HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ye, X. Articles by Bredesen, D. E. Search for Related Content PubMed PubMed Citation Articles by Ye, X. Articles by Bredesen, D. E. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 42, 30202-30208, October 15, 1999

TRAF Family Proteins Interact with the Common Neurotrophin Receptor and Modulate Apoptosis Induction^*

From the Programs on ^a Aging and Cancer, ^e Apoptosis and Cell Death, and ^h Gene Regulation, The Burnham Institute, La Jolla, California 92037, the ^c Apoptosis and Differentiation, Center of Molecular and Cellular Genetic, CNRS UMR5534, University of Lyon1, 69622 Villeurbanne, France, the ^d Interdepartmental Program in Neuroscience, University of California, Los Angeles, California 90024, and the ⁱ Neuroscience Department, University of California, San Diego, California 92093

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The common neurotrophin receptor, p75^NTR, has been shown to signal in the absence of Trk tyrosine kinase receptors, including induction of neural apoptosis and activation of NF-B. However, the mechanisms by which p75^NTR initiates these intracellular signal transduction pathways are unknown. Here we report interactions between p75^NTR and the six members of TRAF (tumor necrosis factor receptor-associated factors) family proteins. The binding of different TRAF proteins to p75^NTR was mapped to distinct regions in p75^NTR. Furthermore, TRAF4 interacted with dimeric p75^NTR, whereas TRAF2 interacted preferentially with monomeric p75^NTR. TRAF2-p75^NTR, TRAF4-p75^NTR, and TRAF6-p75^NTR interactions modulated p75^NTR-induced cell death and NF-B activation with contrasting effects. Coexpression of TRAF2 with p75^NTR enhanced cell death, whereas coexpression of TRAF6 was cytoprotective. Furthermore, overexpression of TRAF4 abrogated the ability of dimerization to prevent the induction of apoptosis normally mediated by monomeric p75^NTR. TRAF4 also inhibited the NF-B response, whereas TRAF2 and TRAF6 enhanced p75^NTR-induced NF-B activation. These results demonstrate that TRAF family proteins interact with p75^NTR and differentially modulate its NF-B activation and cell death induction.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The neurotrophins, including NGF,¹ brain-derived neurotrophic factor, neurotrophin-3, and neurotrophin-4/5, are critical for differentiation and survival of specific neuronal populations during development. The cellular responses to neurotrophins are elicited via two specific surface receptors: Trk (tropomyosin-related kinase) tyrosine kinase receptors and the common neurotrophin receptor, p75^NTR (1). Trk proteins have intrinsic tyrosine kinase activities. Binding of neurotrophins to Trks activates their kinase domains, triggering downstream Ras signaling pathways, which are responsible for a series of trophic factor responses, e.g. neuronal survival, neurite outgrowth from cultured neurons, and differentiation of PC12 cells (2).

In comparison to Trk family members, p75^NTR functions are less well established and remain controversial (3-5). p75^NTR has been shown to facilitate and regulate the function of Trk receptors (6, 7). However, p75^NTR is also capable of triggering cellular responses independent of Trk receptors (7). p75^NTR confers neurotrophin dependence in neural cells (8, 9): in the absence of neurotrophins, overexpression of p75^NTR induces apoptosis. Furthermore, studies of p75-null mice revealed increased numbers and somal sizes of medial septal and diagonal band cholinergic neurons compared with control animals (10, 11). These findings indicate that p75^NTR is likely to be involved in the programmed cell death of this population of neurons. In addition, p75^NTR has been reported to mediate NGF-induced NF-B (nuclear factor B) activation in Schwann cells (12) and SAPK/JNK (stress-activated protein kinase or c-Jun N-terminal kinase) activation in oligodendrocytes (13).

p75^NTR belongs to the TNFR/NGFR cell surface receptor superfamily (14). Based on their intracellular domains, the TNFR/NGFR receptor superfamily members are divided into two major subgroups: one group that includes the so-called "death domain" and another that does not (4). Members of the former group, including Fas and TNFR I, typically mediate apoptosis. In contrast, members of the latter group often differentially deliver signals for either induction or suppression of apoptosis, depending upon the cell contexts. Remarkably, compared with the extensive literature describing signal transduction of TNFR, FAS/APO-1, and other members of this cytokine receptor family, little is known about the p75^NTR signal transduction pathways. Ligand binding to TNFR and FAS/APO-1 induces receptor aggregation, recruiting cytoplasmic signaling proteins such as FADD and pro-caspase-8 to the receptor complex (15). However, this has not been shown to be the case for p75^NTR.

One family of signaling proteins in the TNF receptor complex is composed of the TRAF family proteins, originally described by Goeddel and colleagues (16). TRAF proteins were isolated based on their ability to interact with the cytosolic domains of specific TNFR family members. To date, six members of the TRAF family have been identified. These TRAF proteins have two main characteristics: first, all contain conserved C-terminal TRAF domains, which are responsible for homo- or heteroligomerization and for the interaction with the cytoplasmic regions of specific TNFR superfamily receptors (16-19). Second, all TRAF proteins other than TRAF1 contain an N-terminal RING finger structure and multiple zinc fingers, which appear to be critical for their effector functions (17, 20).

TRAF proteins are signal transduction adapter proteins. TRAF2, -5, and -6 have been shown to be mediators of both NF-B activation (20-22) and SAPK/JNK activation (23, 24). The activation processes involve successions of protein-protein interactions and phosphorylation of protein kinases. TRAF2, TRAF5, and TRAF6 interact with the downstream kinase NF-B inducing kinase (24, 25), which in turn interacts with the kinases within the IB kinase complex (26, 27). In addition, the death domain kinase (reporter-interacting protein) (28, 29) and the serine-threonine kinase IRAK (21) have also been reported to interact with TRAF proteins and mediate NF-B activation. On the other hand, apoptosis signal-regulating kinase ASK1, a TRAF interacting kinase, was recently demonstrated to be a downstream target of TRAF2, TRAF5, and TRAF6 in the JNK signaling pathway (30).

To investigate signal transduction mediated by p75^NTR, we analyzed the interaction between p75^NTR and the TRAF family members. Here we show that all six TRAF proteins interact with p75^NTR. These proteins constitute the first group of adapter molecules to be identified for p75^NTR. We also demonstrate that TRAF2 and TRAF4 bind to distinct domains of p75^NTR, and TRAF2, TRAF4, and TRAF6 differentially modulate the ability of this receptor to induce cell death and NF-B activation.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell Culture and Transfection Procedures-- Immortalized 293T cells, derived from human embryonic kidney, were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum (Sigma). Transient transfections of HKE 293T cells were performed using a modified calcium-phosphate procedure as described previously (31). Efficiency of transfection was estimated in parallel experiments using eukaryotic assay vector pCH110 (Amersham Pharmacia Biotech). pCH110 contains the gene encoding -galactosidase under control of the SV40 early promoter. Cells that express -galactosidase were monitored by 5-bromo-chloro-3-indolyl--D-galactopyranoside staining.

Plasmid Constructs-- The coding region of human TRAF1, murine TRAF5, and human TRAF6 were amplified by polymerase chain reaction from pSG5-TRAF1 (gift of G. Mosialos), pMKITNeo-HA-mTRAF5 (gift of H. Nakano), and pGEM-TRAF6 (gift of C. Ware), respectively. The primers used for polymerase chain reaction are: EcoRI-huTRAF1, CCGGAATTCATGGCCTCCAGCTCAGGCA and huTRAF1-XhoI CCGCTCGAGCTAAGTGCTGGTCTCCACA; EcoRI-mTRAF5, CCGGAATTCATGGCTCATTCGGAGGAG and mTRAF5-XhoI, CCGCTCGAGTCACAGATCCTCCAAGTCAGTTAA; EcoRI-huTRAF6, CCGGAATTCATGAGTCTGCTAAACTGTGAAA; huTRAF6-XhoI, CCGCTCGAGCTATACCCCTGCATCAGTACT. After digestion, the EcoRI/XhoI fragments were ligated into pcDNA3-myc (gift of Y. Takahashi) to create pcDNA3-myc-hTRAF1, pcDNA3-myc-mTRAF5, and pcDNA3-myc-hTRAF6. The full-length human TRAF2, TRAF3, TRAF4, and TRAF4 (308-470) were cloned in-frame into the EcoRI and XhoI sites of pcDNA3-HA vector (32, 33). TRAF2 (272-501) was cloned in KpnI-BamHI sites of pcDNA3 by polymerase chain reaction amplification using primers (5') GGGGTACCATGTGCGAGAGCCTGGAGAAG and (3') CGGGATCCTTAGAGCCCTGTCAGGTCC. pcDNA3-p75-Flag was obtained by cloning the rat p75^NTR cDNA in pcDNA3 with a Flag tag fused to the C terminus of p75^NTR. pFKBPp75IC contains the FK506-binding domain and a myristoylation signal.² IBM, an IB dominant negative mutant was obtained from Doug Green (34). NF-B reporter construct contains four tandem NF-B binding sites inserted upstream of a minimal fos promoter (35) driving luciferase expression.

NF-B Activity Measurement-- NF-B activity was monitored by measuring the luciferase activity of cells transfected with NF-B reporter gene. Briefly, HEK 293T cells were co-transfected with various TRAF and p75^NTR constructs in the presence of the reporter (ratio 5:1). 48 h after transfection, cells were lysed and luciferase activity was determined using the Boehringer Luciferase Reporter Gene Assay kit according to the manufacturer's instruction.

Immunoblotting-- One-dimensional immunoblotting experiments using antibodies raised against p75^NTR (Promega), Myc epitope (Babco), or HA epitope (Roche Molecular Biochemicals) were performed as described previously (36). The results were detected with the ECL system (Amersham) and autoradiographs were recorded onto X-Omat AR films (Kodak). The analysis was performed within the range of linearity of the film.

Cell Death Assay-- Cell death was analyzed using the trypan blue staining procedure as described previously (37). 48 h after transfection, cells were treated with 17 µM tamoxifen (Sigma) for 2 h before being collected, washed in serum-free media, and resuspended in serum-free medium. Cells were stained with 0.04% trypan blue (Sigma) before counting. The percentage of cell death was determined as the percentage of trypan blue positive cells in each sample.

Generation of GST Fusion Protein and in Vitro Binding Assays-- p75IC(Lys²⁴⁵-Val³⁹⁶), p75ICC83(Lys²⁴⁵-Leu³¹³), and p75ICN82(Thr³²⁷-Leu³⁸⁶) were polymerase chain reaction amplified and cloned into GST (glutathione S-transferase) fusion expression vectors (Amersham Pharmacia Biotech). The 5' primers were: 1) 5'-CGGGATCCGCAATGAAGAGGTGGAACAGCTGC-3' (for GST:p75IC and GST:p75ICC83); 2) 5'-CGCGGATCCACCTGGCGACATCTGGCAGGC-3' (for p75ICN82). The 3' primers were: 1) 5'-ACGTCGACTCACACTGGGGATGTGGCAGTGGACTC-3' (for GST:p75IC) and 2) 5'-ACGTCGACTACAGGGGCAGGCTACTG-3' (for GST:p75ICC83); and 3) 5'CGGAATTCGCTTAGACTCTCCACAATGTCAGC3' (for GST:p75ICN82). GST:p75IC and GST:p75ICC83 were cloned in-frame into BamHI-SalI sites of pGEX-4T-1. p75ICN82 was cloned in BamHI-EcoRI sites of pGEX-2T. Expression and purification of the GST fusion proteins were performed according to the manufacturer's instruction. For in vitro binding assays, HEK 293T cells in a 6-well plate were transfected with expression vectors for different TRAFs. 36 h after transfection, cells were harvested and lysed in 1 ml of E1A buffer (18). For each in vitro binding assay, 5 µg of the appropriate GST fusion protein bound to glutathione-Sepharose beads (Amersham Pharmacia Biotech) was incubated with 250 µl of cell lysate overnight at 4 °C for 1 h. The beads were then washed multiple times with the same buffer. Proteins on the beads were fractionated by SDS-polyacrylamide gel electrophoresis and subjected to immunoblotting analysis.

Coimmunoprecipitation Assay-- Co-transfected HEK 293T were harvested, washed, and resuspended in E1A buffer (500 mM HEPES, pH 7.6, 250 mM NaCl, 0.1% Nonidet P-40, 5 mM EDTA) (18). Cell lysates were immunoprecipitated with anti-Myc (Babco), anti-HA (Roche Molecular Biochemicals), or anti-Flag antibody (M2, Kodak), using protein A-Sepharose (Sigma). After extensive washes, proteins bound to the Sepharose were analyzed by immunoblotting.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Association of TRAF Family Members with p75^NTR-- In light of the signal transduction mediated by the interactions between TNFR family members and the TRAF proteins, we investigated the potential interactions between p75^NTR and TRAF family members. Flag-tagged p75^NTR and HA- or Myc-tagged TRAF1, -2, -3, -4, -5, and -6 were coexpressed in HEK 293T cells and immunoprecipitated with anti-Flag antibody. After the immune complexes were subjected to immunoblotting with anti-TRAF2, anti-HA or anti-Myc antibodies, p75^NTR was found to associate with all of the TRAF proteins (Fig. 1). These findings suggested that p75^NTR bound to TRAF proteins via the conserved C-terminal TRAF domain. In support of this idea, N-terminal deletion mutants of TRAF2 and 4, which retained the TRAF domains, were found to associate with p75^NTR (Fig. 1, B and C).

View larger version (22K): [in this window] [in a new window]   Fig. 1.   Interaction of p75NTR with TRAF Proteins. p75NTR Flag was transiently transfected with each TRAF expression vector into HEK 293T cells. After 36 h, cytosolic proteins were extracted with E1A lysis buffer, immunoprecipitated (IP) with anti-Flag antibody (M2), and immunoblotted (WB, Western blotting) with anti-TRAF2, anti-HA, or anti-Myc antibodies. A, association between TRAF1, TRAF3, TRAF5, and TRAF6 with p75NTR. Lane 1, total protein extract (Lysate) from HEK 293T cells transfected with indicated TRAF genes; lanes 2 and 3, proteins immunoprecipitated with M2 antibody. The antibody used for each Western blot is as indicated. B, association between TRAF2 and p75NTR involved the TRAF domain of TRAF2. WT: full-length TRAF2; N: TRAF2 (272-501). C, association between TRAF4 and p75NTR involved the TRAF domain of TRAF4. WT: full-length TRAF4; N: TRAF4 (308-470). In both B and C, lanes 1 and 2 show the expression of WT and N forms of TRAF2 or TRAF4 in total protein extracts (Lysate). Lanes 3-6 show the results of immunoprecipitation with M2 antibody. Heavy chain (*) and light chain () proteins of the M2 antibody used for immunoprecititation are indicated.

The intracellular domain of p75^NTR contains two distinct regions: a highly conserved and unstructured juxtamembrane region and a six-helical bundle type II death domain-like sequence in the C terminus (38). To map the domains required for TRAF interaction within p75^NTR, we utilized a GST pull-down assay. Various deletion mutants of GST-p75IC fusion proteins were incubated with TRAF2 or TRAF4 in HEK 293T cell extracts. Immunoblotting of the proteins precipitated by the glutathione-Sepharose showed that TRAF2 interacted with the C-terminal helical region of the p75IC (Thr³²⁷-Leu³⁸⁶) (Fig. 2B). In contrast, TRAF4 associated with the N-terminal juxtamembrane region of p75IC (Lys²⁴⁵-Gly³¹³) (Fig. 2B). In a recent report, it was shown that TRAF6 also bound to the juxtamembrane region of p75^NTR (39).

View larger version (15K): [in this window] [in a new window]   Fig. 2.   Binding domains between TRAF2, TRAF4, and p75NTR. A, schematic representation of GST-p75IC fusion constructs. Their abilities to interact with TRAF2 or TRAF4 in GST pull-down assays are shown: +, interaction with TRAF2 or TRAF4; , no interactions. B, interaction of TRAF2 and TRAF4 with wild type and mutant p75IC. TRAF2 or TRAF4 protein expressed in HEK 293T cells was extracted and subjected to GST pull-down assay. IC, GST:p75IC; N, GST:p75ICC83(245-313); C, GST:p75IC N82(327-386)

Activation of NF-B by p75^NTR Is Modulated by TRAF Proteins-- TRAF2, -5, and -6 have been demonstrated to be mediators of NF-B activation initiated by multiple TNFR family members (20-22). Previous studies indicated that p75^NTR may induce the nuclear translocation of the p65 subunit of NF-B in Schwann cells following NGF binding (12). To determine whether TRAF proteins have any effect on p75^NTR-mediated NF-B activation, we utilized a luciferase reporter system in HEK 293T cells.

Overexpression of p75^NTR in HEK 293T cells led to a modest activation of NF-B, measured by NF-B dependent luciferase activity (Fig. 3). Co-transfection of a trans-dominant inhibitor for NF-B activation, IBM (34), resulted in increased apoptosis in comparison to that induced by p75^NTR expression alone (Fig. 4). This finding indicates that NF-B plays an anti-apoptotic rather than a pro-apoptotic role during p75^NTR induced cell death in HEK 293T cells. Our observation is compatible with previous reports that the NF-B activation protects various types of cells against apoptosis caused by stimuli including TNF-, ionizing radiation, and chemotherapy drugs (34, 40, 41).

View larger version (34K): [in this window] [in a new window]   Fig. 3.   TRAF proteins modulate p75NTR-induced NF-B activity. HEK 293T cells were transiently co-transfected with 0.25 µg of pcDNA3-p75NTR (p75+) or pcDNA3 (p75) and 0.25 µg of TRAF2 (A), Myc-TRAF6 (B), or HA-TRAF4 expressing plasmids (C) or pcDNA3 control plasmid (TRAF-) in the presence of 0.1 µg of NF-B reporter. NF-B activation was determined as described under "Materials and Methods." The fold of NF-B activation was obtained as the ratio between the relative light units obtained for each sample with that measured with pcDNA3 transfected control cells. Standard deviations are as indicated (n = 3). D, pcDNA3-p75NTR (p75+) or pcDNA3 (p75) (0.25 µg) was co-transfected with TRAF2 or TRAF6 (0.25 µg) in the presence or absence of TRAF4 (0.25 µg). 0.25 µg of pcDNA3 was used as the negative control for TRAF4 and 0.1 µg of NF-B reporter was used. NF-B activation was determined as described in A-C. Standard deviations are as indicated (n = 2).

View larger version (39K): [in this window] [in a new window]   Fig. 4.   Inhibition of NF-B activation enhances p75NTR-induced cell death. HEK 293T cells were transiently co-transfected with 2.5 µg of pFKBP-p75IC (p75+) or pcDNA3 control plasmid (p75) and 2.5 µg of pLXSN or NF-B activation super suppressor pLXSN-IBM. Cell death was monitored 48 h after transfection, using trypan blue exclusion as described under "Materials and Methods." Standard deviations are indicated (n = 3).

Although all six TRAF proteins were found to interact with p75^NTR, only TRAF2, -4, and -6 had significant effects on p75^NTR-induced NF-B activation when each of the six TRAF family proteins was individually coexpressed with p75^NTR and NF-B response was measured by NF-B dependent luciferase activity (data not shown).

Both TRAF2-p75^NTR and TRAF6-p75^NTR coexpression had synergistic effects on NF-B activation. Overexpression of TRAF2 by itself led to an approximately 5-fold induction of NF-B dependent luciferase activity. While expression of p75^NTR alone led to only a modest NF-B activation of 3-fold, coexpression of TRAF2 with p75^NTR led to NF-B activation of approximately 12-fold (Fig. 3A). In comparison to TRAF2, coexpression of TRAF6 with p75^NTR had a more profound synergistic effect on NF-B activation: expression of TRAF6 alone led to an increase of NF-B dependent luciferase production of 30-fold, whereas coexpression of TRAF6 with p75^NTR led to an activation of approximately 90-fold (Fig. 3B).

In contrast to the positive effect on NF-B activation conferred by TRAF2 and TRAF6, TRAF4 had an inhibitory effect on p75^NTR-mediated NF-B activation. TRAF4 expression in the absence of p75^NTR had no effect on the basal level of NF-B activation (Fig. 3C), compatible with previous reports for TRAF4 (42). However, when coexpressed with p75^NTR, TRAF4 completely blocked NF-B activation by p75^NTR (Fig. 3C).

We further analyzed whether TRAF4 could affect NF-B activation induced by TRAF2/p75^NTR or TRAF6/p75^NTR. Interestingly, TRAF4 selectively blocked NF-B activation induced by co-transfection of TRAF6 and p75^NTR (Fig. 3D), suggesting the possible competition between TRAF4 and TRAF6 for p75^NTR. TRAF4 expression did not affect NF-B activation by TRAF6 alone, nor did it affect NF-B activation by TRAF2 or TRAF2/p75^NTR (Fig. 3D).

p75^NTR-induced Apoptosis Is Modulated by TRAFs in a Multimerizationdependent Fashion-- One of the important functions of p75^NTR is apoptosis induction, which has been described both in the absence of neurotrophins (8, 9, 11) and following neurotrophin binding (43, 44). In cases in which p75^NTR was shown to sensitize cells to apoptosis in the absence of ligand binding, the pro-apoptotic effect of p75^NTR overexpression could be reversed by dimeric peptides derived from NGF (45), FKBP based dimerizing drugs,² or (dimeric) neurotrophins (8). Therefore, we evaluated the effects of TRAF family members on p75^NTR-induced apoptosis, with and without enforced dimerization.

We utilized the fusion construct of p75IC and the FK506-binding protein (FKBP), pFKBP-p75IC, described by Wang et al.² This construct allows enforced dimerization of p75IC upon addition of the divalent ligand AP1510² (46). As described,² expression of monomeric p75IC in the absence of AP1510-induced cell death in HEK 293T cells. Addition of AP1510 led to the dimerization of p75IC and inhibition of cell death, demonstrating that p75IC in the monomeric form, but not multimeric form, induces cell death.

Coexpression of TRAF2, TRAF4, or TRAF6 with pFKBP-p75IC had prominent yet distinct effects on p75^NTR-induced apoptosis in HEK 293T cells. Coexpression of TRAF2 with p75^NTR led to a marked increase of p75^NTR-induced cell death (Fig. 5A). Expression of TRAF2 in the absence of p75^NTR was not pro-apoptotic, arguing that TRAF2 enhances the pro-apoptotic effect of p75^NTR but is not, in and of itself, pro-apoptotic (Fig. 5A). Furthermore, expression of a TRAF2 dominant negative mutant lacking the N-terminal 272 amino acids (T2N) significantly decreased p75^NTR-mediated apoptosis (Fig. 5B). Apoptosis induced by the coexpression of TRAF2 and pFKBP-p75IC was completely suppressed by enforced dimerization with AP1510. Thus although TRAF2 markedly enhanced p75^NTR-induced apoptosis, it did not affect the ability of dimerization to suppress the pro-apoptotic effect of p75^NTR.

View larger version (41K): [in this window] [in a new window]   Fig. 5.   TRAF2, TRAF4, and TRAF6 modulate p75NTR-induced cell death. HEK 293T cells were transiently co-transfected with 2.5 µg of pFKBP-p75IC (p75+) or pcDNA3 control plasmid (p75) and 2.5 µg of TRAF2 (A), TRAF2 (272-501) (B), TRAF4 (C), TRAF6 expressing plasmids (D) or pcDNA3 as the negative control (TRAF-). 24 h after transfection, dimerization of p75NTR was induced by adding 2 µM AP1510. Cell death was then monitored 24 h later, using trypan blue exclusion as described. Standard deviations are indicated (n = 3).

In contrast, TRAF4 expression did not enhance monomeric p75^NTR-induced apoptosis (Fig. 5C). However, TRAF4 completely suppressed the ability of p75^NTR dimerization to block cell death induction by p75^NTR (Fig. 5C).

TRAF6, in contrast, protected HEK 293T cells from p75^NTR-induced apoptosis. Coexpression of TRAF6 suppressed cell death induced by monomeric p75^NTR. The suppression of cell death was as efficient as that resulting from enforced dimerization of pFKBP-p75IC with AP1510 (Fig. 5D). As with TRAF2, TRAF6 did not affect the suppression of p75-induced cell death upon dimerization with AP1510 (Fig. 5D).

TRAF4 Associates with Dimeric p75^NTR Whereas TRAF2 Interacts Preferentially with Monomeric p75^NTR-- Because of the multimerization-dependent effects of TRAF2 and TRAF4 on p75^NTR induced apoptosis, TRAF2 affecting p75^NTR-induced apoptosis, which is a function of p75^NTR monomer, and TRAF4 affecting the inhibition of apoptosis induction that occurs with p75^NTR dimerization, we investigated the interactions between TRAF2, TRAF4, and p75^NTR as a function of p75^NTR dimerization. pFKBP-p75IC was coexpressed with TRAF2 or TRAF4 in HEK 293T cells, and AP1510 was administered to induce dimerization of p75^NTR. Fig. 6B shows that TRAF4 coimmunoprecipitated with dimeric, but not monomeric, p75^NTR. In contrast, TRAF2 interacted preferentially with monomeric p75^NTR (Fig. 6A). Some p75^NTR did coimmunoprecipitate with TRAF2 in the presence of AP1510. This may either represent incomplete dimerization of pFKBP-p75IC by AP1510 (in which case, residual monomeric p75^NTR may be coimmunoprecipitated with TRAF2) or binding of TRAF2 to dimeric p75^NTR with reduced affinity. In either case, however, TRAF2 interacted preferentially with monomeric p75^NTR, whereas TRAF4 interacted solely with dimeric p75^NTR.

View larger version (11K): [in this window] [in a new window]   Fig. 6.   TRAF4 interacts with p75NTR dimer while TRAF2 binds preferentially to p75NTR monomer. HEK 293T cells were co-transfected with pFKBP-p75IC and HA-TRAF2 or HA-TRAF4. 24 h after transfection, cells were treated with 2 µM AP1510. Coimmunoprecipitation was performed using anti-HA to immunoprecipitate TRAF2 (A) or TRAF4 (B) as described under "Materials and Methods." The results of immunoblotting using anti-p75NTR polyclonal antibody are presented. Lanes 1-3 in A and lanes 1-4 in B, total protein extracts (Lysate) from transfected HEK 293T cells; lanes 4-6 in A and lanes 5-8 in B, proteins immunoprecipitated with anti-HA antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Although accumulated evidence has demonstrated the ability of the common neurotrophin receptor p75^NTR to signal in the absence of Trk proteins in certain cellular contexts (4, 47), the nature of p75^NTR signaling pathways has been elusive. In the current study, we observed that multiple TRAF family members interacted with the common neurotrophin receptor, p75^NTR, as detected by coimmunoprecipitation after overepression in HEK 293T cells. Considering that TRAF proteins are capable of forming hetero- and homodimers through the common TRAF domain (or the unique isoleucine zipper regions in the case of TRAF3 and TRAF5) (48), the interactions we detected between TRAF proteins and p75^NTR may be direct or indirect.

NMR structural analysis has disclosed two distinct structural domains in the intracytoplasmic region of p75^NTR: an unstructured N-terminal region and a C-terminal region with six -helices. The latter region is reminiscent of the structure of the death domains of Fas and RAIDD (38), with the exception that Fas and RAIDD display a type I death domain, whereas p75^NTR displays a type II death domain. In the current study, we found that TRAF2, TRAF4, and TRAF6 selectively interact with these two different regions of p75^NTR. Specifically, the TRAF2-p75^NTR interaction required the helical C-terminal region (residues Thr³²⁷-Leu³⁸⁶) and the TRAF4-p75^NTR and TRAF6-p75^NTR interactions required the juxtamembrane region (residues Lys²⁴⁵-Gly³¹³) (39). A similar scenario has been reported for CD40-TRAF interactions: TRAF1, -2, -3, and -5 bind to a different region of CD40 than the site required for TRAF6 interaction (48, 49).

TRAF2 and TRAF6, when coexpressed with p75^NTR, enhanced the modest NF-B activation induced by p75^NTR expression alone, consistent with their roles as NF-B activators in the signaling pathways triggered by other members of the TNFR/NGFR superfamily. TRAF6 was a much stronger inducer of NF-B activation than TRAF2. No previous role has been described for TRAF4, although it demonstrates structural similarity to other TRAF proteins. Our current results indicate that TRAF4 is a negative regulator of NF-B activation by p75^NTR: TRAF4 inhibited NF-B activation by both p75^NTR and p75^NTR/TRAF6 while it did not affect NF-B activation induced by TRAF2-p75^NTR coexpression. These data suggest that signals derived from TRAF2 and TRAF6 may be differentially regulated, which would be compatible with the observation that TRAF4 and TRAF6 bound to the juxtamembrane region of p75^NTR, while TRAF2 interacted with the C-terminal helical region of p75^NTR.

We also found that the interactions between TRAF proteins and p75^NTR could modulate p75^NTR-induced apoptosis in HEK 293T cells with markedly differing results: TRAF2 enhanced monomeric p75^NTR-mediated apoptosis, but had no effect on apoptosis in the absence of p75^NTR. Furthermore, a dominant-negative mutant of TRAF2, TRAF2 (272-501), inhibited p75^NTR-induced cell death, arguing that TRAF2 plays a role in the endogenous pathway of p75^NTR-mediated apoptosis. TRAF2, however, did not affect the dimerization-induced inhibition of p75^NTR-mediated apoptosis. This combination of effects is compatible with the finding that TRAF2 interacted preferentially with monomeric p75^NTR.

In contrast, TRAF4 interacted with dimeric, but not monomeric, p75^NTR, and its functional effects on p75^NTR-induced apoptosis were found to be compatible with that interaction: TRAF4 had no effect on p75^NTR monomer-induced apoptosis, but TRAF4 completely suppressed the dimerization-induced inhibition of p75^NTR-mediated apoptosis.

In the case of TRAF6, it protected HEK 293T cells from p75^NTR monomer-induced cell death, but did not have a significant effect on the inhibition of apoptosis upon dimerization of p75^NTR. According to the recent report by Khursigara et al. (39), TRAF6 interacts with multimerized p75^NTR since interaction between TRAF6 and p75^NTR is dependent on NGF binding.

The role of NF-B activation during apoptosis induced by various stimuli is still in debate. In our current studies, NF-B activation did not correlate well with apoptosis induction, implying that other variables (e.g. SAPK/JNK activation) may turn out to be more important. On one hand, NF-B activation appeared to protect HEK 293T cells from p75^NTR-induced cell death, since the expression of the transdominant inhibitor for NF-B activation, IBM, led to an elevated level of apoptosis when cells were challenged by overexpression of p75^NTR. Also, the strong NF-B inducer TRAF6 was cell protective, and the NF-B inhibitor TRAF4 blocked cell rescue upon dimerization of p75^NTR.

On the other hand, TRAF2 promoted cell death yet increased NF-B activation. It has been reported that targeted disruption of the TRAF2 gene in mice results in increased sensitivity to TNF-induced apoptosis, implying an antiapoptotic function for TRAF2 (50). However, there may be distinct regulation of the signals derived from the interactions between p75^NTR and TRAF2 or TRAF6, since these interactions were mapped to different regions in the intracytoplasmic region of p75^NTR. In addition, the fact that TRAF2 interacts with reporter-interacting protein, a death-domain-containing protein kinase may possibly explain why, as a NF-B activator, TRAF2 is able to enhance p75^NTR-induced cell death, given that overexpression of reporter-interacting protein has been shown to induce apoptosis, mimicking TNF effect on cells (51).

The effect of TRAF2 and TRAF4 on p75^NTR-induced cell death and NF-B activation is consistent with our unpublished observations³ that TRAF2 and TRAF4 are expressed endogenously in PC12 cells. TRAF4 is reported to be expressed in post-mitotic undifferentiated neurons (52), indicating its function in neural development and neurogenesis.

Our results suggest a model for the effects of TRAF2, TRAF4, and TRAF6 on p75^NTR-mediated NF-B activation and apoptosis (Fig. 7). They do not exclude the possibility that these TRAF family members have effects on other cellular parameters. Furthermore, cells other than HEK 293T cells may respond differently. HEK 293T cells were utilized because the pro-apoptotic effects of p75^NTR in neural cells have been reproduced in HEK 293T cells,² and thus HEK 293T cells serve as a useful model for studies of p75^NTR-mediated apoptosis. It is important to analyze the functions of the various TRAF proteins in vivo using mice with targeted disruption of the TRAF genes. Future in vivo studies should provide additional insight into the functions of these signal transducing molecules and the signaling pathways trigged by the common neurotrophin receptor p75^NTR.

View larger version (19K): [in this window] [in a new window]   Fig. 7.   Model of the involvement of TRAF proteins in p75NTRR-induced NF-B activation and cell death. Unliganded p75NTR induces cell death as a monomer. The presence of the ligand leads to the dimerization of p75NTR, blocking cell death induction. When TRAF2 is coexpressed, it binds to p75NTR in the absence of ligand and generates an increased apoptotic effect. However, binding of the ligand to p75NTR leads to the dimerization of p75NTR and the disassociation of TRAF2 from p75NTR. In the presence of TRAF4, regardless of the presence or absence of the ligand, p75NTR induces apoptosis. Binding of TRAF4 to p75NTR inhibits the rescue and leads to a persistent cell death. TRAF6 protects cells from p75NTR-induced apoptosis to the same extent as that by AP1510-induced dimerization. TRAF2 and TRAF6 enhance p75NTR-induced NF-B activation while TRAF4 blocks p75NTR-induced NF-B activation.

	ACKNOWLEDGEMENTS

We thank Doug Green for the IBM expression construct, David Spencer for the FKBP vectors, Ariad Pharmaceuticals for the AP1510, and Sabina Sperandio for the p75^NTR Flag construct.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants CA69381, NS35155, and NS33376 (to D. E. B.) and Association pour la Recherche contre le Cancer 9036, 7040, Ligue Nationale contre le Cancer and Ligue Regionale contre le Cancer (to P. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^b National Research Service Award fellow.

^d National Science Foundation Predoctoral fellow.

^f National Research Service Award fellow.

^g Supported by Deutsch Forschungsgemeinschaft Grant EL-818.

^j To whom correspondence should be addressed: Buck Center for Research in Aging, P.O. Box 638, Novato, CA 94948. Tel.: 415-899-1800; Fax: 415-899-1810; E-mail: dbredesen@buckcenter.org.

² J. J. L. Wang, S. Rabizadeh, A. Tasinato, S. Sperandio, X. Ye, M. Green, N. Assa-Munt, D. Spencer, and D. E. Bredesen, submitted for publication.

³ X. Ye, T. VanArsdale, H. Zhang, and D. E. Bredesen, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: NGF, nerve growth factor; NGFR, NGF receptor; TRAF, TNF receptor associated factor; Trk, tropomyosin related kinase; NF-B, nuclear factor B; SAPK/JNK, stress-activated protein kinase or c-Jun N-terminal kinase; TNF, tumor necrosis factor; TNFR, TNF receptor; NTR, neurotrophin receptor; GST, glutathione S-transferase.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M.-J. Hsu, C. Y. Hsu, B.-C. Chen, M.-C. Chen, G. Ou, and C.-H. Lin Apoptosis Signal-Regulating Kinase 1 in Amyloid {beta} Peptide-Induced Cerebral Endothelial Cell Apoptosis J. Neurosci., May 23, 2007; 27(21): 5719 - 5729. [Abstract] [Full Text] [PDF]

				L. He, X. Wu, R. Siegel, and P. E. Lipsky TRAF6 Regulates Cell Fate Decisions by Inducing Caspase 8-dependent Apoptosis and the Activation of NF-{kappa}B J. Biol. Chem., April 21, 2006; 281(16): 11235 - 11249. [Abstract] [Full Text] [PDF]

				A. N. Abell and G. L. Johnson MEKK4 Is an Effector of the Embryonic TRAF4 for JNK Activation J. Biol. Chem., October 28, 2005; 280(43): 35793 - 35796. [Abstract] [Full Text] [PDF]

				J. P. Aurikko, B. T. Ruotolo, J. G. Grossmann, M. C. Moncrieffe, E. Stephens, V.-M. Leppanen, C. V. Robinson, M. Saarma, R. A. Bradshaw, and T. L. Blundell Characterization of Symmetric Complexes of Nerve Growth Factor and the Ectodomain of the Pan-neurotrophin Receptor, p75NTR J. Biol. Chem., September 30, 2005; 280(39): 33453 - 33460. [Abstract] [Full Text] [PDF]

M. S. Linggi, T. L. Burke, B. B. Williams, A. Harrington, R. Kraemer, B. L. Hempstead, S. O. Yoon, and B. D. Carter Neurotrophin Receptor Interacting Factor (NRIF) Is an Essential Mediator of Ap