JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vyas, D. R.
Right arrow Articles by Tsika, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vyas, D. R.
Right arrow Articles by Tsika, R. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 43, 30832-30842, October 22, 1999


Nuclear Protein Binding at the beta -Myosin Heavy Chain A/T-rich Element Is Enriched following Increased Skeletal Muscle Activity*

Dharmesh R. VyasDagger , John J. McCarthyDagger , and Richard W. TsikaDagger §parallel

From the Dagger  Department of Biomedical Sciences, School of Veterinary Medicine, the § Department of Biochemistry, School of Medicine, and the  Dalton Cardiovascular Research Center, University of Missouri-Columbia, Columbia, Missouri 65211

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In adult mouse skeletal muscle, beta -myosin heavy chain (beta MyHC) gene expression is primarily restricted to slow-type I fibers but can be induced in fast-type II fibers by mechanical overload (MOV). Our previous transgenic analyses have delimited an 89-base pair (bp) MOV-responsive region (-293 to -205), and shown that mutation of the MCAT and C-rich elements within this region did not abolish beta MyHC transgene induction by MOV. In this study we describe an A/T-rich element (beta A/T-rich; -269 5'-GGAGATATTTTT-3' -258) located within this 89-bp region that, only under MOV conditions, revealed enriched binding as characterized by electrophoretic mobility shift assays and dimethyl sulfate and diethyl pyrocarbonate interference footprinting. Direct, competition, and supershift electrophoretic mobility shift assays revealed highly enriched specific binding activity at the beta A/T-rich element that was antigenically distinct from GATA-4, MEF2A-D, SRF, and Oct-1, nuclear proteins that were previously shown to bind A/T-rich elements. In vitro translated GATA-4, MEF2C, SRF, and Oct-1 bound to consensus GATA, MEF2, SRE, and Oct-1 elements, respectively, but not to the beta A/T-rich element. Two-dimensional UV cross-linking of the bromodeoxyuridine-substituted beta A/T-rich element with mechanically overloaded plantaris (MOV-P) nuclear extract detected two proteins (44 and 48 kDa). Our results indicate that the beta A/T-rich element may function in vivo as a beta MyHC MOV-inducible element during hypertrophy of adult skeletal muscle by binding two distinct proteins identified only in MOV-P nuclear extract.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Myosin is an abundantly expressed contractile protein comprised of two heavy chain subunits and two pairs of dissimilar light chains. The myosin heavy chain (MyHC)1 subunit is encoded by a multigene family comprised of eight members that are regulated in a tissue-specific manner throughout development and in response to various physiological stimuli (1, 2). The heterogeneous spectrum of vertebrate sarcomeric MyHC isoforms and their differential expression pattern underlies the broad classification scheme that histochemically (myofibrillar ATPase) distinguishes four primary adult-stage skeletal muscle fiber-types. Because each MyHC isoform is thought to serve a specific physiological role, variation in the proportion and spatial arrangement of each fiber-type underlies the biochemical and functional specialization of each muscle. This notion is underscored by the classic finding that actin-activated myosin ATPase activity and unloaded shortening velocity (Vmax) are highly correlated to the amount and type of isomyosin or MyHC comprising a given muscle or muscle fiber (3-5). More recently, insight into the function of individual MyHC isoforms was gained from studies employing the genetic strategy of homologous recombination to target the inactivation of either the fast type IIb or IId/x MyHC genes. Functional analyses of muscle from either the type IIb or IId/x MyHC knock-out mice revealed altered contractile properties that were unique to each null mutation despite the compensatory activation of the endogenous fast type IId/x and IIa genes, respectively (6, 7). In contrast to our current knowledge concerning the diversity of adult-stage MyHC isoforms and their distinct functional properties, there exists a paucity of information regarding the mechanisms that govern MyHC fiber-type-specific gene expression and their differential regulation in response to various modes of neuromuscular activity.

It has been well documented that the phenotype of adult-stage skeletal muscle can be profoundly altered in response to specific mechanical perturbations, such as mechanical overload (MOV) or non-weight bearing (NWB), which presumably reflect altered neuromuscular activity. To better understand this phenotypic plasticity in molecular terms, we have used the beta MyHC gene as a model system since beta MyHC expression is primarily restricted to slow-type I fibers in the adult mouse but can be induced in fast-type II fibers following MOV (8). In addition, beta MyHC expression is decreased in slow-type I fibers in response to NWB activity (9, 10). Our investigation into the regulatory mechanism(s) underlying the antithetic expression pattern of the beta MyHC gene in response to these two diverse stimuli have established that NWB- and MOV-responsive element(s) are distinct and segregated within the proximal promoter of the beta MyHC gene (see Fig. 1, Refs. 8-10). More specifically, our transgenic studies have delimited a 156-bp beta MyHC NWB-responsive promoter region (nucleotides -450 to -294), and within this region we have identified a negative regulatory element (dbeta NRE-S: -332 to -311) that binds two distinct proteins found only in NWB soleus nuclear extract (10).2 As concerns MOV, we have identified an 89-bp beta MyHC MOV-responsive promoter region (-293 to -205), and shown that mutation of the muscle-CAT (MCAT) and C-rich elements within this region did not abolish transgene induction, suggesting that an MOV element(s) resides within this region (see Fig. 1, Refs. 8 and 10).

Examination of the nucleotide sequence comprising this 89-bp beta MyHC MOV-responsive region revealed that, in addition to containing MCAT and C-rich elements, there is an A/T-rich motif (-269 5'-GGAGATATTTTT-3' -258) that is highly conserved in nucleotide sequence and location across species (Fig. 2, Refs. 11, 12, 14, and 16)3,4 and has a high degree of homology to both the consensus myocyte enhancer factor 2 (MEF2) element [CTA(A/T)4TAG/A] and the consensus GATA element [(A/T)GATA(A/G)]. In support of the hypothesis that a MOV element may reside within the beta MyHC 89-bp MOV-responsive region, Hasegawa et al. (17) have reported that this A/T-rich element (referred to as a GATA element by them) within the proximal promoter region of rat beta MyHC reporter genes acts as an inducible element following direct injection into pressure-overloaded adult rat hearts. This response was presumably conferred by GATA-4 binding at this element. In light of this finding, and because the A/T-rich element (referred to as beta A/T-rich hereafter) contains a GATA/MEF2-like homology, it is noteworthy that McGrew et al. (18) have recently reported the detection of GATA-2 and -3 transcripts in skeletal muscle since GATA factor expression is thought to be absent in this tissue. Furthermore, these investigators also demonstrated that an intact GATA motif is required for full transcriptional activation of the fast alkali myosin light chain-3 (FMLC3) promoter in transient expression assays using primary cultures of neonatal skeletal muscle cells. In contrast to GATA, the involvement of MEF2 proteins in activating muscle gene transcription in response to mechanical perturbations of adult skeletal muscle has not been reported as yet.

In addition to GATA and MEF2 proteins, A/T-rich elements have been reported to interact with a diverse group of transcription factors including the ubiquitously expressed POU-domain octamer-binding factor; Oct-1, the homeodomain protein; MHox, the MADS-box (MCM, Agamous, Deficiens, Serum response factor) factor; serum response factor (SRF), and the high-mobility group I and II (HMG-I, HMG-II) architectural proteins (19-24). Given the broad range of transcription factor types that can interact at A/T-rich elements, several important questions arise. First, do known A/T-rich binding transcription factors serve a functional role in directing adult-stage skeletal muscle gene expression in response to altered neuromuscular activity? Second, does the beta MyHC A/T-rich (beta A/T-rich) element confer MOV-inducible expression to the beta MyHC gene in both cardiac and skeletal muscle? Third, given the fast-to-slow fiber-type transition associated with skeletal muscle MOV, does the beta A/T-rich element serve a dual role as an inducible and fiber-type element? As an initial attempt to define these important regulatory mechanisms, the current analyses focused on determining whether the beta A/T-rich element served as a beta MyHC mechanical overload element in MOV skeletal muscle and if GATA, MEF2, SRF, and Oct-1 transcription factor family members bind this element under MOV conditions. This report is the first to implicate a role for the beta A/T-rich sequence as a putative MOV element during skeletal muscle hypertrophy in vivo. Additionally, our results provide evidence that GATA4, MEF2C, SRF, and Oct-1 are not components of the highly enriched binding activity identified within mechanically overloaded plantaris (MOV-P) nuclear extract in this study. Furthermore, our data show that two distinct (44 and 48 kDa) proteins, present only in MOV-P nuclear extract, bind the beta A/T-rich element under MOV conditions. The latter result implicates these proteins in the MOV-induction of beta MyHC transgene expression in fast type II skeletal muscle fibers that normally do not express the beta MyHC to any significant degree.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Preparation of Nuclear Protein Extract from Adult Skeletal Muscle-- Nuclear extract was isolated from adult rat control plantaris (CP) and MOV-P muscle as described previously (10). All procedures were carried out on ice. All buffers contained 2 µg/ml each of aprotinin and leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride, protease inhibitors. Ten grams of either CP or MOV-P were harvested from adult female Harlan Sprague-Dawley 200-gram rats and minced in phosphate-buffered saline. Minced muscle tissue was incubated in relaxation buffer I, for two 15-min intervals, followed by two 10-min washes in relaxation buffer II. The muscle tissue was then homogenized in buffer A and centrifuged through a 27% Percoll (Amersham Pharmacia Biotech) density gradient at 27,000 × g for 15 min at 4 °C. The pelleted nuclear layer was consolidated and lysed by the addition of 3 M NH4SO4 (pH 7.9) to a final concentration of 0.4 M. The lysate was ultracentrifuged at 126,000 × g for 1 h (4 °C) to pellet nuclear membrane debris. Solid NH4SO4 (0.3 g/ml) was added slowly to the supernatant, and the precipitated nuclear proteins were concentrated by ultra-centrifugation at 126,000 × g for 30 min. The resulting pellet was resuspended in dialysis buffer and dialyzed for 2 h. The nuclear protein extract was stored in aliquots at -80 °C. Protein concentration was determined according to Bradford (25).

Electrophoretic Mobility Shift Assay-- All oligonucleotide probes used in this study are listed in Table I (17, 26-31). Electrophoretic mobility shift assays (EMSAs) were performed as described previously (10). The double-stranded AT-rich oligonucleotide probe (nucleotides -275 to -252) was labeled by fill-in reaction using the Klenow fragment of Escherichia coli DNA polymerase I (Stratagene, La Jolla, CA) and [alpha -32P]dCTP (3000Ci/mmol). All other oligonucleotide probes were end-labeled by T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and [gamma -32P]ATP (6000 Ci/mmol). Probes were purified by polyacrylamide gel electrophoresis prior to use in EMSA. Binding reactions were performed with 5 µg of either CP or MOV-P nuclear extract and 20,000 cpm of labeled probe for 20 min at room temperature in a 25-µl total volume. Where indicated, 1 µl of in vitro translated GATA-4, 2 µl of MEF2C, 1 µl of SRF, or 0.5 µl of Oct-1 protein was used in place of MOV-P nuclear extract. The binding reactions were resolved on a 5% non-denaturing polyacrylamide gel at 220 volts for 2.5 h at 4 °C. Supershift EMSAs were performed by preincubation of MOV-P nuclear extract or in vitro translated GATA-4, MEF2C, SRF, or Oct-1 protein with 2 µl of the corresponding antibody for 30 min at room temperature prior to the addition of the 32P-labeled DNA probe. Following electrophoresis, the gels were dried and DNA-protein complexes were visualized by autoradiography.

In vitro Transcription/Translation (TnT)-- In vitro coupled TnT was performed using 1 µg of expression plasmid in the T7 TnT wheat germ (GATA-4, MEF2C) and rabbit reticulocyte TnT (Oct-1, GATA-4) lysate systems according to the instructions of the manufacturer (Promega). Prior to use in the wheat germ TnT reaction, the expression plasmids pcDNAI GATA-4 (1.7-kb insert of mouse GATA-4 cDNA, Ref. 32), pcDNAI MEF2C (1.4-kb insert of mouse MEF2C cDNA, Ref. 29), and pT7SRFDelta ATG (1.6-kb insert of human SRF cDNA, Ref. 34) were linearized with XhoI, XbaI, and EcoRI, respectively. Circular p6HisOct-1 expression plasmid (33) containing the full-length human Oct-1 cDNA was used in the rabbit reticulocyte kit. Parallel TnT reactions were performed in the presence of [35S]methionine (NEN Life Science Products). Efficient translation and expected molecular weights of the protein products were verified by resolving the radiolabeled reaction products on a sodium dodecyl sulfate-12% polyacrylamide gel (SDS-PAGE).

Antibodies-- The antibodies used in this study are as follows: GATA-4, affinity-purified goat polyclonal antibody raised against mouse GATA-4 carboxyl terminus amino acids 420-439 (Santa Cruz Biotechnology, Inc.); MEF2A, rabbit polyclonal antibody raised against fusion protein GST-MEF2A (human, amino acids 129-253) (35); MEF2B, rabbit polyclonal antibody raised against fusion protein GST-MEF2B (human, amino acids 88-365) (36); MEF2, affinity-purified rabbit polyclonal antibody raised against human MEF2 carboxyl terminus amino acids 487-507 (Santa Cruz Biotechnology, Inc.); SRF, affinity-purified rabbit polyclonal antibody raised against a peptide within the carboxyl terminus of human SRF (Santa Cruz Biotechnology, Inc.); and Oct-1 rabbit polyclonal raised against human Oct-1.

Two-dimensional UV Cross-linking Analysis-- Two-dimensional UV cross-linking was performed essentially as described previously by us (10). The first dimension of this assay involved EMSA using the bromodeoxyuridine-substituted beta A/T-rich probe and MOV-P nuclear extract since only this reaction revealed the formation of a highly enriched DNA-protein complex. EMSA was performed as described above, except that the reaction mixture was scaled up 5-fold. Immediately following electrophoresis, the gel was exposed to UV irradiation (312 nm) for 30 min at 4 °C. The specific band corresponding to the cross-linked DNA-protein complex was excised, transferred to a sample well of a SDS-12% polyacrylamide gel, and electrophoresed at 150 V for 75 min (second dimension PAGE). Following electrophoresis, the gel was placed on Whatman filter paper and dried, and the DNA-protein complexes were visualized by autoradiography.

Dimethyl Sulfate (DMS) and Diethyl Pyrocarbonate (DEPC) Interference Assays-- DMS and DEPC DNA-footprinting assays were performed as described by Sturm et. al (37). 32P-labeled beta A/T-rich probe was modified by either 0.7% DMS or 2% DEPC for 15 min at 25 °C and 37 °C, respectively. The probe was used for preparative EMSA as described above, except the reactions were scaled-up 10-fold. Bands corresponding to the DNA-protein complex and free probe were excised from the EMSA gel and recovered by electroelution. Base-specific cleavage of the recovered DNA was carried out in a 100-µl 1 M piperidine incubation for 30 min at 90 °C which was followed by repeated rounds of lyophilization to remove the piperidine. Equivalent amounts (1000 cpm/lane) of free and bound cleaved probe were resolved on a 20% polyacrylamide, M urea denaturing sequencing gel. Gels were autoradiographed for 24 h.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Identification of Enriched MOV-P Nuclear Protein Binding Activity That Interacts at the Human beta A/T-rich Element-- Our previous work has identified an 89-bp MyHC MOV-responsive region (-293 to -205) which contains a highly conserved A/T-rich motif that harbors an overlapping GATA/MEF2-like homology (Figs. 1 and 2). Since the beta A/T-rich element appears to function, in part, as an inducible element of injected rat beta MyHC reporter constructs in pressure overloaded adult rat hearts, it was important that we determine whether the human beta A/T-rich element functions in vivo as an MOV-inducible element (MOV-E) in adult skeletal muscle. We initiated this investigation by first examining the binding properties of the beta A/T-rich element by performing gel EMSAs using CP and MOV-P nuclear extract. The incubation of the double stranded 24-bp 32P-labeled beta A/T-rich probe (-275/-252, Table I) with these skeletal muscle nuclear extracts resulted in a binding complex that was substantially enriched only when MOV-P nuclear extract was used (Fig. 3A and Fig. 4, lanes 1 versus 7). This enriched binding complex was judged to be specific because the addition of 100-fold molar excess cold wild-type beta A/T-rich probe abolished binding complex formation (Fig. 4, lanes 2 and 8), whereas 100-fold molar excess cold mutant (beta A/T-mut) probe (Fig. 4, lanes 3 versus 9) did not. The nucleotides mutated within the beta A/T-mut probe corresponded to DNA-protein contact points elucidated in our DMS and DEPC footprinting experiments (Fig. 3, B and C). These data establish that highly enriched binding activity exists in MOV-P nuclear extract as compared with CP nuclear extract and support the notion that the beta A/T-rich element may function as an MOV element that confers induction to beta MyHC transgenes in adult skeletal muscle.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   beta MyHC transgene expression in response to MOV activity. Schematic summary of the pattern of chloramphenicol acetyltransferase (CAT) reporter gene expression in control soleus (CS), control plantaris (CP), and mechanically overloaded plantaris (MOV-P) muscles of transgenic mice. Transgenes consist of either 205 (beta 205), 293 (beta 293), 350 (beta 350), or 450 bp (beta 450) of human beta MyHC 5'-promoter sequence and 120 bp of 5'-untranslated region fused to the bacterial CAT reporter gene. Transgene beta 600 contains 600 bp of the mouse beta MyHC 5' promoter sequence and the entire 1600 bp of the 5'-untranslated region linked to the CAT reporter gene. Transgene beta 600 mut3 is structurally identical to beta 600 except it harbors mutations within the three major regulatory elements (MCAT, C-rich, and beta e3). +, expression; -, barely detectable to no expression; up-arrow , induced expression. Open boxes within the transgene 5'-untranslated region represent untranslated exons.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Sequence comparison of the beta MyHC proximal promoter region from multiple species. Nucleotide sequences of the human (Ref. 11, X52889), pig (Ref. 12, L10130), rabbit,3 hamster (Ref. 14, L12104), rat X16291),4 and mouse (Ref. 16, L07306) were aligned using the CLUSTALW program provided in the Biology Workbench (available on the WWW). Gaps were inserted to optimize the alignment. Sequences are compared with the human beta MyHC MOV-P responsive promoter region spanning nucleotides -293 to -205. The positions of the MCAT and C-rich elements are indicated in gray. Conserved nucleotides of the beta A/T-rich sequence are stippled and in boldface. The reference and accession numbers for each sequence are listed in parenthesis.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Oligonucleotides probes and competitors
Putative binding elements within the various oligonucleotides used in this study are delineated in boldface type. The beta A/T-rich GATA-like motif is underlined to distinguish it as a component of this GATA/MEF2-like composite element. mut, mutation of beta A/T-rich binding site with base pair alterations shown in lowercase letters. BrdU, bromodeoxyuridine-substituted probe.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 3.   A, EMSA analysis of DNA-protein interaction at the beta A/T-rich element. 32P-labeled beta A/T-rich probe was incubated with 5 µg of either control plantaris (CP) or mechanical-overload rat plantaris (MOV-P) nuclear extract. Binding complexes were resolved as described under "Experimental Procedures." Note an enriched DNA-protein binding complex in the presence of MOV-P (lane 2) but not CP nuclear extract (lane 1). B, DMS and DEPC interference footprinting of the beta A/T-rich·MOV-P complex. The 24-bp beta A/T-rich probe was 32P-end-labeled on either the sense or antisense strand. Parallel reactions of the labeled probe were partially methylated with DMS or carbethoxylated with DEPC. The modified probes were incubated in the presence of MOV-P nuclear extracts and resolved by preparative EMSA as described under "Experimental Procedures." The cleavage patterns of the bound (B) and free (F) probe are shown for the sense (lanes 1-4) and antisense (lanes 7-10). Control sequences G and G/A (lanes 5, 6, 11, and 12) represent base-specific chemical cleavage of the unbound probe. The positions of the modified guanine (G) and adenine (A) residues which either completely (closed circle) or partially (open circle) interfere with MOV-P factor(s) binding is shown to the left (DMS) and right (DEPC) of each panel. C, summary of the DMS and DEPC footprint formed by MOV-P factor(s) interaction at the beta A/T-rich element. Oligonucleotide numbering begins at the 5'-end of the sense strand. The probe extends from nucleotides -275 to -252 of the human beta MyHC promoter. Open circle depicts partial interference; closed circle, depicts complete interference.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 4.   EMSA analysis of sequence-specific DNA-protein interactions at the beta A/T-rich element. 5 µg of either CP (lanes 1-6) or MOV-P (lanes 7-12) nuclear extract was incubated in the presence of 8 fmol (20,000 cpm) of the beta A/T-rich oligonucleotide. For competition assays, the following non-radioactive competitor oligonucleotides were added to the reaction mixture at a 100-fold molar excess prior to the addition of the probe: beta A/T-rich (lanes 2 and 8), beta A/T-rich mutant (lanes 3 and 9), cTnC GATA (lanes 4 and 10), alpha MyHC GATA (lanes 5 and 11), and BNP GATA (lanes 6 and 12). Free probe (lane 13) represents the beta A/T-rich probe resolved in the absence of nuclear extract. SC, specific complex.

To identify the exact nucleotides involved in the highly enriched DNA-protein binding complex formed at the beta A/T-rich element, we performed DMS and DEPC interference footprinting analyses. DMS footprinting delimited a binding site on the sense strand of the 24-bp beta A/T-rich probe that encompassed nucleotides -269 to -266 wherein methylation of guanine residues either partially (positions 7 and 8) or strongly (position 10) interfered with nuclear protein binding (Fig. 3, B and C). In contrast, DMS modification of the antisense strand did not distinguish a DNA-protein interaction. The modification of adenine residues by DEPC treatment resolved a protein binding site demarcated by strong interference at positions 11 and 13 on the sense strand, and 12, 14, 15, and 16 on the antisense strand (Fig. 3, B and C). Overall, our DMS and DEPC interference footprinting experiments revealed that MOV-P nuclear protein(s) interact at a site spanning nucleotides -269 to -260 of the 24-bp beta A/T-rich probe. This interaction involves nucleotides comprising the overlapping GATA/MEF2-like homology; however, it also includes two 5'-flanking guanines that may be important determinants specifying binding affinity and classification of transcription factor(s) binding at this site (Fig. 3C).

EMSA Analyses Indicate That GATA-4 Does Not Bind to the Human beta A/T-rich Element during MOV Induction of the beta MyHC Gene-- The beta A/T-rich element contains a GATA-like consensus element (5/6 nucleotides match, 83%) that has recently been reported to mediate pressure overload induction of injected rat beta MyHC reporter genes and to bind GATA-4 protein (17). In contrast to GATA-2 and -3 mRNAs, the detection of GATA protein in skeletal muscle has not been reported as yet; however, it is possible that intracellular signals generated by MOV may activate the transcription of GATA isoforms during the hypertrophic growth of adult skeletal muscle. To determine whether GATA protein(s) represent a component of the enriched binding activity identified in MOV-P nuclear extract, we performed competition EMSAs. As discussed previously, incubation of the 32P-labeled beta A/T-rich probe with MOV-P nuclear extract formed a highly enriched specific binding complex in comparison to that formed when CP nuclear extract was used (Fig. 3A and Fig. 4, lanes 1-3 versus 7-9). Competition EMSA made use of probes harboring GATA elements previously shown to bind GATA-4. When using CP or MOV-P nuclear extract, complex formation was not inhibited by the addition of 100-fold molar excess of cold mouse cardiac troponin C GATA (cTnC GATA; Fig. 4, lanes 4 and 10), rat alpha-MyHC GATA (alpha -MyHC GATA; Fig. 4, lanes 5 and 11), or rat B-type natriuretic peptide GATA (BNP GATA; Fig. 4, lanes 6 and 12) probe to the binding reaction. These data further demonstrate the specificity of the enriched binding complex formed between MOV-P nuclear protein and the beta A/T-rich element, and suggest that GATA protein does not bind to the beta A/T-rich element under control or MOV conditions.

To test whether GATA-4 could bind to the human beta A/T-rich element, we conducted binding studies using wheat germ lysate in vitro translated GATA-4 (Fig. 5A, inset, [35S]methionine-labeled GATA-4) and the 32P-labeled human beta A/T-rich probe. Fig. 5A shows that an enriched binding complex formed only when MOV-P nuclear extract was used in binding reactions containing the 32P-labeled beta A/T-rich probe (lane 1 versus 2). A binding complex was not formed when either unprogrammed lysate (UL) or in vitro translated GATA-4 was reacted with our 32P-labeled human beta A/T-rich probe (Fig. 5A, lanes 3 and 4). To assess the binding integrity of our in vitro translated GATA-4 protein, binding experiments were performed to determine whether our in vitro translated GATA-4 could bind to the alpha -MyHC, cTnC, and BNP consensus GATA elements. As observed with the human beta A/T-rich probe, a specific binding complex was not formed when UL was added to binding reactions containing either the alpha MyHC, the cTnC, or the BNP GATA element (Fig. 5A, lanes 5, 7, and 9). However, the addition of in vitro translated GATA-4 to binding reactions containing either the alpha MyHC, the cTnC, or the BNP GATA probe resulted in the formation of binding complexes (Fig. 5A, lanes 6, 8, and 10). These results provide evidence that in vitro translated GATA-4 is capable of binding a genuine GATA site and support the conclusion that GATA-4 is not a component of the enriched MOV-P binding activity.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5.   A, EMSA analysis of in vitro transcribed-translated GATA-4 protein. Inset, [35S]methionine-labeled GATA-4. The wheat germ lysate system was programmed with 1 µg of linearized mouse GATA-4 expression plasmid in the presence of [35S]methionine. The transcribed-translated (TNT) product was resolved on 12% SDS-PAGE and exposed to film. Molecular mass markers (in kilodaltons) are shown on the right. -, represents parallel reaction not programmed with GATA-4 expression plasmid. Right panel, EMSA of 32P-labeled beta A/T-rich, alpha -MyHC GATA, cTnC GATA, and BNP GATA oligonucleotides with in vitro TNT GATA-4. Binding assays contained 1 µl of either unprogrammed (-, lanes 3, 5, 7, and 9) or GATA-4 cDNA programmed TNT product (+, lanes 4, 6, 8, and 10). Note GATA-4 interacts with the alpha -MyHC, cTnC, and BNP GATA elements but not with the beta A/T-rich sequence. CP and MOV-P binding to the beta A/T-rich probe are provided for reference (SC, lanes 1 and 2). B, EMSA analysis of GATA-4 TNT protein binding at the rat beta A/T-rich element. EMSA of 32P-labeled rat beta MyHC GATA oligonucleotide with in vitro TNT rabbit reticulocyte GATA-4 product. The binding assays contained 1 µl of either unprogrammed (-, lane1) or GATA-4 cDNA programmed (+, lanes 2-4) TNT protein. Competition reactions were performed with 100-fold molar excess of either self (lane 3) or BNP GATA (lane 4) oligonucleotides. No difference was observed in sequence-specific DNA-protein binding between the unprogrammed and programmed reactions. C, antibody supershift EMSA analysis of MOV-P and GATA-4 TNT binding complexes. Supershift EMSAs were performed by preincubation of MOV-P nuclear extract and GATA-4 TNT product with 2 µl of polyclonal anti-GATA-4 antibody for 30 min at room temperature prior to the addition of the labeled probe. Either immunodepletion or supershift (SS) of the DNA-protein complex was observed with the alpha -MyHC, cTnC, and BNP GATA probes (lanes 7, 11, and 15). In contrast, the GATA-4 antibody did not disrupt the beta A/T-rich·MOV-P complex (lane 3). Control reactions were performed with preimmune serum (PI, lanes 2, 6, 10, and 14). Sequence-specific binding of the GATA-4 TNT to the alpha -MyHC, cTnC, and BNP GATA elements is demonstrated by the eradication of binding complex formation upon addition of 100-fold molar excess of the corresponding unlabeled oligonucleotide (lanes 5, 9, and 13).

The failure of in vitro translated GATA-4 to bind the human beta A/T-rich element was not expected since GATA-4 has been reported to bind to the rat beta MyHC A/T-rich element (17). To investigate if this discrepancy was because of species-specific divergences in nucleotide sequence flanking the GATA site, we conducted binding experiments using a 31-bp 32P-labeled rat beta A/T-rich probe and rabbit reticulocyte lysate-generated in vitro translated GATA-4 (Fig. 5B). A specific binding complex between in vitro translated GATA-4 and the rat beta A/T-rich element was not formed, but rather, a series of identical nonspecific binding complexes formed when using either UL or programmed lysate (Fig. 5B, lanes 1-4). These nonspecific complexes were not competed for by addition of 100-fold molar excess of either the rat beta A/T-rich element or the high affinity BNP GATA binding site, indicating that the endogenous binding activity in rabbit reticulocyte lysate was not GATA-4 (Fig. 5B, lanes 1-4). Similarly, multiple nonspecific binding activities have been observed by another investigator in studies examining the binding of rabbit reticulocyte lysate-produced GATA-4 protein to the cTnC GATA site (also referred to as CEF-1) (24). Interestingly, these nonspecific complexes were notably absent when using wheat germ lysate (Fig. 5, A and C versus B).

To complete our investigation into whether GATA-4 might be a component of the enriched MOV-P·beta A/T-rich binding complex, we performed supershift EMSAs using a polyclonal antibody that specifically recognizes GATA-4. The enriched specific binding complex formed when MOV-P nuclear extract was reacted with the 32P-labeled human beta A/T-rich element was clearly not altered by preincubation with either preimmune serum or polyclonal GATA-4 antibody (Fig. 5C, lane 1 versus lanes 2 and 3). The binding complex formed between either the alpha MyHC (lanes 4 versus 5), the cTnC (lane 8 versus 9), or the BNP (lane 12 versus 13) GATA elements and in vitro translated GATA-4 was self-competed away by addition of 100-fold molar excess of each respective cold probe to the binding reaction thereby revealing specific binding (Fig. 5C). Preincubation of preimmune serum in binding reactions containing in vitro translated GATA-4 and either the alpha MyHC (lanes 6 versus 7), the cTnC (lanes 10 versus 11) or the BNP (lanes 14 versus 15) GATA probes did not alter complex formation, whereas the addition of polyclonal GATA-4 antibody either depleted or supershifted these binding complexes (Fig. 5C). When taken together, the results gathered from our direct, competition, and supershift EMSA experiments support the notion that GATA proteins, in particular GATA-4, are not a component of the enriched MOV-P·beta A/T-rich binding complex. In addition, our EMSA results indirectly indicate that GATA-5, GATA-6, and HMG-II are not components of the MOV-P·beta A/T-rich binding complex since the cTnC GATA element, previously shown to bind these factors, did not compete for complex formation (Fig. 4, lanes 4 and 10) (24, 38, 39). However, these experiments do not eliminate the possibility that unidentified GATA-related protein(s) interact at the beta A/T-rich element during the hypertrophy of adult skeletal muscle.

MEF2 Proteins Are Not a Component of the Enriched MOV-P Binding Activity-- Members of the MEF2 family play a pivotal role during mouse embryogenesis by collaboratively regulating the expression of muscle genes that are critical for striated muscle differentiation (40). However, it is not known what role, if any, MEF2 proteins serve in regulating gene expression during adult skeletal muscle hypertrophy. Since the beta A/T-rich element contains an MEF2-like homology, it was important to determine whether MEF2 proteins bind the beta A/T-rich element in response to skeletal muscle MOV. To address this possibility, we performed competition and supershift EMSAs, as well as binding reactions using in vitro translated MEF2C (Fig. 6, A and B). The addition of 100-fold molar excess cold muscle creatine kinase MEF2 (MCK MEF2) or desmin MEF2 probe to the binding reaction as a competitor resulted in the partial inhibition of 32P-labeled beta A/T-rich·MOV-P complex formation (Fig. 6A, lane 1 versus lanes 2 and 3). This result was not surprising given the high degree of sequence homology between these elements (Table I). Although binding complexes formed when in vitro translated MEF2C (Fig. 6A, inset, [35S]methionine-labeled MEF2C) was added to binding reactions containing the 32P-labeled human beta A/T-rich element, these complexes did not differ from those obtained when UL was used and therefore must be considered nonspecific (Fig. 6A, lanes 4 and 5). In contrast, when in vitro translated MEF2C was added to binding reactions containing a 32P-labeled MCK MEF2 probe, a binding complex formed that had a lower mobility than the nonspecific binding complex that formed when using UL (Fig. 6A, lanes 6 versus 7). In competition experiments, 100-fold molar excess cold MCK MEF2 probe completely abolished complex formation and 100-fold molar excess desmin MEF2 probe effectively competed for complex formation; however, the human beta A/T-rich probe only partially competed away complex formation (Fig. 6A, lanes 7 versus 8-10).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6.   A, EMSA analysis of in vitro transcribed-translated MEF2C protein. Inset, [35S]methionine-labeled MEF2C. The wheat germ lysate system was programmed with 1 µg of linearized mouse MEF2C expression plasmid in the presence of [35S]methionine. The TNT product was resolved on 12% SDS-PAGE and exposed to film. Molecular mass markers (in kilodaltons) are shown on the right. -, represents parallel reaction not programmed with MEF2C expression plasmid. Right panel, competition EMSA of 32P-labeled beta A/T-rich and MCK MEF2 probes. 5 µg of MOV-P nuclear extract was incubated with radiolabeled beta A/T-rich oligonucleotide (SC, lanes 1-3). Unlabeled competitor oligonucleotides harboring the beta A/T-rich (lane 10), MCK MEF2 (lanes 2 and 8), and desmin MEF2 (lanes 3 and 9) binding elements were added at a 100-fold molar excess. Binding assays were also performed using 2 µl of either unprogrammed (-, lanes 4 and 6), or MEF2C cDNA-programmed TNT product (+, lanes 5 and 7-10). Note that MEF2C interacts with the MCK MEF2 oligonucleotide. In contrast, MEF2C does not bind to the beta A/T-rich probe as shown by the lack of difference in band pattern between unprogrammed (-) and MEF2C programmed (+) lysate. B, antibody supershift EMSA analysis of MOV-P and MEF2C TNT binding complexes. Antibody EMSAs were performed by preincubation of MOV-P nuclear extract (5 µg) and MEF2C TNT product with 2 µl of either preimmune serum (PI, lanes 2 and 7), or polyclonal anti-MEF2A, -MEF2B, or -MEF2 antibody for 30 min at room temperature (see "Experimental Procedures"). Only the general anti-MEF2 antibody produced a supershift (SS) of the MEF2C binding complex (lane 10). None of the antibodies disrupted specific binding of the MOV-P factor(s) to the beta A/T-rich probe (SC, lanes 3-5).

To assess whether other MEF2 isoproteins interact with the human beta A/T-rich element, we performed supershift EMSAs using antibodies that specifically recognize either MEF2A or MEF2B, as well as a general MEF2 antibody that recognizes MEF2A, -C, and -D isoforms. Preincubation of MOV-P nuclear extract with either preimmune serum or with any of the MEF2 antibodies (MEF2A-Ab, MEF2B-Ab, MEF2-Ab) did not supershift or immunodeplete the 32P-labeled beta A/T-rich binding complex (Fig. 6B, lanes 1-5). The formation of a specific binding complex between in vitro translated MEF2C protein and the 32P-labeled MCK MEF2 probe was not altered by preincubation with preimmune serum or MEF2A- or MEF2B-specific antibodies (Fig. 6B, lane 6 versus lanes 7-9); however, preincubation with MEF2 antibody supershifted the MEF2C 32P-labeled MCK MEF2 probe binding complex (Fig. 6B, lane 10). These data strongly suggest that MEF2 proteins are not likely to be a component of the MOV-P·beta A/T-rich complex.

The SRF Does Not Bind the beta A/T-rich Element-- The SRE (CC(A/T)TATA(T/A)GG) is an A/T-rich element previously shown to bind the MADS-box transcription factor, SRF, and to function as a regulator of numerous muscle and nonmuscle genes in response to very diverse stimuli (22). Given the relatedness of the consensus SRE to the beta A/T-rich element (GGAGATATTT) (Table I), and the observations that the SRF is activated by growth factors, elevated levels of intracellular calcium, and mechanical stretch (three stimuli associated with MOV), we investigated whether the SRF might comprise a component of the enriched MOV-P binding activity. In competition and supershift EMSA experiments we found that the enriched binding complex formed between the beta A/T-rich element and MOV-P nuclear extract was neither competed for by a consensus SRE nor supershifted by SRF antibody (Fig. 7, lanes 1-5). To determine whether SRF could bind to the beta A/T-rich element, we performed binding reactions using wheat germ lysate in vitro translated SRF (Fig. 7, inset, [35S]methionine-labeled SRF) and the 32P-labeled beta A/T-rich element. A binding complex was not formed when either UL or in vitro translated SRF protein was added to binding reactions containing the 32P-labeled beta A/T-rich element (Fig. 7, lanes 6 and 7). When in vitro translated SRF was reacted with a 32P-labeled consensus SRE probe, a complex formed (lanes 8 versus 9) that was inhibited by addition of 100-fold molar excess cold SRE probe, but not beta A/T-rich probe (Fig. 7, lane 9 versus lanes 10 and 11). Preincubation of the in vitro translated SRF containing binding reaction with preimmune serum did not alter complex formation, whereas preincubation with SRF antibody resulted in a supershifted binding complex (Fig. 7, lanes 12 versus 13). Thus, these data provide evidence indicating that the SRF is not a component of the MOV-P binding activity.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 7.   EMSA investigation of MOV-P binding to the beta A/T-rich oligonucleotide. Inset, [35S]methionine-labeled SRF protein. The wheat germ lysate system was programmed with 1 µg of linearized mouse SRF expression plasmid in the presence of [35S]methionine. The TNT product was resolved on 12% SDS-PAGE and exposed to film. Molecular mass markers (in kilodaltons) are shown on the right. -, represents parallel reaction not programmed with SRF expression plasmid. Right panel, competition and antibody supershift EMSA analyses of beta A/T-rich and c-fos SRE oligonucleotides. Radiolabeled beta A/T-rich probe was incubated with 5 µg of MOV-P nuclear extract (SC, lanes 1-5). Competition reactions were performed with excess unlabeled beta A/T-rich (lanes 2 and 11) and c-fos SRE (lanes 3 and 10) oligonucleotides. Binding assays were also performed using 1 µl of either unprogrammed (-, lanes 6 and 8), or SRE cDNA-programmed TNT product (+, lanes 7 and 9-13). In vitro TNT SRF protein bound to the consensus c-fos SRE, but not to the beta A/T-rich site. Supershift reactions were performed using 2 µl of either preimmune serum (PI, lanes 4 and 12) or polyclonal anti-SRF antibody (lanes 5 and 13). Pre-incubation of the EMSA reaction with the anti-SRF antibody resulted in a supershift (SS) of the SRF TNT binding complex (lane 13), but not of the beta A/T-rich·MOV-P complex (lane 5).

The Homeodomain Protein Oct-1 Does Not Bind the beta A/T-rich Element during Skeletal Muscle Hypertrophy-- The ubiquitous Oct-1 protein is present in most cell types and is thought to participate in directing B-cell specific immunoglobulin gene transcription through interaction at an octamer (ATGCAAAT) motif (41). In addition to its action in B-cells, several recent findings suggest a regulatory role for Oct-1 in the transcriptional activation of striated muscle genes. An A/T-rich (AGTATATTTAG) site within the proximal promoter of the mouse cardiac troponin I gene was shown in expression assays to be required for full promoter activity, and in EMSAs it was shown to bind both MEF2 and Oct-1 (42). Similarly, two A/T-rich elements (mAT1, ATTTCTAATTATATCCATTCA, and mAT2, TGTCAAATTATTTATAG) within the MyHC IIb proximal promoter also bind MEF2 and Oct-1 (21). Thus, on the basis of these findings, and when considering the sequence similarity between our beta A/T-rich element (GGAGATATTT) (Table I) and the aforementioned A/T-rich elements, it is conceivable that Oct-1 binds the beta A/T-rich element under MOV conditions. To ascertain if Oct-1 binds the human beta A/T-rich element, we performed competitive and supershift EMSAs. Addition of 100-fold molar excess cold beta A/T-rich oligo to the binding reaction containing 32P-labeled beta A/T-rich element completely inhibits complex formation, whereas addition of an oligo carrying a consensus Oct-1 element only partially blocked complex formation (Fig. 8, lane 1 versus lanes 2 and 3). However, the preincubation of MOV-P nuclear extract with either preimmune serum or an antibody recognizing Oct-1 did not alter the highly enriched specific binding complex formed between MOV-P nuclear extract and the beta A/T-rich element (Fig. 8, lanes 4 and 5). To determine whether Oct-1 could bind to the beta A/T-rich element, we performed binding reactions using rabbit reticulocyte lysate in vitro translated Oct-1 (Fig. 8, inset, [35S]methionine-labeled Oct-1) and the 32P-labeled beta A/T-rich element. A binding complex was not formed when either UL or in vitro translated Oct-1 protein was added to binding reactions containing the 32P-labeled beta A/T-rich element (Fig. 8, lanes 6 and 7). When in vitro translated Oct-1 was reacted with a 32P-labeled consensus Oct-1 probe, a complex formed (lanes 8 versus 9) that was inhibited by addition of 100-fold molar excess cold Oct-1 probe but not beta A/T-rich probe (Fig. 8, lane 9 versus lanes 10 and 11). Preincubation of the in vitro translated Oct-1 containing binding reaction with preimmune serum did not alter complex formation, whereas preincubation with Oct-1 antibody resulted in a supershifted binding complex (Fig. 8, lane 12 versus 13). These results indicate that Oct-1 is not a component of the enriched binding complex formed between MOV-P nuclear extract and the beta A/T-rich element.


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 8.   EMSA analysis of in vitro transcribed-translated Oct-1 protein. Inset, [35S]methionine-labeled Oct-1 protein. The rabbit reticulocyte lysate system was programmed with 1 µg of circular human Oct-1 expression plasmid in the presence of [35S]methionine. The radiolabeled TNT product was resolved by 12% SDS-PAGE and exposed to film. Molecular mass markers (in kilodaltons) are shown on the right. -, represents reaction not programmed with the Oct-1 expression vector. Right panel, competition and antibody supershift EMSA analysis of radiolabeled beta A/T-rich and Oct-1 oligonucleotides. MOV-P nuclear extract (5 µg) was incubated with 32P-labeled beta A/T-rich probe (SC, lanes 1-5). Unlabeled competitor beta A/T-rich (lanes 2 and 11) and Oct-1 (lanes 3 and 10) oligonucleotides were added at a 100-fold molar excess. Binding assays were also performed using 0.5 µl of either unprogrammed (-, lanes 6 and 8) or Oct-1 cDNA-programmed TNT product (+, lanes 7 and 9-13). Note that Oct-1 protein shows sequence-specific binding to the Oct-1 oligonucleotide but not to the beta A/T-rich probe. For antibody supershift EMSA, MOV-P nuclear extract and Oct-1 TNT product were pre-incubated with 2 µl of either preimmune (PI, lanes 4 and 12) or polyclonal anti-Oct-1 antibody (lanes 5 and 13) for 30 min at room temperature prior to the addition of the probe. The anti-Oct-1 antibody produced a supershift (SS) of the Oct-1 TNT binding complex (lane 13) but not of the beta A/T-rich·MOV-P complex (lane 5).

Biochemical Analysis of MOV-P DNA-binding Factor Interaction at beta A/T-rich Element-- Our EMSA and footprinting analyses support the notion that the human beta A/T-rich element functions as an MOV element in adult skeletal muscle. Furthermore, the composite nature (5/6 GATA, 8/10 MEF2) of our beta A/T-rich binding site and its flanking sequence as determined by footprinting analysis suggested the possibility that, under MOV conditions, a multiprotein complex likely forms at this element (Fig. 3, B and C). As an initial inquiry into what factor(s) within the MOV-P nuclear extract interacts with the 32P-labeled beta A/T-rich probe, we performed two-dimensional UV cross-linking analysis (Fig. 9). A bromodeoxyuridine-substituted beta A/T-rich probe was incubated with MOV-P nuclear extract, and the enriched binding complex was separated from unbound probe by EMSA. The EMSA gel was then exposed to UV light (312 nm) for 30 min, and both the highly enriched binding complex and the unbound (free) probe were excised from the gel, electroeluted, and resolved on a 12% (w/v) SDS-polyacrylamide gel. This analysis detected two distinct bands of apparent molecular masses of 44 and 48 kDa, thereby indicating that the enriched binding complex formed at the beta A/T-rich element is comprised of two different proteins whose identities are presently not known (Fig. 9). When our experimental data herein are considered collectively, it can be tentatively concluded that the beta A/T-rich element likely functions in vivo as an MOV element involved in beta MyHC induction in fast-type II fibers following skeletal muscle overload, and that two distinct proteins are involved in this process.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 9.   Two-dimensional UV cross-linking of the DNA-protein complex. The beta A/T-rich·MOV-P complex was resolved on a preparative EMSA gel. The wet gel was exposed to UV irradiation (312 nm) for 30 min at 4 °C. The cross-linked DNA-protein complex was excised and resolved on a SDS-12% polyacrylamide gel. Two bands were identified, with approximate molecular masses of 44 and 48 kDa.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Future characterization of the enriched binding activity we observed between MOV-P nuclear extract and the beta A/T-rich element will provide information essential for the mechanistic understanding of the adaptive responses that occur during skeletal muscle hypertrophy. Although phenotypic changes occurring during this process have been extensively described biochemically, there remains a notable information void at the molecular genetic level. One major obstacle toward progress in this area derives from the lack of a myogenic cell line that is capable of maintaining an adult-stage phenotype. In addition, it is currently not possible to emulate in culture the input from integrative systems imposed on a MOV muscle of an intact animal, thus requiring these investigations to make use of transgenic models. In this study, we have advanced the mechanistic understanding of MOV changes in adult skeletal muscle phenotype by providing substantial molecular evidence that the beta A/T-rich element located within the 89-bp beta MyHC MOV-responsive region functions as a putative MOV element. This finding is important since the induction of beta MyHC gene expression is a common MOV response shared by adult-stage rodent cardiac and skeletal muscle, and recently the beta A/T-rich element was shown to play a role in the transcriptional activation of rat beta MyHC-reporter constructs following direct injection into pressure-overloaded adult rat hearts (17). Therefore, when considering our findings herein with those of others, it seems reasonable to tentatively propose that MOV induction of the beta MyHC gene in both rodent cardiac and skeletal muscle is conferred in part by a common element; i.e. the beta A/T-rich site. The authenticity of the beta A/T-rich element as an in vivo MOV-inducible element in both striated muscle subtypes will require the analysis of chromosomally integrated transgenes carrying wild type and mutant beta A/T rich elements, a focus of our ongoing investigations.

GATA-4, SRF, Oct-1, and MEF2 Are Not Components of the Binding Complex Formed at the beta A/T-rich Element during MOV Induction of beta MyHC Gene Expression in Adult-stage Skeletal Muscle-- An extensive body of literature exists that provide persuasive evidence suggesting that either GATA-4, SRF, Oct-1, or MEF2 may function independently or in combination to regulate beta MyHC induction in response to MOV by binding to the beta A/T-rich site. For example, several current findings indicate that GATA element(s) and/or protein(s) not only act as mediators of cardiovascular development (43, 44) but are also implicated in the regulation of other cellular responses such as the hypertrophic response in adult rat hearts (17, 45). Nevertheless, our direct, competition, and supershift EMSA experimental results (Figs. 5-8) provide comprehensive evidence that the factor(s) binding the beta A/T-rich element in response to mechanical stimuli in skeletal muscle differ from that proposed (GATA-4) for cardiac muscle (17). Our experiments revealed that in vitro translated GATA-4 made in both wheat germ and rabbit reticulocyte lysate did not bind the human beta A/T-rich element, whereas it did bind to probes harboring alpha -MyHC, cTnC, and BNP GATA sites in a sequence-specific manner (Fig. 5, A-C). Furthermore, Northern analysis did not detect the expression of GATA-4 transcripts in control or MOV plantaris muscle, eliminating the possibility of load-induced GATA-4 expression in adult skeletal muscle (data not shown). Moreover, the expression of GATA isoproteins as well as the newly identified GATA cofactors, FOG and FOG2 (Friend of GATA), have not been detected within adult-stage skeletal muscle (46-49).

This study also provides ample evidence that rules out other known transcription factors that otherwise might have logically been assumed to activate beta MyHC induction during skeletal muscle hypertrophy based on tissue distribution and the nucleotide composition of the beta A/T-rich element. Specifically, even though SRF, Oct-1, and MEF2 have been shown to be required for striated muscle expression of a number of contractile protein genes, our findings do not support a role for these transcription factors in the MOV induction of beta MyHC expression in adult-stage skeletal muscle. Regardless of the high degree of nucleotide homology shared between the beta A/T-rich element and consensus recognition binding sites for SRF, Oct-1, and MEF2 (Table I), our EMSA analysis revealed that the enriched beta A/T-rich·MOV-P binding complex was neither effectively competed for by these elements nor supershifted/depleted by SRF-, Oct-1-, or MEF2-specific antibodies (Figs. 6-8). The finding that MEF2 was not a component of the highly enriched MOV-P·beta A/T-rich complex was surprising since it has recently been hypothesized that the activation of a Ca2+/calmodulin-dependent calcineurin signaling pathway underlies slow-type I fiber-specific transcription in response to a sustained increase in intracellular calcium induced by slow motor nerve activity (50). Mechanistically, the transcriptional activation of select slow-type I fiber-specific genes was shown to involve both MEF2 and NF-AT proteins (50). The potential applicability of this pathway to MOV is derived from the fact that MOV of the adult plantaris muscle results in a significant increase in the proportion of histochemically identified slow-type I fibers. This later finding has been confirmed by studies revealing an increase in the number of slow motor units innervating the adult MOV plantaris muscle (Ref. 8, and references within).

An interesting observation gleaned from the MEF2 EMSA experiments that we feel merits discussion is the detection of an additional low migrating binding complex (which was more prominent following longer exposure) that was only visible when using MOV-P nuclear extract (Fig. 6B). In addition to having a lower mobility than the highly enriched MOV-P·beta A/T-rich binding complex (SC), this complex was not altered by preimmune serum but was supershifted by MEF2A and general MEF2 antibodies, indicating that MEF2A is a component of this minor binding complex (Fig. 6B, top of gel above MEF2C arrow, lanes 1-5). This notion was confirmed by EMSA analysis which revealed that wheat germ lysate produced in vitro translated MEF2A bound the beta A/T-rich element and that this binding complex was supershifted by MEF2A antibody and displayed a migration pattern identical to the low mobility MOV-P·beta A/T-rich binding complex (data not shown). Additionally, in parallel EMSA experiments using MOV-P nuclear extract, we found that MEF2A binds to the MCK MEF2 element with much higher affinity in comparison with its binding to the beta A/T-rich element (data not shown). The significance of the minor MEF2A·beta A/T-rich binding complex is not clear at present, however, based on the low affinity binding of MEF2A to the beta A/T-rich site, we speculate that it is unlikely to represent a functionally relevant complex during MOV-induced beta MyHC expression. Importantly, while these experiments show that MEF2A within MOV-P nuclear extract can bind to the beta A/T-rich element with low affinity, our current experiments demonstrate that two proteins (44 and 48 kDa) found only in MOV-P nuclear extract comprise the highly enriched beta A/T-rich·MOV-P binding complex and are not MEF2 proteins.

Although MEF2C, GATA-4, SRF, and Oct-1 have been shown to bind A/T-rich sites within the control region of other muscle genes, and GATA-4 has been associated with the cardiac hypertrophic response, our finding that these factors are not a component of the enriched MOV-P·beta A/T-rich binding complex in MOV adult skeletal muscle is not surprising for a number of reasons. First, it has been shown that the same A/T-rich element within the control region of a given gene can bind multiple different factors, and that this binding may differ in accordance to developmental-stage and/or cell type (20, 21, 36, 42, 51). Second, accumulating evidence has established that the nucleotides flanking cis-elements, such as the MCAT, E-box, and MEF2, can exert a profound effect on transcription factor binding specificity and affinity (40, 52, 53). In this respect, the beta A/T-rich element examined in this study is a composite element comprised of overlapping non-consensus GATA-like (83%, sense strand) and MEF2-like (80%, antisense) homology containing core and flanking nucleotide sequences that are divergent from sites previously shown to bind GATA or MEF2 factors (Table II, Refs. 54-59, and references within table). Third, it has been well documented that mechanical stretch of cultured striated muscle cells leads to the activation of a deluge of intracellular signal pathways (15, 60, 61). Thus, it is likely that the potent stimulus of MOV activates numerous cell-signaling programs that alter transcription factor expression, activity via post-translational modification, or cofactor(s) availability and/or interaction. Last, the experimental paradigm used herein differs from those typically employed by others in that it utilizes adult-stage skeletal muscle that is undergoing a fast-to-slow fiber-type remodeling induced by MOV. Therefore, it is not unreasonable to suggest that transcription factor type and activity, as well as chromatin structure and/or microenvironment within the nuclear milieu of MOV skeletal muscle differs significantly from that within the cell-types commonly studied.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Sequence comparison of A/T-rich motifs in muscle gene regulatory regions
A/T-rich elements are delineated by underlining. The sense strand is shown for the sequences unless otherwise indicated by AS, antisense.

Our experiments have shown that the beta A/T-rich site is a putative MOV element and that the enriched MOV-P binding activity at this site is comprised of two distinct proteins that may be unique to the MOV stimulus. Their i