JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tominaga, K.
Right arrow Articles by Nakanishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tominaga, K.
Right arrow Articles by Nakanishi, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 44, 31463-31467, October 29, 1999


Role of Human Cds1 (Chk2) Kinase in DNA Damage Checkpoint and Its Regulation by p53*

Kaoru TominagaDagger §, Hirobumi MorisakiDagger §, Yoko KanekoDagger , Atsushi FujimotoDagger , Takashi Tanaka, Motoaki Ohtsuboparallel , Momoki Hirai**, Hiroto OkayamaDagger Dagger , Kyoji IkedaDagger , and Makoto NakanishiDagger §§

From the Dagger  Department of Geriatric Research, National Institute for Longevity Sciences, 36-3 Gengo, Morioka, Obu, Aichi 474-8522, Japan, the  Department of Biochemistry, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan, the parallel  Division of Molecular Genetics, Institute of Life Science, Kurume University, 2432-2433 Aikawa-machi, Kurume, Fukuoka 839-0861, Japan, the ** Department of Biological Sciences, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan, and the Dagger Dagger  Department of Biochemistry and Molecular Biology, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

In response to DNA damage, mammalian cells adopt checkpoint regulation, by phosphorylation and stabilization of p53, to delay cell cycle progression. However, most cancer cells that lack functional p53 retain an unknown checkpoint mechanism(s) by which cells are arrested at the G2/M phase. Here we demonstrate that a human homolog of Cds1/Rad53 kinase (hCds1) is rapidly phosphorylated and activated in response to DNA damage not only in normal cells but in cancer cells lacking functional p53. A survey of various cancer cell lines revealed that the expression level of hCds1 mRNA is inversely related to the presence of functional p53. In addition, transfection of normal human fibroblasts with SV40 T antigen or human papilloma viruses E6 or E7 causes a marked induction of hCds1 mRNA, and the introduction of functional p53 into SV40 T antigen- and E6-, but not E7-, transfected cells decreases the hCds1 level, suggesting that p53 negatively regulates the expression of hCds1. In cells without functional ataxia telangiectasia mutated (ATM) protein, phosphorylation and activation of hCds1 were observed in response to DNA damage induced by UV but not by ionizing irradiation. These results suggest that hCds1 is activated through an ATM-dependent as well as -independent pathway and that it may complement the function of p53 in DNA damage checkpoints in mammalian cells.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

The fidelity of chromosome segregation is achieved by checkpoint controls that prevent cell cycle progression when damage to DNA is encountered or key processes are not completed (1, 2). In mammals, cell cycle arrest in response to DNA damage is mediated through the transcriptional activation of DNA damage-inducible genes by the p53 tumor suppressor gene. p53 has an essential role in the G1 checkpoint in response to DNA-damaging agents such as ionizing radiation (3). p53, a transcription factor with sequence-specific DNA binding activity (4), activates the transcription of target genes, including p21 Cdk inhibitor (5), when DNA is damaged. Although cells lacking functional p53 are completely defective in the G1 checkpoint in response to DNA damage, they retain an unknown checkpoint mechanism at G2/M, which may underlie the resistance of these cells to anti-cancer drugs (6). Interestingly, cells derived from patients with ataxia telangiectasia (AT)1 are defective in both G1 and G2 checkpoint functions and display a high frequency of spontaneous as well as radiation-induced chromosomal aberrations (7, 8). Although defects in the G1 checkpoint function in AT cells appear to be the result of their inability to phosphorylate p53 in response to DNA damage (7, 9), the molecular mechanism underlying the impaired G2 checkpoint in AT cells is not known.

In yeast, several Rad-related proteins are thought to participate in the signaling as well as monitoring processes that detect DNA damage (10). Among these, Rad3, a yeast homolog of human ATM (AT mutated), appears to play a central role in the DNA damage checkpoint. Rad3 is a member of a subfamily of protein kinases that are large proteins with lipid kinase-related domains at their carboxyl termini (11), and it is considered to be a transducer of a DNA damage signal in yeast. In fission yeast, the protein kinases Chk1 and Cds1 are required for cell cycle arrest in response to DNA damage (12-15). These kinases act downstream of several Rad gene products and are phosphorylated upon DNA damage. Activated Chk1 and Cds1 kinases have been reported to phosphorylate Cdc25 (16, 17), and phosphorylated Cdc25 is negatively regulated by binding to Rad24 and Rad25, which are homologs of human 14-3-3 protein (18). The inactive form of human and Xenopus Cdc25 before mitosis contains phosphorylated serine residues at 216 and 287, respectively, creating a consensus 14-3-3 binding site (19-21). It has been shown that human homologs of Chk1 and Cds1 (hCds1) phosphorylate Cdc25C on Ser-216 (22-24) and act, at least in part, by regulating the binding of 14-3-3 to Cdc25C. A more recent study points to the involvement of hCds1 in the DNA damage checkpoint, by showing that hCds1 is activated through phosphorylation in an ATM-dependent manner in response to DNA damage induced by ionizing radiation (23). However, it remains unknown at which phase of the cell cycle hCds1 functions and how it cooperates with p53-dependent checkpoint pathways in response to DNA damage.

In this report, we demonstrate that hCds1 is specifically expressed at the S-to-M phase of the cell cycle and is rapidly activated through phosphorylation in response to DNA damage not only in normal cells but also in p53-deficient cancer cells. In addition, we present evidence that hCds1 expression is negatively regulated by functional p53, leading to a high level of expression in p53-deficient cancer cells. Thus, hCds1 may complement the function of p53 in the DNA damage checkpoint in p53-deficient cancer cells.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

Cell Lines-- HeLa cells and human diploid fibroblasts (MJ90) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 100 µg/ml penicillin and streptomycin. Human papilloma virus (HPV) type 16 E6 and E7 retrovirus vectors and LXSN-E6 and -E7 were kindly provided by Dr. D. Galloway (25). SV40 T antigen retrovirus vector pZipSV40 was kindly provided by Dr. P. Jat (26). Retroviruses encoding SV40 T antigen and HPV E6 and E7 were prepared using pZipSV40, LXSN-E6, LXSN-E7, respectively, as described previously (27). Normal human fibroblasts WI-38 (obtained from RIKEN Cell Bank) were used as the recipients for retroviral infection and were cultured under the same conditions as described above. Human p53 adenovirus vector was kindly donated by Drs. H. Hamada and J. Miyazaki. Fibroblasts derived from a patient with ataxia telangiectasia (AT2KY) were cultured in RPMI 1640 medium supplemented with 20% FBS and 100 µg/ml penicillin and streptomycin. To induce DNA damage, cells were irradiated with UV at 322 nm using a UV cross-linker (Taitech, Tokyo).

Molecular Cloning of Human Cds1-- Degenerate primers for the conserved motifs in the FHA and kinase domains of SpCds1 (28), T/AG/CNAAT/CGGNACCTTTTTNAAT and T/CTTA/GTTA/G/TATA/G/TATT/C/TTA/G/TATGGC, were used to screen MDAH041 cDNAs by PCR. Sequence analysis of a PCR product revealed an incomplete open reading frame, which was highly homologous to SpCds1. Additional nucleotides of the novel 5' DNA sequence were obtained by 5' rapid amplification of the cDNA ends (RACE). The sequence of the 3'-end of hCds1 cDNA was identical with a partial sequence in the data base of an expressed sequence tag clone (AA773443).

Northern Blotting-- mRNAs were isolated using a Quickprep mRNA Purification kit (Amersham Parmacia Biotech) according to the manufacture's instructions. RNA (2 µg each) was denatured, separated by electrophoresis on 1.0% agarose-formaldehyde gels, and transferred onto nylon membranes. hCds1 cDNA was labeled with [alpha -32P]dCTP using a random primer labeling kit (Amersham Pharmacia Biotech). The hybridization signal was detected and quantitated using a Fuji imaging analyzer (BAS 1500).

Preparation of Recombinant hCds1 Protein in Sf9 Cells-- Baculoviruses expressing hCds1myc/6xHis were generated by PCR with a common 5'-primer (TTTGAATTCGCGGTCGTGATGTCTCGGGAG) and a 3'-primer (TTTCTCGAGCAACACAGCAGCACACACAGC), using cDNA derived from MJ90 cells as a template. The PCR product was digested with EcoRI/XhoI and ligated into pcDNA3.1/Myc-HisA. The EcoRI/PmeI fragment from pcDNA3.1/Myc-His hCds1 was subcloned into pVL1392, which was cut with EcoRI/SmaI. One µg of pVL1392hCds1myc/6xHis was co-transfected into Sf9 cells with 2.5 µg of linearized baculovirus DNA (BaculoGold, PharMingen).

Preparation of GST-fused hCds1 Protein in Escherichia coli-- pGEX-hCds1 was generated by ligation of the EcoRI/XhoI fragment of hCds1 cDNA into pGEX 5X-1. Overnight cultures of E. coli transformed with plasmids encoding GST-fusion proteins were diluted 10-fold with fresh medium and cultured for 2 h at 37 °C, followed by incubation with 0.1 mM isopropyl-beta -D-thiogalactopyranoside for an additional 2 h. Cells were harvested and lysed by sonication in NETN150 buffer (20 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, and a mixture of protease inhibitors consisting of 20 µg/ml soybean trypsin inhibitor, 2 µg/ml aprotinin, and 100 µg/ml phenylmethylsulfonyl fluoride (PMSF)). Recombinant proteins were purified on glutathione-Sepharose beads (Amersham Pharmacia Biotech).

Preparation of Anti-hCds1 Antibody-- Antibody against hCds1 was generated by immunizing a rabbit with hCds1myc/6xHis protein purified from Sf9 cells using ProBond Resin (Invitrogen). Antisera were purified on CNBr-activated Sepharose 4B (Amersham Pharmacia Biotech) coupled with GST-hCds1.

Western Blot Analysis, Immunocytochemistry, and Immunoprecipitation-- For Western blot analysis, cells were lysed in ice-cold IP kinase buffer (50 mM HEPES, pH 8.0, 150 mM NaCl, 2.5 mM EGTA, 1 mM EDTA, 0.1% Tween 20, and 10% glycerol) containing a mixture of protease inhibitors (20 µg/ml soybean trypsin inhibitor, 2 µg/ml aprotinin, 5 µg/ml leupeptin, and 100 µg/ml PMSF) and phosphatase inhibitors (50 mM NaF, 0.1 mM Na3VO4, and 5 mg/ml phosphatase substrate). Clear lysates (100 µg) were separated on 8% SDS-polyacrylamide gels and analyzed by Western blotting using anti-hCds1 antibody (1:1000). Baculovirus-expressing wild-type hCds1myc/6xHis and its mutant (K249M) proteins were immunoprecipitated with anti-Myc-Tag (MBL, Nagoya, Japan) and were subjected to an in vitro kinase assay. Cell lysates from HeLa and AT2KY cells were immunoprecipitated with anti-hCds1 antibody coupled to CNBr-activated Sepharose 4B.

For immunocytochemistry, HeLa cells were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton X-100. The permeabilized cells were incubated with anti-hCds1 antibody (1:200) and then with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (1:100, Immunotech) and were mounted in PermaFluor aqueous mounting medium (Immunon, PA).

Kinase Assay-- The kinase activity of hCds1 was determined at 30 °C for 30 min in a 30-µl reaction mixture containing 50 mM HEPES, pH 8.0, 10 mM MgCl2, 2.5 mM EGTA, 1 mM dithiothreitol, 10 µM beta -glycerophosphate, 1 mM NaF, 0.1 mM Na3VO4, 0.1 mM PMSF, 10 µM ATP, and 185 kBq[gamma -32P]ATP (222 TBq/mmol; NEM), using the GST-Cdc25C fragment as a substrate (29). The reaction products were separated on SDS-PAGE, and phosphorylated proteins were detected by autoradiography. In some experiments, anti-hCds1 immunoprecipitants from HeLa cell lysates were treated with 2000 units of lambda  phosphatase at 37 °C for 1 h in the absence of phosphatase inhibitor.

Chromosomal Localization of hCds1 Gene-- To determine the chromosomal localization of the hCds1 gene, fluorescence in situ hybridization was performed as described previously (30). A biotinylated cDNA probe for hCds1 was hybridized to R-banded chromosomes prepared from PHA-stimulated lymphocytes from normal donors. After overnight hybridization at 37 °C, the slides were washed in 50% formamide/2× SSC at 37 °C for 10 min followed by a wash in 1× SSC at room temperature for 15 min. Hybridization signals were amplified using rabbit antibiotin (Enzo) and fluorescein-labeled goat anti-rabbit IgG (Enzo). The chromosomes were counter-stained with propidium iodide.

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

Molecular Cloning of hCds1 cDNA-- A human homolog of Schizosaccharomyces pombe Cds1 (spCds1), which functions in both DNA replication and damage checkpoints, was cloned by degenerate PCR using primers designed on the basis of spCds1 sequences. The human cDNA predicts a translation product of 543 amino acids with a calculated molecular mass of 60 kDa, and the nucleotide sequence of hCds1 gene is identical with that of human Chk2, which has recently been reported by Matsuoka et al. (23).

hCds1 Is Expressed at Late G1-to-M Phase of the Cell Cycle-- To examine at which stage(s) of the cell cycle hCds1 functions in mammalian cells, we first determined the expression of hCds1 mRNA during cell cycle progression by Northern blotting. Normal human fibroblasts (MJ90) were synchronized at the G0 phase of the cell cycle by serum starvation for 72 h and then stimulated with fresh medium containing 15% FBS. Flow cytometric analysis showed that the S phase started approximately 18 h after serum stimulation and that maximal cell division occurred at 24-36 h (data not shown). As shown in Fig. 1A, Northern blot analysis with an hCds1 cDNA probe revealed that an hCds1 transcript of approximately 2.2 kilobases was weakly detected in serum-starved, quiescent cells (time 0). The steady-state level of hCds1 mRNA increased as cells approached the G1/S transition (18 h), remained elevated until 36 h, and declined during the next G1 phase (48 h in Fig. 1A).


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 1.   Cell cycle-dependent expression (A) and nuclear localization (B) of hCds1. A, MJ90 cells were cultured in serum-deprived medium for 3 days and then restimulated with fresh medium containing 15% FBS. mRNA and protein extracts were prepared at the indicated times after serum stimulation, and hCds1 mRNA and protein were detected by Northern and Western blot analysis, respectively. AS, asynchronous culture. B, HeLa cells cultured on glass coverslips were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton X-100. The permeabilized cells were incubated with anti-hCds1 antibody (1:200, right) or normal rabbit IgG (left) and then with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Immunotech, 1:100).

To examine whether the level of hChk1 protein also changes in a cell cycle-dependent fashion, we prepared antiserum that specifically interacts with full-length hCds1 protein expressed in insect cells, and extracts from synchronized MJ90 cells were analyzed by Western blotting using affinity-purified anti-hCds1 antibody. As shown in Fig. 1A (lower panel), using the antibody, a predominant band was detected at 60 kDa in the lysates of MJ90 cells, and this completely disappeared after preabsorption of the antibody with GST-fused hCds1 protein expressed in E. coli (data not shown). In agreement with the results of the Northern analysis, Western analysis revealed that hCds1 protein was expressed from late G1 through M phases of the cell cycle. Although cell cycle-dependent expression of Cds1 and Rad53 has not been described in yeast, the expression pattern of hCds1 is very similar to that of hChk1, another checkpoint kinase in mammalian cells (29).

Nuclear Localization of hCds1-- We next attempted to determine the subcellular localization of hCds1 protein. As shown in Fig. 1B, whereas almost no signal was detected using normal rabbit serum (Control Ab), indirect immunofluorescence revealed clearly detected signals with our anti-hCds1 antibody in the nucleoplasm of HeLa cells, indicating that hCds1 is present in the nucleoplasm. The nuclear localization of hCds1 was not affected by DNA damage (data not shown).

hCds1 Gene Exists on Chromosome 22q11.2-- Very recently, Cahill et al. (31) reported that mutations of a mitotic checkpoint gene, hBUB1, can cause chromosomal instability in human cancers. To see whether this is also the case with hCds1, we determined the chromosomal localization of hCds1 and analyzed the chromosomal aberrations in the region. The results of fluorescence in situ hybridization showed that the hCds1 gene is localized to human chromosome 22q11.2 (Fig. 2). It is also noteworthy that the hCds1 locus is adjacent to the gene encoding hSNF5/INI1, which has been implicated in the etiology of malignant rhabdoid tumors (32), raising the possibility that a mutation or deletion in the hCds1 gene may be involved in the oncogenesis of rhabdoid tumors.


View larger version (61K):
[in this window]
[in a new window]
  		Fig. 2.   Chromosomal localization of the hCds1 gene. A biotinylated hCds1 cDNA probe was hybridized to R-banded chromosomes from activated lymphocytes. The arrow indicates the locus of hCds1 at 22q11.2

Activation of hCds1 through Phosphorylation in Response to DNA Damage-- In yeast, Rad53 and spCds1 have been reported to be phosphorylated in response to DNA damage, in a Mec1/Rad3-dependent manner (33, 34). To see whether hCds1 functions in DNA damage response in mammalian cells under p53-deficient conditions, modification of hCds1 protein following UV-induced DNA damage was determined in HeLa cells that lack functional p53. As shown in Fig. 3A, the band corresponding to hCds1 protein was shifted upward on SDS-PAGE in extracts of HeLa cells exposed to UV compared with those from untreated cells. This mobility shift was completely reversed by phosphatase treatment, indicating that the modification following UV irradiation was because of phosphorylation of hCds1 protein. Although hCds1 protein was mostly phosphorylated at 2 h after UV irradiation, a time course experiment revealed that phosphorylation of hCds1 protein occurred as early as 10 min, when an intermediate pattern was observed (data not shown).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 3.   Phosphorylation and activation of hCds1 in response to DNA damage. A, HeLa cells were irradiated with UV light at 0.1 J/cm2. After 2 h, cell lysates were prepared, and hCds1 protein was immunoprecipitated with a specific antibody. After washing, the immunoprecipitates were treated with 2000 units of lambda  phosphatase (PPase) at 30 °C for 1 h in the presence or absence of phosphatase inhibitor and were subjected to SDS-PAGE and Western blot analysis to detect hCds1. B, HeLa cells were irradiated with UV light at 0.07 J/cm2. After 8 h, cell lysates were prepared, immunoprecipitation was performed as in A, and the kinase activity in the anti-hCds1 immunoprecipitates was determined using a GST-hCdc25C fragment as a substrate. In this experiment, a lower dose of UV light (0.07 J/cm2) was used because a higher dose (0.1 J/cm2) appeared to be slightly toxic for a longer culture. C, HeLa cells, normal human fibroblasts (MJ90), and fibroblasts derived from a patient with ataxia telangiectasia (AT2KY) were subjected to ionizing radiation (X-ray; 10 Gy), UV irradiation (0.07 J/cm2), and MMS (0.03%) treatment for 2, 8, and 16 h, respectively. Cell lysates were prepared, and hCds1 protein was detected by Western blotting (HeLa cells and MJ90 cells) or by immunoprecipitation followed by Western blotting, in the case of AT2KY cells, because of the presence of a nonspecific band recognized by the secondary antibody.

To examine whether the phosphorylation of hCds1 protein affects its kinase activity, we measured the kinase activity of hCds1 from HeLa cell extracts, with or without DNA damage, using the GST-Cdc25C fragment as a substrate. As shown in Fig. 3B, the kinase activity in the anti-hCds1 immunoprecipitates increased approximately 5-fold following UV irradiation. The kinase activity was not detected when a Cdc25C mutant (S216A) with a substitution of alanine at serine 216 was used as a substrate (data not shown), which is consistent with a previous report that hChk2 phosphorylates serine 216 of Cdc25C (23). Interestingly, autophosphorylation of hCds1 was detected in the anti-hCds1 immunoprecipitates following UV treatment (Fig. 3B). These results suggest that hCds1 is activated by phosphorylation in response to DNA damage induced by UV irradiation and that activated hCds1 phosphorylates Cdc25C on serine 216. Taken together with the recent report that phosphorylation of Cdc25C on serine 216 is critical for the DNA damage checkpoint in mammals (19), this finding suggests that hCds1 plays a pivotal role in this checkpoint pathway.

We next examined whether hCds1 is phosphorylated by other DNA-damaging agents. As shown in Fig. 3C, hCds1 was phosphorylated following x-ray irradiation and MMS treatment, as well as UV irradiation, not only in HeLa cells but in normal fibroblasts, suggesting that hCds1 is involved in DNA damage checkpoint pathways induced by a wide variety of DNA damage. Interestingly, in AT2KY cells, which lack functional ATM, the band shift of hCds1 was observed in response to UV irradiation or MMS treatment but not following x-ray irradiation (Fig. 3C). Taken together with the previous observations that AT cells show hypersensitivity to ionizing radiation but not to UV or alkylating agents (35, 36), it is likely that hCds1 is regulated through an ATM-dependent as well as -independent mechanism, depending on the type of DNA damage.

Negative Regulation of hCds1 by p53-- Although the data so far suggest the role of hCds1 in the DNA damage response, the functional relationship between the hCds1-mediated G2 checkpoint and the p53-mediated G1 checkpoint is largely unknown. To address this question, we first surveyed the expression of hCds1 in various cell lines with and without functional p53. Interestingly, the level of hCds1 mRNA was very low (Cds1 mRNA/GAPDH mRNA ratio, 0.12-0.23) in cells with wild-type p53, such as MJ90 (37), AT2KY (38), and A172 (39) cells, whereas it was relatively higher (hCds1 mRNA/GAPDH mRNA ratio, 0.7-3.7) in cells without functional p53, including Raji (40), MDAH041 (41), HeLa (42), U937 (43), and T98G (44) cells (Fig. 4A), raising the possibility that wild-type p53 negatively regulates the expression of the hCds1 gene. The status of p53 and its content in these cell lines were confirmed by Northern blot analysis using p21 cDNA as a probe, which showed a higher expression of p21 in cells containing functional p53 and a lower expression in cells lacking functional p53 (data not shown). These results, that the levels of hCds1 mRNA varied among cancer cells lacking functional 53, raise the possibility that additional genetic alterations may be involved in the regulation of hCds1 expression.


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 4.   Negative regulation of hCds1 expression by wild-type p53. A, expression of hCds1 mRNA in various cell types, including cells with wild-type p53 (MJ90, AT2KY, and A172) or without functional p53 (Raji, MDAH041, HeLa, U937, SaOS2, and T98G), was examined by Northern blotting. The levels of hCds1 mRNA with standard deviations determined by three independent experiments, corrected for those of GAPDH mRNA, are shown below. B, human diploid fibroblasts (WI-38) and derivatives that express SV40 large T antigen or HPV E6 or E7 were cultured overnight with (+) or without (-) infection with p53-expressing adenovirus (Ad-p53, multiplicity of infection = 10). Total cellular RNA was extracted, and Northern blot analysis was performed with a hCds1 cDNA probe. The levels of hCds1 mRNA with standard deviations determined by three independent experiments, corrected for those of GAPDH mRNA, are shown below. kb, kilobase pair.

To further substantiate negative regulation of hCds1 expression by p53, normal human fibroblasts (WI-38) were transfected with retroviruses encoding the viral oncoproteins, SV40 large T antigen, and HPV E6 or E7 protein to abrogate the function of both p53 and pRb (45, 46), p53 only (47), or pRb only (48), respectively, and the expression of hCds1 mRNA was determined. As shown in Fig. 4B, parent WI-38 cells expressed a low level of endogenous hCds1 mRNA. Expression of SV40 large T antigen, E6 or E7 protein in WI-38 cells caused a marked induction of hCds1 mRNA, with T antigen being more potent than E6 or E7 protein in inducing hCds1 expression (4.5-fold by T antigen, 2.0-fold by E6, and 2.1-fold by E7). Interestingly, as shown in Fig. 4B, infection of an adenovirus vector encoding wild-type p53 significantly decreased the level of hCds1 mRNA in SV 40 large T antigen (both p53 and pRb disrupted)- and E6-transformed cells (only p53 function disrupted) but not in E7-transformed cells (only pRb function disrupted). These results indicate that the induction of hCds1 expression in oncoprotein-transduced cells (Fig. 4B) is, at least in part, because of the inhibition of p53 function. In addition, on the basis of our finding that the expression of hCds1 was also increased in E7-transformed (pRb function disrupted) cells, compared with parent WI-38 cells, and that the level was higher in cells transformed by SV 40 large T- than in E6-transduced cells, it is tempting to speculate that the pRb pathway may also negatively regulate hCds1 expression. Taken together with the recent report that pRb plays an essential role in the DNA damage checkpoint during the G1 phase (49), our results are consistent with the hypothesis that the expression of hCds1 is enhanced when the G1 checkpoint function is compromised by either p53 or pRb dysfunction.

In conclusion, we propose the existence of a counter-regulatory mechanism; when cells lose functional p53 and thus G1 checkpoint control, hCds1 plays a pivotal role in the DNA damage checkpoint during the G2 phase of the cell cycle. In normal cells, p53 and/or pRb, rather than hCds1, are thought to play the main role in DNA damage checkpoint. Once mutations disrupt the p53- and/or pRb-dependent pathways, cells respond with increased expression of hCds1, which in turn plays a compensatory role in the G2 checkpoint in the case of DNA damage. It is conceivable that activation of the hCds1-dependent checkpoint pathway may underlie the resistance of p53-deficient cancer cells to ionizing irradiation and anti-cancer drugs. Thus, the development of specific inhibitors of hCds1 may provide a novel strategy for cancer therapy by enhancing the sensitivity of cancer cells to DNA damage induced by anti-cancer drugs.

    ACKNOWLEDGEMENTS

We thank Dr. Akira Tachibana for providing AT2KY cells and Drs. Hirofumi Hamada and Jun-ichi Miyazaki for p53-expressing adenovirus. We also thank the members of the cell cycle group in the Department of Geriatric Research, National Institute for Longevity Sciences for their helpful discussions.

    FOOTNOTES

* This work was supported in part by Grant-in-aid 09273104 for Scientific Research on Priority Areas (to M. N.) from the Ministry of Education, Science, Sports, and Culture of Japan and a Health Sciences Research Grant for Research on the Human Genome and Gene Therapy (H10-genome-001) (to K. I.) from the Ministry of Health and Welfare of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ The first two authors contributed equally to this work.

§§ To whom correspondence should be addressed: Dept. of Biochemistry, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 Japan. Tel.: 81-52-853-8145; Fax: 81-52-842-3955; E-mail: mkt-naka@med.nagoya-cu.ac.jp.

    ABBREVIATIONS

The abbreviations used are: AT, ataxia telangiectasia; ATM, ataxia telangiectasia mutated; FBS, fetal bovine serum; PMSF, phenylmethylsulfonyl fluoride; HPV, human papilloma virus; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; GST, glutathione S-transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMS, methyl methanesulfonate.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

1. Elledge, S. J. (1996) Science 274, 1664-1672[Abstract/Free Full Text]
2. Paulovich, A. G., Toczyski, D. P., and Hartwell, L. H. (1997) Cell 88, 315-321[CrossRef][Medline] [Order article via Infotrieve]
3. Levine, A. J. (1997) Cell 88, 323-331[CrossRef][Medline] [Order article via Infotrieve]
4. El-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B. (1992) Nat. Genet. 1, 45-49[CrossRef][Medline] [Order article via Infotrieve]
5. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, D. B., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817-825[CrossRef][Medline] [Order article via Infotrieve]
6. Waldman, T., Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1996) Nature 381, 713-716[CrossRef][Medline] [Order article via Infotrieve]
7. Kastan, M. B., Zhan, Q., El-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fornace, A. J., Jr. (1992) Cell 71, 587-597[CrossRef][Medline] [Order article via Infotrieve]
8. Beamish, H., Williams, R., Chen, P., and Lavin, M. F. (1996) J. Biol. Chem. 271, 20486-20493[Abstract/Free Full Text]
9. Barlow, C., Brown, K. D., Deng, C.-X., Tagle, D. A., and Wynshaw-Boris, A. (1997) Nat. Genet. 17, 453-456[CrossRef][Medline] [Order article via Infotrieve]
10. Longhese, M. P., Foiani, M., Muzi-Falconi, M., Lucchini, G., and Plevani, P. (1998) EMBO J. 17, 5525-5528[CrossRef][Medline] [Order article via Infotrieve]
11. Zakian, V. A. (1995) Cell 82, 685-687[CrossRef][Medline] [Order article via Infotrieve]
12. Walworth, N., Davey, S., and Beach, D. (1993) Nature 363, 368-371[CrossRef][Medline] [Order article via Infotrieve]
13. Walworth, N. C., and Bernards, R. (1996) Science 271, 353-356[Abstract]
14. Saka, Y., Esashi, F., Matsusaka, T., Mochida, S., and Yanagida, M. (1997) Genes & Dev. 11, 3387-3400[Abstract/Free Full Text]
15. Lindsay, H. D., Griffiths, D. J. F., Edwards, R. J., Christensen, P. U., Murray, J. M., Osman, F., Walworth, N., and Carr, A. M. (1998) Genes & Dev. 12, 382-395[Abstract/Free Full Text]
16. Furnari, B., Rhind, N., and Russell, P. (1997) Science 277, 1495-1497[Abstract/Free Full Text]
17. Zeng, Y., Forbes, K. C., Wu, Z., Moreno, S., Piwnica-Worms, H., and Enoch, T. (1998) Nature 395, 507-510[CrossRef][Medline] [Order article via Infotrieve]
18. Ford, J. C., Al-Khodairy, F., Fotou, E., Sheldrick, K. S., Griffiths, D. J. F., and Carr, A. M. (1994) Science 265, 533-535[Abstract/Free Full Text]
19. Peng, C-Y., Graves, P. R., Thoma, R. S., Wu, Z., Shaw, A. S., and Piwnica-Worms, H. (1997) Science 277, 1501-1505[Abstract/Free Full Text]
20. Kumagai, A., Yakowec, P. S., and Dunphy, W. G. (1998) Mol. Biol. Cell 9, 345-354[Abstract/Free Full Text]
21. Kumagai, A., Guo, Z., Emami, K. H., Wang, S. X., and Dunphy, W. G. (1998) J. Cell Biol. 142, 1559-1569[Abstract/Free Full Text]
22. Sanchez, Y., Wong, C., Thoma, R. S., Richman, R., Wu, Z., Piwnica-Worms, H., and Elledge, S. J. (1997) Science 277, 1497-1501[Abstract/Free Full Text]
23. Matsuoka, S., Huang, M., and Elledge, S. J. (1998) Science 282, 1893-1897[Abstract/Free Full Text]
24. Blasina, A., Van de Weyer, I., Laus, M. C., Luyten, W. H. M. L., Parker, A. E., and McGowan, C. H. (1999) Curr. Biol. 9, 1-10[CrossRef][Medline] [Order article via Infotrieve]
25. Halbert, C. L., Demers, G. W., and Galloway, D. A. (1992) J. Virol. 66, 2125-2134[Abstract/Free Full Text]
26. Jat, P. S., Cepko, C. L., Mulligan, R. C., and Sharp, P. A. (1986) Mol. Cell. Biol. 6, 1204-1217[Abstract/Free Full Text]
27. Miller, and Rosman. (1989) BioTechniques 7, 980-990[Medline] [Order article via Infotrieve]
28. Murakami, H., and Okayama, H. (1995) Nature 374, 817-819[CrossRef][Medline] [Order article via Infotrieve]
29. Kaneko, Y., Watanabe, N., Akita, H., Morisaki, H., Fujimoto, A., Tominaga, K., Ikeda, K., and Nakanishi, M. (1999) Oncogene, in press
30. Hirai, M., Suto, Y., and Kanoh, M. (1994) Cytogenet. Cell Genet. 66, 149-151[Medline] [Order article via Infotrieve]
31. Cahill, D. P., Lengauer, C., Yu, J., Riggins, G. J., Willson, J. K. V., Markowitz, S. D., Kinzler, K. W., and Vogelstein, B. (1998) Nature 392, 300-303[CrossRef][Medline] [Order article via Infotrieve]
32. Versteege, I., Sevenet, N., Lange, J., Rousseau-Merck, M.-F., Ambros, P., Handgretinger, R., Aurias, A., and Delattre, P. (1998) Nature 394, 203-206[CrossRef][Medline] [Order article via Infotrieve]
33. Sanchez, Y., Desany, B. A., Jones, W. J., Liu, Q., Wang, B., and Elledge, S. J. (1996) Science 271, 357-360[Abstract]
34. Lindsay, H. D., Griffiths, D. J., Edwards, R. J., Christensen, P. U., Murray, J. M., Osman, F., Walworth, N., and Carr, A. M. (1998) Genes & Dev. 12, 382-395
35. Khanna, K. K., and Lavin, M. F. (1993) Oncogene 8, 3307-3312[Medline] [Order article via Infotrieve]
36. Xu, Y., and Baltimore, D. (1996) Genes & Dev. 10, 2401-2410[Abstract/Free Full Text]
37. Nakanishi, M., Adami, G. R., Robetorye, R. S., Noda, A., Venable, S. F., Dimitrov, D., Pereira-Smith, O. M., and Smith, J. R. (1995) Proc. Natl. Acad. Sci U. S. A. 92, 4532-4536[Abstract/Free Full Text]
38. Sasaki, M. S., and Taylor, A. M. (1994) Mutat. Res. 307, 107-113[Medline] [Order article via Infotrieve]
39. Tanikawa, M., Yamada, K., Tominaga, K., Morisaki, H., Kaneko, Y., Ikeda, K., Suzuki, M., Kiho, T., Tomokiyo, K., Furuta, K., Noyori, R., and Nakanishi, M. (1998) J. Biol. Chem. 273, 18522-18527[Abstract/Free Full Text]
40. Duthu, A., Debuire, B., Romano, J., Ehrhart, J. C., Fishcella, M., May, E., Appella, E., and May, P. (1992) Oncogene 7, 2161-2167[Medline] [Order article via Infotrieve]
41. Yin, Y., Tainsky, M. A., Bischoff, F. G., Strong, L. C., and Wahl, G. M. (1992) Cell 70, 937-948[CrossRef][Medline] [Order article via Infotrieve]
42. Yaginuma, Y., and Westphal, H. (1991) Cancer Res. 51, 6506-6509[Abstract/Free Full Text]
43. Biggs, J. R., Kudlow, J. E., and Kraft, A. S. (1996) J. Biol. Chem. 271, 901-906[Abstract/Free Full Text]
44. Fuse, T., Yamada, K., Asai, K., Kato, T., and Nakanishi, M. (1996) Biochem. Biophys. Res. Commun. 225, 759-763[CrossRef][Medline] [Order article via Infotrieve]
45. Segawa, K., Minowa, A., Sugasawa, K., Takano, T., and Hanaoka, F. (1993) Oncogene 8, 543-548[Medline] [Order article via Infotrieve]
46. Zalvide, J., and DeCaprio, J. A. (1995) Mol. Cell. Biol. 15, 5800-5810[Abstract]
47. Scheffner, M., Huibregtse, J. M., Vierstra, R. D., and Howley, P. M. (1993) Cell 75, 495-505[CrossRef][Medline] [Order article via Infotrieve]
48. Dyson, N., Howley, P. M., and Harlow, E. (1989) Science 243, 934-937[Abstract/Free Full Text]
49. Harrington, E. A., Bruce, J. L., Harlow, E., and Dyson, N. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11945-11950[Abstract/Free Full Text]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
G. Buscemi, L. Carlessi, L. Zannini, S. Lisanti, E. Fontanella, S. Canevari, and D. Delia
DNA Damage-Induced Cell Cycle Regulation and Function of Novel Chk2 Phosphoresidues
Mol. Cell. Biol., November 1, 2006; 26(21): 7832 - 7845.
[Abstract] [Full Text] [PDF]

Home page
 MutagenesisHome page
H. Niida and M. Nakanishi
DNA damage checkpoints in mammals
Mutagenesis, January 1, 2006; 21(1): 3 - 9.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
C.-M. Aliouat-Denis, N. Dendouga, I. Van den Wyngaert, H. Goehlmann, U. Steller, I. van de Weyer, N. Van Slycken, L. Andries, S. Kass, W. Luyten, et al.
p53-Independent Regulation of p21Waf1/Cip1 Expression and Senescence by Chk2
Mol. Cancer Res., November 1, 2005; 3(11): 627 - 634.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
H. I. de Vries, L. Uyetake, W. Lemstra, J. F. Brunsting, T. T. Su, H. H. Kampinga, and O. C. M. Sibon
Grp/DChk1 is required for G2-M checkpoint activation in Drosophila S2 cells, whereas Dmnk/DChk2 is dispensable
J. Cell Sci., May 1, 2005; 118(9): 1833 - 1842.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-H. Wei, Y.-F. Chou, Y.-H. Ou, Y.-H. Yeh, S.-W. Tyan, T.-P. Sun, C.-Y. Shen, and S.-Y. Shieh
TTK/hMps1 Participates in the Regulation of DNA Damage Checkpoint Response by Phosphorylating CHK2 on Threonine 68
J. Biol. Chem., March 4, 2005; 280(9): 7748 - 7757.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Matsui, Y. Katsuno, T. Inoue, F. Fujita, T. Joh, H. Niida, H. Murakami, M. Itoh, and M. Nakanishi
Negative Regulation of Chk2 Expression by p53 Is Dependent on the CCAAT-binding Transcription Factor NF-Y
J. Biol. Chem., June 11, 2004; 279(24): 25093 - 25100.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
H. K. Sluss, H. Armata, J. Gallant, and S. N. Jones
Phosphorylation of Serine 18 Regulates Distinct p53 Functions in Mice
Mol. Cell. Biol., February 1, 2004; 24(3): 976 - 984.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Haoudi, R. C. Daniels, E. Wong, G. Kupfer, and O. J. Semmes
Human T-cell Leukemia Virus-I Tax Oncoprotein Functionally Targets a Subnuclear Complex Involved in Cellular DNA Damage-Response
J. Biol. Chem., September 26, 2003; 278(39): 37736 - 37744.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Ishimi, Y. Komamura-Kohno, H.-J. Kwon, K. Yamada, and M. Nakanishi
Identification of MCM4 as a Target of the DNA Replication Block Checkpoint System
J. Biol. Chem., June 27, 2003; 278(27): 24644 - 24650.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Q. Yu, J. La Rose, H. Zhang, H. Takemura, K. W. Kohn, and Y. Pommier
UCN-01 Inhibits p53 Up-Regulation and Abrogates {gamma}-Radiation-induced G2-M Checkpoint Independently of p53 by Targeting Both of the Checkpoint Kinases, Chk2 and Chk1
Cancer Res., October 15, 2002; 62(20): 5743 - 5748.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
Y. Zheng, L. Li, H. Shen, E. M. Sturgis, S. A. Eicher, S. S. Strom, M. R. Spitz, and Q. Wei
Polymorphic hCHK2/hCds1 codon 84 allele and risk of squamous cell carcinoma of the head and neck--a case-control analysis
Carcinogenesis, December 1, 2001; 22(12): 2005 - 2008.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Xie, H. Wu, Q. Wang, J. P. Cogswell, I. Husain, C. Conn, P. Stambrook, M. Jhanwar-Uniyal, and W. Dai
Plk3 Functionally Links DNA Damage to Cell Cycle Arrest and Apoptosis at Least in Part via the p53 Pathway
J. Biol. Chem., November 9, 2001; 276(46): 43305 - 43312.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. Vahteristo, A. Tamminen, P. Karvinen, H. Eerola, C. Eklund, L. A. Aaltonen, C. Blomqvist, K. Aittomaki, and H. Nevanlinna
p53, CHK2, and CHK1 Genes in Finnish Families with Li-Fraumeni Syndrome: Further Evidence of CHK2 in Inherited Cancer Predisposition
Cancer Res., August 1, 2001; 61(15): 5718 - 5722.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Matsuoka, T. Nakagawa, A. Masuda, N. Haruki, S. J. Elledge, and T. Takahashi
Reduced Expression and Impaired Kinase Activity of a Chk2 Mutant Identified in Human Lung Cancer
Cancer Res., July 1, 2001; 61(14): 5362 - 5365.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
E. A. Sausville, S. G. Arbuck, R. Messmann, D. Headlee, K. S. Bauer, R. M. Lush, A. Murgo, W. D. Figg, T. Lahusen, S. Jaken, et al.
Phase I Trial of 72-Hour Continuous Infusion UCN-01 in Patients With Refractory Neoplasms
J. Clin. Oncol., April 15, 2001; 19(8): 2319 - 2333.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
V. Gottifredi, O. Karni-Schmidt, S.-Y. Shieh, and C. Prives
p53 Down-Regulates CHK1 through p21 and the Retinoblastoma Protein
Mol. Cell. Biol., February 15, 2001; 21(4): 1066 - 1076.
[Abstract] [Full Text]

Home page
 Mol. Cell. Biol.Home page
I. Oishi, K. Iwai, Y. Kagohashi, H. Fujimoto, K.-I. Kariya, T. Kataoka, H. Sawa, H. Okano, H. Otani, H. Yamamura, et al.
Critical Role of Caenorhabditis elegans Homologs of Cds1 (Chk2)-Related Kinases in Meiotic Recombination
Mol. Cell. Biol., February 15, 2001; 21(4): 1329 - 1335.
[Abstract] [Full Text]