|
J Biol Chem, Vol. 274, Issue 44, 31160-31168, October 29, 1999
Decay Accelerating Activity of Complement Receptor Type 1 (CD35)
TWO ACTIVE SITES ARE REQUIRED FOR DISSOCIATING C5
CONVERTASES*
Malgorzata
Krych-Goldberg ,
Richard E.
Hauhart ,
V. Bala
Subramanian ,
Basil M.
Yurcisin II ,
Daniel L.
Crimmins§,
Dennis
E.
Hourcade , and
John P.
Atkinson ¶
From the Division of Rheumatology, Department of
Medicine and the § Division of Laboratory Medicine,
Department of Pathology, Washington University School of Medicine,
St. Louis, Missouri 63110
 |
ABSTRACT |
The goal of this study was to identify the
site(s) in CR1 that mediate the dissociation of the C3 and C5
convertases. To that end, truncated derivatives of CR1 whose
extracellular part is composed of 30 tandem repeating modules, termed
complement control protein repeats (CCPs), were generated. Site 1 (CCPs
1-3) alone mediated the decay acceleration of the classical and
alternative pathway C3 convertases. Site 2 (CCPs 8-10 or the nearly
identical CCPs 15-17) had one-fifth the activity of site 1. In
contrast, for the C5 convertase, site 1 had only 0.5% of the decay
accelerating activity, while site 2 had no detectable activity.
Efficient C5 decay accelerating activity was detected in recombinants
that carried both site 1 and site 2. The activity was reduced if the intervening repeats between site 1 and site 2 were deleted. The results
indicate that, for the C5 convertases, decay accelerating activity is
mediated primarily by site 1. A properly spaced site 2 has an important
auxiliary role, which may involve its C3b binding capacity. Moreover,
using homologous substitution mutagenesis, residues important in site 1 for dissociating activity were identified. Based on these results, we
generated proteins one-fourth the size of CR1 but with enhanced decay
accelerating activity for the C3 convertases.
 |
INTRODUCTION |
Complement receptor type 1 (CR1,1 or CD35, immune
adherence or C3b/C4b receptor) is expressed by most peripheral blood
cells including erythrocytes (1-3). On phagocytic cells, CR1 mediates adherence and ingestion of C3b/C4b-coated particles (4-6), while on B
lymphocytes and follicular dendritic cells these activities promote
antigen localization and processing (7). In this regard, the immune
response, especially to T-dependent antigens, is impaired in mice lacking CR1 and complement receptor type 2 (CD21) (8-10). On
erythrocytes, CR1 binds C3b/C4b opsonized immune complexes (immune
adherence) (11) and processes and transports them to the liver
and spleen for clearance (12, 13). Microorganisms such as
Leishmania, Mycobacteria, and human
immunodeficiency virus become coated with C3b and use CR1 to enter host
cells (14, 15).
Recently, CR1 was shown to be the receptor involved in rosette
formation between malaria-infected and -uninfected erythrocytes (a
phenomenon that correlates with cerebral malaria and a high mortality)
(16). This interaction involves CR1 on the uninfected cells and varies
with expression of CR1-related blood group antigens.
The complement cascade requires stringent control. The C3 and C5
convertases are inhibited by proteins encoded by the regulators of
complement activation (RCA) gene family (17). Factor H and C4b binding
protein are fluid phase regulators present in plasma, whereas membrane
cofactor protein (CD46) and decay accelerating factor (DAF; CD55) are
ubiquitously expressed membrane inhibitors. RCA proteins accelerate the
dissociation of C3 and C5 convertases (decay accelerating activity
(DAA)) and/or serve as cofactors for the factor I-mediated cleavage of
C3b and C4b (cofactor activity (CA)). CR1 is the most versatile member
of this group. It possesses DAA and CA and inhibits C3 and C5
convertases of both the classical and alternative pathways (CP and AP,
respectively). Moreover, it is unique among the cofactor proteins in
that through its cofactor activity it generates C3d, which serves as a
ligand for complement receptor type 2. A recombinant, soluble form of
CR1 (sCR1) inhibits self-destructive C activation in immune
complex-mediated syndromes, ischemia/reperfusion injury (18), and
hyperacute xenograft rejection (19). It is presently in clinical trials
as a complement inhibitor (20).
Like all members of the RCA family, CR1 is composed of the ~60-amino
acid-long repeating units called complement control protein repeats
(CCPs) or short consensus repeats. Of the 30 CCPs in CR1, the first 28 can be organized, based on internal homology, into four long homologous
repeats (LHRs), A-D, each composed of seven CCPs (21, 22). Analyses of
CR1 derivatives carrying a single LHR established that the LHRs A, B,
and C contain C3b/C4b binding sites (23, 24). LHR B and its structural
and functional duplicate LHR C bind C3b and C4b and possess CA for
their cleavage (25-27). LHR A binds C4b with a similar affinity as LHR
B or C but binds C3b weakly and has barely detectable CA (27).
The initial three CCPs of LHRs A, B, and C form a functional unit,
called site 1 in LHR A and site 2 in LHR B or C (21, 27). The amino
acid sequences of CCPs 1 and 2 are 39% different from their
counterparts in site 2 (CCPs 8 and 9 or CCPs 15 and 16). On the other
hand, the amino acid sequences of the third CCP in each site (CCPs 3, 10, and 17) are nearly identical. Consequently, variation in the
initial two CCPs determines the functional differences between the
sites. Using homologous substitution mutagenesis, amino acids important
for ligand binding and for CA in site 1 and in site 2 were identified
(24, 27, 28). In this investigation, our goal was to localize site(s)
for DAA and to identify peptides and amino acids critical for this
regulatory activity.
 |
EXPERIMENTAL PROCEDURES |
General Design
All constructs were expressed as secreted proteins and
quantified by enzyme-linked immunosorbent assay (27). They were then assessed for iC3/C4b binding ability and for DAA.
Construction of CR1 Derivatives
Polymerase chain reaction (PCR) products were subcloned in
vector pCRTMII (Invitrogen, Carlsbad, CA), sequenced, and cut with the
appropriate enzyme for cloning in the expression vector to generate the
constructs shown in Fig. 1. Amino acid substitutions were made by
site-directed mutagenesis (QuikChangeTM, Stratagene, La Jolla, CA) in
the expression vector pSG5 (Stratagene) without subcloning.
Specific Constructs
LHR A contains CCPs 1-7 (i.e. amino acids 1-449
(27)). CCP 1-3 contains amino acids 1-194 (28). CCP 1 and CCP
2, lacking amino acids 1-60 and 61-122, respectively, were made from
LHR A (24). CCP 3, lacking amino acids 123-194, was produced from LHR A by oligonucleotide-directed mutagenesis using the Double TakeTM
mutagenesis kit (Stratagene).
LHR B--
CR1-4(8,9), described earlier (27), was derived from
CR1-4 (CCP 1-8 and one-half of CCP 9) by changing amino acids of CCPs 1 and 2 to those of CCPs 8 and 9, respectively. LHR B was then generated by converting CCP 3 to CCP 10 (mutation T132A) and by replacing Gly450 (the fourth position downstream of the
last Cys in CCP 7) with a stop codon (28). Since CCPs 4-7 are
identical to CCPs 11-14, the protein encoded by this cDNA is
identical to CCPs 8-14 (i.e. LHR B (residues
451-899)).
LHR C and LHR D+--
The construction of LHR C,
which contains CCPs 15-21, (i.e. amino acids 898-1353) has
been described (28). LHR D+ (amino acids 1348-1928)
contains LHR D (CCPs 22-28) followed by CCPs 29 and 30. CR1 cDNA
in AprM8 obtained from Lloyd Klickstein (Harvard Medical School,
Boston, MA) served as a template for PCR amplification of the signal
peptide and of LHR D+. The 5'-primer for
amplification of the signal peptide,
ATATACAGATCTATGGGAGCCTCTTCTCCAAGA, contains a
BglII site (underlined) for cloning into pSG5. The 3'-primer,
CGGATCCCCATGCAACAGGCAGTGCAAGCAGCACCACAACTGCTAGCAGA, destroys an internal BamHI site by a silent mutation and
generates the terminal BamHI site (underlined) by another
silent mutation for ligation to LHR D+. Six more silent
mutations interrupt GC-rich stretches. The 5'-primer for the
amplification of LHR D+,
ACATAGGATCCGTTCGTGCTGGTC, incorporates codons for six out
of eight amino acids between the last Cys of CCP 21 and the first Cys
of CCP 22. The BamHI site (underlined) was created by a
silent mutation for ligation to the signal peptide. The 3'-primer for amplification of LHR D+,
TATATAAGATCTTTATGCACGAGAGGTACATTT, replaces
His1929 (the fifth position downstream of the last Cys in
CCP 30) with a stop codon followed by a BglII site
(underlined) for cloning into pSG5. Each PCR product was cut from
pCRTMII vector with BamHI and BglII. The signal
peptide and LHR D+ were then ligated through the
BamHI site, and the ligation product was cloned into the
BglII site of pSG5. The sequence of LHR D+
contained an ATT coding for Ile1835 instead of the reported
ACT coding for Thr1835 (21). ATT was present in the PCR
product and in the original template.
LHR AC (CCP 1-7 followed by CCP 15-21; i.e. amino acids 1-449
followed by amino acids 899-1353) and LHR BC (CCP 8-21; i.e. amino
acids 451-1353)--
LHR A in CR1-4 and LHR B in CR1-4(8,9) are
followed by CCP 8 (identical to CCP 15) and the first half of CCP 9 (identical to the homologous part of CCP 16). The latter contains a
unique PflMI site. CR1-4 and CR1-4(8,9) were linearized at
this site to generate the amino-terminal portion of LHR AC and LHR BC,
respectively, extending to the PflMI site in CCP 16. The
remaining part of LHR C, namely to the end of CCP 21, was amplified
using CR1 cDNA as a template. The 5'-primer,
GATCCAGTGAATGGCATGG, includes a PflMI site
(underlined) in CCP 16. The 3'-primer,
CCATTCACTGGTTAACCAGCACGAACAGAAAGTTC, replaces
Gly1353 (the seventh position downstream of the last Cys of
CCP 21) with a stop codon followed by a PflMI site
(underlined). The PCR product, cut from pCRTMII with
PflMI, was ligated to PflMI-linearized CR1-4 and
to CR1-4(8,9), generating LHR AC and LHR BC, respectively.
CCP 1-4,15-18 (amino acids 1-254 followed by amino acids
899-1153)--
CR1-4 was used as a template for the PCR amplification
of CCPs 1-4. The 5'-primer, ATATAGATCTCAGGTCATTGTTCCA,
contains a BglII site (underlined) for cloning into pSG5.
The 3'-primer, ATATATCCTAGGCGTGAGCAGCTTGGTAG, anneals to
the end of CCP 4 and includes amino acids 253 and 254 after the last
Cys of CCP 4. The AvrII site (underlined), generated by two
silent mutations, facilitated ligation to CCP 15. LHR C served as a
template for the PCR amplification of CCP 15-18. The 5'-primer,
CGCTGTGGAATCCTAGGTCACTGTCAAGCCCCA, includes amino acids 899-901 preceding the first Cys of CCP 15. The AvrII site
(underlined) was created by two silent mutations for ligation to CCP 4. The 3'-primer, CTAGTCGTAAGATCTTTACCTGGAGCAGCTTGG, replaces
Val1155 (the third position after the last Cys in CCP 18)
with a stop codon and contains a BglII site (underlined).
The two PCR products were cut from pCRTMII with BglII and
AvrII. CCP 15-18 was then ligated to CCP 1-4 through the
AvrII site, generating a cDNA for the construct CCP
1-4,15-18.
CCP 1-4,15-21 (amino acids 1-254 followed by amino acids 899-1353)
was constructed by deleting CCP 5-7 from LHR AC. This was accomplished
by replacing the sequence between the two HindIII sites in
LHR AC, one in CCP 4 and the other in CCP 18, with the sequence present
between the same HindIII sites in CCP 1-4,15-18.
Substitution Mutants in CCPs 1 and 2--
The strategy for
homologous substitution mutagenesis in CCPs 1 and 2 has been described
(28) and is summarized in Fig. 4. The new mutants, 13a-d, 9a, 9b, 6c,
and 10a11c, are derived from LHR A and are in the expression vector
pSG5. The other mutants represented in Fig. 4 have been described (24,
27, 28).
Preparation of C3b Dimers
C3 was purified from plasma by anion exchange chromatography
(29). To generate C3b dimers, C3 (2 mg) in 200 µl of
phosphate-buffered saline at pH 7 was treated with 20 µg of trypsin
(Sigma) for 3 min at 37 °C. The reaction was stopped with 200 µg
of soybean trypsin inhibitor (Sigma). Cross-linking through the free
sulfhydryl group generated by breaking the thioester bond was then
performed for 3 days at 4 °C using 15 µl of 0.34 mM
bismaleimidohexane (Pierce) dissolved in methanol. With this procedure,
the yield was over 50%. If, however, as recommended by the
manufacturer, bismaleimidohexane was dissolved in Me2SO,
the yield of C3b dimers did not exceed 10%. The dimers were purified
by size exclusion high performance liquid chromatography using a TSK
4000SW column (TosoHaas, Montgomeryville, PA). The dimers were 95%
pure based on a Coomassie Blue-stained gel.
Expression of CR1 Derivatives in COS 7 Cells
Plasmids containing cDNAs encoding CR1 derivatives were
transfected into COS 7 cells using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's instructions. One day after transfection, the cells were washed and incubated in Opti-MEM I medium
in the absence of serum to avoid possible DAA from the C4b binding
protein and factor H in bovine serum. After a 2- or 3-day incubation,
supernatants were collected, aliquoted, and stored at 70 °C.
Protein levels were estimated by enzyme-linked immunosorbent assay (27)
using two monoclonal anti-CR1 antibodies, 3D9 (4) and E11 (30). Because
proteins CCP 1-3 and CCP 1-4,15-18 are not recognized by E11, a
polyclonal antibody (25) was used for their quantification.
Ligand Binding
iC3 and C4b binding experiments were performed as described (27,
28), but the data are presented differently to be consistent with the
decay accelerating results. Instead of reporting the fraction of a CR1
derivative that bound to iC3- or C4b-Sepharose, binding of the mutant
proteins was expressed relative to the parental protein LHR A. A 100%
value was assigned to the fraction of LHR A that bound to C4b- or
iC3-Sepharose.
Assays for Decay Accelerating Activity
Alternative pathway factors B, D, and P; classical complement
pathway components C1, C2, C4, and C3; terminal components C5-C9; and
antibody-sensitized sheep erythrocytes (EA) were obtained from Advanced
Research Technologies (San Diego, CA).
Hemolytic Assay for the Classical Pathway DAA
The assay was performed in isotonic veronal-buffered saline
containing 2.5 mM veronal (pH 7.35), 71 mM
NaCl, 139 mM dextrose, 0.15 mM
CaCl2, 1 mM MgCl2, and 0.1%
gelatin (DGVB2+) (31). Three ml of washed EA (2.5 × 108/ml) were incubated with C1 (6 µg diluted in 3 ml) at
30 °C for 15 min. After centrifugation, cells were resuspended in 3 ml of DGVB2+, and 10 µg of C4 in 1.5 ml of buffer was
added. After a 15-min incubation at 30 °C, the cells were
centrifuged and resuspended to 3 ml. One ml of these EAC14 cells was
incubated with 0.5 µg of C2 diluted in 1 ml for 4 min at room
temperature. To prepare the C5 convertase, EAC14 cells were incubated
with 0.5 µg of C2 and with 10 µg of C3 at room temperature for 4 min. The resulting EAC142 or EAC1423 cells were centrifuged, washed,
resuspended in 1 ml, and used to assess DAA for the C3 convertase or
the C5 convertase, respectively. Specifically, EAC142 cells (50 µl)
were incubated for 10 min at 30 °C with 50 µl of an inhibitor or
with buffer and transferred to ice, and then 0.5 ml of C'-EDTA (a
20-fold dilution of guinea pig serum (Colorado Serum, Denver, CO) in 40 mM EDTA containing veronal buffered saline) was added. In
the modified assay, C'-EDTA was replaced with 0.5 ml of buffer
containing 500 ng of each terminal component (C5-C9), with or without
C3. After a 30-min incubation at 37 °C and centrifugation, the OD of
the supernatant was read at 414 nm.
Hemolytic Assay for the Alternative Pathway DAA
The convertase was assembled using purified components (32).
EAC14 cells (0.5 ml), prepared as above but at a concentration of
1.5 × 109/ml, were incubated with 0.225 µg of C2
and 50 µg of C3 for 30 min at 30 °C. After washing and
resuspending in veronal-buffered saline containing 128 mM
NaCl, 4.5 mM veronal (pH 7.35), 0.1% gelatin, and 10 mM Na2-EDTA, cells were incubated for 2 h
at 37 °C to allow dissociation of C1 and C2. The resulting EAC43
cells were washed twice with the above buffer; washed twice with buffer (Mg2+-EGTA) containing 10 mM
Na2-EGTA, 7 mM MgCl2, 115 mM dextrose, 0.83% gelatin, 59 mM NaCl, and
4.2 mM veronal (pH 7.35); and then resuspended in 6 ml of
the same buffer.
EAC43 cells (100 µl) were incubated for 30 min at 30 °C with 5 ng
of factor D, 45 ng of properdin, 1.5 ng of factor B, and 75 µl of
inhibitor or Mg2+-EGTA. After adding 0.3 ml of C'-EDTA,
hemolysis was estimated as for the classical pathway. In the modified
assay, C'-EDTA was replaced with 300 µl of buffer containing 300 ng
of each terminal component (C5-C9) with or without C3.
Microtiter Plate Assay for the Alternative Pathway DAA
For the C3 convertase decay accelerating assay (33), microtiter
plates were coated overnight with 5 µg/ml C3b (Advanced Research
Technologies) in phosphate-buffered saline. Plates were blocked for
2 h at 37 °C with phosphate-buffered saline containing 1%
bovine serum albumin and 0.1% Tween 20. Plates were then incubated for
15 min at 37 °C with 10 ng of factor B, 1 ng of factor D, and 0.8 mM NiCl2 in 2.5 mM veronal buffer,
pH 7.4, containing 71 mM NaCl and 0.05% Tween 20. Using
this same buffer, sequential 1-h incubations were performed with 1-10
ng of a CR1 derivative, 0.129 µg of goat anti-human factor B antibody
(Incstar, Stillwater, MN), and 100 µl of a 1:15,000 dilution of
anti-goat antibody conjugated to horseradish peroxidase (Jackson
Immunoresearch Laboratories, West Grove, PA). Color was developed with
O-phenylenediamine. In this assay, DAF and factor H behave
as expected as mediators of decay accelerating activity (see Ref. 33),
and we have detected C3a release using the Amersham Pharmacia Biotech
C3a des-Arg RIA kit.2
For the C5 convertase assay, microtiter wells were coated (as above)
with C3b dimers at 5 µg/ml. The assay was performed under conditions
similar to those used for the C3 convertase except that the amounts of
factor B and D were 20 and 2 ng, respectively.
 |
RESULTS |
Characterization of the structural requirements for DAA proceeded
in three steps: first, identification of the required LHR(s); second,
localization of the necessary CCPs within an LHR; and, third,
determination of critical peptides and individual amino acids within
CCPs. DAA was analyzed for the CP and AP C3 and C5 convertases, and the
activity of the constructs (illustrated in Fig.
1) was compared.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of the structural
and functional domains of CR1 and its derivatives. The
extramembranous part of CR1 (sCR1) is composed of 30 CCPs, which are
shown as boxes. Based on the degree of identity, the first
28 CCPs form LHRs A, B, C, and D, which arose through duplication of a
seven-CCPs unit. There are two distinct functional sites, each composed
of three CCPs. Site 1 was localized to LHR A, and two nearly identical
copies of site 2 were localized to LHRs B and C (23-28). The first two
CCPs in site 1 (CCPs 1 and 2) are 39% different from the first two
CCPs in site 2 (CCPs 8 and 9) as well as from CCPs 15 and 16, and they
are marked by different shading. The third CCP in site 1 is
nearly identical to the third CCP (10 or 17) in site 2. CCPs 3, 10, and
17 are represented by boxes with horizontal
lines. In addition to LHR D, LHR D+ includes
CCPs 29 and 30.
|
|
LHRs Required for DAA--
A hemolytic assay was employed in which
the CP C3 convertase was formed using purified components, and the
lytic sites were developed with C'-EDTA. The main site of DAA for the
CP C3 convertase was in LHR A (Table I),
which had 60% of the activity of sCR1. LHR B or C had approximately
the activity of sCR1. LHR D+ lacked detectable
DAA.
View this table:
[in this window]
[in a new window]
|
Table I
Decay accelerating activity for the classical pathway C3
convertase
A hemolytic assay was employed. Cellular intermediates were prepared
using purified C1, C4, and C2, and lytic sites were developed with
C'-EDTA.
|
|
In contrast, if DAA for the AP was assessed by a similar hemolytic
assay, LHR A had only 0.5% of the activity of sCR1 (Table II), while LHRs B, C, and D+
had no detectable activity (even if the molar concentration of these
proteins was 100-fold higher than sCR1). Mixing LHR A with LHR B or
D+ did not result in activity above that of LHR A alone.
These results were surprising because it was expected that, as for the
CP C3 convertase, a single LHR would be capable of dissociating the AP
C3 convertase. To further assess this issue, constructs bearing more
than one LHR were evaluated (Table III).
While LHR BC had barely detectable activity, LHR AC had DAA equal to
50% of the DAA of sCR1.
View this table:
[in this window]
[in a new window]
|
Table II
Decay accelerating activity for the alternative pathway convertase in a
hemolytic assay
Cellular intermediates were prepared using purified components and
lytic sites developed with C'-EDTA.
|
|
View this table:
[in this window]
[in a new window]
|
Table III
LHR AC is required for decay accelerating activity for the alternative
pathway convertase in a hemolytic assay
|
|
These data suggested that LHR A was sufficient for DAA of the CP C3
convertase, while LHR AC was required for the AP C3 convertase. Because
the two C3 convertases are so similar and because it was difficult to
reconcile results for the AP with those for the CP, a second assay for
the AP C3 convertase was employed in which the convertase was assembled
on a microtiter plate using purified components. In this assay, LHR A
had DAA equivalent to that of sCR1, whereas LHR B or C had 12 and 14%,
respectively (Table IV). These results,
consistent with the data obtained in the CP C3 convertase assay,
indicate that LHR A contains the major site for CP and AP DAA.
View this table:
[in this window]
[in a new window]
|
Table IV
Decay aaccelerating activity of single LHR constructs for the
alternative pathway C3 convertase in a microtiter assay
C3 convertase was formed by adding purified components B and D to C3b
bound to a microtiter plate.
|
|
To account for the requirement that LHR A be linked to LHR C for
efficient decay of the AP convertase on EA, we hypothesized that during
the convertase assembly step both the C3 convertase (C3bBb) and the C5
convertase ((C3b)2Bb) had been generated. This might occur
if C3b dimers were produced by the classical pathway C3 convertase
employed to deposit C3b. If so, LHR A would be sufficient for DAA for
the C3 convertase, whereas LHR AC might be necessary for efficient
dissociation of the C5 convertase. To test this possibility, the
hemolytic assay was modified such that instead of developing lytic
sites with C'-EDTA, they were developed using purified C5-C9, with or
without the addition of C3. The rationale was that, if a C5 convertase
were generated during the initial steps of the assay, hemolysis would
be independent of additional C3. 60% of erythrocytes were lysed with
the addition of C5-C9, and 80% were lysed if C3 was also added. The
60 ± 7% value is similar to the 56 ± 8% lysis if C'-EDTA
was used to develop lytic sites. Because hemolysis was largely
independent of the added C3, we concluded that the AP C5 convertase had
been generated on erythrocytes, probably as a result of C3b dimer
formation (34).
To further address the question, microtiter wells were precoated with
purified C3b dimers and incubated with Ni2+ and factors B
and D. The resulting complexes, (C3b)2BbNi2+,
were treated with LHR A or with LHR AC. LHR AC was 10 times more
effective than LHR A in dissociating the C5 convertase (Fig. 2). This finding was consistent with the
results obtained in the hemolytic assay (Table III) in which a C5
convertase was also present.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
LHR AC is more efficient than LHR A in
decaying the alternative pathway C5 convertase in the microtiter assay
system.
|
|
We next asked if LHR AC is required for efficient DAA of the CP C5
convertase as well. An assay was employed in which a C5 convertase was
formed on EA and lytic sites developed by the addition of purified
C5-C9. DAA of the C5 convertase by LHR AC was similar to that of sCR1,
while LHR A was approximately 200-fold less effective (Table
V). As in the case of the AP C5
convertase, LHR BC had little DAA for the CP C5 convertase (Table V).
These results establish that optimal DAA of C5 convertases requires two
functional sites.
View this table:
[in this window]
[in a new window]
|
Table V
LHR AC with appropriate spacing between site 1 and site 2 is required
for the optimal decay accelerating activity for the classical pathway
C5 convertase
|
|
Identification of CCPs Required for DAA--
To determine which
CCPs within LHR A are responsible for DAA of the CP and AP C3
convertases, truncated LHR A derivatives, containing a full or partial
site 1, were analyzed (Table VI). DAA of
CCP 1-3 (site 1) was comparable with that of LHR A or CCP 1-4,
indicating that CCPs 4-7 do not contribute to this regulatory function. We next constructed LHR A derivatives deleted of CCP 1, 2, or
3 (Table VI). DAA was substantially reduced, indicating that each CCP
is necessary for DAA as they are for ligand binding (24, 28).
Since LHR A linked to LHR C was required for DAA for the C5
convertases, we asked if CCPs 5-7, located between the two active sites, play a role. The construct CCP 1-4,15-18, lacking CCPs 5-7,
had 7- and 10-fold lower activity for the CP and AP, respectively, than
did LHR AC but much higher activity than LHR A (Fig.
3, Table V). Construct CCP 1-4,15-21
was very similar to CCP 1-4,15-18 (not shown). Because CCPs 5-7,
located between the active sites, possess no activity on their own, a
requirement for proper spacing between sites 1 and 2 in the decay
acceleration of C5 convertases is strongly suggested.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
LHR AC is required for efficient decay of the
C5 convertases in the hemolytic assays. A, classical
pathway; B, alternative pathway.
|
|
Identification of Peptides and Amino Acids Important for
DAA--
Modified forms of LHR A, carrying amino acid substitutions in
CCPs 1 and 2 derived from the homologous positions of CCPs 8 and 9, respectively (Fig. 4), were assessed for
DAA for C3 convertases. For these experiments, a hemolytic assay for
the CP and a microtiter assay for the AP were employed. All mutants
shown in Fig. 4 were tested, but only mutations that produced a ±20%
change are listed in Table VII. The
effects of the mutations on DAA and on ligand binding (Refs. 24 and 28;
present report) defined the three groups.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Mutations produced in CCPs 1 and 2 of LHR
A. The amino acids in CCP 1 are aligned with those in CCP 8, and
amino acids in CCP 2 are aligned with those in CCP 9. For CCPs 8 and 9, only amino acids different from those in CCPs 1 and 2 are shown. The
four invariant cysteines in each CCP are boxed. Multiple
amino acid substitutions are identified by the numbers
above the brackets. The lowercase
letters below the alignment mark
individual substitutions within the bracketed sequence. Single amino
acid substitutions published earlier are in roman
type, while those reported for the first time here, 13a-d,
9a and 9b, and 6c, are indicated by the italicized
letters below the alignment. Mutant 6 does not include the substitution F82V, so this mutation is marked
separately as 6c. C4b above the
alignment refers to the amino acids in site 1 necessary for
the interaction with C4b. C3b/C4b below the
alignment indicates the amino acids in site 2 that, if
transferred to site 1, increase its interaction with the ligands. The
subscript numbers that precede the first residue
and follow the last residue in a CCP indicate the amino acid number in
the mature protein. Data are modified from Ref. 28.
|
|
View this table:
[in this window]
[in a new window]
|
Table VII
Effect of amino acid substitutions in site 1 on decay accelerating
activity for C3 convertases
DAA for the CP was tested in a hemolytic assay and for the AP in a
microtiter assay. Binding was defined as unchanged if the difference
relative to LHR A was less than 20%. All binding data for 9a and 9b,
13a and 13b, and 6c are reported here for the first time as are iC3
binding data for 1a, 1b, 5a, 5b, 8a, and 8b. Binding results for the
other proteins were reported in Refs. 24 and 28. Compared with LHR A,
sCR1 has 170 ± 16% of the DAA for the CP C3 convertase and
105 ± 12% of the DAA for the AP C3 convertase.
|
|
Group I represents substitutions, which decrease DAA for one or both
convertases but have no effect on ligand binding. Hence, these
mutations identify residues likely to be specifically required for DAA.
In this group, the most marked effect was caused by F82V, which nearly
abrogated DAA for both C3 convertases. To a lesser extent, mutations
T103E, T110A, and V111A also reduced DAA for both C3 convertases. Other
mutations reduced DAA for one pathway only. For example, W7H almost
abrogated DAA for the AP, while mutations K92T and S99H reduced DAA for
the CP.
Groups II and III are mutations that caused parallel changes in DAA and
in ligand binding. Group II mutations produced a decrease in
DAA and binding. For example, mutant G35E had reduced C4b and C3b
binding and DAA for the AP and CP C3 convertases. Two substitutions, R64K and Y94H, produced a reduction in C4b binding and DAA for the CP
C3 convertase. N65T reduced C3b binding and DAA for the AP C3
convertase only.
Group III mutations increased ligand binding and DAA. Mutant
D109N had enhanced DAA for the C3 convertases and ligand binding (Table
VII). This mutant and the double mutant D109N,E116K are of special
interest because of the marked enhancement in DAA, which is further
illustrated in the kinetic analysis shown in Fig.
5. Two other mutations, E6D and N29K,
increased DAA for the CP C3 convertase, while mutation S37Y increased
DAA for the AP convertase. In addition, mutant 14, with nine amino acid
substitutions, showed increased DAA for the AP. No single mutation was
responsible for this effect.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
Increased DAA of mutants D109N (10a) and
D109N,E116K (10a11c) for the classical pathway C3
convertase.
|
|
 |
DISCUSSION |
DAA for C3 Convertases--
LHR A was identified as the main site
of DAA for the CP and AP C3 convertases (Refs. 35 and 36; this report).
Within LHR A, CCPs 1-3 account for all DAA, being equivalent to CCPs
1-4 or LHR A itself. If CCP 1, 2, or 3 was deleted from LHR A, DAA was
markedly reduced. Thus, CCPs 1-3 (site 1) are necessary and sufficient
for the dissociating activity. That site 1 was the major region for DAA
for both convertases was unexpected because C3b binding by CCPs 1-3 is
very low. However, this seemingly paradoxical observation is consistent
with the functional profile of DAF, which has a low affinity for C3b or
C4b but efficiently dissociates both C3 convertases (37). Transient
interaction of an inhibitor with a convertase appears sufficient and
probably optimal for deactivation. Like DAF, site 1 of CR1 may have a
higher affinity for the convertases than for C3b or C4b alone (37).
Previously, we found that most of the cofactor activity for C3b and C4b
resides in site 2, which is located in CCPs 8-10 and duplicated in the nearly identical CCPs 15-17 (27). Here we show that this site has
inefficient DAA in its own right. Therefore, site 1 is DAF-like, whereas site 2 is membrane cofactor protein-like.
While the major site of DAA for the C3 convertases is in LHR A, several
lines of evidence indicate a contribution from site 2. First, LHRs B
and C have detectable DAA. Second, compared with sCR1, LHR A has 60%
of DAA for the CP C3 convertase, while LHR AC has 100%. These results
suggest that site 2 participates in regulating the CP C3 convertase.
Regarding the AP C3 convertase, in the microtiter assay system, site 1 accounts for all of the DAA detected with sCR1. In the hemolytic assay,
the contribution of site 2 to the decay of the C3 convertase could not
be evaluated because of the simultaneous presence of the C5 convertase
(see below).
DAA for C5 Convertases--
In contrast to the C3 convertases,
optimal DAA for the C5 convertases requires both site 1 and site 2. LHR
B or C, single or linked together as in LHR BC, lacked DAA for the C5
convertases. If LHR A is mixed with LHR B, DAA is not augmented above
the level observed with LHR A alone. However, if the two sites are in a single protein as in LHR AC, efficient DAA results.
CCPs 5-7, which are not required for ligand binding and are not
formally part of a functional site, are necessary for full CP and AP
convertase DAA. This suggests that a function of CCPs 5-7 is to serve
as a spacer; i.e. this arrangement of active sites may
optimize an interaction with C4bC3b heterodimers and C3bC3b homodimers.
These studies therefore provide an explanation for the seven-CCP-long
unit, which is repeated four times in CR1. In addition to facilitating
the decay of the C5 convertases, binding to dimers and other
multiplicatives of ligands is probably optimized by this arrangement.
Indeed, efficiency of C3b dimer binding by the four polymorphic size
variants of CR1 is enhanced as the copy number of site 2 increases from
one to three (38). A cooperative interaction between the two functional
sites of CR1 was suggested previously based on greater cofactor
activity for C4b if C3b was adjacent (39).
The different requirements for decay of the CP C3 versus the
CP C5 convertase were readily demonstrable. In contrast, the interpretation of results for the AP convertases was initially complicated by the simultaneous presence of both C3 and C5 convertases in a hemolytic assay designed to assess decay of the C3 convertase. The
presence of the AP C5 convertase in this system was conclusively shown
by developing the lytic sites with purified C5-C9 rather than with
C'-EDTA. Because lysis occurred without the addition of C3, C5
convertases must have been present. Thus, besides monomers, C3b dimers
were deposited in this assay system, and the subsequent addition of
factors B, D, and P resulted in the formation of the AP C5 convertase.
That AP C5 convertase can be generated without an intermediate stage of
the C3 convertase has been reported (34). The requirement for two sites
for optimal DAA for the AP C5 convertase was supported by the second
assay system, in which microtiter wells were coated with C3b dimers and
factor B and D were added to produce a C5 convertase. Consistent with
results of the hemolytic assay, LHR AC had greater DAA than LHR A.
DAA of site 1 for the C5 convertases is much reduced compared with LHR
AC or sCR1. On the other hand, LHR B or C carrying site 2 possesses no
DAA for the C5 convertases. These results indicate that site 1 is the
primary site for DAA, whereas the role of site 2 is probably to bind to
the third subunit, C3b, of the C5 convertases. Experiments with the
construct LHR AA, composed of two tandem copies of LHR A, support this
concept, since its DAA for AP and CP C5 convertases is similar to LHR
A.3 Binding to C3b could
destabilize the C5 convertase complex directly or facilitate the
interaction between the dissociating site of LHR A and its convertase
target. We are currently examining the relation between the strength of
C3b binding by the carboxyl-terminal LHR and the efficiency of
decay of the C5 convertases.
For optimal DAA of C5 convertases, two sites in CR1 and intervening
CCPs are required. More than one site may also be required for full DAA
in factor H. This is based on the observation that DAA of a factor
H-like protein, composed of the initial seven CCPs, is about 100 times
lower compared with full-length factor H, with its 20 CCPs and two
additional C3b binding sites (40). However, DAF, with only four CCPs,
has DAA for the C5 convertases equivalent to CR1.3 One
interpretation of these findings is that there is a difference in the
mechanism for deactivation of convertases between DAF and CR1.
Alternatively, dimers of DAF may be necessary for C5 convertase decay.
A biologically active form of DAF with a molecular weight approximately
twice that of DAF was described by Kinoshita et al. (41).
Although it constitutes less than 10% of DAF on human erythrocytes, it
exceeds 50% on orangutan erythrocytes (42), where it was shown to be a
nondisulfide covalently linked homodimer (43). Also, many more C3 than
C5 convertases are formed during complement activation, so only a small
percentage of DAF may need to be dimerized.
Identification of Amino Acids Important for DAA for the C3
Convertases--
Several amino acids including Phe82,
Trp7, Ile112, Lys92, and
Ser99 are specifically required for DAA (Ref. 44; this
report). Their substitution reduced DAA for one or both C3
convertase(s) without altering ligand binding. The Phe82
substitution almost abrogated DAA for both AP and CP C3 convertases. Therefore, Phe82, which is not a conserved amino acid in a
CCP, is a critical residue for DAA for both convertases. The
Trp7 and Ile112 substitutions affected DAA for
the AP, while Ser99 and Lys92 substitutions led
to a reduction of DAA for the CP C3 convertase. These results indicate
distinct structural requirements for regulatory activity
versus ligand binding and for dissociation of the CP versus the AP.
The effects of several other mutations indicate that DAA is also a
function of ligand binding. For example, substitution of Gly35 caused a parallel reduction in DAA for both C3
convertases and for C3b and C4b binding. If Arg64 or
Tyr94 were altered, C4b binding was reduced, as was DAA for
the CP C3 convertase. Additional evidence that ligand binding is
important for DAA comes from the mutant D109N, in which increased C3b
and C4b binding is associated with enhanced DAA for both C3
convertases. Another example is mutant 14 with increased C3b binding
and DAA for the AP C3 convertase.
In a previous report (27), the peptide sequence in site 2 homologous to
regions 10 and 11 in site 1 was shown to be critical for ligand binding
and cofactor activity. Here we demonstrate that peptides 10 and 11 are
important for the DAA of site 1. Reduced DAA was observed after
replacement of Thr110 and Val111.
The importance of the region 10 and 11 is further underscored by the
increase in DAA for C3 convertases, above the level of sCR1, as a
result of the substitution of one amino acid, D109N, or two amino
acids, D109N and E116K. In addition to increased DAA, these proteins
have increased C3b and C4b binding and cofactor activity (28). They are
candidates for a new generation of complement inhibitors because 1)
their DAA for C3 convertases not only exceeds DAA of their parental
protein LHR A but also that of sCR1, 2) they are one-fourth the size of
sCR1, and 3) they can be further truncated to include only CCPs 1-3.
The potential also exists for improving the efficiency of DAA for the
C5 convertases by modification of LHR A in LHR AC. Last, as previously
suggested (24) and further emphasized by these data, homologous
peptides in regions 10 and 11 are likely to be functionally important
in DAF, membrane cofactor protein, C4b binding protein, and factor H.
Some of the amino acids important for DAA in site 1 are present in the
homologous positions of the active site (CCPs 2-4) of DAF (45) (Fig.
6). One example is Phe82,
whose counterpart in DAF, Phe148, is especially noteworthy
because its substitution, along with the preceding Leu147,
caused a substantial decrease in DAA by DAF for convertases of both
pathways (46). These residues were predicted to be involved in DAA of
DAF, based on a computer model in which they are a part of the groove
between CCP 2 and 3 (47). Other residues important for DAA in site 1, Gly35, Asn65, Tyr94,
Ser99, and Val111, are also found in the
homologous positions of the active site of DAF, and one other,
Thr110, is replaced with a conservative Ser. The prediction
is that these amino acids are also essential for the function of DAF, serving as convertase contact points or as essential structural elements.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 6.
Amino acids important for DAA in CR1 and
conserved in DAF. Alignment of the amino acids of CCP 1 of CR1
with those of CCP 2 of DAF and of the amino acids of CCP 2 of CR1 with
those of CCP 3 of DAF. The numbered amino
acids represent residues in site 1 of CR1 important for DAA
that are identical or conserved in the active site of DAF but not in
site 2 of CR1.
|
|
In conclusion, DAA for the CP and AP C3 convertases is mediated
primarily by CCPs 1-3 (site 1) of LHR A. Optimal DAA for C5 convertases requires two contiguous LHRs, one carrying site 1 for DAA
and the other carrying site 2 for C3b binding. The spacing between
these two sites is important. Within site 1, amino acids were
identified that are important solely for DAA, and others were
identified that alter DAA and ligand binding in parallel. Proteins were
generated in which DAA for only one or the other C3 convertase is
reduced as well as proteins with increased DAA for C3 convertases but
one-fourth the size of CR1. These results increase our understanding of
the structure-function relationships in CR1 including a reason for its
unusual highly homologous repetitive structure. They provide insights
into the structural requirements for DAA of CR1 as well as of related
proteins. Together with our prior analysis of ligand binding and
cofactor activity in CR1, these data should facilitate the analysis of
the three-dimensional structure of active sites of proteins bearing CCPs.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant R01 AI41592 and by funding from CytoMed, Inc. (Cambridge, MA).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Division of
Rheumatology, 660 S. Euclid Ave., Box 8045, St. Louis, MO 63110. Tel.: 314-362-8391; Fax: 314-362-1366; E-mail:
jatkinso@imgate.wustl.edu.
2
M. Krych-Goldberg, R. E. Hauhart, and
J. P. Atkinson, unpublished data.
3
M. Krych-Goldberg, R. E. Hauhart, and
J. P. Atkinson, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
CR1, complement
receptor type 1;
sCR1, soluble CR1;
CP, classical pathway;
AP, alternative pathway;
CCP, complement control protein repeat;
LHR, long
homologous repeat;
EA, antibody-sensitized sheep erythrocytes, DAA,
decay accelerating activity;
DAF, decay accelerating factor;
RCA, regulator of complement activation;
CA, cofactor activity;
PCR, polymerase chain reaction.
 |
REFERENCES |
| 1.
|
Tedder, T. F.,
Fearon, D. T.,
Gartland, G. L.,
and Cooper, M. D.
(1983)
J. Immunol.
130,
1668-1673[Abstract]
|
| 2.
|
Wilson, J. G.,
Tedder, T. F.,
and Fearon, D. T.
(1983)
J. Immunol.
131,
684-689[Abstract]
|
| 3.
|
Fischer, E.,
Capron, M.,
Prin, L.,
Kusnierz, J. P.,
and Kazatchkine, M. D.
(1986)
Cell Immunol.
97,
297-306[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
O'Shea, J. J.,
Brown, E. J.,
Gaither, T. A.,
Takahashi, T.,
and Frank, M. M.
(1985)
J. Immunol.
135,
1325-1330[Abstract]
|
| 5.
|
Fallman, M.,
Andersson, R.,
and Andersson, T.
(1993)
J. Immunol.
151,
330-338[Abstract]
|
| 6.
|
Ehlenberger, A. G.,
and Nussenzweig, V.
(1977)
J. Exp. Med.
145,
357-371[Abstract/Free Full Text]
|
| 7.
|
Fearon, D. T.
(1980)
J. Exp. Med.
152,
20-30[Abstract/Free Full Text]
|
| 8.
|
Molina, H.,
Holers, V. M.,
Li, B.,
Fang, Y.-F.,
Mariathasan, S.,
Goellner, J.,
Strauss-Schoenberger, J.,
Karr, R. W.,
and Chaplin, D. D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
3357-3361[Abstract/Free Full Text]
|
| 9.
|
Ahearn, J. M.,
Fischer, M. B.,
Croix, D.,
Goerg, S.,
Ma, M.,
Xia, J.,
Zhou, X.,
Howard, R. G.,
Rothstein, T. L.,
and Carroll, M. C.
(1996)
Immunity
4,
251-262[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Thyphronitis, G.,
Kinoshita, T.,
Inoue, K.,
Schweinle, J. E.,
Tsokos, G. C.,
Metcalf, E. S.,
Finkelman, F. D.,
and Balow, J. E.
(1991)
J. Immunol.
147,
224-230[Abstract]
|
| 11.
|
Nelson, R. A., Jr.
(1953)
Science
118,
733-737[Free Full Text]
|
| 12.
|
Cornacoff, J. B.,
Hebert, L. A.,
Smead, W. L.,
VanAman, M. E.,
Birmingham, D. J.,
and Waxman, F. J.
(1983)
J. Clin. Invest.
71,
236-247
|
| 13.
|
Hebert, L. A.,
and Cosio, F. G.
(1987)
Kidney Int.
31,
870-877
|
| 14.
|
Thieblemont, N.,
Haeffner-Cavaillon, N.,
Ledur, A.,
L'Age-Stehr, J.,
Ziegler- Hietbrock, H. W.,
and Kazatchkine, M. D.
(1993)
Clin. Exp. Immunol.
92,
106-113[Medline]
[Order article via Infotrieve]
|
| 15.
|
Cooper, N. R.
(1991)
Immunol. Today
12,
327-331[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Rowe, J. A.,
Moulds, J. M.,
Newbold, C. I.,
and Miller, L. H.
(1997)
Nature
388,
292-295[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Liszewski, M. K.,
Farries, T. C.,
Lublin, D. M.,
Rooney, I. A.,
and Atkinson, J. P.
(1996)
Adv. Immunol.
61,
201-283[Medline]
[Order article via Infotrieve]
|
| 18.
|
Weisman, H. F.,
Bartow, T.,
Leppo, M. K.,
Marsh, H. C., Jr.,
Carson, G. R.,
Concino, M. F.,
Boyle, M. P.,
Reux, K. H.,
Weisfeldt, M. L.,
and Fearon, D. T.
(1990)
Science
249,
146-151[Abstract/Free Full Text]
|
| 19.
|
Pruitt, S. K.,
Bollinger, R. R.,
Collins, B. H.,
Marsh, H. C., Jr.,
Levin, J. L.,
Rudolph, A. R.,
Baldwin, W., III,
and Sanfilippo, F.
(1997)
Transplantation
63,
900-902[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Morgan, B. P.,
and Harris, C. L.
(1999)
in
Complement Regulatory Proteins
(Morgan, B. P.
, and Harris, C. L., eds)
, p. 250, Academic Press, Inc., San Diego
|
| 21.
|
Klickstein, L. B.,
Wong, W. W.,
Smith, J. A.,
Weis, J. H.,
Wilson, J. G.,
and Fearon, D. T.
(1987)
J. Exp. Med.
165,
1095-1112[Abstract/Free Full Text]
|
| 22.
|
Hourcade, D.,
Miesner, D. R.,
Atkinson, J. P.,
and Holers, V. M.
(1988)
J. Exp. Med.
168,
1255-1270[Abstract/Free Full Text]
|
| 23.
|
Klickstein, L. B.,
Bartow, T. J.,
Miletic, V.,
Rabson, L. D.,
Smith, J. A.,
and Fearon, D. T.
(1988)
J. Exp. Med.
168,
1699-1717[Abstract/Free Full Text]
|
| 24.
|
Krych, M.,
Hourcade, D.,
and Atkinson, J. P.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4353-4357[Abstract/Free Full Text]
|
| 25.
|
Makrides, S. C.,
Scesney, S. M.,
Ford, P. J.,
Evans, K. S.,
Carson, G. R.,
and Marsh, H. C.
(1992)
J. Biol. Chem.
267,
24754-24761[Abstract/Free Full Text]
|
| 26.
|
Kalli, K. R.,
Hsu, P.,
Bartow, T. J.,
Ahearn, J. M.,
Matsumoto, A. K.,
Klickstein, L. B.,
and Fearon, D. T.
(1991)
J. Exp. Med.
174,
1451-1460[Abstract/Free Full Text]
|
| 27.
|
Krych, M.,
Clemenza, L.,
Howdeshell, D.,
Hauhart, R.,
Hourcade, D.,
and Atkinson, J. P.
(1994)
J. Biol. Chem.
269,
13273-13278[Abstract/Free Full Text]
|
| 28.
|
Krych, M.,
Hauhart, R.,
and Atkinson, J. P.
(1998)
J. Biol. Chem.
273,
8623-8629[Abstract/Free Full Text]
|
| 29.
|
Dykman, T. R.,
Cole, J. L.,
Iida, K.,
and Atkinson, J. P.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
1698-1702[Abstract/Free Full Text]
|
| 30.
|
Hogg, N.,
Ross, G. D.,
Jones, D. B.,
Slusarenko, M.,
Walport, M. J.,
and Lachmann, P. J.
(1984)
Eur. J. Immunol.
14,
236-243[Medline]
[Order article via Infotrieve]
|
| 31.
|
Cervoni, F.,
Oglesby, T. J.,
Fenichel, P.,
Dohr, G.,
Rossi, B.,
Atkinson, J. P.,
and Hsi, B. L.
(1993)
J. Immunol.
151,
939-948[Abstract]
|
| 32.
|
Hourcade, D. E.,
Wagner, L. M.,
and Oglesby, T. J.
(1995)
J. Biol. Chem.
270,
19716-19722[Abstract/Free Full Text]
|
| 33.
|
Hourcade, D. E.,
Mitchell, L. M.,
and Medof, M. E.
(1999)
Immunopharmacology
42,
167-173[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Hong, K.,
Kinoshita, T.,
Pramoonjago, P.,
Kim, Y. U.,
Seya, T.,
and Inoue, K.
(1991)
J. Immunol.
146,
1868-1873[Abstract]
|
| 35.
|
Krych, M.,
Hauhart, R.,
and Atkinson, J. P.
(1996)
Mol. Immunol.
33,
33[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Krych, M.,
Hauhart, R. E.,
Hourcade, D. E.,
and Atkinson, J. P.
(1998)
Mol. Immunol.
35,
403
|
| 37.
|
Pangburn, M. K.
(1986)
J. Immunol.
136,
2216-2221[Abstract]
|
| 38.
|
Wong, W. W.,
and Farrell, S. A.
(1990)
J. Immunol.
146,
656-662[Abstract]
|
| 39.
|
Medof, M. E.,
and Nussenzweig, V.
(1984)
J. Exp. Med.
159,
1669-1685[Abstract/Free Full Text]
|
| 40.
|
Kuhn, S.,
and Zipfel, P. F.
(1996)
Eur. J. Immunol.
26,
2383-2387[Medline]
[Order article via Infotrieve]
|
| 41.
|
Kinoshita, T.,
Rosenfield, S. I.,
and Nussenzweig, V.
(1987)
J. Immunol.
138,
2994-2998[Abstract]
|
| 42.
|
Nickells, M. W.,
and Atkinson, J. P.
(1990)
J. Immunol.
144,
4262-4268[Abstract]
|
| 43.
|
Nickells, M. W.,
Alvarez, J. I.,
Lublin, D. M.,
and Atkinson, J. P.
(1994)
J. Immunol.
152,
676-685[Abstract]
|
| 44.
|
Krych, M.,
Hauhart, R.,
Hourcade, D.,
Subramanian, B.,
and Atkinson, J. P.
(1997)
J. Allergy Clin. Immunol.
99,
S373
|
| 45.
|
Medof, M. E.,
Lublin, D. M.,
Holers, V. M.,
Ayers, D. J.,
Getty, R. R.,
Leykam, J. F.,
Atkinson, J. P.,
and Tykocinski, M. L.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
2007-2011[Abstract/Free Full Text]
|
| 46.
|
Brodbeck, W. G.,
Kuttner-Kondo, L., Yu, J.,
and Medof, M. E.
(1998)
Mol. Immunol.
35,
426
|
| 47.
|
Kuttner-Kondo, L.,
Medof, M. E.,
Brodbeck, W.,
and Shoham, M.
(1996)
Protein Eng.
9,
1143-1149[Abstract/Free Full Text]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Yamaguchi, H. Takagawa, H. Iwakaji, S. Miyagawa, P.-C. Wang, and N. Ishii
Construction of the Plasmid, Expression by Chinese Hamster Ovary Cell, Purification and Characterization of the First Three Short Consensus Repeat Modules of Human Complement Receptor Type 1
J. Biochem.,
April 1, 2009;
145(4):
533 - 542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Okroj, L. Mark, A. Stokowska, S. W. Wong, N. Rose, D. J. Blackbourn, B. O. Villoutreix, O. B. Spiller, and A. M. Blom
Characterization of the Complement Inhibitory Function of Rhesus Rhadinovirus Complement Control Protein (RCP)
J. Biol. Chem.,
January 2, 2009;
284(1):
505 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Kuttner-Kondo, D. E. Hourcade, V. E. Anderson, N. Muqim, L. Mitchell, D. C. Soares, P. N. Barlow, and M. E. Medof
Structure-based Mapping of DAF Active Site Residues That Accelerate the Decay of C3 Convertases
J. Biol. Chem.,
June 22, 2007;
282(25):
18552 - 18562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Katschke Jr., K. Y. Helmy, M. Steffek, H. Xi, J. Yin, W. P. Lee, P. Gribling, K. H. Barck, R. A.D. Carano, R. E. Taylor, et al.
A novel inhibitor of the alternative pathway of complement reverses inflammation and bone destruction in experimental arthritis
J. Exp. Med.,
June 11, 2007;
204(6):
1319 - 1325.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Harris, D. M. Pettigrew, S. M. Lea, and B. P. Morgan
Decay-Accelerating Factor Must Bind Both Components of the Complement Alternative Pathway C3 Convertase to Mediate Efficient Decay
J. Immunol.,
January 1, 2007;
178(1):
352 - 359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Liszewski, M. K. Leung, R. Hauhart, R. M. L. Buller, P. Bertram, X. Wang, A. M. Rosengard, G. J. Kotwal, and J. P. Atkinson
Structure and Regulatory Profile of the Monkeypox Inhibitor of Complement: Comparison to Homologs in Vaccinia and Variola and Evidence for Dimer Formation
J. Immunol.,
March 15, 2006;
176(6):
3725 - 3734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Krych-Goldberg, R. E. Hauhart, T. Porzukowiak, and J. P. Atkinson
Synergy between Two Active Sites of Human Complement Receptor Type 1 (CD35) in Complement Regulation: Implications for the Structure of the Classical Pathway C3 Convertase and Generation of More Potent Inhibitors
J. Immunol.,
October 1, 2005;
175(7):
4528 - 4535.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mullick, A. K. Singh, Y. Panse, V. Yadav, J. Bernet, and A. Sahu
Identification of Functional Domains in Kaposica, the Complement Control Protein Homolog of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8)
J. Virol.,
May 1, 2005;
79(9):
5850 - 5856.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Kuttner-Kondo, M. P. Dybvig, L. M. Mitchell, N. Muqim, J. P. Atkinson, M. E. Medof, and D. E. Hourcade
A Corresponding Tyrosine Residue in the C2/Factor B Type A Domain Is a Hot Spot in the Decay Acceleration of the Complement C3 Convertases
J. Biol. Chem.,
December 26, 2003;
278(52):
52386 - 52391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yazdanbakhsh, S. Kang, D. Tamasauskas, D. Sung, and A. Scaradavou
Complement receptor 1 inhibitors for prevention of immune-mediated red cell destruction: potential use in transfusion therapy
Blood,
June 15, 2003;
101(12):
5046 - 5052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Kuttner-Kondo, L. Mitchell, D. E. Hourcade, and M. E. Medof
Characterization of the Active Sites in Decay-Accelerating Factor
J. Immunol.,
August 15, 2001;
167(4):
2164 - 2171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Moulds, P. A. Zimmerman, O. K. Doumbo, L. Kassambara, I. Sagara, D. A. Diallo, J. P. Atkinson, M. Krych-Goldberg, R. E. Hauhart, D. E. Hourcade, et al.
Molecular identification of Knops blood group polymorphisms found in long homologous region D of complement receptor 1
Blood,
May 1, 2001;
97(9):
2879 - 2885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Rowe, S. J. Rogerson, A. Raza, J. M. Moulds, M. D. Kazatchkine, K. Marsh, C. I. Newbold, J. P. Atkinson, and L. H. Miller
Mapping of the Region of Complement Receptor (CR) 1 Required for Plasmodium falciparum Rosetting and Demonstration of the Importance of CR1 in Rosetting in Field Isolates
J. Immunol.,
December 1, 2000;
165(11):
6341 - 6346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Liszewski, M. Leung, W. Cui, V. B. Subramanian, J. Parkinson, P. N. Barlow, M. Manchester, and J. P. Atkinson
Dissecting Sites Important for Complement Regulatory Activity in Membrane Cofactor Protein (MCP; CD46)
J. Biol. Chem.,
November 22, 2000;
275(48):
37692 - 37701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Hourcade, L. Mitchell, L. A. Kuttner-Kondo, J. P. Atkinson, and M. E. Medof
Decay-accelerating Factor (DAF), Complement Receptor 1 (CR1), and Factor H Dissociate the Complement AP C3 Convertase (C3bBb) via Sites on the Type A Domain of Bb
J. Biol. Chem.,
January 4, 2002;
277(2):
1107 - 1112.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|