J Biol Chem, Vol. 274, Issue 43, 30832-30842, October 22, 1999
Nuclear Protein Binding at the
-Myosin Heavy Chain A/T-rich
Element Is Enriched following Increased Skeletal Muscle Activity*
Dharmesh R.
Vyas
,
John J.
McCarthy
, and
Richard W.
Tsika
§¶
From the
Department of Biomedical Sciences, School of
Veterinary Medicine, the § Department of Biochemistry,
School of Medicine, and the ¶ Dalton Cardiovascular Research
Center, University of Missouri-Columbia, Columbia, Missouri 65211
 |
ABSTRACT |
In adult mouse skeletal muscle,
-myosin heavy
chain (
MyHC) gene expression is primarily restricted to slow-type I
fibers but can be induced in fast-type II fibers by mechanical overload (MOV). Our previous transgenic analyses have delimited an 89-base pair
(bp) MOV-responsive region (
293 to
205), and shown that mutation of
the MCAT and C-rich elements within this region did not abolish
MyHC
transgene induction by MOV. In this study we describe an A/T-rich
element (
A/T-rich;
269 5'-GGAGATATTTTT-3'
258) located within
this 89-bp region that, only under MOV conditions, revealed enriched
binding as characterized by electrophoretic mobility shift assays and
dimethyl sulfate and diethyl pyrocarbonate interference footprinting.
Direct, competition, and supershift electrophoretic mobility shift
assays revealed highly enriched specific binding activity at the
A/T-rich element that was antigenically distinct from GATA-4,
MEF2A-D, SRF, and Oct-1, nuclear proteins that were previously shown
to bind A/T-rich elements. In vitro translated GATA-4,
MEF2C, SRF, and Oct-1 bound to consensus GATA, MEF2, SRE, and Oct-1
elements, respectively, but not to the
A/T-rich element.
Two-dimensional UV cross-linking of the bromodeoxyuridine-substituted
A/T-rich element with mechanically overloaded plantaris (MOV-P) nuclear extract detected two proteins (44 and 48 kDa). Our results indicate that the
A/T-rich element may function in vivo
as a
MyHC MOV-inducible element during hypertrophy of adult skeletal muscle by binding two distinct proteins identified only in MOV-P nuclear extract.
 |
INTRODUCTION |
Myosin is an abundantly expressed contractile protein comprised of
two heavy chain subunits and two pairs of dissimilar light chains. The
myosin heavy chain (MyHC)1
subunit is encoded by a multigene family comprised of eight members that are regulated in a tissue-specific manner throughout development and in response to various physiological stimuli (1, 2). The
heterogeneous spectrum of vertebrate sarcomeric MyHC isoforms and their
differential expression pattern underlies the broad classification
scheme that histochemically (myofibrillar ATPase) distinguishes four
primary adult-stage skeletal muscle fiber-types. Because each MyHC
isoform is thought to serve a specific physiological role, variation in
the proportion and spatial arrangement of each fiber-type underlies the
biochemical and functional specialization of each muscle. This notion
is underscored by the classic finding that actin-activated myosin
ATPase activity and unloaded shortening velocity
(Vmax) are highly correlated to the amount and
type of isomyosin or MyHC comprising a given muscle or muscle fiber
(3-5). More recently, insight into the function of individual MyHC
isoforms was gained from studies employing the genetic strategy of
homologous recombination to target the inactivation of either the fast
type IIb or IId/x MyHC genes. Functional analyses of muscle from either the type IIb or IId/x MyHC knock-out mice revealed altered contractile properties that were unique to each null mutation despite the compensatory activation of the endogenous fast type IId/x and IIa
genes, respectively (6, 7). In contrast to our current knowledge
concerning the diversity of adult-stage MyHC isoforms and their
distinct functional properties, there exists a paucity of information
regarding the mechanisms that govern MyHC fiber-type-specific gene
expression and their differential regulation in response to various
modes of neuromuscular activity.
It has been well documented that the phenotype of adult-stage skeletal
muscle can be profoundly altered in response to specific mechanical
perturbations, such as mechanical overload (MOV) or non-weight bearing
(NWB), which presumably reflect altered neuromuscular activity. To
better understand this phenotypic plasticity in molecular terms, we
have used the
MyHC gene as a model system since
MyHC expression
is primarily restricted to slow-type I fibers in the adult mouse but
can be induced in fast-type II fibers following MOV (8). In addition,
MyHC expression is decreased in slow-type I fibers in response to
NWB activity (9, 10). Our investigation into the regulatory
mechanism(s) underlying the antithetic expression pattern of the
MyHC gene in response to these two diverse stimuli have established
that NWB- and MOV-responsive element(s) are distinct and segregated
within the proximal promoter of the
MyHC gene (see Fig. 1, Refs.
8-10). More specifically, our transgenic studies have delimited a
156-bp
MyHC NWB-responsive promoter region (nucleotides
450 to
294), and within this region we have identified a negative regulatory
element (d
NRE-S:
332 to
311) that binds two distinct proteins
found only in NWB soleus nuclear extract
(10).2 As concerns MOV, we
have identified an 89-bp
MyHC MOV-responsive promoter region (
293
to
205), and shown that mutation of the muscle-CAT (MCAT) and C-rich
elements within this region did not abolish transgene induction,
suggesting that an MOV element(s) resides within this region (see Fig.
1, Refs. 8 and 10).
Examination of the nucleotide sequence comprising this 89-bp
MyHC
MOV-responsive region revealed that, in addition to containing MCAT and
C-rich elements, there is an A/T-rich motif (
269 5'-GGAGATATTTTT-3'
258) that is highly conserved in nucleotide sequence and location across species (Fig. 2, Refs. 11, 12, 14, and
16)3,4
and has a high degree of homology to both the consensus myocyte enhancer factor 2 (MEF2) element [CTA(A/T)4TAG/A] and the
consensus GATA element [(A/T)GATA(A/G)]. In support of the hypothesis
that a MOV element may reside within the
MyHC 89-bp MOV-responsive region, Hasegawa et al. (17) have reported that this
A/T-rich element (referred to as a GATA element by them) within the
proximal promoter region of rat
MyHC reporter genes acts as an
inducible element following direct injection into pressure-overloaded
adult rat hearts. This response was presumably conferred by GATA-4
binding at this element. In light of this finding, and because the
A/T-rich element (referred to as
A/T-rich hereafter) contains a
GATA/MEF2-like homology, it is noteworthy that McGrew et al.
(18) have recently reported the detection of GATA-2 and -3 transcripts
in skeletal muscle since GATA factor expression is thought to be absent
in this tissue. Furthermore, these investigators also demonstrated that
an intact GATA motif is required for full transcriptional activation of
the fast alkali myosin light chain-3 (FMLC3) promoter in transient
expression assays using primary cultures of neonatal skeletal muscle
cells. In contrast to GATA, the involvement of MEF2 proteins in
activating muscle gene transcription in response to mechanical
perturbations of adult skeletal muscle has not been reported as yet.
In addition to GATA and MEF2 proteins, A/T-rich elements have been
reported to interact with a diverse group of transcription factors
including the ubiquitously expressed POU-domain octamer-binding factor;
Oct-1, the homeodomain protein; MHox, the MADS-box (MCM, Agamous,
Deficiens, Serum response factor) factor; serum response factor (SRF),
and the high-mobility group I and II (HMG-I, HMG-II) architectural
proteins (19-24). Given the broad range of transcription factor types
that can interact at A/T-rich elements, several important questions
arise. First, do known A/T-rich binding transcription factors serve a
functional role in directing adult-stage skeletal muscle gene
expression in response to altered neuromuscular activity? Second, does
the
MyHC A/T-rich (
A/T-rich) element confer MOV-inducible expression to the
MyHC gene in both cardiac and skeletal muscle? Third, given the fast-to-slow fiber-type transition associated with
skeletal muscle MOV, does the
A/T-rich element serve a dual role as
an inducible and fiber-type element? As an initial attempt to define
these important regulatory mechanisms, the current analyses focused on
determining whether the
A/T-rich element served as a
MyHC
mechanical overload element in MOV skeletal muscle and if GATA, MEF2,
SRF, and Oct-1 transcription factor family members bind this element
under MOV conditions. This report is the first to implicate a role for
the
A/T-rich sequence as a putative MOV element during skeletal
muscle hypertrophy in vivo. Additionally, our results
provide evidence that GATA4, MEF2C, SRF, and Oct-1 are not components
of the highly enriched binding activity identified within mechanically
overloaded plantaris (MOV-P) nuclear extract in this study.
Furthermore, our data show that two distinct (44 and 48 kDa) proteins,
present only in MOV-P nuclear extract, bind the
A/T-rich element
under MOV conditions. The latter result implicates these proteins in
the MOV-induction of
MyHC transgene expression in fast type II
skeletal muscle fibers that normally do not express the
MyHC to any
significant degree.
 |
EXPERIMENTAL PROCEDURES |
Preparation of Nuclear Protein Extract from Adult Skeletal
Muscle--
Nuclear extract was isolated from adult rat control
plantaris (CP) and MOV-P muscle as described previously (10). All
procedures were carried out on ice. All buffers contained 2 µg/ml
each of aprotinin and leupeptin, and 0.5 mM
phenylmethylsulfonyl fluoride, protease inhibitors. Ten grams of either
CP or MOV-P were harvested from adult female Harlan Sprague-Dawley
200-gram rats and minced in phosphate-buffered saline. Minced muscle
tissue was incubated in relaxation buffer I, for two 15-min intervals,
followed by two 10-min washes in relaxation buffer II. The muscle
tissue was then homogenized in buffer A and centrifuged through a 27%
Percoll (Amersham Pharmacia Biotech) density gradient at 27,000 × g for 15 min at 4 °C. The pelleted nuclear layer was
consolidated and lysed by the addition of 3 M
NH4SO4 (pH 7.9) to a final concentration of 0.4 M. The lysate was ultracentrifuged at 126,000 × g for 1 h (4 °C) to pellet nuclear membrane debris.
Solid NH4SO4 (0.3 g/ml) was added slowly to the
supernatant, and the precipitated nuclear proteins were
concentrated by ultra-centrifugation at 126,000 × g
for 30 min. The resulting pellet was resuspended in dialysis buffer and
dialyzed for 2 h. The nuclear protein extract was stored in
aliquots at
80 °C. Protein concentration was determined according to Bradford (25).
Electrophoretic Mobility Shift Assay--
All oligonucleotide
probes used in this study are listed in Table I (17, 26-31).
Electrophoretic mobility shift assays (EMSAs) were performed as
described previously (10). The double-stranded AT-rich oligonucleotide
probe (nucleotides
275 to
252) was labeled by fill-in reaction
using the Klenow fragment of Escherichia coli DNA polymerase
I (Stratagene, La Jolla, CA) and [
-32P]dCTP
(3000Ci/mmol). All other oligonucleotide probes were end-labeled by T4
polynucleotide kinase (New England Biolabs, Beverly, MA) and
[
-32P]ATP (6000 Ci/mmol). Probes were purified by
polyacrylamide gel electrophoresis prior to use in EMSA. Binding
reactions were performed with 5 µg of either CP or MOV-P nuclear
extract and 20,000 cpm of labeled probe for 20 min at room temperature
in a 25-µl total volume. Where indicated, 1 µl of in
vitro translated GATA-4, 2 µl of MEF2C, 1 µl of SRF, or 0.5 µl of Oct-1 protein was used in place of MOV-P nuclear extract. The
binding reactions were resolved on a 5% non-denaturing polyacrylamide
gel at 220 volts for 2.5 h at 4 °C. Supershift EMSAs were
performed by preincubation of MOV-P nuclear extract or in
vitro translated GATA-4, MEF2C, SRF, or Oct-1 protein with 2 µl
of the corresponding antibody for 30 min at room temperature prior to
the addition of the 32P-labeled DNA probe. Following
electrophoresis, the gels were dried and DNA-protein complexes were
visualized by autoradiography.
In vitro Transcription/Translation (TnT)--
In
vitro coupled TnT was performed using 1 µg of expression plasmid
in the T7 TnT wheat germ (GATA-4, MEF2C) and rabbit reticulocyte TnT
(Oct-1, GATA-4) lysate systems according to the instructions of the
manufacturer (Promega). Prior to use in the wheat germ TnT reaction,
the expression plasmids pcDNAI GATA-4 (1.7-kb insert of mouse
GATA-4 cDNA, Ref. 32), pcDNAI MEF2C (1.4-kb insert of mouse
MEF2C cDNA, Ref. 29), and pT7SRF
ATG (1.6-kb insert of human SRF
cDNA, Ref. 34) were linearized with XhoI,
XbaI, and EcoRI, respectively. Circular
p6HisOct-1 expression plasmid (33) containing the full-length human
Oct-1 cDNA was used in the rabbit reticulocyte kit. Parallel TnT
reactions were performed in the presence of
[35S]methionine (NEN Life Science Products). Efficient
translation and expected molecular weights of the protein products were
verified by resolving the radiolabeled reaction products on a sodium
dodecyl sulfate-12% polyacrylamide gel (SDS-PAGE).
Antibodies--
The antibodies used in this study are as
follows: GATA-4, affinity-purified goat polyclonal antibody raised
against mouse GATA-4 carboxyl terminus amino acids 420-439 (Santa Cruz
Biotechnology, Inc.); MEF2A, rabbit polyclonal antibody raised against
fusion protein GST-MEF2A (human, amino acids 129-253) (35); MEF2B, rabbit polyclonal antibody raised against fusion protein GST-MEF2B (human, amino acids 88-365) (36); MEF2, affinity-purified rabbit polyclonal antibody raised against human MEF2 carboxyl terminus amino
acids 487-507 (Santa Cruz Biotechnology, Inc.); SRF, affinity-purified rabbit polyclonal antibody raised against a peptide within the carboxyl
terminus of human SRF (Santa Cruz Biotechnology, Inc.); and Oct-1
rabbit polyclonal raised against human Oct-1.
Two-dimensional UV Cross-linking Analysis--
Two-dimensional
UV cross-linking was performed essentially as described previously by
us (10). The first dimension of this assay involved EMSA using the
bromodeoxyuridine-substituted
A/T-rich probe and MOV-P nuclear
extract since only this reaction revealed the formation of a highly
enriched DNA-protein complex. EMSA was performed as described above,
except that the reaction mixture was scaled up 5-fold. Immediately
following electrophoresis, the gel was exposed to UV irradiation (312 nm) for 30 min at 4 °C. The specific band corresponding to the
cross-linked DNA-protein complex was excised, transferred to a sample
well of a SDS-12% polyacrylamide gel, and electrophoresed at 150 V for
75 min (second dimension PAGE). Following electrophoresis, the gel was
placed on Whatman filter paper and dried, and the DNA-protein complexes were visualized by autoradiography.
Dimethyl Sulfate (DMS) and Diethyl Pyrocarbonate (DEPC)
Interference Assays--
DMS and DEPC DNA-footprinting assays were
performed as described by Sturm et. al (37).
32P-labeled
A/T-rich probe was modified by either 0.7%
DMS or 2% DEPC for 15 min at 25 °C and 37 °C, respectively. The
probe was used for preparative EMSA as described above, except the
reactions were scaled-up 10-fold. Bands corresponding to the
DNA-protein complex and free probe were excised from the EMSA gel and
recovered by electroelution. Base-specific cleavage of the recovered
DNA was carried out in a 100-µl 1 M piperidine incubation
for 30 min at 90 °C which was followed by repeated rounds of
lyophilization to remove the piperidine. Equivalent amounts (1000 cpm/lane) of free and bound cleaved probe were resolved on a 20%
polyacrylamide, 8 M urea denaturing sequencing gel. Gels
were autoradiographed for 24 h.
 |
RESULTS |
The Identification of Enriched MOV-P Nuclear Protein Binding
Activity That Interacts at the Human
A/T-rich Element--
Our
previous work has identified an 89-bp MyHC MOV-responsive region (
293
to
205) which contains a highly conserved
A/T-rich motif that harbors an
overlapping GATA/MEF2-like homology (Figs. 1 and
2). Since the
A/T-rich element appears
to function, in part, as an inducible element of injected rat
MyHC
reporter constructs in pressure overloaded adult rat hearts, it was
important that we determine whether the human
A/T-rich element
functions in vivo as an MOV-inducible element (MOV-E) in
adult skeletal muscle. We initiated this investigation by first
examining the binding properties of the
A/T-rich element by
performing gel EMSAs using CP and MOV-P nuclear extract. The incubation
of the double stranded 24-bp 32P-labeled
A/T-rich probe
(
275/
252, Table I) with these
skeletal muscle nuclear extracts resulted in a binding
complex that was substantially enriched
only when MOV-P nuclear extract was used (Fig. 3A and Fig.
4, lanes 1 versus
7). This enriched binding complex was judged to be specific because the
addition of 100-fold molar excess cold wild-type
A/T-rich probe
abolished binding complex formation (Fig. 4, lanes 2 and
8), whereas 100-fold molar excess cold mutant
(
A/T-mut) probe (Fig. 4,
lanes 3 versus 9) did not. The nucleotides
mutated within the
A/T-mut probe corresponded to DNA-protein contact
points elucidated in our DMS and DEPC footprinting experiments (Fig. 3,
B and C). These data establish that highly enriched binding activity exists in MOV-P nuclear extract as compared with CP nuclear extract and support the notion that the
A/T-rich element may function as an MOV element that confers induction to
MyHC transgenes in adult skeletal muscle.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
MyHC transgene expression in
response to MOV activity. Schematic summary of the pattern of
chloramphenicol acetyltransferase (CAT) reporter gene
expression in control soleus (CS), control plantaris
(CP), and mechanically overloaded plantaris
(MOV-P) muscles of transgenic mice. Transgenes consist of
either 205 ( 205), 293 ( 293), 350 ( 350), or 450 bp ( 450) of
human MyHC 5'-promoter sequence and 120 bp of 5'-untranslated region
fused to the bacterial CAT reporter gene. Transgene 600 contains 600 bp of the mouse MyHC 5' promoter sequence and the entire 1600 bp of
the 5'-untranslated region linked to the CAT reporter gene. Transgene
600 mut3 is structurally identical to 600 except it harbors
mutations within the three major regulatory elements (MCAT, C-rich, and
e3). +, expression; , barely detectable to no expression; ,
induced expression. Open boxes within the transgene
5'-untranslated region represent untranslated exons.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 2.
Sequence comparison of the MyHC proximal promoter region from multiple
species. Nucleotide sequences of the human (Ref. 11, X52889), pig
(Ref. 12, L10130), rabbit,3 hamster (Ref. 14, L12104), rat
X16291),4 and mouse (Ref. 16, L07306) were aligned using
the CLUSTALW program provided in the Biology Workbench (available on
the WWW). Gaps were inserted to optimize the alignment. Sequences are
compared with the human MyHC MOV-P responsive promoter region
spanning nucleotides 293 to 205. The positions of the MCAT and
C-rich elements are indicated in gray. Conserved nucleotides
of the A/T-rich sequence are stippled and in
boldface. The reference and accession numbers for each
sequence are listed in parenthesis.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Oligonucleotides probes and competitors
Putative binding elements within the various oligonucleotides used in
this study are delineated in boldface type. The A/T-rich GATA-like
motif is underlined to distinguish it as a component of this
GATA/MEF2-like composite element. mut, mutation of A/T-rich binding
site with base pair alterations shown in lowercase letters. BrdU,
bromodeoxyuridine-substituted probe.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 3.
A, EMSA analysis of DNA-protein
interaction at the A/T-rich element. 32P-labeled
A/T-rich probe was incubated with 5 µg of either control plantaris
(CP) or mechanical-overload rat plantaris (MOV-P)
nuclear extract. Binding complexes were resolved as described under
"Experimental Procedures." Note an enriched DNA-protein binding
complex in the presence of MOV-P (lane 2) but not CP nuclear
extract (lane 1). B, DMS and DEPC interference
footprinting of the A/T-rich·MOV-P complex. The 24-bp A/T-rich
probe was 32P-end-labeled on either the sense or antisense
strand. Parallel reactions of the labeled probe were partially
methylated with DMS or carbethoxylated with DEPC. The modified probes
were incubated in the presence of MOV-P nuclear extracts and resolved
by preparative EMSA as described under "Experimental Procedures."
The cleavage patterns of the bound (B) and free
(F) probe are shown for the sense (lanes 1-4)
and antisense (lanes 7-10). Control sequences G and G/A
(lanes 5, 6, 11, and 12) represent base-specific
chemical cleavage of the unbound probe. The positions of the modified
guanine (G) and adenine (A) residues which either completely
(closed circle) or partially (open circle)
interfere with MOV-P factor(s) binding is shown to the left
(DMS) and right (DEPC) of each panel.
C, summary of the DMS and DEPC footprint formed by MOV-P
factor(s) interaction at the A/T-rich element. Oligonucleotide
numbering begins at the 5'-end of the sense strand. The probe extends
from nucleotides 275 to 252 of the human MyHC promoter.
Open circle depicts partial interference; closed
circle, depicts complete interference.
|
|

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 4.
EMSA analysis of sequence-specific
DNA-protein interactions at the A/T-rich
element. 5 µg of either CP (lanes 1-6) or MOV-P (lanes
7-12) nuclear extract was incubated in the presence of 8 fmol
(20,000 cpm) of the A/T-rich oligonucleotide. For competition
assays, the following non-radioactive competitor oligonucleotides were
added to the reaction mixture at a 100-fold molar excess prior to the
addition of the probe: A/T-rich (lanes 2 and
8), A/T-rich mutant (lanes 3 and
9), cTnC GATA (lanes 4 and 10),
MyHC GATA (lanes 5 and 11), and BNP GATA
(lanes 6 and 12). Free probe (lane 13)
represents the A/T-rich probe resolved in the absence of nuclear
extract. SC, specific complex.
|
|
To identify the exact nucleotides involved in the highly enriched
DNA-protein binding complex formed at the
A/T-rich element, we
performed DMS and DEPC interference footprinting analyses. DMS
footprinting delimited a binding site on the sense strand of the 24-bp
A/T-rich probe that encompassed nucleotides
269 to
266 wherein
methylation of guanine residues either partially (positions 7 and 8) or
strongly (position 10) interfered with nuclear protein binding (Fig. 3,
B and C). In contrast, DMS modification of the
antisense strand did not distinguish a DNA-protein interaction. The
modification of adenine residues by DEPC treatment resolved a protein
binding site demarcated by strong interference at positions 11 and 13 on the sense strand, and 12, 14, 15, and 16 on the antisense strand
(Fig. 3, B and C). Overall, our DMS and DEPC
interference footprinting experiments revealed that MOV-P nuclear
protein(s) interact at a site spanning nucleotides
269 to
260 of
the 24-bp
A/T-rich probe. This interaction involves nucleotides
comprising the overlapping GATA/MEF2-like homology; however, it also
includes two 5'-flanking guanines that may be important determinants
specifying binding affinity and classification of transcription
factor(s) binding at this site (Fig. 3C).
EMSA Analyses Indicate That GATA-4 Does Not Bind to the Human
A/T-rich Element during MOV Induction of the
MyHC Gene--
The
A/T-rich element contains a GATA-like consensus element (5/6
nucleotides match, 83%) that has recently been reported to mediate
pressure overload induction of injected rat
MyHC reporter genes and
to bind GATA-4 protein (17). In contrast to GATA-2 and -3 mRNAs,
the detection of GATA protein in skeletal muscle has not been reported
as yet; however, it is possible that intracellular signals generated by
MOV may activate the transcription of GATA isoforms during the
hypertrophic growth of adult skeletal muscle. To determine whether GATA
protein(s) represent a component of the enriched binding activity
identified in MOV-P nuclear extract, we performed competition EMSAs. As
discussed previously, incubation of the 32P-labeled
A/T-rich probe with MOV-P nuclear extract formed a highly enriched
specific binding complex in comparison to that formed when CP nuclear
extract was used (Fig. 3A and Fig. 4, lanes 1-3
versus 7-9). Competition EMSA made use of probes harboring GATA
elements previously shown to bind GATA-4. When using CP or MOV-P
nuclear extract, complex formation was not inhibited by the addition of
100-fold molar excess of cold mouse cardiac troponin C GATA (cTnC GATA;
Fig. 4, lanes 4 and 10), rat alpha-MyHC GATA (
-MyHC GATA; Fig. 4, lanes 5 and 11), or rat
B-type natriuretic peptide GATA (BNP GATA; Fig. 4, lanes 6 and 12) probe to the binding reaction. These data further
demonstrate the specificity of the enriched binding complex formed
between MOV-P nuclear protein and the
A/T-rich element, and suggest
that GATA protein does not bind to the
A/T-rich element under
control or MOV conditions.
To test whether GATA-4 could bind to the human
A/T-rich element, we
conducted binding studies using wheat germ lysate in vitro
translated GATA-4 (Fig. 5A,
inset, [35S]methionine-labeled GATA-4) and the
32P-labeled human
A/T-rich probe. Fig. 5A
shows that an enriched binding complex formed only when MOV-P nuclear
extract was used in binding reactions containing the
32P-labeled
A/T-rich probe (lane 1 versus 2). A binding complex was not formed when either
unprogrammed lysate (UL) or in vitro translated GATA-4 was
reacted with our 32P-labeled human
A/T-rich probe (Fig.
5A, lanes 3 and 4). To assess the
binding integrity of our in vitro translated GATA-4 protein, binding experiments were performed to determine whether our in vitro translated GATA-4 could bind to the
-MyHC, cTnC, and BNP consensus GATA elements. As observed with the human
A/T-rich probe,
a specific binding complex was not formed when UL was added to binding
reactions containing either the
MyHC, the cTnC, or the BNP GATA
element (Fig. 5A, lanes 5, 7, and
9). However, the addition of in vitro translated
GATA-4 to binding reactions containing either the
MyHC, the cTnC, or
the BNP GATA probe resulted in the formation of binding complexes (Fig.
5A, lanes 6, 8, and 10). These results provide evidence that in vitro translated
GATA-4 is capable of binding a genuine GATA site and support the
conclusion that GATA-4 is not a component of the enriched MOV-P binding
activity.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
A, EMSA analysis of in vitro
transcribed-translated GATA-4 protein. Inset,
[35S]methionine-labeled GATA-4. The wheat germ lysate
system was programmed with 1 µg of linearized mouse GATA-4 expression
plasmid in the presence of [35S]methionine. The
transcribed-translated (TNT) product was resolved on 12%
SDS-PAGE and exposed to film. Molecular mass markers (in kilodaltons)
are shown on the right. , represents parallel reaction not
programmed with GATA-4 expression plasmid. Right panel, EMSA
of 32P-labeled A/T-rich, -MyHC GATA, cTnC GATA, and
BNP GATA oligonucleotides with in vitro TNT
GATA-4. Binding assays contained 1 µl of either unprogrammed ( ,
lanes 3, 5, 7, and 9) or GATA-4 cDNA
programmed TNT product (+, lanes 4, 6, 8, and
10). Note GATA-4 interacts with the -MyHC, cTnC, and BNP
GATA elements but not with the A/T-rich sequence. CP and MOV-P
binding to the A/T-rich probe are provided for reference
(SC, lanes 1 and 2). B,
EMSA analysis of GATA-4 TNT protein binding at the rat
A/T-rich element. EMSA of 32P-labeled rat MyHC GATA
oligonucleotide with in vitro TNT rabbit
reticulocyte GATA-4 product. The binding assays contained 1 µl of
either unprogrammed ( , lane1) or GATA-4 cDNA
programmed (+, lanes 2-4) TNT protein.
Competition reactions were performed with 100-fold molar excess of
either self (lane 3) or BNP GATA (lane 4)
oligonucleotides. No difference was observed in sequence-specific
DNA-protein binding between the unprogrammed and programmed reactions.
C, antibody supershift EMSA analysis of MOV-P and GATA-4
TNT binding complexes. Supershift EMSAs were performed by
preincubation of MOV-P nuclear extract and GATA-4 TNT
product with 2 µl of polyclonal anti-GATA-4 antibody for 30 min at
room temperature prior to the addition of the labeled probe. Either
immunodepletion or supershift (SS) of the DNA-protein
complex was observed with the -MyHC, cTnC, and BNP GATA probes
(lanes 7, 11, and 15). In contrast, the GATA-4
antibody did not disrupt the A/T-rich·MOV-P complex (lane
3). Control reactions were performed with preimmune serum
(PI, lanes 2, 6, 10, and 14).
Sequence-specific binding of the GATA-4 TNT to the
-MyHC, cTnC, and BNP GATA elements is demonstrated by the
eradication of binding complex formation upon addition of 100-fold
molar excess of the corresponding unlabeled oligonucleotide
(lanes 5, 9, and 13).
|
|
The failure of in vitro translated GATA-4 to bind the human
A/T-rich element was not expected since GATA-4 has been reported to
bind to the rat
MyHC A/T-rich element (17). To investigate if this
discrepancy was because of species-specific divergences in nucleotide
sequence flanking the GATA site, we conducted binding experiments using
a 31-bp 32P-labeled rat
A/T-rich probe and rabbit
reticulocyte lysate-generated in vitro translated GATA-4
(Fig. 5B). A specific binding complex between in
vitro translated GATA-4 and the rat
A/T-rich element was not
formed, but rather, a series of identical nonspecific binding
complexes formed when using either UL or programmed lysate (Fig. 5B,
lanes 1-4). These nonspecific complexes were not competed for by addition of 100-fold molar excess of either the rat
A/T-rich element or the high affinity BNP GATA binding site, indicating that the
endogenous binding activity in rabbit reticulocyte lysate was not
GATA-4 (Fig. 5B, lanes 1-4). Similarly, multiple
nonspecific binding activities have been observed by another
investigator in studies examining the binding of rabbit reticulocyte
lysate-produced GATA-4 protein to the cTnC GATA site (also referred to
as CEF-1) (24). Interestingly, these nonspecific complexes were notably absent when using wheat germ lysate (Fig. 5, A and C
versus B).
To complete our investigation into whether GATA-4 might be a component
of the enriched MOV-P·
A/T-rich binding complex, we performed
supershift EMSAs using a polyclonal antibody that specifically recognizes GATA-4. The enriched specific binding complex formed when
MOV-P nuclear extract was reacted with the 32P-labeled
human
A/T-rich element was clearly not altered by preincubation with
either preimmune serum or polyclonal GATA-4 antibody (Fig. 5C, lane 1 versus lanes 2 and 3). The binding complex formed between either the
MyHC (lanes 4 versus 5), the cTnC
(lane 8 versus 9), or the BNP
(lane 12 versus 13) GATA elements and
in vitro translated GATA-4 was self-competed away by
addition of 100-fold molar excess of each respective cold probe to the
binding reaction thereby revealing specific binding (Fig.
5C). Preincubation of preimmune serum in binding reactions
containing in vitro translated GATA-4 and either the
MyHC
(lanes 6 versus 7), the cTnC
(lanes 10 versus 11) or the BNP
(lanes 14 versus 15) GATA probes did not alter complex formation, whereas the addition of polyclonal GATA-4 antibody either depleted or supershifted these binding complexes (Fig. 5C). When taken together, the results gathered from our
direct, competition, and supershift EMSA experiments support the notion that GATA proteins, in particular GATA-4, are not a component of the
enriched MOV-P·
A/T-rich binding complex. In addition, our EMSA
results indirectly indicate that GATA-5, GATA-6, and HMG-II are not
components of the MOV-P·
A/T-rich binding complex since the cTnC
GATA element, previously shown to bind these factors, did not compete
for complex formation (Fig. 4, lanes 4 and 10) (24, 38, 39). However, these experiments do not eliminate the
possibility that unidentified GATA-related protein(s) interact at the
A/T-rich element during the hypertrophy of adult skeletal muscle.
MEF2 Proteins Are Not a Component of the Enriched MOV-P Binding
Activity--
Members of the MEF2 family play a pivotal role during
mouse embryogenesis by collaboratively regulating the expression of muscle genes that are critical for striated muscle differentiation (40). However, it is not known what role, if any, MEF2 proteins serve
in regulating gene expression during adult skeletal muscle hypertrophy.
Since the
A/T-rich element contains an MEF2-like homology, it was
important to determine whether MEF2 proteins bind the
A/T-rich
element in response to skeletal muscle MOV. To address this
possibility, we performed competition and supershift EMSAs, as well as
binding reactions using in vitro translated MEF2C (Fig.
6, A and B). The
addition of 100-fold molar excess cold muscle creatine kinase MEF2 (MCK
MEF2) or desmin MEF2 probe to the binding reaction as a competitor
resulted in the partial inhibition of 32P-labeled
A/T-rich·MOV-P complex formation (Fig. 6A, lane
1 versus lanes 2 and 3). This
result was not surprising given the high degree of sequence homology
between these elements (Table I). Although binding complexes formed
when in vitro translated MEF2C (Fig. 6A, inset,
[35S]methionine-labeled MEF2C) was added to binding
reactions containing the 32P-labeled human
A/T-rich
element, these complexes did not differ from those obtained when UL was
used and therefore must be considered nonspecific (Fig. 6A,
lanes 4 and 5). In contrast, when in
vitro translated MEF2C was added to binding reactions containing a
32P-labeled MCK MEF2 probe, a binding complex formed that
had a lower mobility than the nonspecific binding complex that formed when using UL (Fig. 6A, lanes 6 versus
7). In competition experiments, 100-fold molar excess cold
MCK MEF2 probe completely abolished complex formation and 100-fold
molar excess desmin MEF2 probe effectively competed for complex
formation; however, the human
A/T-rich probe only partially competed
away complex formation (Fig. 6A, lanes 7 versus 8-10).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6.
A, EMSA analysis of in vitro
transcribed-translated MEF2C protein. Inset,
[35S]methionine-labeled MEF2C. The wheat germ lysate
system was programmed with 1 µg of linearized mouse MEF2C expression
plasmid in the presence of [35S]methionine. The
TNT product was resolved on 12% SDS-PAGE and exposed to
film. Molecular mass markers (in kilodaltons) are shown on the
right. , represents parallel reaction not programmed with
MEF2C expression plasmid. Right panel, competition EMSA of
32P-labeled A/T-rich and MCK MEF2 probes. 5 µg of
MOV-P nuclear extract was incubated with radiolabeled A/T-rich
oligonucleotide (SC, lanes 1-3). Unlabeled
competitor oligonucleotides harboring the A/T-rich (lane
10), MCK MEF2 (lanes 2 and 8), and desmin
MEF2 (lanes 3 and 9) binding elements were added
at a 100-fold molar excess. Binding assays were also performed using 2 µl of either unprogrammed ( , lanes 4 and 6),
or MEF2C cDNA-programmed TNT product (+, lanes
5 and 7-10). Note that MEF2C interacts with the MCK
MEF2 oligonucleotide. In contrast, MEF2C does not bind to the
A/T-rich probe as shown by the lack of difference in band pattern
between unprogrammed ( ) and MEF2C programmed (+) lysate.
B, antibody supershift EMSA analysis of MOV-P and MEF2C
TNT binding complexes. Antibody EMSAs were performed by
preincubation of MOV-P nuclear extract (5 µg) and MEF2C
TNT product with 2 µl of either preimmune serum (PI, lanes 2 and
7), or polyclonal anti-MEF2A, -MEF2B, or -MEF2 antibody for
30 min at room temperature (see "Experimental Procedures"). Only
the general anti-MEF2 antibody produced a supershift (SS) of
the MEF2C binding complex (lane 10). None of the antibodies
disrupted specific binding of the MOV-P factor(s) to the A/T-rich
probe (SC, lanes 3-5).
|
|
To assess whether other MEF2 isoproteins interact with the human
A/T-rich element, we performed supershift EMSAs using antibodies that specifically recognize either MEF2A or MEF2B, as well as a general
MEF2 antibody that recognizes MEF2A, -C, and -D isoforms. Preincubation
of MOV-P nuclear extract with either preimmune serum or with any of the
MEF2 antibodies (MEF2A-Ab, MEF2B-Ab, MEF2-Ab) did not supershift or
immunodeplete the 32P-labeled
A/T-rich binding complex
(Fig. 6B, lanes 1-5). The formation of a
specific binding complex between in vitro translated MEF2C
protein and the 32P-labeled MCK MEF2 probe was not altered
by preincubation with preimmune serum or MEF2A- or MEF2B-specific
antibodies (Fig. 6B, lane 6 versus
lanes 7-9); however, preincubation with MEF2 antibody supershifted the MEF2C 32P-labeled MCK MEF2 probe binding
complex (Fig. 6B, lane 10). These data strongly
suggest that MEF2 proteins are not likely to be a component of the
MOV-P·
A/T-rich complex.
The SRF Does Not Bind the
A/T-rich Element--
The SRE
(CC(A/T)TATA(T/A)GG) is an A/T-rich element previously shown to bind
the MADS-box transcription factor, SRF, and to function as a regulator
of numerous muscle and nonmuscle genes in response to very diverse
stimuli (22). Given the relatedness of the consensus SRE to the
A/T-rich element (GGAGATATTT) (Table I), and the observations that
the SRF is activated by growth factors, elevated levels of
intracellular calcium, and mechanical stretch (three stimuli associated
with MOV), we investigated whether the SRF might comprise a component
of the enriched MOV-P binding activity. In competition and supershift
EMSA experiments we found that the enriched binding complex formed
between the
A/T-rich element and MOV-P nuclear extract was neither
competed for by a consensus SRE nor supershifted by SRF antibody (Fig.
7, lanes 1-5). To determine
whether SRF could bind to the
A/T-rich element, we performed binding
reactions using wheat germ lysate in vitro translated SRF
(Fig. 7, inset, [35S]methionine-labeled SRF)
and the 32P-labeled
A/T-rich element. A binding complex
was not formed when either UL or in vitro translated SRF
protein was added to binding reactions containing the
32P-labeled
A/T-rich element (Fig. 7, lanes 6 and 7). When in vitro translated SRF was reacted
with a 32P-labeled consensus SRE probe, a complex formed
(lanes 8 versus 9) that was inhibited by addition
of 100-fold molar excess cold SRE probe, but not
A/T-rich probe
(Fig. 7, lane 9 versus lanes 10 and
11). Preincubation of the in vitro translated SRF
containing binding reaction with preimmune serum did not alter complex
formation, whereas preincubation with SRF antibody resulted in a
supershifted binding complex (Fig. 7, lanes 12 versus 13). Thus, these data provide evidence
indicating that the SRF is not a component of the MOV-P binding
activity.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 7.
EMSA investigation of MOV-P binding to
the A/T-rich oligonucleotide.
Inset, [35S]methionine-labeled SRF protein.
The wheat germ lysate system was programmed with 1 µg of linearized
mouse SRF expression plasmid in the presence of
[35S]methionine. The TNT product was resolved
on 12% SDS-PAGE and exposed to film. Molecular mass markers (in
kilodaltons) are shown on the right. , represents parallel
reaction not programmed with SRF expression plasmid. Right
panel, competition and antibody supershift EMSA analyses of
A/T-rich and c-fos SRE oligonucleotides. Radiolabeled
A/T-rich probe was incubated with 5 µg of MOV-P nuclear extract
(SC, lanes 1-5). Competition reactions were performed with
excess unlabeled A/T-rich (lanes 2 and 11) and
c-fos SRE (lanes 3 and 10)
oligonucleotides. Binding assays were also performed using 1 µl of
either unprogrammed ( , lanes 6 and 8), or SRE
cDNA-programmed TNT product (+, lanes 7 and
9-13). In vitro TNT SRF protein
bound to the consensus c-fos SRE, but not to the A/T-rich
site. Supershift reactions were performed using 2 µl of either
preimmune serum (PI, lanes 4 and 12)
or polyclonal anti-SRF antibody (lanes 5 and 13).
Pre-incubation of the EMSA reaction with the anti-SRF antibody resulted
in a supershift (SS) of the SRF TNT binding
complex (lane 13), but not of the A/T-rich·MOV-P
complex (lane 5).
|
|
The Homeodomain Protein Oct-1 Does Not Bind the
A/T-rich Element
during Skeletal Muscle Hypertrophy--
The ubiquitous Oct-1 protein
is present in most cell types and is thought to participate in
directing B-cell specific immunoglobulin gene transcription through
interaction at an octamer (ATGCAAAT) motif (41). In addition to its
action in B-cells, several recent findings suggest a regulatory role
for Oct-1 in the transcriptional activation of striated muscle genes.
An A/T-rich (AGTATATTTAG) site within the proximal promoter of the
mouse cardiac troponin I gene was shown in expression assays to be
required for full promoter activity, and in EMSAs it was shown to bind
both MEF2 and Oct-1 (42). Similarly, two A/T-rich elements (mAT1,
ATTTCTAATTATATCCATTCA, and mAT2, TGTCAAATTATTTATAG) within the MyHC IIb
proximal promoter also bind MEF2 and Oct-1 (21). Thus, on the basis of
these findings, and when considering the sequence similarity between
our
A/T-rich element (GGAGATATTT) (Table I) and the aforementioned
A/T-rich elements, it is conceivable that Oct-1 binds the
A/T-rich
element under MOV conditions. To ascertain if Oct-1 binds the human
A/T-rich element, we performed competitive and supershift EMSAs.
Addition of 100-fold molar excess cold
A/T-rich oligo to the binding
reaction containing 32P-labeled
A/T-rich element
completely inhibits complex formation, whereas addition of an oligo
carrying a consensus Oct-1 element only partially blocked complex
formation (Fig. 8, lane 1 versus lanes 2 and 3). However, the
preincubation of MOV-P nuclear extract with either preimmune serum or
an antibody recognizing Oct-1 did not alter the highly enriched
specific binding complex formed between MOV-P nuclear extract and the
A/T-rich element (Fig. 8, lanes 4 and 5). To
determine whether Oct-1 could bind to the
A/T-rich element, we
performed binding reactions using rabbit reticulocyte lysate in
vitro translated Oct-1 (Fig. 8, inset, [35S]methionine-labeled Oct-1) and the
32P-labeled
A/T-rich element. A binding complex was not
formed when either UL or in vitro translated Oct-1 protein
was added to binding reactions containing the 32P-labeled
A/T-rich element (Fig. 8, lanes 6 and 7). When
in vitro translated Oct-1 was reacted with a
32P-labeled consensus Oct-1 probe, a complex formed
(lanes 8 versus 9) that was inhibited by addition
of 100-fold molar excess cold Oct-1 probe but not
A/T-rich probe
(Fig. 8, lane 9 versus lanes 10 and
11). Preincubation of the in vitro translated
Oct-1 containing binding reaction with preimmune serum did not alter
complex formation, whereas preincubation with Oct-1 antibody resulted
in a supershifted binding complex (Fig. 8, lane 12 versus 13). These results indicate that Oct-1 is
not a component of the enriched binding complex formed between MOV-P
nuclear extract and the
A/T-rich element.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 8.
EMSA analysis of in vitro
transcribed-translated Oct-1 protein. Inset,
[35S]methionine-labeled Oct-1 protein. The rabbit
reticulocyte lysate system was programmed with 1 µg of circular human
Oct-1 expression plasmid in the presence of
[35S]methionine. The radiolabeled TNT product
was resolved by 12% SDS-PAGE and exposed to film. Molecular mass
markers (in kilodaltons) are shown on the right. ,
represents reaction not programmed with the Oct-1 expression vector.
Right panel, competition and antibody supershift EMSA
analysis of radiolabeled A/T-rich and Oct-1 oligonucleotides. MOV-P
nuclear extract (5 µg) was incubated with 32P-labeled
A/T-rich probe (SC, lanes 1-5). Unlabeled
competitor A/T-rich (lanes 2 and 11) and Oct-1
(lanes 3 and 10) oligonucleotides were added at a
100-fold molar excess. Binding assays were also performed using 0.5 µl of either unprogrammed ( , lanes 6 and 8)
or Oct-1 cDNA-programmed TNT product (+, lanes
7 and 9-13). Note that Oct-1 protein shows
sequence-specific binding to the Oct-1 oligonucleotide but not to the
A/T-rich probe. For antibody supershift EMSA, MOV-P nuclear extract
and Oct-1 TNT product were pre-incubated with 2 µl of
either preimmune (PI, lanes 4 and 12)
or polyclonal anti-Oct-1 antibody (lanes 5 and
13) for 30 min at room temperature prior to the addition of
the probe. The anti-Oct-1 antibody produced a supershift
(SS) of the Oct-1 TNT binding complex
(lane 13) but not of the A/T-rich·MOV-P complex
(lane 5).
|
|
Biochemical Analysis of MOV-P DNA-binding Factor Interaction at
A/T-rich Element--
Our EMSA and footprinting analyses support
the notion that the human
A/T-rich element functions as an MOV
element in adult skeletal muscle. Furthermore, the composite nature
(5/6 GATA, 8/10 MEF2) of our
A/T-rich binding site and its flanking
sequence as determined by footprinting analysis suggested the
possibility that, under MOV conditions, a multiprotein complex likely
forms at this element (Fig. 3, B and C). As an
initial inquiry into what factor(s) within the MOV-P nuclear extract
interacts with the 32P-labeled
A/T-rich probe, we
performed two-dimensional UV cross-linking analysis (Fig.
9). A bromodeoxyuridine-substituted
A/T-rich probe was incubated with MOV-P nuclear extract, and the
enriched binding complex was separated from unbound probe by EMSA. The
EMSA gel was then exposed to UV light (312 nm) for 30 min, and both the highly enriched binding complex and the unbound (free) probe were excised from the gel, electroeluted, and resolved on a 12% (w/v) SDS-polyacrylamide gel. This analysis detected two distinct bands of
apparent molecular masses of 44 and 48 kDa, thereby indicating that the
enriched binding complex formed at the
A/T-rich element is comprised
of two different proteins whose identities are presently not known
(Fig. 9). When our experimental data herein are considered collectively, it can be tentatively concluded that the
A/T-rich element likely functions in vivo as an MOV element involved
in
MyHC induction in fast-type II fibers following skeletal muscle overload, and that two distinct proteins are involved in this process.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 9.
Two-dimensional UV cross-linking of the
DNA-protein complex. The A/T-rich·MOV-P complex was resolved
on a preparative EMSA gel. The wet gel was exposed to UV irradiation
(312 nm) for 30 min at 4 °C. The cross-linked DNA-protein complex
was excised and resolved on a SDS-12% polyacrylamide gel. Two bands
were identified, with approximate molecular masses of 44 and 48 kDa.
|
|
 |
DISCUSSION |
Future characterization of the enriched binding activity we
observed between MOV-P nuclear extract and the
A/T-rich element will
provide information essential for the mechanistic understanding of the
adaptive responses that occur during skeletal muscle hypertrophy. Although phenotypic changes occurring during this process have been
extensively described biochemically, there remains a notable information void at the molecular genetic level. One major obstacle toward progress in this area derives from the lack of a myogenic cell
line that is capable of maintaining an adult-stage phenotype. In
addition, it is currently not possible to emulate in culture the input
from integrative systems imposed on a MOV muscle of an intact animal,
thus requiring these investigations to make use of transgenic models.
In this study, we have advanced the mechanistic understanding of MOV
changes in adult skeletal muscle phenotype by providing substantial
molecular evidence that the
A/T-rich element located within the
89-bp
MyHC MOV-responsive region functions as a putative MOV
element. This finding is important since the induction of
MyHC gene
expression is a common MOV response shared by adult-stage rodent
cardiac and skeletal muscle, and recently the
A/T-rich element was
shown to play a role in the transcriptional activation of rat
MyHC-reporter constructs following direct injection into
pressure-overloaded adult rat hearts (17). Therefore, when considering
our findings herein with those of others, it seems reasonable to
tentatively propose that MOV induction of the
MyHC gene in both
rodent cardiac and skeletal muscle is conferred in part by a common
element; i.e. the
A/T-rich site. The authenticity of the
A/T-rich element as an in vivo MOV-inducible element in
both striated muscle subtypes will require the analysis of
chromosomally integrated transgenes carrying wild type and mutant
A/T rich elements, a focus of our ongoing investigations.
GATA-4, SRF, Oct-1, and MEF2 Are Not Components of the Binding
Complex Formed at the
A/T-rich Element during MOV Induction of
MyHC Gene Expression in Adult-stage Skeletal Muscle--
An
extensive body of literature exists that provide persuasive evidence
suggesting that either GATA-4, SRF, Oct-1, or MEF2 may function
independently or in combination to regulate
MyHC induction in
response to MOV by binding to the
A/T-rich site. For example,
several current findings indicate that GATA element(s) and/or
protein(s) not only act as mediators of cardiovascular development (43,
44) but are also implicated in the regulation of other cellular
responses such as the hypertrophic response in adult rat hearts (17,
45). Nevertheless, our direct, competition, and supershift EMSA
experimental results (Figs. 5-8) provide comprehensive evidence that
the factor(s) binding the
A/T-rich element in response to mechanical
stimuli in skeletal muscle differ from that proposed (GATA-4) for
cardiac muscle (17). Our experiments revealed that in vitro
translated GATA-4 made in both wheat germ and rabbit reticulocyte
lysate did not bind the human
A/T-rich element, whereas it did bind
to probes harboring
-MyHC, cTnC, and BNP GATA sites in a
sequence-specific manner (Fig. 5, A-C). Furthermore, Northern analysis did not detect the expression of GATA-4 transcripts in control or MOV plantaris muscle, eliminating the possibility of load-induced GATA-4 expression in adult skeletal muscle (data not
shown). Moreover, the expression of GATA isoproteins as well as the
newly identified GATA cofactors, FOG and FOG2 (Friend of GATA), have
not been detected within adult-stage skeletal muscle (46-49).
This study also provides ample evidence that rules out other known
transcription factors that otherwise might have logically been assumed
to activate
MyHC induction during skeletal muscle hypertrophy based
on tissue distribution and the nucleotide composition of the
A/T-rich element. Specifically, even though SRF, Oct-1, and MEF2
have been shown to be required for striated muscle expression of a
number of contractile protein genes, our findings do not support a role
for these transcription factors in the MOV induction of
MyHC
expression in adult-stage skeletal muscle. Regardless of the high
degree of nucleotide homology shared between the
A/T-rich element
and consensus recognition binding sites for SRF, Oct-1, and MEF2 (Table
I), our EMSA analysis revealed that the enriched
A/T-rich·MOV-P
binding complex was neither effectively competed for by these elements
nor supershifted/depleted by SRF-, Oct-1-, or MEF2-specific antibodies
(Figs. 6-8). The finding that MEF2 was not a component of the highly
enriched MOV-P·
A/T-rich complex was surprising since it has
recently been hypothesized that the activation of a
Ca2+/calmodulin-dependent calcineurin signaling
pathway underlies slow-type I fiber-specific transcription in response
to a sustained increase in intracellular calcium induced by slow motor
nerve activity (50). Mechanistically, the transcriptional activation of
select slow-type I fiber-specific genes was shown to involve both MEF2
and NF-AT proteins (50). The potential applicability of this pathway to
MOV is derived from the fact that MOV of the adult plantaris
muscle results in a significant increase in the proportion of
histochemically identified slow-type I fibers. This later finding has
been confirmed by studies revealing an increase in the number of slow
motor units innervating the adult MOV plantaris muscle (Ref. 8, and
references within).
An interesting observation gleaned from the MEF2 EMSA experiments that
we feel merits discussion is the detection of an additional low
migrating binding complex (which was more prominent following longer
exposure) that was only visible when using MOV-P nuclear extract (Fig.
6B). In addition to having a lower mobility than the highly
enriched MOV-P·
A/T-rich binding complex (SC), this complex was not
altered by preimmune serum but was supershifted by MEF2A and general
MEF2 antibodies, indicating that MEF2A is a component of this minor
binding complex (Fig. 6B, top of gel above MEF2C
arrow, lanes 1-5). This notion was confirmed by
EMSA analysis which revealed that wheat germ lysate produced in
vitro translated MEF2A bound the
A/T-rich element and that this
binding complex was supershifted by MEF2A antibody and displayed a
migration pattern identical to the low mobility MOV-P·
A/T-rich
binding complex (data not shown). Additionally, in parallel EMSA
experiments using MOV-P nuclear extract, we found that MEF2A binds to
the MCK MEF2 element with much higher affinity in comparison with its
binding to the
A/T-rich element (data not shown). The significance of the minor MEF2A·
A/T-rich binding complex is not clear at
present, however, based on the low affinity binding of MEF2A to the
A/T-rich site, we speculate that it is unlikely to represent a
functionally relevant complex during MOV-induced
MyHC expression.
Importantly, while these experiments show that MEF2A within MOV-P
nuclear extract can bind to the
A/T-rich element with low affinity,
our current experiments demonstrate that two proteins (44 and 48 kDa)
found only in MOV-P nuclear extract comprise the highly enriched
A/T-rich·MOV-P binding complex and are not MEF2 proteins.
Although MEF2C, GATA-4, SRF, and Oct-1 have been shown to bind A/T-rich
sites within the control region of other muscle genes, and GATA-4 has
been associated with the cardiac hypertrophic response, our finding
that these factors are not a component of the enriched MOV-P·
A/T-rich binding complex in MOV adult skeletal muscle is not
surprising for a number of reasons. First, it has been shown that the
same A/T-rich element within the control region of a given gene can
bind multiple different factors, and that this binding may differ in
accordance to developmental-stage and/or cell type (20, 21, 36, 42,
51). Second, accumulating evidence has established that the nucleotides
flanking cis-elements, such as the MCAT, E-box, and MEF2, can exert a
profound effect on transcription factor binding specificity and
affinity (40, 52, 53). In this respect, the
A/T-rich element
examined in this study is a composite element comprised of overlapping
non-consensus GATA-like (83%, sense strand) and MEF2-like (80%,
antisense) homology containing core and flanking nucleotide sequences
that are divergent from sites previously shown to bind GATA or MEF2
factors (Table II, Refs. 54-59, and
references within table). Third, it has been well documented that
mechanical stretch of cultured striated muscle cells leads to the
activation of a deluge of intracellular signal pathways (15, 60, 61).
Thus, it is likely that the potent stimulus of MOV activates numerous
cell-signaling programs that alter transcription factor expression,
activity via post-translational modification, or cofactor(s)
availability and/or interaction. Last, the experimental paradigm
used herein differs from those typically employed by others in that it
utilizes adult-stage skeletal muscle that is undergoing a fast-to-slow
fiber-type remodeling induced by MOV. Therefore, it is not unreasonable
to suggest that transcription factor type and activity, as well as
chromatin structure and/or microenvironment within the nuclear milieu
of MOV skeletal muscle differs significantly from that within the
cell-types commonly studied.
View this table:
[in this window]
[in a new window]
|
Table II
Sequence comparison of A/T-rich motifs in muscle gene regulatory
regions
A/T-rich elements are delineated by underlining. The sense strand is
shown for the sequences unless otherwise indicated by AS, antisense.
|
|
Our experiments have shown that the
A/T-rich site is a putative MOV
element and that the enriched MOV-P binding activity at this site is
comprised of two distinct proteins that may be unique to the MOV
stimulus. Their i