhoA that converts RhoA to a more acidic form.

View larger version (19K): [in this window] [in a new window]   Fig. 2.   Two-dimensional gel electrophoresis analysis of RhoA in cytosolic extracts of Yersinia-infected cells. Subconfluent COS-7 cells were kept uninfected (Control) or infected with WA-C(pYVO8), WA-C(pYVO8E), WA-C(pYVO8T), and WA-C(pYVO8T/+T). Cytosolic fractions were prepared as described under "Experimental Procedures," and 200 µg of protein were subjected to isoelectric focusing using IPG gel strips with a pH gradient ranging from 4 to 7. Proteins were separated in the second dimension by a 12% SDS-PAGE. The proteins were then electrotransferred, and the resulting PVDF membrane was immunoblotted with the 26C4 monoclonal anti-RhoA antibody as described under "Experimental Procedures."

YopT-dependent Membrane Release of RhoA-- In most cell types 80-90% of Rho is present in the cytosol complexed to Rho-GDI and the remaining Rho is bound to the plasma membrane. After activation of a cell surface receptor Rho is thought to dissociate from Rho-GDI, to bind GTP, and to translocate to the plasma membrane where it can activate specific signal transduction pathways (12). To check whether the YopT-mediated modification changes the intracellular distribution of RhoA, we compared its content in cytosol and membranes of control and Yersinia-infected cells by Western blot (Fig. 3). As expected, in control cells a minor but detectable part of RhoA was present in membranes with the remainder being located in the cytosol. In cells infected with WA-C(pYVO8) or WA-C(pYVO8E), RhoA was released from membranes and concomitantly accumulated in the cytosol. However, membrane binding of Rho was unchanged in cells infected with WA-C(pYVO8T). Again the YopT complemented strain WA-C(pYVO8T/+T) behaved like WA-C(pYVO8). These data are consistent with the notion that the modification induced by the cytotoxin YopT is responsible for a shift of modified RhoA from the membrane to the cytosol.

View larger version (35K): [in this window] [in a new window]   Fig. 3.   RhoA-Western blot analysis of membrane and cytosolic fractions of Yersinia-infected cells. Subconfluent COS-7 cells were not infected (Control) or infected with WA-C(pYVO8), WA-C(pYVO8E), WA-C(pYVO8T), and WA-C(pYVO8T/+T). After 2 h cells were broken with a Dounce homogenizer, and membrane and cytosolic fractions were obtained by ultracentrifugation of the post-nuclear supernatant at 100,000 × g for 30' at 4 °C. 50 µg of protein from cytosolic and membrane fractions were separated by a 15% SDS-PAGE. After transfer on PVDF membrane RhoA was detected with the 26C4 monoclonal antibody specific for RhoA as described under "Experimental Procedures."

YopT Disrupts Stress Fibers in Endothelial Cells-- RhoA regulates formation of stress fibers and, consequently, cytotoxins that modify RhoA either form stress fibers when the modification is activatory or destruct stress fibers when the modification is inhibitory. To assess the functional consequence of the YopT-dependent modification of RhoA, we tested the effect of YopT on stress fibers after infection of HUVEC with WA-C(pYV-515), WA-C(pYVO8), WA-C(pYVO8T), and WA-C(pYVO8E). The Yersinia secretion mutant unable to translocate Yops WA-C(pYV-515) did not disrupt stress fibers in HUVEC (Fig. 4A). Conversely, WA-C(pYVO8), producing the two cytotoxins YopE and YopT, destructed stress fibers as well as grossly altered the cell shape from a polygonal spread-out form to an elongated irregular form (Fig. 4B). When cells were infected with the YopT-mutant WA-C(pYVO8T), a strain that still exhibits the cytotoxic activity of YopE, the change in cell shape was still apparent, although stress fibers were only slightly diminished and the majority of them were still visible (Fig. 4C). In contrast, in cells infected with the YopE-mutant WA-C(pYVO8E), a strain still expressing the cytotoxic activity of YopT, stress fibers were completely abolished and cells acquired an enlarged spread-out phenotype (Fig. 4D). These results imply that cytotoxic alteration of cell shape and disruption of stress fibers are two distinct features of Yersinia-infected cells, the former mediated by YopE, the latter by YopT.

View larger version (155K): [in this window] [in a new window]   Fig. 4.   Rhodamine phalloidin staining of HUVEC infected with different Y. enterocolitica strains. HUVEC grown on collagen-coated glass coverslips were infected at a m.o.i. of 50 with WA-C(pYV-515) (A), WA-C(pYVO8) (B), WA-C(pYVO8T) (C), and WA-C(pYVO8E) (D). After 90 min, cells were gently washed with PBS, fixed with 3.7% formaldehyde in PBS for 10 min, permeabilized for 5 min in cold acetone, and air-dried. Coverslips were then incubated for 20 min with rhodamine phalloidin and mounted in Mowiol. The bar represents 30 µm.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The biochemical mechanisms by which Yersinia spp. resist the nonspecific immune defense of the host are poorly understood and most of the targets of effector Yops remain to be discovered. Here we investigated whether one of the known actin disrupting cytotoxins of Y. enterocolitica, YopE or YopT, works through inhibition of Rho GTP-binding proteins. YopE presents homology to the amino-terminal part of Exoenzyme S from P. aeruginosa, an ADP-ribosyltransferase modifying GTPases of the Ras family. Therefore it was speculated that YopE might act by ADP-ribosylating and inactivating Rho proteins (28). However, in a recent study the amino-terminal YopE-like domain and the carboxyl-terminal ADP-ribosyltransferase domain of ExoS were shown to act independently of each other on the host cell actin cytoskeleton (29). Interestingly, actin disruption by the isolated YopE-like domain of ExoS could be overcome by pretreatment of cells with the Rho-, Rac-, and CDC42Hs-activating cytotoxin CNF, further suggesting involvement of Rho-GTPases in YopE function. However, our results presented here argue against a role of RhoA in YopE function. Neither by one- nor by two-dimensional gel electrophoresis could a change in the chemical property of RhoA be detected. Furthermore, Y. enterocolitica mutants expressing the YopE but not the YopT cytotoxin primarily affected endothelial cell shape and only secondarily and inefficiently disrupted stress fibers that are controlled by RhoA. In contrast, YopT mainly seems to exert it's effect on stress fiber stability of endothelial cells. Similarly to YopT we have shown recently in the same HUVEC that the specific Rho inhibitor C3-transferase completely abolishes stress fibers before any effect on cell shape becomes detectable (26). Our data indicate that YopT mediates inactivation of RhoA by inducing a biochemical modification of RhoA. Infection of cells with wild type Yersinia strains induces both, an increase in SDS-PAGE mobility and an acidic shift in two-dimensional gels of RhoA. These effects are dependent on intracellular translocation of the cytotoxin YopT but not on any other known effector Yop. Modification by C3-transferase from C. botulinum or CNF from E. coli produces a decrease in SDS-PAGE mobility of RhoA as opposed to the increase in mobility seen in Yersinia-infected cells (13, 18-20). In addition, neither C3, C. difficile toxin A, nor CNF produce an acidic shift of RhoA in isoelectric focusing (data not shown). In vivo only membrane-GTP-bound RhoA controls cellular processes. After Yersinia infection, RhoA is detectable only in the cytosol, further suggesting an inhibitory effect of YopT on cellular responses controlled by RhoA. None of the hitherto described bacterial cytotoxins were reported to release Rho from cellular membranes. Thus, we conclude that the YopT-mediated modification of RhoA represents a modification not previously ascribed to a bacterial cytotoxin. Among the known post-translational modifications of RhoA, phosphorylation has been implicated in releasing RhoA from membranes (30). Phosphorylation is also known to produce an acidic two-dimensional shift of proteins (31). Nevertheless after Y. enterocolitica infection of in vivo [³²P]P_i-labeled COS-7 cells, no phosphorylated protein spot at the place of the acidic form of RhoA could be detected by two-dimensional gel analysis. Furthermore, treatment of cytosolic extract from Y. enterocolitica infected cells with alkaline phosphatase was without any effect on the migration behavior of the modified RhoA in one- or two-dimensional gels (data not shown). Interestingly, inhibition of RhoA carboxyl methylation with methyltransferase inhibitors was also shown to produce an acidic shift of RhoA in two-dimensional gels (32). Although a different two-dimensional system was used in this study, the unmethylated acidic form of RhoA was calculated to have a pI of 5.9, similar to what we calculated for YopT-modified RhoA. It was reported that carboxyl methylation of Ras-related proteins increases in response to the chemoattractant N-formyl-methionyl-leucyl-phenylalanine in vitro and in vivo (33). Furthermore, inhibitors of prenylcysteine carboxyl methylation effectively blocked neutrophil responses to N-formyl-methionyl-leucyl-phenylalanine, suggesting regulation of Ras GTP-binding protein activity by carboxyl methylation (33). Like protein phosphorylation, methylation is reversible under physiological conditions and has been implicated in the control of membrane association of Ras GTP-binding proteins (34). When we performed a saponification reaction with the cytosol of uninfected and infected cells, breakage of the methyl ester link at the COOH terminus did not induce the higher mobility form of RhoA (data not shown). Thus these two processes, phosphorylation or demethylation, are most likely not involved in the YopT-dependent RhoA modification, redistribution, and inactivation. Our study reveals for the first time that an intracellularly translocated bacterial modulin can lead to modification and inhibition of RhoA, a phenomenon reported previously only for exotoxins. The finding that a bacterial modulin translocated by a type III secretion system affects Rho signaling goes along with a recent work of Hardt et al. (35) who discovered a Salmonella-encoded guanine nucleotide exchange factor which directly activates CDC42Hs and Rac. Given the propensity of bacterial toxins and modulins to alter Rho GTPase functions and to exploit the host cell cytoskeleton, it can be expected that additional Rho-GTPase modulatory principles are exploited by bacteria exhibiting secretion systems of various types.

	ACKNOWLEDGEMENTS

We are grateful to B. Böhlig and C. Trasak for expert technical assistance.

	FOOTNOTES

^* This work was supported by the Deutsche Forschungsgemeinschaft (Sonderforschungsbereich 413, Dynamics and Regulation of the Cytoskeleton, Teilprojekt B1 and B6; Ae11) and by the French-German exchange program PROCOPE.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Max von Pettenkofer Institut, Pettenkoferstr. 9a, 80336 Munich, Germany. Tel.: 49-89-51-60-5264; Fax: 49-89-5160-5223; E-mail: aepfelbacher@m3401.mpk. med.uni-muenchen.de.

	ABBREVIATIONS

The abbreviations used are: Yops, Yersinia outer proteins; HUVEC, human umbilical vein endothelial cells; m.o.i., multiplicity of infection; IPG, immobilized pH gradient; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; GDI, guanidine nucleotide dissociation inhibitor; CNF, cytotoxic necrotizing factor; PVDF, polyvinylidene difluoride.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				W.-J. Dai, Y. Zeng, Z.-P. Xie, and C. Staehelin Symbiosis-Promoting and Deleterious Effects of NopT, a Novel Type 3 Effector of Rhizobium sp. Strain NGR234 J. Bacteriol., July 15, 2008; 190(14): 5101 - 5110. [Abstract] [Full Text] [PDF]

				A. McNally, R. M. La Ragione, A. Best, G. Manning, and D. G. Newell An aflagellate mutant Yersinia enterocolitica biotype 1A strain displays altered invasion of epithelial cells, persistence in macrophages, and cytokine secretion profiles in vitro Microbiology, May 1, 2007; 153(5): 1339 - 1349. [Abstract] [Full Text] [PDF]

				C. Trasak, G. Zenner, A. Vogel, G. Yuksekdag, R. Rost, I. Haase, M. Fischer, L. Israel, A. Imhof, S. Linder, et al. Yersinia Protein Kinase YopO Is Activated by A Novel G-actin Binding Process J. Biol. Chem., January 26, 2007; 282(4): 2268 - 2277. [Abstract] [Full Text] [PDF]

				Z. Huang, L. Taylor, B. Liu, J. Yu, and P. Polgar Modulation by bradykinin of angiotensin type 1 receptor-evoked RhoA activation of connective tissue growth factor expression in human lung fibroblasts Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1291 - L1299. [Abstract] [Full Text] [PDF]

				K. Ruckdeschel, G. Pfaffinger, K. Trulzsch, G. Zenner, K. Richter, J. Heesemann, and M. Aepfelbacher The Proteasome Pathway Destabilizes Yersinia Outer Protein E and Represses Its Antihost Cell Activities J. Immunol., May 15, 2006; 176(10): 6093 - 6102. [Abstract] [Full Text] [PDF]

				G. Yang, A. J. Dowling, U. Gerike, R. H. ffrench-Constant, and N. R. Waterfield Photorhabdus Virulence Cassettes Confer Injectable Insecticidal Activity against the Wax Moth J. Bacteriol., March 15, 2006; 188(6): 2254 - 2261. [Abstract] [Full Text] [PDF]

				P. Troisfontaines and G. R. Cornelis Type III Secretion: More Systems Than You Think Physiology, October 1, 2005; 20(5): 326 - 339. [Abstract] [Full Text] [PDF]

				C. R. Buttner, G. R. Cornelis, D. W. Heinz, and H. H. Niemann Crystal structure of Yersinia enterocolitica type III secretion chaperone SycT Protein Sci., August 1, 2005; 14(8): 1993 - 2002. [Abstract] [Full Text] [PDF]

				D. E. Nelson, D. P. Virok, H. Wood, C. Roshick, R. M. Johnson, W. M. Whitmire, D. D. Crane, O. Steele-Mortimer, L. Kari, G. McClarty, et al. Chlamydial IFN-{gamma} immune evasion is linked to host infection tropism PNAS, July 26, 2005; 102(30): 10658 - 10663. [Abstract] [Full Text] [PDF]

				K. Trulzsch, G. Geginat, T. Sporleder, K. Ruckdeschel, R. Hoffmann, J. Heesemann, and H. Russmann Yersinia Outer Protein P Inhibits CD8 T Cell Priming in the Mouse Infection Model J. Immunol., April 1, 2005; 174(7): 4244 - 4251. [Abstract] [Full Text] [PDF]

				X.-Z. Huang and L. E. Lindler The pH 6 Antigen Is an Antiphagocytic Factor Produced by Yersinia pestis Independent of Yersinia Outer Proteins and Capsule Antigen Infect. Immun., December 1, 2004; 72(12): 7212 - 7219. [Abstract] [Full Text] [PDF]

				K. Trulzsch, T. Sporleder, E. I. Igwe, H. Russmann, and J. Heesemann Contribution of the Major Secreted Yops of Yersinia enterocolitica O:8 to Pathogenicity in the Mouse Infection Model Infect. Immun., September 1, 2004; 72(9): 5227 - 5234. [Abstract] [Full Text] [PDF]

				D. M. Janowicz, K. R. Fortney, B. P. Katz, J. L. Latimer, K. Deng, E. J. Hansen, and S. M. Spinola Expression of the LspA1 and LspA2 Proteins by Haemophilus ducreyi Is Required for Virulence in Human Volunteers Infect. Immun., August 1, 2004; 72(8): 4528 - 4533. [Abstract] [Full Text] [PDF]

				K. Brugirard-Ricaud, A. Givaudan, J. Parkhill, N. Boemare, F. Kunst, R. Zumbihl, and E. Duchaud Variation in the Effectors of the Type III Secretion System among Photorhabdus Species as Revealed by Genomic Analysis J. Bacteriol., July 1, 2004; 186(13): 4376 - 4381. [Abstract] [Full Text] [PDF]

				H. Nogawa, A. Kuwae, T. Matsuzawa, and A. Abe The Type III Secreted Protein BopD in Bordetella bronchiseptica Is Complexed with BopB for Pore Formation on the Host Plasma Membrane J. Bacteriol., June 15, 2004; 186(12): 3806 - 3813. [Abstract] [Full Text] [PDF]

				M. Vakevainen, S. Greenberg, and E. J. Hansen Inhibition of Phagocytosis by Haemophilus ducreyi Requires Expression of the LspA1 and LspA2 Proteins Infect. Immun., October 1, 2003; 71(10): 5994 - 6003. [Abstract] [Full Text] [PDF]

				A. P. SOMLYO and A. V. SOMLYO Ca2+ Sensitivity of Smooth Muscle and Nonmuscle Myosin II: Modulated by G Proteins, Kinases, and Myosin Phosphatase Physiol Rev, October 1, 2003; 83(4): 1325 - 1358. [Abstract] [Full Text] [PDF]

				M. Aepfelbacher, C. Trasak, G. Wilharm, A. Wiedemann, K. Trulzsch, K. Krauss, P. Gierschik, and J. Heesemann Characterization of YopT Effects on Rho GTPases in Yersinia enterocolitica-infected Cells J. Biol. Chem., August 29, 2003; 278(35): 33217 - 33223. [Abstract] [Full Text] [PDF]

				L. K. Logsdon and J. Mecsas Requirement of the Yersinia pseudotuberculosis Effectors YopH and YopE in Colonization and Persistence in Intestinal and Lymph Tissues Infect. Immun., August 1, 2003; 71(8): 4595 - 4607. [Abstract] [Full Text] [PDF]

I. Sorg, C. Hoffmann, J. Dumbach, K. Aktories, and G. Schmidt The C Terminus of YopT Is Crucial for Activity and the N Terminus Is Crucial for Substrate Binding Infect. Immun., Au