 |
INTRODUCTION |
Vascular cell adhesion molecule 1 (VCAM-1)1 is an inducible cell
surface glycoprotein belonging to the immunoglobulin supergene family.
It was first identified as an adhesion molecule induced on endothelial
cells by the inflammatory cytokines interleukin (IL)-1 and tumor
necrosis factor (TNF) or lipopolysaccharide (1, 2). VCAM-1 plays a
central role in inflammatory cell recruitment and accumulation at sites
of inflammation by binding to its ligand the leukocyte
4
1 integrin VLA-4 on T and B lymphocytes,
eosinophils, monocytes, and basophils but not on neutrophils that lack
VLA-4 (3, 4). In addition to its importance in inflammatory cell recruitment, VCAM-1 is also involved in both T lymphocyte and eosinophil activation by providing T cell receptor-engaged
CD4+ T cells the costimulation required for T cell
proliferation, IL-2 receptor expression, and cytokine release (5, 6),
and by interaction with its ligand VLA 4 on eosinophils promoting superoxide generation and degranulation (7, 8). Finally, endothelial
expression of VCAM-1 is increased in asthma and rhinitis, which are
allergic airway conditions characterized by inflammation with
lymphocyte and eosinophil infiltration (9-12). These data suggest that
VCAM-1 is a crucial molecule in inflammatory cell recruitment,
accumulation, and activation at sites of allergic inflammation.
Respiratory virus infections have recently been associated with the
majority of asthma exacerbations in both adults and children (13-16).
In all these studies, rhinoviruses were the most frequently identified
virus type. Rhinovirus-induced asthma exacerbations therefore cause
enormous morbidity and represent a major health and economic problem. A
better understanding of the mechanisms involved in rhinovirus-induced
asthma exacerbations would greatly aid the development of new therapies
for this common condition, because to date, no safe effective therapy
is available (17, 18).
The mechanisms by which rhinoviruses trigger asthma exacerbations are
poorly understood. The lower airway cellular response to experimental
RV colds has been recently studied in normal, allergic rhinitic, and
asthmatic subjects. Increased numbers of T lymphocytes (19) and
eosinophils (19-21) have been reported, and persistent eosinophilia
was observed 4-8 weeks after the infection only in allergic rhinitic
or asthmatic patients (19, 21). These data, combined with the increased
bronchial hyperresponsiveness demonstrated in experimental rhinovirus
infections in asthmatic (21, 22) and atopic subjects (23) and the fact
that asthma exacerbations have been induced by experimental
rhinovirus infections (21, 24), provide strong evidence that
rhinovirus-induced bronchial intraepithelial lymphocyte and eosinophil
infiltration and activation are likely very important mechanisms in
virus-induced asthma exacerbations.
Rhinovirus RNA has recently been detected in bronchial lavage cells
taken during experimentally induced colds, suggesting that rhinovirus
can promote local inflammation by direct infection of the lower airways
(25). Indeed rhinoviruses are capable of prolonged, noncytolytic
infection of lower respiratory epithelial cells and induce production
of pro-inflammatory cytokines such as IL-6, IL-8, and granulocyte
macrophage colony-stimulating factor (26-29).
Endothelial expression of VCAM-1 is important in inflammatory cell
recruitment to sites of inflammation, and this can be inhibited by
monoclonal antibody to its ligand, VLA-4 (30). However, such treatment
involves intravenous delivery of heterologous or humanized proteins and
as such is expensive and impractical. Basal and inducible epithelial
VCAM-1 expression has recently been observed in small bowel,
glomerular, and tubular epithelial cells (31-35). The presence of
VCAM-1 has been described on glomerular epithelial cells in normal
glomeruli in renal biopsies (34-36), and VCAM-1 up-regulation in
epithelial cells has been documented in immune-mediated renal disease
(33, 37, 38), suggesting that renal epithelial VCAM-1 expression is
important in immune-mediated renal diseases.
Two previous experimental studies have failed to demonstrate
constitutive or inducible VCAM-1 on bronchial epithelial cells (39,
40), suggesting that respiratory epithelial cells do not express
VCAM-1. However, epithelial VCAM-1 is thought to mediate adhesion and
penetration of pro-inflammatory leukocytes in tonsilar epithelium (41),
inducible expression of VCAM-1 was recently reported in the BEAS-2B
bronchial epithelial cell line and soluble VCAM-1 was detected in
supernatants of primary bronchial epithelial cells (42), suggesting
that respiratory epithelial cells may express VCAM-1 under certain circumstances.
We investigate respiratory epithelial VCAM-1 expression and its
modulation by rhinovirus infection and pro-inflammatory stimuli. Having
found that rhinovirus infection, but not other pro-inflammatory stimuli, induced VCAM-1 up-regulation in various human respiratory epithelial cell types, we investigated the intracellular mechanisms of
rhinovirus induction of VCAM-1 expression to identify potential targets
for modulation of rhinovirus-induced VCAM-1 in the therapy of
rhinovirus-induced asthma exacerbations.
| |
MATERIALS AND METHODS |
Cell Culture--
Ohio HeLa cells were obtained from the Medical
Research Council Common Cold Unit (Salisbury, UK), and A549 cells, a
type II respiratory cell line, were obtained from the American Type
Culture Collection (Manassas, VA). 16HBE cells, a differentiated SV-40 transformed bronchial epithelial cell line (43), were a generous gift
from Dr. D.C. Gruenert (University of California, San Francisco, CA).
Primary human bronchial epithelial cells (HBEC) were obtained by
bronchial brushing from normal subjects and cultured as described previously (44). These cells are >95% cytokeratin 18 immunoreactive epithelial cells as assessed by immunofluorescence microscopy.
Viral Stocks--
Rhinoviruses type 16, 9 (major group), and 2 (minor group) were obtained from the Medical Research Council Common
Cold Unit. Viral stocks were prepared and titrated by infection of
sensitive cell monolayers (HeLa) as described previously (44). Tissue culture infective dose 50% (TCID50)/ml values were
determined (45), and virus at a multiplicity of infection (MOI) of 1 was used for all the experiments, except where indicated.
Rhinovirus Inactivation--
For selected experiments,
inactivated rhinovirus type 16 was used, as described previously (28,
44). Inactivation/exclusion of the virus was achieved by (i) precoating
the virus with its receptor (ICAM-1), (ii) UV light, or (iii)
rhinovirus removal from inocula, by ultrafiltration through 30-kDa
cut-off membranes (Amikon, London, UK). For each method, confirmation
of inactivation was carried out by microtiter plate assay as described above.
Measurement of VCAM-1 Surface Protein Expression--
Flow
cytometry was used to quantify the level of expression of VCAM-1 on the
surface of resting and stimulated respiratory epithelial cells. 1 × 105 A549 or 16HBE cells were cultured in 24-well plates.
Control medium or one of the following stimuli was added when cells
were confluent: rhinovirus type 16 at MOI of 1; phorbol 12-myristate 13-acetate (20 ng/ml); lipopolysaccharide (100 mg/ml); IFN-
(100 units/ml); TNF (200 units/ml); IFN- plus TNF; IFN- plus
TNF and IL-1 (10 units/ml). Incubation continued for various time points between 1 and 72 h. Dose response studies were carried out
by using 0.1, 0.2, 0.5, 1, and 2 MOI, and cells were harvested at
8 h. Similarly, the effect of inactivated virus was studied at
8 h. HBEC (2 × 105) were grown in 12-well plates
and infected when confluent for 8 h.
At desired time points, cells were harvested, incubated with
fluorescein isothiocyanate-conjugated antihuman VCAM-1 (CD 106) antibody or isotype-specific control antibody (Southern Biotechnology Associates, Birmingham, AL), and analyzed for fluorescence by single
color flow cytometry as described previously (44). Mean fluorescence
intensity was measured and normalized as percentage of noninfected
control values, after subtraction of background staining.
VCAM-1 mRNA Analysis--
5 × 106 A549
cells were cultured in 100-mm plates until confluent, and medium alone
or rhinovirus type 16 were added for various times between 1 and
24 h. At desired times total RNA was isolated, and 1 µg of
reverse transcribed P1 (24 ng/ml) was used as specific primer (46)
(CTCTGACAGAAGAAGCCAAG). cDNA was amplified by PCR in the presence
of a specific primer pair P1 and P2 (ACTTGAGTCCACTGAAGCCA) as described
previously (44). Cycling conditions were 1 min at 94 °C, 1 min at
55 °C, and 2 min at 72 °C for 25 cycles. Inner primers P3
(TCCTGCTCCGAAAATCCTGTG and P4 (ATTCCACTTCCTTTCTGCTTCTTCC) were used for
a nested amplification, annealing temperature 69 °C. Final PCR
products (10 µl) were electrophoresed through 1.5% agarose gel,
stained in ethidium bromide, and photographed under UV light.
mRNA for adenine phosphoribosyltransferase (APRT, primers
P1hk GCTGCGTGCTCATCCGAAAG and P2hk
CCTTAAGCGAGGTCAGCTCC) was evaluated in each sample as
housekeeping gene control. Densitometry was performed to express VCAM-1
mRNA relative to APRT mRNA. These methods were shown to give
linear quantification of input mRNA by dilutional analysis in
preliminary experiments (data not shown) and have previously been shown
to give good quantification of mRNA in other systems (44).
VCAM-1 Nuclear Transcription Analysis--
Isolation of nuclei
and nuclear transcription assay were performed as described previously
(44). For each sample total RNA was extracted from 107
nuclei, before and after in vitro transcription, in the
presence or in the absence of the RNA polymerase II inhibitor
-amanitin (1 mg/ml). VCAM-1 RT-PCR was thereafter performed for each
different condition to detect in vitro transcribed products.
These methods have previously been shown to give linear quantification
of in vitro transcribed mRNA in other systems (44).
Reporter Gene Constructs--
The VCAM-1
promoter-chloramphenicol acetyltransferase (CAT) constructs were a
generous gift of Dr. T. Collins (Brigham and Women's Hospital, Boston,
MA). They contained sequential deletions (
755, 518, 258, 98,
and 44) of the VCAM-1 5'-flanking region linked to the CAT coding
region (47). A plasmid containing deletion 258 with mutations of the
two GATA-binding sequences located between 254 to 236 (258m,
confirmed by sequencing), a plasmid containing deletion 98 with a
mutated 72 to 63 NF-
B-binding sequence (98mA, confirmed by
sequencing), and a plasmid containing deletion 98 with a mutated 57
to 48 NF-B-binding sequence (98mB, confirmed by sequencing) were
also kindly provided (47).
Cell Transfection and CAT Assay--
Transfection was performed
by the calcium phosphate co-precipitation technique using 20 µg of
plasmid (44). Protein-equivalent extracts were assayed for CAT activity
according to standard protocols (44, 48). The CAT activity was
expressed as a percentage of chloramphenicol converted to acetyl
chloramphenicol after resolution by thin layer chromatography and
scintillation counting.
Electrophoretic Mobility Shift Assay--
Preparation of nuclear
extracts. Confluent A549 were exposed to rhinovirus 16 for various time
points (0, 30, 60, 90, and 120 min), and nuclear extracts were obtained
by a modification of the method of Dignam et al. (49) as
described previously (44).
Oligonucleotide Probes (Table I)--
Double-stranded
oligonucleotides containing wild type and mutated sequences of the
VCAM-1 promoter NF-B- and GATA-binding sequences were obtained
commercially (Oswell DNA Service, Southampton, UK). For control
experiments double-stranded oligonucleotides containing wild type
sequences of the ICAM-1 promoter SP-1-binding sequence were used
(Oswell DNA Service). Mutant sequences were identical to those used in
the mutant reporter constructs. NF-B, AP-1, and SP1 consensus
double-stranded oligonucleotides were obtained commercially (Promega).
Oligonucleotides were labeled and incubated with 5 µg of nuclear
protein as previously reported (44). Complexes were resolved on 5%
nondenaturing polyacrylamide gels. Dried gels were autoradiographed at
70 °C overnight.
Statistical Analysis--
Data were expressed as means ± S.E., and comparison between groups was performed by analysis of
variance for multiple comparisons, and by paired Student's
t test for individual comparisons. All experiments were
carried out at least three times.
| |
RESULTS |
Respiratory Epithelial Cells Constitutively Expresses VCAM-1
Surface Protein--
VCAM-1 was constitutively present on both
respiratory epithelial cell lines and primary bronchial epithelial
cells, with mean fluorescence intensities of 30.2 ± 8.4, 26.3 ± 7.1, and 22.6 ± 4.5 for 16HBE, A549, and HBEC,
respectively, after subtraction of background staining. A
representative example of 16HBE basal VCAM-1 expression is shown in
Fig. 1. Consistent with these findings, VCAM-1 mRNA was clearly detectable in the respiratory epithelial cells under basal conditions when the PCR cycle number was increased to
30, in both first round and nested amplifications (data not shown).
View larger version (9K):
[in this window]
[in a new window]
|
Fig. 1.
VCAM-1 surface protein expression on 16HBE
epithelial cells. Representative flow cytometric analysis of
VCAM-1-specific immunofluorescence with anti CD106 (VCAM-1) monoclonal
antibody (dotted line) or isotype matched control monoclonal
antibody (solid line) in 16HBE epithelial cells. Cells were
in resting (control) conditions. The y axis indicates the
number of counted cells/each fluorescence intensity channel, and the
x axis shows the associated fluorescence intensity.
|
|
Rhinovirus Infection, but No Other Stimuli Tested, Induces VCAM-1
Cell Surface Protein Expression in Respiratory Epithelial
Cells--
VCAM-1 expression on 16HBE and A459 cells was measured
before and after incubation with phorbol 12-myristate 13-acetate,
lipopolysaccharide, IFN-, TNF, IFN- and TNF combined, and
the combination of IFN-, TNF, and IL-1 for 8 and 24 h.
None of these potent proinflammatory stimuli either alone or in
combination were found to up-regulate VCAM-1 expression on 16HBE cells
(data not shown).
In contrast to the other stimuli tested, rhinovirus infection induced a
significant up-regulation of VCAM-1 expression in 16HBE, A549, and
primary HBEC cells. Dose response studies were performed in A549 and
16HBE cells infected with rhinovirus 16 to determine whether the
induction of VCAM-1 occurred in a dose response manner. Cell surface
VCAM-1 expression was examined 8 h after infection on the basis of
preliminary studies. Enhanced expression of VCAM-1 relative to
uninfected cells was observed in both cell lines, starting from 0.5 TCID50/cell and being maximal at 1-2
TCID50/cell (Fig. 2, upper
panel). Based on these dose response data, a MOI of 1 was utilized
in all subsequent studies.
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 2.
Dose response and time course of
rhinovirus-induced VCAM-1 surface expression on 16HBE
(A) and A549 (B) respiratory
epithelial cells. Upper panel, surface VCAM-1
expression was measured by flow cytometry on 16HBE and A549 epithelial
cells cultured for 8 h with medium alone (control) or rhinovirus
16 at titers ranging from 0.1 to 2 MOI. Rhinovirus infection of 16HBE
and A549 epithelial cells induced a significant up-regulation of VCAM-1
surface expression at multiplicities of infection of 0.5, 1, and 2, with peak induction occurring at an MOI of 1. Lower panel,
surface VCAM-1 expression was measured by flow cytometry on respiratory
epithelial cells cultured with medium alone (Cont) or
rhinovirus 16 at an MOI of 1 for 1, 4, 8, 16, 24, 48, and 72 h.
Rhinovirus infection of respiratory epithelial cells induced a
significant up-regulation of VCAM-1 surface expression within
4 h of inoculation and was still evident up to 72 h after
infection. Rhinovirus induction of VCAM-1 surface expression
peaked at 8 h in 16HBE and at 24 h in A549 epithelial cells.
VCAM-1 induction by rhinovirus infection is expressed as a percentage
of control uninfected cells. Data are the means ± S.E. of at
least four separate experiments. *, p < 0.01; **,
p < 0.001 compared with control.
|
|
To evaluate the temporal kinetics of VCAM-1 induction by rhinovirus
infection in both cell lines, surface VCAM-1 expression was studied at
0, 1, 4, 8, 16, 24, 48, and 72 h post rhinovirus 16 infection.
Similar results were observed in A549 and 16HBE cells, with a
significant increase within 4 h, a maximal effect between 8-24 h,
and a still detectable up-regulation at 72 h (Fig. 3, lower panel). In view of the
time course results, 8 and 24 h infection were respectively chosen
for A549 and 16HBE cells to investigate the receptor specificity and
virus specificity of the up-regulation.
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of inactivation of virus replication
and prevention of virus-receptor binding on rhinovirus induction of
VCAM-1 surface expression on 16HBE (A) and A549
(B) respiratory epithelial cells and evaluation of
serotype and receptor specificity. Surface VCAM-1 expression was
measured by flow cytometry on 16HBE cells cultured for 8 h
(A) and on A549 epithelial cells cultured for 24 h
(B) under the following conditions: medium alone
(Control); live rhinovirus 16 at an MOI of 1 (RV16); UV-inactivated rhinovirus 16 (UVRV16);
sICAM-1 pretreated rhinovirus 16 (sICAM RV16); rhinovirus 16 physically removed by filtration (Filtered RV16); live
rhinovirus 9 at an MOI of 1 (RV9); live rhinovirus 2 at an
MOI of 1 (RV2); and sICAM pretreated rhinovirus 2 (sICAM-1 RV2). VCAM-1 induction by rhinovirus infection is
expressed as a percentage of control uninfected cells. Data are the
means ± S.E. of at least four separate experiments. *,
p < 0.01; **, p < 0.001 compared with
control. As observed in Fig. 1, live rhinovirus type 16 (major group,
using ICAM-1 as virus receptor) induced a marked increase in VCAM-1
surface expression compared with control uninfected cells both in 16HBE
(A) and in A549 (B) epithelial cells.
Inactivation by UV inactivation (UV RV16), physical removal
of virus particles (Filtered RV16), and prevention of
virus-receptor binding (sICAM RV16), all abrogated
rhinovirus induction of VCAM-1 expression in both cell types. Other
rhinovirus serotypes, rhinovirus 9 (RV9, major group) and
rhinovirus 2 (RV2, minor group) were equally able to
up-regulate surface VCAM-1 expression, whereas pretreatment of
rhinovirus 2 (which does not use ICAM-1 as virus receptor) with soluble
major group receptor (sICAM-1 RV2) had no effect on
rhinovirus induction of VCAM-1 expression in both 16HBE and A549
epithelial cells.
|
|
To investigate whether the findings in cells lines were applicable to
primary bronchial epithelium, similar studies were performed with HBEC.
A 50% up-regulation of VCAM-1 surface expression was observed on HBEC
cells in response to 8 h of rhinovirus 16 infection at a MOI of 1 (data not shown).
The Effect of Rhinovirus Inactivation on Rhinovirus-induced VCAM-1
Cell Surface Expression--
Because the virus inoculum was a crude
preparation, experiments were carried out to confirm that the induction
of VCAM-1 surface expression was the result of virus-specific effects.
Inactivation by UV pretreatment and precoating with sICAM and
filtration of the virus from the inoculum all completely abrogated the
induction of VCAM-1 expression observed with live rhinovirus (Fig. 3)
at peak time points in both 16HBE (8 h) and A549 (24 h) cells. These experiments confirmed that the induction of VCAM-1 expression by the
inoculum was related to the presence and replication of live rhinovirus.
Rhinovirus Induction of VCAM-1 Is Not Virus
Receptor/Strain-specific--
The major group (90%) of rhinoviruses
use ICAM-1 as their cell surface receptor (50, 51), whereas the
remainder (minor group) use a member of the LDL-receptor family (52).
To investigate whether rhinovirus induction of VCAM-1 up-regulation is
strain or receptor restricted, the stimulatory effects of rhinovirus 16, rhinovirus 9 (both major group), and rhinovirus 2 (minor group), all at a MOI of 1, were studied on 16HBE cell at 8 h post
infection and on A549 cells at 24 h post infection. As shown in
Fig. 3, rhinovirus 16, rhinovirus 9, and rhinovirus 2 were equally
effective at increasing VCAM-1 surface expression, demonstrating that
rhinovirus induction of VCAM-1 occurs with at least three of the many
different rhinovirus serotypes and that no strain or receptor
specificity is observed. Furthermore, pretreatment of rhinovirus 2 with
sICAM did not alter the ability of this minor group rhinovirus to
induce VCAM-1 (Fig. 3). These findings demonstrate the specificity of rhinovirus inactivation via sICAM-1 binding for the major rhinovirus group.
Induction of VCAM-1 mRNA in A549 Cells by Live and Inactivated
Rhinovirus--
To determine whether the observed VCAM-1 surface
protein up-regulation induced by rhinovirus was accompanied by
increased VCAM-1 mRNA expression, the expression of VCAM-1 mRNA
in response to rhinovirus 16 infection was examined. The time course of
VCAM-1 mRNA was studied by RT-PCR at 0, 1, 3, 6, 8, 12, and 24 h after rhinovirus infection. At the cycle numbers used for these
experiments, A549 cells incubated with medium alone did not contain
detectable levels of VCAM-1 mRNA. In accordance with the findings
on surface expression, a consistent response to rhinovirus infection
was noted, with an early significant increase in levels of VCAM-1 mRNA, which was detectable at 1 h and that peaked at 8 h
(control samples, 0; rhinovirus infection, 1.41 ± 0.07 arbitrary
units; p < 0.001). A representative time course
experiment is depicted in Fig. 4A.
Induction of VCAM-1 mRNA expression in response to rhinovirus
infection was still present, although it was reduced in comparison with
earlier time points, at 24 h (Fig. 4A, rhinovirus infection 0.7 + 01 arbitrary units, p < 0.001 versus control samples). Uniformity of loaded and
processable RNA was assessed by standard housekeeping gene (APRT)
RT-PCR. Similar experiments were also carried out in 16HBE cells;
rhinovirus induction of VCAM-1 mRNA was also observed in 16 HBE
bronchial epithelial cells (data not shown). Because of the large
number of cells required for the subsequent studies, all further
studies were carried out in A549 cells.
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 4.
Time course and effect of inactivation of
virus replication and prevention of virus-receptor binding on
rhinovirus induction of VCAM-1 mRNA expression in A549 respiratory
epithelial cells. Representative (of at least three separate
experiments) RT-PCR analysis for VCAM-1 and APRT (housekeeping gene)
expression in A549 respiratory epithelial cells. Above are ethidium
bromide-stained gel electrophoreses of products of RT-PCR for APRT and
VCAM-1, and below the VCAM-1/APRT ratio determined by densitometric
analysis. A, cells were incubated with rhinovirus 16 at an
MOI of 1 for indicated time points or were uninfected (lane
0). Rhinovirus infection of A549 respiratory epithelial cells
induced increased VCAM-1 mRNA expression which was detectable at
1 h, peaked at 8 h, and was still clearly evident at 24 h after inoculation. B, A549 respiratory epithelial cells
incubated for 8 h with live rhinovirus 16 (lane 1),
rhinovirus 16 precoated with sICAM-1 (lane 2), UV
inactivated rhinovirus 16 (lane 3), rhinovirus 16 removed by
filtration (lane 4), or medium alone (lane 5). As
observed with VCAM-1 surface protein expression (Fig. 3), rhinovirus
induction of VCAM-1 mRNA expression (lane 1) was
completely abolished by prevention of virus-receptor binding by sICAM-1
precoating (lane 2), by UV inactivation (lane 3),
and by filtration (lane 4).
|
|
Consistent with the cell surface expression, sICAM pretreatment (Fig.
4B, lane 2), UV inactivation (Fig. 4B,
lane 3), and exclusion of the virus by filtration (Fig.
4B, lane 4) completely suppressed rhinovirus
induced VCAM-1 mRNA expression (control samples and all inactivated
samples, 0; rhinovirus infected, 1.7 ± 0.08 arbitrary units;
p < 0.001). These data demonstrate that rhinovirus-induced VCAM-1 up-regulation is associated with VCAM-1 mRNA accumulation and therefore is regulated at a pretranslational level.
Rhinovirus 16 Infection of A549 Cells Up-regulates VCAM Gene
Transcription--
To investigate the pretranslational mechanisms of
increased VCAM-1 expression in response to rhinovirus infection, VCAM-1 gene transcription was studied by a previously reported in
vitro transcription assay (44). De novo synthesis of
VCAM-mRNA was evaluated in nuclei obtained from A549 cells after
1 h of rhinovirus infection and from control noninfected cells.
Rhinovirus infection significantly increased VCAM-1 mRNA
transcription (p < 0.001).
In accordance with the observed mRNA time course studies, VCAM-1
mRNA was undetectable in nuclei from control noninfected cells,
either before (Fig. 5, lane 1) or
after (Fig. 5, lane 2) in vitro transcription,
whereas a weak band of VCAM-1 mRNA was detectable after 1 h of
rhinovirus 16 infection before in vitro transcription
(0.14 ± 0.01 arbitrary units; Fig. 6,
lane 3). VCAM-1 mRNA levels were clearly increased by 45 min in vitro transcription (0.3 ± 0.023 arbitrary
units; p > 0.01 versus control and before in vitro transcription samples; Fig. 5, lane 4),
indicating that rhinovirus infection of A549 cells resulted in
increased de novo VCAM-1 mRNA transcription. This was
confirmed by the fact that the rhinovirus-induced increase in VCAM-1
mRNA observed during in vitro transcription was
abolished in the presence of -amanitin (0.12 ± 0.01 arbitrary
units; p < 0.01 versus after in
vitro transcription samples; Fig. 5, lane 5), a
DNA-dependent RNA polymerase II inhibitor (53). From these
results we concluded that rhinovirus infection of A549 cells induces a
rapid increase in VCAM-1 gene transcription.
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
Rhinovirus induction of de novo VCAM-1 gene transcription in A549 respiratory epithelial
cells. Nuclei from uninfected or rhinovirus-infected A549 cells
were used for nuclear in vitro transcription assay.
Representative (of at least three separate experiments) RT-PCR for
VCAM-1 and APRT (housekeeping gene) performed on nuclear RNA obtained
from A549 cells incubated in each of the following conditions:
uninfected control cells before (lane 1) and after
(lane 2) in vitro transcription; rhinovirus 16 infected cells (1 h at an MOI of 1) before (lane 3) and
after in vitro transcription (lane 4), and after
in vitro transcription in the presence of -amanitin
(lane 5). No VCAM-1 mRNA was detectable in control
uninfected cells, either before or after in vitro
transcription (lanes 1 and 2, respectively). As
observed in Fig. 4, increased expression of VCAM-1 mRNA was again
just detectable after 1 h rhinovirus infection but before in
vitro transcription (lane 3). Confirmation of
rhinovirus induction of VCAM-1 gene transcription is seen in lane
4 where VCAM-1 mRNA expression was markedly increased by 45 min in vitro transcription, and in lane 5, where
the rhinovirus-induced increased VCAM-1 mRNA expression occurring
following in vitro transcription is completely inhibited by
addition of the RNA polymerase II inhibitor, -amanitin.
|
|
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of rhinovirus infection of A549
respiratory epithelial cells on VCAM-1 promoter activity and
localization of promoter regions essential for induction of VCAM-1
promoter activity by rhinovirus. A, top,
schematic representation of putative nuclear factor-binding sites on
VCAM-1 promoter. Bottom, promoter-CAT constructs, containing
sequential deletions (755, 518, 258, 98, and 44) of the
VCAM-1 5'-flanking region fused to the coding region of the CAT
reporter were used for CAT assays as described under "Materials and
Methods." B, after transfection, A549 epithelial cells
were incubated with medium alone (C) or rhinovirus 16 at an
MOI of 1 (RV) for 24 h. Cells were harvested and CAT
activity in protein equivalent cell lysates was assessed as described
under "Materials and Methods." VCAM-1 promoter activation is
expressed as fold induction of CAT activity in infected over control
cells. Data are the means ± S.E. of at least five separate
experiments. Rhinovirus infection of A549 respiratory epithelial cells
induced marked increases in VCAM-1 promoter activity when CAT
constructs containing at least 258 bp of the VCAM-1 promoter were
studied. Deletion to 98 resulted in a reduced (by approximately 50%)
response as compared with longer promoters, whereas deletion to 44
completely abrogated the response to rhinovirus infection. These
results indicate that rhinovirus response elements in the VCAM-1
promoter are located within the regions 258/98 and 98/44 base
pairs from the transcription initiation site.
|
|
Rhinovirus Infection of A549 Cells Increases VCAM-1 Promoter
Activity--
Having demonstrated that rhinovirus infection of
respiratory epithelial cells induced VCAM-1 gene transcription, studies
were carried out to further investigate the intracellular mechanisms of
rhinovirus induction of VCAM-1 gene transcription. Experiments were
performed with a CAT construct containing a deletion of the VCAM-1
promoter (258 bp), which was found most active in other studies of
VCAM-1 promoter activity (47). A549 cells infected with rhinovirus 16 for 24 h had markedly increased VCAM-1 promoter activity compared
with control cells, promoter activity being barely detected in control
cells (acetylation, 4.8 ± 2.7%), whereas it was significantly
increased in the rhinovirus infected cells (acetylation, 31.7 ± 6.5%; p < 0.01).
Identification of Rhinovirus Response Regions in the VCAM-1
Promoter--
To map the VCAM-1 promoter regions relevant for
rhinovirus-induced VCAM-1 gene transcription, A549 cells were
transiently transfected with constructs containing CAT reporter genes
whose transcription was regulated by sequential deletions (Fig.
6A) of the VCAM-1 promoter, and the effect of rhinovirus
infection on CAT activity was studied.
As seen in Fig. 6B, promoter activity of the CAT constructs
under the control of the proximal 755, 518, and 258 bp of the VCAM-1 promoter was strongly induced by rhinovirus 16 infection of A549
cells. This inducibility was reduced by 50-60% with the construct
containing the proximal 98 bp of the VCAM-1 promoter. Further
deletions of the VCAM-1 promoter completely abolished the capacity of
rhinovirus infection to induce VCAM-1 promoter activity. These studies
indicated the presence of DNA sequences necessary for rhinovirus
induction of VCAM-1 promoter activity between the positions 258/98
and 98/44 relative to the transcription initiation site.
Rhinovirus Infection Induces Binding of NF-B and GATA
Transcription Factors to the VCAM-1 Promoter--
Sequence analysis of
the proximal VCAM-1 promoter has revealed potential binding sites for
several transcription factors including two GATA elements in the region
258/98 (254/251 and 239/236), and two consensus NF-B
elements in the region 98/44 (72/63 and 57/48) (Fig.
6A). Nuclei were extracted from infected and uninfected A549
respiratory epithelial cells, lysed, and analyzed by electrophoretic
mobility shift assays (EMSAs) using labeled probes containing each of
the potential binding sites in the VCAM-1 promoter.
258 to 232 Probe Containing Two (254/251 and 239/236)
GATA Sites--
Two retarded complexes were observed using nuclear
extracts from rhinovirus 16 infected A549 cells that were faintly
detectable in nuclear extracts from uninfected cells. Time course
experiments showed that binding of these complexes was maximal 30 min
after rhinovirus infection and decreased with longer incubations up to
90 min (Fig. 7A). Competition
experiments were then carried out to confirm the specificity of the
binding. Addition of excess unlabeled specific (258/232)
oligonucleotide blocked the induction of complexes (Fig. 7B,
lanes 2 and 3), confirming the specificity of the
binding activity.
View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Rhinovirus infection of A549 respiratory
epithelial cells induces binding of nuclear transcription factors to
the GATA sites in the 258/98 bp region of the VCAM-1 promoter.
A, the time course of induction by rhinovirus of nuclear
transcription factors binding to the 258/232 (containing two GATA
sites, Table I) portion of the VCAM-1 promoter was assessed by EMSA.
Nuclear extracts were prepared from uninfected (time 0) and rhinovirus
16 infected A549 cells at various time points (30, 60, and 90 min)
after infection and incubated with radiolabeled 258/232 VCAM-1
(Table I) probe. Resolution of binding complexes was accomplished on
5% polyacrylamide gels. Representative radiograph of one of at least
three separate experiments. Two retarded complexes binding to the
258/232 portion of the VCAM-1 promoter were induced in nuclei from
rhinovirus infected cells, with peak induction of binding activity
being observed within 30 min of rhinovirus infection. Induction of
binding activity by rhinovirus reduced gradually from 30 up to 90 min.
B, the specificity of the binding activity induced by
rhinovirus infection of A549 cells was examined by EMSA with
competition studies. Nuclear extracts from A549 cells uninfected
(lane 7) or rhinovirus 16-infected for 30 min (lanes
1-6) were studied. Radiolabeled 258/232 VCAM-1 probe was used
in the absence (lanes 2 and 7) or in the presence
of excess unlabeled specific 258/232 probe (SC,
lane 3), excess unlabeled specific 258/232 probe mutated
at the GATA sites (mGATA, Table I) (lane 4), and
excess unlabeled probes containing consensus AP-1-binding sequences
(lane 5). Radiolabeled mGATA probe (Table I) was used in
lane 6. Resolution of binding complexes was accomplished on
5% polyacrylamide gels. Representative radiograph of one of at least
three separate experiments. Specificity of the binding activity induced
by rhinovirus infection of A549 cells to the 258/232 portion of the
VCAM-1 promoter was confirmed by complete inhibition of the induction
of binding activity with excess unlabeled specific probe (lane
3). Involvement of the GATA sites in this binding activity was
confirmed by the lack of competition with excess unlabeled specific
258/232 probe mutated at the GATA sites (mGATA, lane 4)
or irrelevant probe (consensus AP-1, lane 5). This
result was also confirmed by complete
absence of the induction of binding activity when
radiolabeled specific 258/232 probe mutated at the GATA sites
(mGATA) was used for the EMSA (lane 6).
|
|
Further competition experiments were carried out to identify the
transcription factors binding to the probes. Formation of these
complexes was not affected by competition with excess heterologous oligonucleotide (consensus AP-1) (Fig. 7B, lane
5) or with excess unlabeled DNA oligonucleotide containing mutated
sequences of both VCAM-1 promoter GATA-binding sites (mGATA; Table
I and Fig. 7B, lane
4), indicating that binding complexes were formed of proteins
binding specifically to the VCAM-1 promoter GATA-binding sites.
To confirm this, the same mGATA oligonucleotide was radiolabeled and
used directly as probe. DNA-protein complex formation was not observed
with this labeled probe (Fig. 7B, lane 6), again confirming that rhinovirus infection of A549 cells induces
transcription factors binding specifically to the 254/251 and
239/236 GATA elements of the VCAM-1 promoter.
64 to 45 Probe Containing an NF-B-binding Site
(57/48)--
Because both NF-B sites contained in the VCAM-1
promoter are consensus sites, we investigated induction by rhinovirus
of proteins binding to only one of these sites, the 57/48 site. Two
protein-DNA complexes were clearly induced in nuclear extracts from
rhinovirus-infected A549 cells compared with noninfected cells. This
effect again showed a rapid kinetic peaking at 30 min after infection
and fading thereafter (Fig. 8A).
Competition experiments with excess specific and consensus NF-B
competitor unlabeled probes completely abrogated the signal (Fig.
8B, lanes 2 and 3), whereas an
irrelevant (AP-1) competitor did not (Fig. 8B, lane
4), confirming the NF-B specificity of the binding. These data
indicate that proteins binding to the NF-B sites in the VCAM-1
promoter are also induced in the nuclei of A549 cells during rhinovirus
infection.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 8.
Rhinovirus infection of A549
respiratory epithelial cells induces binding of a nuclear transcription
factor to the NF-B sites in the VCAM-1
promoter. A, the time course of induction by rhinovirus
of nuclear transcription factors binding to the 64/45 (containing a
consensus NF-B-binding site, Table I) portion of the VCAM-1 promoter
was assessed by EMSA. Nuclear extracts were prepared from uninfected
(time 0) and rhinovirus 16-infected A549 cells at various time points
(30, 60, and 90 min) after infection and incubated with radiolabeled
64/45 VCAM-1 (Table I) probe. Resolution of binding complexes was
accomplished on 5% polyacrylamide gels. Representative radiograph of
one of at least three separate experiments. Two retarded complexes
binding to the 64/45 portion of the VCAM-1 promoter were induced in
nuclei from rhinovirus-infected cells, with peak induction of binding
activity being observed within 30 min of rhinovirus infection.
Induction of binding activity by rhinovirus reduced gradually from 30 min up to 90 min. B, the specificity of the binding activity
induced by rhinovirus infection of A549 cells was examined by EMSA with
competition studies. Nuclear extracts from A549 cells uninfected
(lane 5) or rhinovirus 16-infected for 30 min (lanes
1-4) were incubated with radiolabeled 64/45 VCAM-1 probe in
the absence (lanes 1 and 5) or in the presence of
excess unlabeled specific 64/45 probe (SC, lane
2), and excess unlabeled probes containing consensus NF-B- and
AP-1-binding sequences (lanes 3 and 4,
respectively). Resolution of binding complexes was accomplished on 5%
polyacrylamide gels. Representative radiograph of one of at least three
separate experiments. Specificity of the binding activity induced by
rhinovirus infection of A549 cells to the 64/45 portion of the
VCAM-1 promoter was confirmed by complete inhibition of the induction
of binding activity with excess unlabeled specific probe (lane
2). Involvement of the 64/45 NF-B site in the VCAM-1
promoter in this binding activity was confirmed by complete inhibition
of induced binding activity by excess unlabeled consensus NF-B probe
(lane 3) and the lack of competition with excess unlabeled
irrelevant probe (consensus AP-1, lane 4).
|
|
Lack of Rhinovirus Induction of Proteins Binding to the ICAM-1
Promoter 227 to 200 DNA Segment Containing an SP1-binding Site
(206/201)--
To confirm that the changes observed in binding to
GATA and NF-B were direct specific effects of rhinovirus infection
and not nonspecific modifications possibly because of variations in nuclear extract integrity or in complex binding competence, we tested
by EMSAs the same nuclear extracts using a radiolabeled probe
consisting of 227 to 200 of the ICAM-1 promoter containing an
SP1-binding site. Proteins binding to this probe have previously been
shown not to be modified by rhinovirus infection (44).
The EMSA resulted in the retardation of two complexes, but no induction
was observed after rhinovirus infection up to 2 h (Fig.
9). Competition experiments confirmed the SP1
specificity of the binding (data not shown). These data indicate that
protein binding to this DNA segment is specific to the SP1-binding site and that no induction of protein binding occurred during rhinovirus infection and thus confirm the specificity of the induction of proteins
binding to the VCAM-1 NF-B- and GATA-binding sites reported above.
Having observed rhinovirus-specific induction of proteins capable of
binding both NF-B- and GATA-binding sites within the VCAM-1
promoter, we then carried out reporter gene assays to determine whether
the potential candidate transcription factor-binding sites were
functional in rhinovirus induction of VCAM-1 promoter
activity.
View larger version (54K):
[in this window]
[in a new window]
|
Fig. 9.
Rhinovirus infection of A549 respiratory
epithelial cells does not induce binding of nuclear transcription
factors to the SP1 site in the ICAM-1 promoter. The effect of
rhinovirus infection on constitutive SP1 transcription factor binding
to the 227/200 portion of the ICAM-1 promoter (Table I) was
assessed by EMSA. Nuclear extracts were prepared from uninfected (time
0) and rhinovirus 16-infected A549 cells at various time points (30, 60, and 90 min) after infection and incubated with radiolabeled
227/200 ICAM-1 probe. Resolution of binding complexes was
accomplished on 5% polyacrylamide gels. Representative radiograph of
one of at least three separate experiments. Two retarded complexes
binding to the 227/200 portion of the ICAM-1 promoter were present
at base-line conditions, and binding levels were not modified by
rhinovirus infection. Confirmation that these complexes were composed
of proteins binding to the SP1 site within the probe was carried out
with appropriate competition experiments (data not shown).
|
|
The GATA-binding Sites within the Region 258/98 and the
NF-B-binding Sites within the Region 98/44 Are Rhinovirus
Response Elements in the VCAM-1 Promoter--
The 258/98 and
98/44 regions of the VCAM-1 promoter contain sequences that conform
to consensus GATA and NF-B elements, which are already known to play
a role in VCAM-1 promoter activation by other stimuli in other cell
types (47, 54). Furthermore, the EMSAs clearly demonstrated rhinovirus
induction of nuclear proteins binding to these regions of the VCAM-1
promoter. Therefore, for further investigations, constructs were used
that specifically tested these sites in the VCAM-1 promoter.
254/251 and 239/236 GATA Elements--
To investigate
whether the GATA sites within the 258/98 region in the VCAM-1
promoter are essential for rhinovirus induction of VCAM-1 promoter
activity to occur, constructs containing either the proximal 258 bp
of the VCAM-1 promoter or the same construct with mutations at the
254/251 and 239/236 GATA-binding sites were used to transfect
A549 cells. As shown in Fig. 10, mutation of the GATA sites decreased rhinovirus induction of VCAM-1 promoter activity by approximately 60%, confirming that these GATA-binding site
are required for maximal rhinovirus induction of VCAM-1 promoter activity.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 10.
The 254/251 and 239/236 GATA
elements and 72/63 and 57/48 NF-B
elements of the VCAM-1 promoter are essential for full rhinovirus
induction of VCAM-1 promoter activity in A549 respiratory epithelial
cells. A549 cells were transiently transfected with the 258-bp
VCAM-1 promoter-CAT construct or the 258 bp VCAM-1 promoter-CAT
construct mutated at the 254/251 and 239/236 GATA sites
(258m). A549 cells were also transiently transfected with
the 98 bp VCAM-1 promoter-CAT construct or 98 bp VCAM-1
promoter-CAT constructs mutated at the 72/63 and 57/48 NF-B
sites (98mA and 98mb, respectively).
Transfected cells were incubated with medium alone (C) or
rhinovirus 16 at MOI of 1 for 24 h (RV). Epithelial
cells were harvested, and CAT activity in protein equivalent cell
lysates was assessed as described under "Materials and Methods."
VCAM-1 promoter activation is expressed as fold induction of CAT
activity in infected over control cells. Data are the means ± S.E. of four separate experiments. As observed in Fig. 6B,
rhinovirus infection of A549 respiratory epithelial cells induced
markedly increased activity of the 258-bp VCAM-1 promoter. This
rhinovirus responsiveness was markedly (approximately 50-60%) reduced
by mutation of the two GATA sites (258m), confirming the
necessity of these sites for full rhinovirus induction of VCAM-1
promoter activity in A549 cells. As previously observed (Fig.
6B), rhinovirus infection of A549 respiratory epithelial
cells also induced increased activity of the 98-bp VCAM-1 promoter.
This rhinovirus responsiveness was completely abolished by mutation of
either of the 72/63 (98mA) or 57/48
(98mB) NF-B sites, confirming that these sites are also
required for rhinovirus induction of VCAM-1 promoter activity in A549
cells to occur.
|
|
72/63 and 57/48 NF-B Elements--
A similar approach
was used to determine whether the 72/63 and 57/48 NF-B
sequences were functional promoter elements for rhinovirus induction of
VCAM-1 promoter activity. Constructs containing either the proximal
98 bp of the VCAM-1 promoter or the same construct with mutations in
the 72/63 bp (98mA) or in the 57/48 (98mB) NF-B-binding
sequences were used to transfect A549 cells. As shown in Fig. 10,
mutation of either of the two NF-B-binding sites completely
abrogated rhinovirus induction of VCAM-1 promoter activity,
demonstrating that both of the NF-B-binding sites are required for
rhinovirus induction of VCAM-1 promoter activity to occur.
| |
DISCUSSION |
We have investigated mechanisms involved in rhinovirus-induced
asthma exacerbations by studying the effect of rhinovirus infection on
airway epithelial cell VCAM-1 expression. These studies were performed
as intraepithelial lymphocyte and eosinophil recruitment in the lower
airway is an important feature of rhinovirus-induced asthma
exacerbations, and VCAM-1 is an adhesion protein that has a central
role in recruitment and activation of these cell types. We hypothesized
that respiratory epithelial VCAM-1 expression is likely to play an
important role in the mechanisms of virus-induced asthma exacerbations.
We therefore investigated respiratory epithelial cell VCAM-1 expression
and regulation by rhinovirus infection and several pro-inflammatory
stimuli to identify new targets for treatment of virus-induced
asthma exacerbations.
Our initial studies demonstrated that each of A549 pulmonary and 16 HBE
bronchial cell lines and primary bronchial epithelial cells had
base-line constitutive expression of VCAM-1 surface protein and
mRNA. These data are the first to demonstrate constitutive expression of VCAM-1 on respiratory epithelial cells and concord with
the recent observations of Atsuta et al. (42), who found soluble VCAM-1 in supernatants from primary bronchial epithelial cells
(51). These authors also observed inducible VCAM-1 surface expression
in a transformed bronchial epithelial cell line (BEAS-2B) following
stimulation by the combination of IL-1 and TNF, although they
were not able to demonstrate constitutive expression in this cell line.
Maximal induction of surface expression and production of soluble
VCAM-1 was observed with the combination of TNF and IL-4 in BEAS-2B
and primary cells, respectively (42). Our observations are different,
in that we observed no significant effect on surface expression of
VCAM-1 on A549 pulmonary or 16 HBE bronchial cell lines, of several
proinflammatory cytokines or combinations of cytokines that are known
to induce expression of several molecules including adhesion molecules
in respiratory epithelial cells. Our studies included the combination
of IFN-, IL-1, and TNF, at both 8 and 24 h, although we
did not study the effect of IL-4 either alone or in combination. These
data are of interest because they demonstrate that the regulation of
VCAM-1 expression in respiratory epithelial cells is not readily
inducible and suggest that the regulation of VCAM-1 expression may have
unusual features that are not shared by other adhesion molecules that
are easily up-regulated in respiratory epithelium.
It is therefore of great interest that we observed that rhinovirus
infection induced increased VCAM-1 cell surface protein expression in
each of A549 pulmonary and 16 HBE bronchial cell lines and in primary
bronchial epithelial cells. The time course of induced expression was
studied in A549 and 16 HBE cells and peaked in the former at 24 h
and in the latter at 8 h after virus inoculation but in both cell
lines remained elevated above noninfected cells for up to 72 h
after inoculation.
We then investigated the group and serotype specificity of the
induction of VCAM-1 and demonstrated that induction of VCAM-1 by
rhinoviruses is clearly not receptor or serotype restricted. These
observations are in keeping with previous observations relating to
rhinovirus induction of IL-8 (26, 28, 29), IL-6 (27, 29), and ICAM-1
(44) and are important in that they suggest that the mechanisms
involved in induction of VCAM-1 are likely to have broad applicability
across all rhinovirus serotypes.
In the present studies, we observed that each of sICAM and UV
inactivation and filtering virus particles from the inoculum completely
abrogated the observed VCAM-1 induction. We also confirmed the receptor
specificity of the sICAM inactivation by demonstrating that precoating
a minor group virus (rhinovirus 2) with sICAM had no effect on VCAM-1
up-regulation. These data suggest that in contrast to rhinovirus
induction of ICAM-1 or IL-8, where some induction of protein synthesis
appears to occur consequent upon virus-receptor binding (28, 44), the
signal to up-regulate VCAM-1 expression occurs through processes
associated only with viral replication. These data along with the
observed differences in cytokine regulation (we have found no effect of
any of IFN-, IL-1, and TNF on VCAM-1 expression, whereas
ICAM-1 expression is known to be strongly up-regulated by all three),
suggest that the regulation of the two adhesion molecules in
respiratory epithelium is different with respect to a number of stimuli
including rhinoviruses.
The ability of rhinovirus infection to up-regulate respiratory
epithelial cell surface expression of VCAM-1 may have particular importance in the mechanisms of virus-induced asthma exacerbations. We
have previously demonstrated that rhinovirus colds induce bronchial mucosal intraepithelial CD3+, CD4+, and
CD8+ lymphocyte and eosinophil infiltration, with a more
persistent eosinophilia in asthmatic subjects (19). Epithelial
expression of VCAM-1 is likely to play an important function in
retaining both types of inflammatory leukocyte in respiratory
epithelium by binding to its ligand the leukocyte
41 integrin VLA-4, which is expressed on
both lymphocytes and eosinophils. In addition, binding of VCAM-1 to its
integrin ligand on leukocytes activates these cells and leads to
secretion of pro-inflammatory cytokines and mediators (5-8). A further
recent study suggested an important role for VCAM-1 in promoting
inflammation in asthma by demonstrating that inhibition of binding of
VCAM-1 to its ligand VLA-4 markedly inhibited lymphocyte and eosinophil
infiltration in an animal model of allergen-induced inflammation (30).
These data make epithelial VCAM-1 a prime target for therapeutic
intervention strategies for virus-induced asthma exacerbations.
Having demonstrated that rhinovirus infection of respiratory epithelial
cells increased VCAM-1 surface protein expression, we investigated the
effects of rhinovirus infection on respiratory epithelial cell VCAM-1
mRNA expression. We observed rhinovirus induction of VCAM-1
mRNA in pulmonary epithelial cells occurring within 1 h of
virus inoculation, peaking at 8 h and lasting up to 24 h post
virus inoculation; no studies were carried out beyond this time point.
As we had observed with surface protein expression, inactivating the
virus by UV inactivation, filtration or by precoating with soluble
receptor completely abrogated the signal. These studies confirmed that
as with VCAM-1 surface protein expression, rhinovirus induction of
VCAM-1 mRNA was also consequent upon viral replication but not
virus-receptor binding.
Having observed rhinovirus induction of both VCAM-1 protein and
mRNA expression, we wished to determine whether rhinovirus infection of respiratory epithelial cells increased VCAM-1 expression by up-regulating VCAM-1 gene transcription. To investigate this possibility, we analyzed in vitro transcription of VCAM-1
mRNA in rhinovirus-infected and noninfected A549 cells. We observed clear induction of VCAM-1 gene transcription by rhinovirus infection and inhibition of this induction by an inhibitor of RNA polymerase II,
-amanitin. These data confirmed that rhinovirus infection of
respiratory epithelial cells rapidly increased de novo
transcription of VCAM-1 mRNA. Next we wished to determine the
molecular mechanisms involved in rhinovirus induction of VCAM-1
mRNA transcription, because these mechanisms might identify a
target for development of new therapeutic intervention strategies.
The VCAM-1 promoter contains several potential transcription
factor-binding sites, of which NF-B, GATA, IRF-1, AP-1, and SP1 have
been implicated in induction of VCAM-1 gene transcription in response
to various pro-inflammatory stimuli, including TNF, lipopolysaccharide and cytokines (47, 55-58). In the present study, we
used reporter gene assays to investigate the effect of rhinovirus
infection on VCAM-1 promoter activity and observed that rhinovirus
infection of A549 epithelial cells strongly induced VCAM-1 promoter
activity. We therefore used sequentially deleted VCAM-1 promoter
constructs to determine which sites in the VCAM-1 promoter were
functional in rhinovirus induction of VCAM-1 promoter activity. We
observed that sequential deletion of the VCAM-1 promoter up to 258
base pairs from the transcription initiation site had no effect on the
ability of rhinovirus infection to induce VCAM-1 promoter activity.
Deletion of the promoter to 98 base pairs reduced the rhinovirus
induction by approximately 50% and further deletion to 44 base pairs
completely abrogated the rhinovirus induction. These data suggest that
elements contained within the 258 to 44 region of the VCAM-1
promoter were necessary for rhinovirus-induced up-regulation of VCAM-1
promoter activity to occur.
In EMSA assays we observed clear induction by rhinovirus infection of
proteins binding to labeled probes containing both the 254/251 and
the 239/236 GATA-binding sites and to probes containing the
consensus NF-B-binding site present at both the 72/63 and the
57/48 sites within the VCAM-1 promoter. These experiments confirmed
the induction by rhinovirus infection of proteins binding to either or
both of the 254/251 and 239/236 GATA-binding sites and to
either or both of the 72/63 and 57/48 NF-B-binding sites
within the VCAM-1 promoter.
Mutational analysis was therefore carried out with reporter gene assays
to investigate the function
B and GATA Transcription Factors*
TOP
ABSTRACT
INTRODUCTION
