|
J Biol Chem, Vol. 274, Issue 43, 30826-30831, October 22, 1999
Post-transcriptional Adenylation of Signal Recognition
Particle RNA Is Carried Out by an Enzyme Different from mRNA
Poly(A) Polymerase*
Krishna
Sinha,
Karthika
Perumal,
Yahua
Chen, and
Ram
Reddy
From the Department of Pharmacology, Baylor College of Medicine,
One Baylor Plaza, Houston, Texas 77030
 |
ABSTRACT |
A fraction of the signal recognition particle
(SRP) RNA from human, rat, Xenopus, and Saccharomyces
cerevisiae cells contains a single post-transcriptionally added
adenylic acid residue on its 3'-end; in the case of human SRP RNA, over
60% of the SRP RNA molecules contain a nontemplated adenylic acid
residue on their 3'-ends (Sinha, K. M., Gu, J., Chen, Y., and
Reddy, R. (1998) J. Biol. Chem. 273, 6853-6859). In
this study, we investigated the enzyme that is involved in this 3'-end
adenylation of SRP RNA. A U1A protein peptide conjugated to albumin
completely inhibited the polyadenylation of a SV40 mRNA by HeLa
cell nuclear extract in vitro; however, the 3'-end
adenylation of human SRP RNA or Alu RNA, which corresponds
to 5' and 3'-ends of SRP RNA, was not affected by this U1A peptide
conjugate. SRP RNA from mutant strains of S. cerevisiae
with a temperature-sensitive mRNA poly(A) polymerase grown at a
restrictive temperature of 37 °C also contained a
post-transcriptionally added adenylic acid residue just like SRP RNA
from wild-type cells and mutant cells grown at permissive temperature
of 23 °C. In addition, binding of SRP 9/14-kDa protein heterodimer
was required for adenylation of Alu RNA in
vitro. These lines of evidence, along with other data, show that
post-transcriptional adenylation of SRP and Alu RNAs is
carried out by a novel enzyme that is distinct from the mRNA
poly(A) polymerase, CCA-adding enzyme, and nonspecific terminal transferase.
 |
INTRODUCTION |
Following transcription, eukaryotic precursor RNA molecules
undergo various modifications and processing reactions. These modifications include 5' capping, 3' polyadenylation, splicing of
pre-mRNAs, editing, and modifications on the base, sugar, and phosphate residues. We studied the formation of the 3'-end of several
small RNAs, and results showed that a significant fraction of some
human small RNAs including SRP (7SL) RNA, nuclear 7SK RNA, spliceosomal
U2 small nuclear RNA (snRNA)1
and ribosomal 5 S RNA contain a single post-transcriptionally added
adenylic acid residue on their 3'-ends (1). This 3'-end adenylation is
conserved through evolution, since SRP and U2 snRNAs from
Saccharomyces cerevisiae, Xenopus, rat, and human
cells contain this nontemplated post-transcriptionally added adenylic
acid residue. We also developed an in vitro system in
which SRP RNA is accurately processed by the HeLa cell nuclear
extract, where three transcriptionally encoded uridylic acid residues
are removed on the 3'-end and a single adenylic acid residue is added
on the 3'-end (2). These studies also showed that the Alu
portion of the SRP RNA or an 87-nucleotide-long RNA containing 5' and
3' portions of the SRP/Alu RNA is necessary and sufficient
to direct accurate 3'-end processing and adenylation (2). However, not
every small RNA contains this post-transcriptionally added adenylic
acid residue on its 3'-end. For example, there was no detectable
adenylic acid residue on the 3'-end of abundant nuclear RNAs like U1 or
U4 snRNAs. These data show that nontemplated adenylic acid residues are
specifically added to some cellular RNAs (1).
While the exact function of this 3' adenylation in SRP RNA or in other
small RNAs is not known, several facts point toward the importance of
this adenylation. The phenomenon of adenylation is conserved through
evolution from yeast to humans. The extent of 3' adenylation increases
through evolution, indicating that this modification confers an
advantage. For example, in the case of S. cerevisiae cells
only 2-3% of the SRP RNA and U2 snRNA are adenylated, whereas in the
case of human cells over 60% of the SRP RNA and U2 snRNA contain this
post-transcriptional adenylation. The adenylation occurs very early in
the biogenesis of the SRP RNA and is maintained by constant turnover
(2). Xu and Cohen (3) provided evidence for RNA degradation mediated by
the addition of a short poly(A) tail by poly(A) polymerase. However, in
this case, only one adenylic acid residue is added, and over 60% of human SRP RNA molecules contain this adenylation. Therefore, the function of this 3'-end adenylation is unlikely to be related to the
turnover/degradation of SRP RNA.
There are several well studied enzymes that add adenylic acid residues
to the 3'-end of RNAs. The most characterized among these enzymes are
the CCA-adding enzyme to the 3'-end of transfer RNAs and the mRNA
poly(A) polymerase responsible for poly(A) formation in mRNAs (4,
5). In addition to polyadenylation of mRNAs, poly(A) polymerase is
known to be responsible for the addition of one adenylic acid residue,
few adenylate residues, or poly(A) to the 3'-end of many other RNAs
including human telomerase RNA (6) and some stable small RNAs (7, 8).
The CCA addition is carried out by a tRNA-specific
nucleotidyltransferase, and the same enzyme adds both C and A residues
to the 3'-end of tRNAs (9). In fact, Weiner and co-workers (10) have
shown that the CCA-adding enzyme contains a single active site that
contacts the same tRNA structure while adding both the C and A
residues. The tRNA nucleotidyltransferase covalently linked to the tRNA substrate was capable of adding both C and A residues (11). Since the
SRP-adenylating enzyme adds only an A residue but not a C residue (1),
3'-end adenylation of SRP RNA is not mediated by tRNA nucleotidyltransferase.
The mRNA poly(A) polymerase specifically adds a poly(A) tail to the
mRNAs in the presence of specificity factors. In the absence of
specificity factors, poly(A) polymerase is capable of adding multiple
adenylic acid residues to any RNA containing 3' OH groups. While the
S. cerevisiae contains a single poly(A) polymerase (12), the
human cells contain several isoforms of poly(A) polymerase (13, 14).
However, all these isoforms of human poly(A) polymerase are closely
related, and specific polyadenylation is dependent on AAUAAA signal and
specificity factors (13). Stable RNAs with 1-7 adenylic acid residues
on their 3'-ends accumulate in 3' exonuclease-deficient Escherichia coli and in yeast strains (7, 8, 15). In
E. coli strain lacking tRNA nucleotidyltransferase, poly(A)
polymerase participates in the incorporation of A residue into the
defective tRNA-C-C in order to maintain functional tRNA (16). Tyrosine tRNA in chicken mitochondria contains a short poly(A) tail out of which
a single adenylic acid is retained before CCA is added to obtain a
functional tyrosine tRNA. This short poly(A) tail in this tRNA is added
by poly(A) polymerase (17). The mitochondrial ribosomal RNAs are also
known to contain a poly(A) tail (18, 19). The enzyme involved in the
addition of these 3' adenylic acid residues to the stable RNAs is the
poly(A) polymerase (7, 8, 18, 20). In addition, there are several other
instances, including bacteriophage oop RNA (21), where 3'
adenylate residues are added by poly(A) polymerase. Further, poly(A)
polymerase surprisingly adds only a single adenylic acid residue
in vitro under conditions of limiting ATP concentrations
(22). Therefore, it appeared likely that the enzyme responsible for the
addition of adenylic acid residue to the 3'-end of SRP RNA may be
mRNA poly(A) polymerase. Several lines of evidence obtained in this
study show that mRNA poly(A) polymerase is not involved in the 3'
adenylation of SRP RNA; therefore, a novel adenylating enzyme is
responsible for the addition of a single adenylic acid residue to the
3'-end of SRP RNA.
 |
MATERIALS AND METHODS |
Chemicals and Isotopes--
[ -32P]ATP and
[ -32P]UTP were purchased from Amersham Pharmacia
Biotech. All other chemicals were obtained from Sigma. Taq
DNA Polymerase was purchased from Life Technologies, Inc. T7 RNA
polymerase and all other restriction enzymes were obtained from New
England Biolabs. The TA-Cloning Kit was from Invitrogen, and the PCR
DNA product purification kit was from QIAGEN. The BSA-U1A peptide and
free U1A peptide were obtained through Research Genetics, Inc.
(Huntsville, AL).
Preparation of Substrate RNAs--
Plasmid DNA containing the
Alu portion of canine SRP RNA (p7Alu) under the T7 promoter
was a gift from Dr. Katharina Strub (23). This Alu sequence
was altered by PCR in order to insert a DraI site on its
3'-end and was cloned into pUC19 vector by insertion into
EcoRI and HindIII sites. The Alu RNA
was transcribed by T7 RNA polymerase from the DNA template linearized
by DraI, and the transcribed RNA contained three uridylic
acids on the 3'-end. DNA template to prepare mutant Alu RNA
was constructed by PCR-mediated mutagenesis, cloned into pUC19 vector,
and transcribed by T7 RNA polymerase from the plasmid DNA template
linearized by DraI.
For the polyadenylation of yeast CYC1 pre-mRNA with
yeast extract, the plasmid DNA containing the CYC1 gene (a
gift from Dr. Walter Keller) was linearized with NdeI
restriction enzyme, and capped CYC1 pre-mRNA was
synthesized in vitro with T7 RNA polymerase including
[ -32P]UTP as the labeled nucleotide. The run-off
CYC1 pre-mRNA transcript was 194 nucleotides long,
containing a few nucleotides downstream of the AAUAAA polyadenylation
signal. This precleaved RNA was used as a substrate for polyadenylation
by yeast extract in vitro, and this method of RNA
preparation is identical to that described by Keller's laboratory
(24). For the polyadenylation of SV40 late pre-mRNA in HeLa cell
nuclear extract, the plasmid DNA containing SV40 late pre-mRNA
(kindly provided by Dr. Susan Berget) was linearized with
HpaI, and capped precleaved RNA was transcribed with SP6 RNA
polymerase including [ -32P]UTP as a labeled
nucleotide. The in vitro transcription with T7 RNA
polymerase was performed according to standard protocol (New England
Biolabs). All RNA products were purified by fractionation on a 10%
polyacrylamide/7M urea gel, extracted from the gel, and purified by
precipitation with ethanol. The concentration of the RNAs, whenever
necessary, was determined by optical density measurements at 260 nm.
Growth Conditions for Wild-type and Temperature-sensitive Yeast
Strains--
The wild-type yeast cells were grown with shaking in YEPD
medium at 30 °C to an A600 of between 2 and
6. The temperature-sensitive mutants for poly(A) polymerase
pap1-2, pap1-5, and pap1-7 (kindly provided by Dr. Walter Keller; see Ref. 25) were grown in YEPD medium
to a concentration of 1-3 × 106 cells/ml at
23 °C, and then the cultures were divided into two halves, and one
half was incubated with shaking at 37 °C for 6 h. The other
half of the cultures was left to grow at 23 °C for 6 h. The
yeast cells were harvested by centrifugation at 1000 × g for 5 min and then used either for preparation of whole
cell extracts or isolation of total RNA according to published
procedures (26, 27).
Polyadenylation Assay in Yeast Whole Cell Extract--
The
polyadenylation reaction was done according to Minvielle-Sebastia
et al. (25). Briefly, the 25-µl reaction volume contained 40% (v/v) extract, 1.6 mM Hepes-KOH (pH 7.9), 0.016 mM EDTA, 4 mM potassium chloride, 1 mM dithiothreitol, 1.6% glycerol, 2% polyethylene glycol,
75 mM potassium acetate, 2 mM ATP, 20 mM creatine phosphate, creatine kinase (0.2 mg/ml), 0.01%
Nonidet P-40, and precleaved CYC1 RNA (~50,000 cpm). The
reaction was carried out for 60 min at 23 °C for extracts from
mutant cells and at 30 °C for extracts from wild-type cells grown at
30 °C or mutant cells grown at 37 °C. RNA was extracted with a
phenol/chloroform mixture, precipitated with ethanol, and run on a 6%
polyacrylamide, 7 M urea gel. The gel was dried and exposed
to an x-ray film.
Preparation of HeLa Cell Nuclear Extract and in Vitro
Labeling--
Extracts were prepared from HeLa cells grown in
suspension culture by the procedure of Dignam et al. (28).
The final protein concentration of the extract was 5 mg/ml. The nuclear
extract was fractionated with ammonium sulfate as described by Englard and Seifter (29). For in vitro labeling of RNAs, 5 µl of
10× in vitro labeling buffer (6 mM
concentration each of GTP, UTP, and CTP, 250 µM ATP, 10 mM dithiothreitol, 200 mM KCl, 60 mM creatine phosphate, and 100 mM Tris-HCl, pH
8.0), 40 µl of nuclear extract or equal amounts of protein from
ammonium sulfate fractions, and 50 µCi of [ -32P]ATP
were mixed in a total reaction volume of 50 µl and incubated at
30 °C for 3 h. The amount of in vitro synthesized
Alu RNA or mutant Alu RNA used as substrate for
adenylation assay was ~1 µg (20 pmol). Labeled RNAs were extracted
using the phenol/chloroform procedure, purified, and fractionated on
10% polyacrylamide, 7 M urea gels.
Polyadenylation Assay in HeLa Nuclear Extracts--
A standard
polyadenylation reaction for precleaved SV40 late pre-mRNA was
followed according to Sheets et al. (30). Briefly, the
25-µl reaction mixture contained 20 mM creatine
phosphate, 2 mM ATP, 0.6 mM MgCl2,
0.5% PEG, 0.15 mM dithiothreitol, 40% (v/v) HeLa cell
nuclear extract, and labeled substrate RNA (~50,000 cpm). The
reaction mixture was incubated for 45 min at 30 °C. Inhibition of
poly(A) polymerase activity in HeLa cell nuclear extract by bovine
serum albumin-conjugated U1 peptide was carried out according to
Gunderson et al. (31). Extraction, purification, and
analysis of RNA was carried out as described above.
Determination of 3'-End Adenylic Acid of SRP RNA from S. cerevisiae--
An oligonucleotide, Oligo 1 (5'-pgatctgatagtgtcacctaaatgaattca*-3'), with 3' cordycepin (a*) was
ligated to RNAs purified from the yeast cells. A yeast SRP RNA-specific
oligonucleotide (SRP RNA-(354-373), 5'-pgcgtcagaaggtgacccgtg-3') and
an oligonucleotide (Oligo 2) complementary to Oligo 1 were used for
RT-PCR amplification. If the 3'-end nucleotide of the RNA is an
adenylic acid, a BglII restriction site would be created in
the RT-PCR product. Internally labeled RT-PCR products were subjected
to BglII digestion and fractionated on a nondenaturing 10%
polyacrylamide gel; the gel was dried and subjected to autoradiography
or PhosphorImager analysis. Further quantification was done using the
Molecular Dynamics system with the ImageQuant software.
 |
RESULTS |
Fractionation of SRP-adenylating Enzyme--
In our attempts to
characterize and purify the SRP adenylating activity, the HeLa cell
nuclear extracts were subjected to ammonium sulfate fractionation. Four
fractions comprising the 0-30%, 31-50%, and 51-70% ammonium
sulfate precipitates and the 70% ammonium sulfate supernatant were
obtained. These fractions were dialyzed, and equal amounts of protein
from each fraction were used to assay SRP RNA adenylating activity.
Since there is endogenous SRP RNA in the nuclear extract that may get
adenylated (see Fig. 1, lanes
1 and 4), we used Alu RNA as the
substrate. Alu RNA corresponds to the 5'- and 3'-end
sequences of SRP RNA and is faithfully adenylated in vitro
(2). Fig. 1, lane 1, shows the pattern of
adenylation obtained using HeLa cell nuclear extracts, which were used
as the starting material for fractionation. In addition to the
adenylation of Alu RNA, tRNAs and SRP RNA also get
adenylated (Fig. 1, lane 1). While 0-30%
fraction, 31-50% fraction, and 70% supernatant contained some
activity that adenylates Alu RNA (Fig. 1, lanes
2, 3, and 5, respectively), most of
the SRP RNA adenylating activity was in the 51-70% ammonium sulfate fraction (Fig. 1, lane 4). The 51-70% fraction
contained 25% of the total protein and 80% of the SRP adenylating
activity. It is known from the published literature that human mRNA
poly(A) polymerase fractionates in the 0-40% ammonium sulfate
fraction (32). These data suggested that SRP/Alu RNA
adenylating activity may be distinct from mRNA poly(A) polymerase,
since these two activities were fractionating in two different ammonium
sulfate fractions.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 1.
SRP/Alu RNA adenylation by
ammonium sulfate fractions of HeLa nuclear extracts. HeLa cell
nuclear extracts were fractionated at 4 °C into four different
fractions (29), and 50 µg from each fraction was assayed for
Alu RNA adenylating activity. The conditions for the
adenylation reaction are described under "Materials and Methods."
The labeled RNAs were isolated, purified, and fractionated on a 10%
polyacrylamide/7M urea gel; the dried gel was subjected to
autoradiography. Sup., 70% ammonium sulfate
supernatant.
|
|
Effect of U1A Peptide on SRP Adenylation--
To obtain more
definitive evidence that SRP adenylating activity is different from
mRNA poly(A) polymerase, we studied the effect of U1A peptide on
the mRNA polyadenylation and SRP RNA adenylation. Mattaj and
colleagues (31) showed that a portion of the U1 snRNP protein, the U1A
peptide corresponding to 103-119 amino acids conjugated to albumin,
interacts with the catalytic site of human poly(A) polymerase,
resulting in complete inhibition of mRNA poly(A) polymerase
activity. We reasoned that if poly(A) polymerase is involved in SRP RNA
adenylation, then U1A peptide-albumin conjugate should also inhibit
adenylation of SRP RNA. Therefore, we tested this possibility using our
in vitro system for the 3'-end adenylation of
SRP/Alu RNA. Fig.
2A shows the effect of U1A
peptide-albumin conjugate on the adenylation of SV40 late mRNA.
When compared with the starting material (Fig. 2A), there
was significant poly(A) formation on the 3'-end of the SV40 mRNA
when incubated with HeLa cell nuclear extract (Fig. 2A,
lane 2). U1A peptide conjugated to albumin
completely inhibited the polyadenylation of this mRNA (Fig.
2A, lanes 3-5). Albumin alone, U1A
peptide alone, or an unrelated peptide conjugated to albumin did not
inhibit the polyadenylation of this SV40 mRNA (Fig. 2A,
lanes 6, 7, and 8,
respectively). These data are as expected and are completely consistent
with the data published by Mattaj and associates (31). Adenylation of
human SRP RNA and Alu RNA was studied under the same
conditions. The adenylation of SRP RNA and Alu RNA in the
presence of U1A peptide-conjugate (Fig. 2B, lanes
2-4) was the same in the control (Fig. 2B,
lane 1) or when incubated in the presence of
albumin alone, U1A peptide alone, or an unrelated peptide conjugated to albumin (Fig. 2B, lanes 5,
6, and 7, respectively). These data show that
under conditions where mRNA poly(A) polymerase is completely inhibited, the 3' adenylation of SRP and Alu RNA is
unaffected. These data are consistent with the suggestion that the
addition of adenylic acid residue on the 3'-end of human SRP RNA is
carried out by an enzyme distinct from mRNA poly(A)
polymerase.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of U1A peptide-albumin conjugate on
polyadenylation of mRNA and adenylation of SRP RNA.
A, the polyadenylation assay using SV40 precleaved mRNA
was carried out as described under "Materials and Methods." The
concentrations of bovine serum albumin-U1A peptide and other control
peptides or albumin added to the incubation mixture are indicated
above each lane. The unrelated peptide, which was
conjugated to bovine serum albumin, corresponds to 1-27 amino acids of
human parathyroid hormone. The labeled RNAs were isolated, purified,
and fractionated on a 6% polyacrylamide/7M urea gel; the dried gel was
subjected to autoradiography. B, the SRP/Alu RNA
adenylation assay was carried out as described under "Materials and
Methods" and as described earlier (2). The concentrations of bovine
serum albumin-U1A peptide and other control peptides or albumin added
to the incubation mixture are indicated above each
lane. The labeled RNAs were isolated, purified, and
fractionated on a 10% polyacrylamide/7M urea gel, and the dried gel
was subjected to autoradiography/PhosphorImager analysis.
|
|
Adenylation of Yeast SRP RNA in Poly(A) Polymerase
Mutants--
While over 60% of the human SRP RNA molecules contain
nontemplate encoded adenylic acid residue on their 3'-ends (1),
approximately 2-3% of the S. cerevisiae SRP RNA molecules
contain this post-transcriptionally added adenylic
acid.2 Keller's laboratory
(25) has characterized the S. cerevisiae poly(A) polymerase
mutants, and we wanted to see whether adenylation of SRP RNA in these
temperature-sensitive mutants is affected when the poly(A) polymerase
is inactivated by a shift from permissive to nonpermissive temperature.
Fig. 3 shows the data obtained with the
yeast mutants. The yeast cell extracts prepared from wild-type cells
(Fig. 3A, lane 1) and all three yeast
pap mutant cell lines grown at the permissive temperature of
23 °C (Fig. 3A, lanes 2, 4, and 6, respectively) were capable of
adenylating a yeast CYC1 RNA. However, all three yeast
mutants when grown at the nonpermissive temperature of 37 °C were
totally inactive for poly(A) polymerase, and no polyadenylated mRNA
was detectable in an in vitro assay for polymerase activity
(Fig. 3A, lanes 3, 5, and
7, respectively). These data are consistent with published
reports by Keller and colleagues (25).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
A, poly(A) formation by different
pap mutants grown at restrictive and permissive
temperatures. Shown are the polyadenylation of precleaved
CYC1 RNA by yeast whole cell extracts from wild-type
(WT) cells and different yeast mutants pap1-2,
pap1-5, and pap1-7 grown at permissive and
nonpermissive temperature as indicated above each
lane. The polyadenylation reaction for mutants, grown at
permissive temperature, was carried out at 23 °C for 1 h, and
for wild-type cells and mutants, grown at 30 °C and 37 °C
respectively, the reaction was kept at 30 °C for 1 h. The RNAs
were isolated, purified, and fractionated on a 6% polyacrylamide/7M
urea gel, and the dried gel was subjected to
autoradiography/PhosphorImager analysis. B and C,
quantitation of post-transcriptional adenylation in SRP RNA from
different poly(A) polymerase mutants. An oligonucleotide (Oligo 1) was
ligated to RNAs isolated from wild type and different mutants grown at
different temperatures as indicated above each
lane. An internal oligonucleotide specific for yeast SRP RNA
and an oligonucleotide (Oligo 2) complementary to Oligo 1 were used for
RT-PCR amplification. If the 3'-end nucleotide of the RNA is an
adenylic acid, a BglII restriction site would be created in
the RT-PCR product. The BglII digestion products of
RT-PCR-amplified DNA were fractionated on a nondenaturing 10%
polyacrylamide gel. In B, lane 2 shows
the completion of restriction digestion by BglII on the
control DNA shown in lane 1. The numbers on the
right indicate the size of the restricted fragments in base
pairs. The gel was dried and subjected to autoradiography or
PhosphorImager analysis. Further quantification was done using the
Molecular Dynamics system with the ImageQuant software.
|
|
Total RNA was isolated from these mutant yeast cells grown either at
permissive or restrictive temperature, and the presence of the adenylic
acid residue on the 3'-end of yeast SRP RNA was tested by a newly
developed oligonucleotide ligation/RT-PCR/BglII digestion
method (2). In this method, DNA derived from RT-PCR of RNAs containing
a 3' adenylic acid residue would be cleaved by BglII
restriction enzyme and yield two smaller fragments. In the case of wild
type S. cerevisiae cells, 2-3% of the SRP RNA was digested
by the BglII restriction enzyme (Fig. 3B,
lane 4). In the case of yeast mutant
pap1-5 grown at the permissive temperature of 23 °C
(lane 6), or grown at nonpermissive temperature of 37 °C (lane 8),
2-3% of the DNA was cleaved by BglII restriction enzyme.
Identical results were obtained with two other pap mutants, namely pap1-2 and pap1-7 (Fig. 3C).
These data show that under conditions of restrictive temperature, where
yeast mRNA poly(A) polymerase is inactivated, the SRP RNA is
adenylated to the same extent as in the wild-type cells or cells grown
at permissive temperature (Table I).
Thus, these results obtained with the yeast system are consistent with
the results obtained with HeLa cell extracts (Fig. 2) and support the
conclusion that an enzyme distinct from the mRNA ploy(A) polymerase
is involved in the 3' adenylation of SRP RNA.
View this table:
[in this window]
[in a new window]
|
Table I
Quantitation of 3'-end-adenylated SRP RNA from S. cerevisiae pap
mutants
RNA isolated from wild-type and different temperature-sensitive
pap mutants was subjected to a RT-PCR/BglII
digestion assay as described under "Materials amd Methods." All
values are expressed as the percentage of digested products over the
total RT-PCR products. These percentages are an average of two
independent experiments.
|
|
SRP 9/14-kDa Protein Is Required for the Adenylation of SRP
RNA--
It is known that purified poly(A) polymerase and terminal
transferases add nucleotides to any RNA containing 3'-OH groups. We
wanted to see the specificity of this 3' adenylation on the SRP/Alu RNA. The substitution of SRP/Alu RNA
24GUA26 AGG in the mutant Alu
RNA is shown in Fig. 4A. It is
known that substitution of these three nucleotides in the loop near the
5'-end of SRP/Alu RNA abolishes the binding of SRP 9/14-kDa proteins (23, 33). The 3'-end sequences of the Alu RNA and mutant Alu RNA are identical, and if the adenylation occurs
by poly(A) polymerase or by a nonspecific terminal transferase, one would expect both of these RNAs to be adenylated. Fig. 4B
shows the results obtained with this mutant Alu RNA. In the
case of nuclear extract used as a control, the SRP RNA can be
visualized as the adenylated RNA (Fig. 4B, Lane 1). While
Alu RNA was adenylated in lane 2,
there was no detectable adenylation when the reaction mixture was
supplemented with mutant Alu RNA (lane
3). These data show that RNA alone is not a suitable
substrate for 3' adenylation, and binding of 9/14-kDa protein to form a
ribonucleoprotein complex is necessary before 3' adenylation of
SRP/Alu RNA can take place. These data are consistent with
our earlier results, which showed that adenylated Alu and
SRP RNAs were immunoprecipitable with anti-9/14-kDa protein antibodies
(2) and provide evidence for the specificity of adenylation reaction
and provide additional line of evidence for the involvement of a novel
adenylation enzyme distinct from mRNA poly(A) polymerase or a
nonspecific terminal transferase.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4.
Adenylation of Alu RNA and
mutant Alu RNA by HeLa nuclear extract.
A, secondary structure of a portion of Alu RNA
and a mutant Alu RNA that is unable to bind the 9/14-kDa
protein heterodimer. The secondary structure of Alu RNA is
from Larsen and Zwieb (37). The mutation of
24GUA26 to AGG is shown in red. The
secondary structure of SRP and Alu RNAs has been studied by
several investigators (for a review, see Ref. 38). The SRP 9/14 protein
heterodimer was shown to bind in this region of SRP/Alu RNA
(39, 40); however, the relative size and actual sites of binding of the
SRP 9/14 protein heterodimer in this portion is shown only for the
purpose of illustration. B, approximately 1 µg each of the
Alu RNA and mutant Alu RNA were incubated with
[ -32P]ATP with HeLa cell nuclear extract as described
under "Materials and Methods." The labeled RNAs were isolated,
purified, and fractionated on a 10% polyacrylamide/7M urea gel; the
dried gel was subjected to autoradiography.
|
|
 |
DISCUSSION |
This study was initiated to see whether poly(A) polymerase is
involved in the adenylation of a nontemplate-encoded adenylic acid
residue found in several stable small RNAs. This possibility was very
likely, since poly(A) polymerase is known to be involved in the
addition of short oligo(A) stretches found on the 3'-end of stable RNAs
in S. cerevisiae and E. coli strains deficient in
3'-exonuclease. We used adenylation of SRP/Alu RNA to test this possibility, since an accurate in vitro adenylation
system for SRP/Alu RNA is available (2). Data obtained in
this study provide convincing evidence that poly(A) polymerase or a
nonspecific terminal transferase is not involved in the adenylation of
SRP RNA.
The following four lines of evidence are presented to show that an
enzyme distinct from mRNA poly(A) polymerase is involved in the SRP
adenylation: 1) the SRP adenylating activity and poly(A) polymerase
fractionate in different ammonium sulfate fractions; 2) under
conditions where poly(A) polymerase in HeLa cell nuclear extract was
completely inhibited by U1A peptide conjugated to albumin, there was no
effect on the adenylation of SRP RNA; 3) under conditions where yeast
poly(A) polymerase was inactive in three different
temperature-sensitive strains, there was no effect on the adenylation
of SRP RNA; and 4) the adenylation of SRP RNA was dependent on an
intact SRP 9/14-kDa protein heterodimer binding site. As detailed in
the Introduction, our previous results showed that CCA-adding enzyme is
not involved in the adenylation of SRP RNA. These lines of evidence
provide definitive evidence that an enzyme distinct from the mRNA
poly(A) polymerase is involved in the adenylation of SRP RNA.
S. cerevisiae genome is known to contain a single copy of
the poly(A) polymerase (12). In the yeast pap mutant strains
that we used in this study, it is clear that poly(A) polymerase was inactive when maintained at restrictive temperatures (Fig.
3A). The SRP RNA belongs to the class of stable RNAs with
low turnover (34). Therefore, one has to consider whether the
adenylation found in SRP RNA from cells grown at restrictive
temperatures could be due to RNA synthesized under permissive
conditions and remain intact due to low RNA turnover. This is unlikely
because the cells were maintained at the restrictive temperature of
37 °C for 6 h, which is more than two generation times, and the
3' adenylic acid residue in SRP RNA is known to turn over independent of the SRP RNA turnover (2). In addition, there was no reduction in the
extent of adenylation between control and mutant cells (Fig. 3,
B and C). Therefore, these data are supportive of
the conclusion that yeast poly(A) polymerase is not involved in the adenylation of SRP RNA.
The poly(A) polymerases, CCA-adding enzymes, and polynucleotide
phosphorylases belong to a superfamily of nucleotidyltransferases (35),
and all members of this superfamily possess a conserved sequence motif
corresponding to the active site (36). Since SRP-adenylating enzyme
catalyzes the transfer of nucleotide to the 3'-end of SRP RNA, its
properties are consistent with being a member of the superfamily of
nucleotidyltransferases. This study shows that this SRP-adenylating
enzyme is different from CCA-adding enzyme and poly(A) polymerase. The
SRP-adenylating enzyme is not sensitive to micrococcal nuclease
treatment, indicating that it is a protein enzyme and not a
ribonucleoprotein (2).
Does each RNA have an adenylating enzyme of its own? In addition to SRP
RNA, other small RNAs, including 7SK, U2, and 5 S RNAs contain a
nontemplated adenylic acid on their 3'-ends. Since our data show that
SRP/Alu RNA specific 9/14-kDa proteins are required for SRP
RNA adenylation, it is logical to ask which enzyme(s) are involved in
the adenylation of these RNAs. The SRP 9/14-kDa protein associates with
the SRP and Alu RNAs and is an integral part of SRPs (23);
however, this protein heterodimer is not part of ribosomal 5 S, U2, or
7SK RNPs. One possibility is that these RNAs have a
common adenylating enzyme that recognizes diverse RNPs
that may have some common structural motif(s). Development of in
vitro systems capable of accurately adenylating other small RNAs
and purification of the enzyme responsible for adenylating SRP RNA is
necessary to answer these questions.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Walter Keller for providing the
S. cerevisiae pap mutants and the CYC1 plasmid, Dr. Susan
Berget for providing SV40 late mRNA plasmid and advice in carrying
out polyadenylation assays, Minyone Finley for HeLa cells, and Rachana
Dalia for superb technical assistance.
 |
FOOTNOTES |
*
These studies were supported by National Institutes of
Health Grants GM-38320 and GM-52901.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 713-798-7905 or
713-798-7906; Fax: 713-798-3145; E-mail: rreddy@bcm.tmc.edu.
2
K. Perumal, J. Gu, and R. Reddy, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
snRNA, small nuclear
RNA;
PCR, polymerase chain reaction;
RT-PCR, reverse transcription-PCR;
SRP, signal recognition particle;
RNP, ribonucleoprotein.
 |
REFERENCES |
| 1.
|
Sinha, K. M.,
Gu, J.,
Chen, Y.,
and Reddy, R.
(1998)
J. Biol. Chem.
273,
6853-6859[Abstract/Free Full Text]
|
| 2.
|
Chen, Y.,
Sinha, K. M.,
Perumal, K.,
Gu, J.,
and Reddy, R.
(1998)
J. Biol. Chem.
273,
35023-35031[Abstract/Free Full Text]
|
| 3.
|
Xu, F.,
and Cohen, S. N.
(1995)
Nature
374,
180-183[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Keller, W.
(1995)
Cell
81,
829-832[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Manley, J. M.
(1995)
Curr. Opin. Genet. Dev.
5,
222-228[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Chapon, C.,
Cech, T. R.,
and Zaug, A. J.
(1997)
RNA
3,
1337-1351[Abstract]
|
| 7.
|
Li, Z.,
Pandit, S.,
and Deutscher, M. P.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
12158-12162[Abstract/Free Full Text]
|
| 8.
|
Piper, P. W.,
Bellatin, J. A.,
and Lockheart, A.
(1983)
EMBO J.
2,
353-359[Medline]
[Order article via Infotrieve]
|
| 9.
|
Deutscher, M. P.
(1990)
Prog. Nucleic Acid Res. Mol. Biol.
39,
209-240[Medline]
[Order article via Infotrieve]
|
| 10.
|
Yue, D.,
Weiner, A. M.,
and Maizels, N.
(1998)
J. Biol. Chem.
273,
29693-29700[Abstract/Free Full Text]
|
| 11.
|
Shi, P. Y.,
Maizels, N.,
and Weiner, A. M.
(1998)
EMBO J.
17,
3197-3206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Lingner, J.,
Kellermann, J.,
and Keller, W.
(1991)
Nature
354,
496-498[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Ryner, L. C.,
Takagaki, Y.,
and Manley, J. L.
(1989)
Mol. Cell. Biol.
9,
4229-4238[Abstract/Free Full Text]
|
| 14.
|
Thuresson, A. C.,
Astrom, J.,
Astrom, A.,
Gronvik, K. O.,
and Virtanen, A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
979-983[Abstract/Free Full Text]
|
| 15.
|
Elela, S. A.,
and Ares, M.
(1998)
EMBO J.
17,
3738-3746[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Reuven, N. B.,
Zhou, Z.,
and Deutscher, M. P.
(1997)
J. Biol. Chem.
272,
33255-33259[Abstract/Free Full Text]
|
| 17.
|
Yokobori, S.,
and Paabo, S.
(1997)
J. Mol. Biol.
265,
95-99[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Attardi, G.
(1985)
Int. Rev. Cytol.
93,
93-145[Medline]
[Order article via Infotrieve]
|
| 19.
|
Baserga, S.,
Linnenbach, A. J.,
Malcolm, S.,
Ghosh, P.,
Malcolm, A.,
Takshita, K.,
Forget, B. G.,
and Benz, E. J.
(1985)
Gene (Amst.)
35,
305-312[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Clayton, D. A.
(1992)
Int. Rev. Cytol.
141,
217-232[Medline]
[Order article via Infotrieve]
|
| 21.
|
Szalewska-Palasz, A.,
Wrobel, B.,
and Wegrzyn, G.
(1998)
FEBS Lett.
432,
70-72[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Zwierzynski, T. A.,
Widmer, G.,
and Buck, G. A.
(1989)
Nucleic Acids Res.
17,
4647-4660[Abstract/Free Full Text]
|
| 23.
|
Strub, K.,
Moss, J.,
and Walter, P.
(1991)
Mol. Cell. Biol.
11,
3949-3959[Abstract/Free Full Text]
|
| 24.
|
Preker, P. J.,
Lingner, J.,
Minvielle-Sebastia, L.,
and Keller, W.
(1995)
Cell
81,
379-389[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Minvielle-Sebastia, L.,
Preker, P. J.,
and Keller, W.
(1994)
Science
266,
1702-1705[Abstract/Free Full Text]
|
| 26.
|
Patel, D.,
and Butler, J. S.
(1992)
Mol. Cell. Biol.
12,
3297-3304[Abstract/Free Full Text]
|
| 27.
|
Chen, J.,
and Moore, C.
(1992)
Mol. Cell. Biol.
12,
3470-3481[Abstract/Free Full Text]
|
| 28.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1488[Abstract/Free Full Text]
|
| 29.
|
Englard, S.,
and Seifter, S.
(1990)
Methods Enzymol.
182,
285-306[Medline]
[Order article via Infotrieve]
|
| 30.
|
Sheets, M. D.,
Stephenson, P.,
and Wickens, M.
(1987)
Mol. Cell. Biol.
7,
1518-1529[Abstract/Free Full Text]
|
| 31.
|
Gunderson, S. I.,
Vagner, S.,
Polycarpou-Schwarz, M.,
and Mattaj, I. W.
(1997)
Genes Dev.
11,
761-773[Abstract/Free Full Text]
|
| 32.
|
Takagaki, Y.,
Ryner, L. C.,
and Manley, J. L.
(1988)
Cell
52,
731-742[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
He, X.,
Bataille, N.,
and Fried, H. M.
(1994)
J. Cell Sci.
107,
903-912[Abstract]
|
| 34.
|
Zieve, G. W.,
and Sauterer, R. A.
(1990)
Crit. Rev. Biochem. Mol. Biol.
25,
1-46[Medline]
[Order article via Infotrieve]
|
| 35.
|
Yue, D.,
Maizels, N.,
and Weiner, A. M.
(1996)
RNA
2,
895-908[Abstract]
|
| 36.
|
Holm, L.,
and Sanders, C.
(1995)
Trends Biochem. Sci.
20,
345-347[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Larsen, N.,
and Zwieb, C.
(1990)
Nucleic Acids Res.
19,
209-215[Abstract/Free Full Text]
|
| 38.
|
Walter, P.
(1994)
Annu. Rev. Cell Biol.
10,
87-119[CrossRef]
|
| 39.
|
Weichenrieder, O.,
Kapp, U.,
Cusack, S.,
and Strub, K.
(1997)
RNA
3,
1262-1274[Abstract]
|
| 40.
|
Birse, D. E. A.,
Kapp, U.,
Strub, K.,
Cusack, S.,
and Aberg, A.
(1997)
EMBO J.
16,
3757-3766[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Tomecki, A. Dmochowska, K. Gewartowski, A. Dziembowski, and P. P. Stepien
Identification of a novel human nuclear-encoded mitochondrial poly(A) polymerase
Nucleic Acids Res.,
November 16, 2004;
32(20):
6001 - 6014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. VAN NUES and J. D. BROWN
Saccharomyces SRP RNA secondary structures: A conserved S-domain and extended Alu-domain
RNA,
January 1, 2004;
10(1):
75 - 89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Liu, H. Ben-Shlomo, Y.-x. Xu, M. Z. Stern, I. Goncharov, Y. Zhang, and S. Michaeli
The Trypanosomatid Signal Recognition Particle Consists of Two RNA Molecules, a 7SL RNA Homologue and a Novel tRNA-like Molecule
J. Biol. Chem.,
May 9, 2003;
278(20):
18271 - 18280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Grosshans, K. Deinert, E. Hurt, and G. Simos
Biogenesis of the Signal Recognition Particle (SRP) Involves Import of SRP Proteins into the Nucleolus, Assembly with the SRP-RNA, and Xpo1p-mediated Export
J. Cell Biol.,
May 7, 2001;
153(4):
745 - 762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Perumal, K. Sinha, D. Henning, and R. Reddy
Purification, Characterization, and Cloning of the cDNA of Human Signal Recognition Particle RNA 3'-Adenylating Enzyme
J. Biol. Chem.,
June 8, 2001;
276(24):
21791 - 21796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Kyriakopoulou, H. Nordvarg, and A. Virtanen
A Novel Nuclear Human Poly(A) Polymerase (PAP), PAPgamma
J. Biol. Chem.,
August 31, 2001;
276(36):
33504 - 33511.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|