Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhan, D.
Right arrow Articles by Hermonat, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhan, D.
Right arrow Articles by Hermonat, P. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 44, 31619-31624, October 29, 1999


Binding of the Human Papillomavirus Type 16 p97 Promoter by the Adeno-associated Virus Rep78 Major Regulatory Protein Correlates with Inhibition*

DeJin ZhanDagger , Alessandro D. SantinDagger , Yong LiuDagger , Groesbeck P. ParhamDagger , Chunling LiDagger , Craig Meyers§, and Paul L. HermonatDagger

From the Dagger  Department of Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205 and the § Department of Microbiology and Immunology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Human papillomavirus type 16 (HPV-16) infection is positively associated with cervical cancer, whereas adeno-associated virus (AAV) infection is negatively associated with this same cancer. In earlier studies these two virus types have been shown to directly interact, with AAV inhibiting or enhancing papillomavirus functions depending upon the specific circumstances. One defined interaction between these two viruses is the ability of the AAV Rep78 major regulatory protein to inhibit gene expression of the E6 promoter of BPV-1 (bovine papillomavirus type 1) and HPV types 16 and 18. As Rep78 is a DNA binding transcription factor, we considered whether Rep78 might bind HPV-16 DNA. Here, Rep78 is demonstrated to bind a 44-base pair region (nucleotides 14-56) within the HPV-16 p97 promoter using the electrophoretic mobility shift assay. This region is important for HPV-16 because it includes functional Sp1 and E2 protein binding motifs as well as part of the origin of replication. Furthermore, two Rep78 amino acid substitution mutants, at positions 77 or 64-65, were identified that did not recognize p97 DNA. Both of these Rep78 mutants were found to be defective for inhibition of p97 promoter activity in HeLa and T-47D nuclear extracts in vitro, in a transient chloramphenicol acetyltransferase assay, as well as defective for full inhibition of HPV-16-directed focus formation. These data, taken together, strongly suggest that the Rep78-p97 promoter interaction is at least partially responsible for Rep78-mediated inhibition of HPV-16. Finally, the finding that Rep78 specifically recognizes p97 DNA is surprising because the p97 promoter region contains no GAGC motifs, the core motif for Rep78 recognition. These data suggest that the p97 promoter may represent a new prototypical DNA target type for Rep78.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Infection and DNA integration by certain human papillomavirus types (HPV)1 are central events in the generation of cervical cancer (1, 2). The most common HPV type associated with cervical cancer is HPV-16; roughly two-thirds of cervical cancers contain the DNA of this virus. Adeno-associated virus (AAV) is another virus commonly found in the anogenital region (3-6). Infection by AAV, in sharp contrast to the HPVs, is negatively associated with cervical cancer as demonstrated by the prevalence or titer of anti-AAV antibodies (7, 8). Bidirectional interaction has been observed between AAV and papillomaviruses. One such interaction is that papillomaviruses might serve as helpers for AAV (AAV is a helper-dependent parvovirus) (9), allowing for AAV DNA replication and virion production.

Our laboratory is exploring the hypothesis that AAV may regulate the role of HPVs in cervical carcinogenesis. In earlier studies (10-12) we demonstrated that AAV inhibits bovine papillomavirus type 1 (BPV-1) and HPV-16-induced oncogenic transformation. Others (13-15) have also observed AAV inhibition of BPV-1 and HPV-18. The effect has been mapped to the AAV encoded Rep78 protein, and this protein has been shown to inhibit expression of the papillomavirus promoter just upstream of the E6 gene (p89 of BPV-1, p97 of HPV-16, and p105 of HPV-18) (11, 13, 14, 16). In addition, Rep78 regulates a variety of heterologous genes. C-H-ras (17-19), c-fos (20, 21), c-myc (20, 21), and the human immunodeficiency virus long terminal repeat (HIV-LTR) (22, 23) are down-regulated by Rep78, whereas the c-sis promoter is up-regulated (24). Still other genes are not affected, such as the murine osteosarcoma virus long terminal repeat (MSV-LTR) (18) and the human beta -actin promoter (14). The largest of four products encoded by the AAV rep open reading frame (25), Rep78 is required for AAV DNA replication (26, 27) and for AAV gene regulation (28, 29). Rep78 carries out a range of biochemical activities that are necessary for its biological phenotypes (30, 31), including binding to promoter DNA (32-34) and to a variety of cellular proteins (36), such as the transcription factors Sp1 (37, 38) and TBP (39) as well as itself (40-42).

Because Rep78 is a DNA binding transcription factor, we considered whether Rep78 might bind to HPV-16 DNA and investigated the importance of this interaction by using Rep78 mutants in DNA binding. Here, it is demonstrated that the favored site for Rep78 binding within the HPV-16 genome was a region within the p97 promoter of the long control region (LCR), from nt 14 to 58. These findings are surprising because the p97 target sequence contains no GAGC (or GCTC) motifs, the core sequence of almost all Rep78 DNA recognitions. Furthermore, Rep78 mutants that are unable to bind DNA are also defective in their ability to fully inhibit HPV-16 (pL67R)-induced oncogenic transformation, demonstrating the importance of the Rep78-p97 DNA interaction.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Rep78 Affinity Chromatography Selection of HPV-16 DNA Fragments-- The BamHI fragment containing the complete HPV-16 genome (without plasmid sequences from pAT/HPV-16) was isolated by gel electrophoresis using the GeneClean II kit. This DNA was further digested with PstI, Klenow-labeled with [alpha 32P[lrsqb]dCTP, and cleaned by phenol extraction and ethanol precipitation. The Rep78 affinity chromatography was carried out using 50 µg of MBP-Rep78 bound to 100 µl of amylose resin (New England Biolabs). Klenow-labeled 32P-HPV-16 DNA (2 µg), digested by PstI and BamHI, was applied to the column in 100 µl of column buffer (20 mM Tris (pH 7.4), 200 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol) and incubated for 15 min at room temperature. After washing the column twice with 1 ml of column buffer, the bound DNA was eluted with 100 µl of 1% SDS, 20 mM Tris, pH 7.5. The eluted products were then analyzed by polyacrylamide gel electrophoresis (4%), dried, and autoradiographed.

DNA Substrates and the Electrophoretic Mobility Shift Assay (EMSA)-- HPV-16 and MSV-LTR DNA substrates were generated by polymerase chain reaction (PCR) amplification. The AAV terminal repeat (TR) substrate was generated by the ligation of three separate synthetic oligonucleotides as described previously (43). The TR was 5' end-labeled with polynucleotide kinase using [32P]ATP (5000 Ci/mmol, Amersham Pharmacia Biotech). Single-stranded DNA substrates were generated by asymmetric PCR amplification as described previously (44). EMSA was carried out as follows; approximately 1 ng of 32P-labeled DNA substrate was incubated with increasing amounts of MBP-Rep78 for 10 min at room temperature in binding buffer (25 mM HEPES KOH, pH 7.5, 10 mM MgCl2, 1 mM dithiothreiotol, 2% glycerol, 25 µg of bovine serum albumin, 50 mM NaCl, 0.01% Nonidet P-40, and 0.5 µg poly(dI-dC)). Samples were electrophoresed in a 4% polyacrylamide gel (40:1 acrylamide and bis-acrylamide weight ratio) with 5% glycerol in 0.5× TBE buffer at 100 V for approx. 3 h. Gels were dried and autoradiographed at -70 °C.

Construction of Rep78 Mutant Plasmids, pMAL-Rep-64LH65TM and pMal-Rep-77LG, and Production of MBP-Rep78 Chimeric Proteins-- The construction of the plasmid pMAL-Rep-64LH65TM from which mutant MBP-64LH65TM protein is produced has been described previously (45, 46). The plasmid pMal-Rep-77LG was similarly constructed using a different mutagenic oligonucleotide (5'-CCCCGGAGGCCGAATTCTTTGTGCAA) and the M13-based plasmid pALTER-AAV3 (containing all of the AAV genes). A second oligonucleotide created a SphI restriction site immediately upstream of the Rep78 open reading frame. The mutations were initially characterized by the generation of a new restriction site and were further verified by DNA sequencing with Sequenase (U. S. Biochemical Corp.) according to the manufacturer's recommendations. The mutant Rep78 open reading frames were then transferred into pMALc2 on an SphI and XhoI fragment (nt 321-2233) to generate pMAL-Rep-64LH65TM and pMAL-Rep-77LG. Both the mutant and wild type fusion proteins with MBP were purified by affinity chromatography using amylose resin following the kit directions of the manufacturer (Protein Purification and Expression System, New England Biolabs). Fractions were collected and analyzed by SDS-polyacrylamide gel electrophoresis. Purified fractions were concentrated using Centricon 10-kDa cut-off membrane filters (Amicon). These procedures routinely resulted in MBP-Rep78 and 64LH65TM proteins of 70-90% purity with a yield of 20 µg/100 ml bacterial culture.

Construction of Full-length AAV Genomes (FLAG) Carrying the Rep78 Mutations-- The Bsa I fragment (4.2 kb, containing all of the AAV genes) from pALTER-AAV-64LH65TM and pALTER-AAV-77LG were isolated and ligated to the BsaI partial digestion fragment (4.9 kb, containing pBR322 plus the AAV TRs) from pSM620 (47) to generate pFLAG-64LH65TM and pFLAG-77LG. To ensure that the mutations were transferred into the full-length AAV background, the region of the mutation was once again sequenced as described above.

In Vitro Transcription Analysis of p97 Promoter Activity-- An HPV-16 p97-CAT DNA fragment was used as a template for transcription. The p97-CAT DNA fragment was generated by PCR amplification using primer 1 (5'ACAAGCAGGATTGAAGGCCA, HPV-16 nt 7043-7065) complementary to the p97 sequences) and primer 2 (5' CATATCACCAGC TCACCGTC, nt 615-633 of pSV2CAT) complementary to the CAT sequences). The plasmid p16P (p97-CAT) was used as the original PCR template (48). This produced a 1.2-kb product. A 25-µl reaction mixture contained 0.5 µg of DNA template, 20 mM HEPES, pH 7.9, 5 mM MgCl2, 100 mM KCl. 0.5 mM dithiothreitol, 20% glycerol, 25 µM [32P]GTP, 400 µM ATP, CTP, and UTP, and 8 units of Hela nuclear extract (Promega, HPV-positive cervical cancer) or 5 µg of T-47D nuclear extract (Geneka Corp., HPV-negative breast ductal carcinoma). Reactions were incubated at 30 °C for 60 min and then terminated by adding 175 µl of Stop solution containing 300 mM Tris-HCl, pH 7.9, 0.5% SDS, 300 mM sodium acetate, 2 mM EDTA, and 3 µg/ml tRNA. RNA was extracted with phenol-chloroform, precipitated with ethanol, and finally dissolved in 10 µl of formamide containing 0.1% each of xylene cyanol and bromphenol blue. Samples were analyzed on a 6% polyacrylamide, 7 M urea gel, dried, and autoradiographed. A p97-specifc RNA product of approximately 300 bases results.

Transient Chloramphenicol Acetyltransferase Assay-- Transient CAT assays were carried out by calcium phosphate transfection of the p16P (p97-CAT) plasmid plus several AAV plasmids (amounts indicated within the figure legend). Forty-eight hours after transfection cell extracts were prepared, equalized for protein content by spectroscopic analysis at 280 nm, and assayed as described previously (48, 11).

Focus Formation Assay-- Contact-inhibited murine C127 mouse fibroblasts were calcium phosphate-transfected with 3 µg of the HPV-16/ras chimeric plasmid, pL67R (13) plus 6 ug of either pSM620 (+Rep78, wild type), dl10-37 (-Rep78, large deletion) (26), pFLAG-64LH65TM, or pFLAG-77LG. The plasmid pL67R contains the EJ-H-ras coding sequences ligated in place of the E1 gene (11). Thus, pL67R contains three oncogenes (E6, E7, and ras), all of which are expressed from the p97 promoter. The cells were fed for 2.5 weeks, fixed with formaldehyde, and stained with methylene blue.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Rep78 Recognizes the p97 Promoter DNA-- To observe whether Rep78 bound to HPV-16 DNA, we initially utilized Rep78 affinity chromatography. MBP-Rep78, bound to amylose resin, was incubated with 32P-labeled HPV-16 DNA fragments generated from PstI and BamHI double digestion. After washing and elution, the products were agarose gel-electrophoresed adjacent to unselected HPV-16 fragments. As shown in Fig. 1A, although a few partial digestion products were present, it was clear that it was the 1.8-kb fragment (nt 7003-875) of HPV-16 that was preferentially recognized by Rep78.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1.   Rep78 recognizes sequences from the HPV-16 p97 promoter. Shown are affinity chromatography and EMSA experiments identifying the region of HPV-16 to which Rep78 binds. The amount of protein added is given in micrograms in parentheses. A, Rep78 binds a 1.8-kb PstI fragment from HPV-16 (nt 7003-875). Rep78 affinity chromatography was used to select 32P-labeled PstI, BamHI double-digested HPV-16 DNA. Note that the 1.8-kb fragment, which contains the HPV-16 LCR, is preferentially bound by Rep78. B, Rep78 preferentially binds sequences from the HPV-16 LCR, nt 7841-106, compared with an equal size fragment from the MSV-LTR by EMSA analysis. The number in parentheses is the amount of protein added, shown in micrograms. C, as determined by EMSA analysis, Rep78 preferentially binds nt 14-106 compared with 7841-13. D, as determined by EMSA analysis, Rep78 preferentially binds nt 14-56 compared with 57-106.

Within the 1.8-kb fragment lies the LCR of HPV-16, which contains central cis elements (origin of replication, enhancers, and promoters) essential for HPV-16 biological function. Furthermore, Rep78 is a viral transcription factor known to bind promoter DNA (32-34). Thus, we reasoned that Rep78 might be targeting the origin of replication/p97 region within this fragment because of Rep78's known modulation of the HPV-16 p97 and HPV-18 p105 promoters (10-12, 14) as well as its modulation of BPV-1 DNA replication (49). To map the region of binding, sequentially smaller substrates from this region were tested for recognition by Rep78 (Fig. 1, B and C) by EMSA analysis. In Fig. 1B, Rep78 was shown to strongly recognize the HPV-16 sequences from nt 7814 to 106 (p97), whereas it does not significantly recognize a similarly sized analogous fragment from the MSV-LTR. These data clearly indicate that there is a specific recognition of the p97 DNA well above nonspecific binding. As mentioned earlier, Rep78 is able to inhibit expression from p97, but it has little effect on the MSV-LTR (18). Thus, we hypothesized that Rep78 binding of promoter DNA might be associated with an ability to regulate p97 expression. In Fig. 1C, the target sequence was further defined to be in the 3' half of this region (nt 14-106, hereinafter referred to as "p97"). Finally, in Fig. 1D, a strong target sequence for Rep78 binding is shown to be contained within nt 14-56. Fig. 2 shows the sequences of this region. Note that the nt 14-56 sequences contain an intact E2 binding motif and an Sp1 binding motif. These sequences also partially overlap the HPV-16 origin of replication and E1 binding regions.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   Sequences of the HPV-16 p97 promoter. Shown are important elements (labeled boxes) within the immediate p97 region.

The E2 motifs are interrupted palindromes and can potentially form hairpin structures. There are also other interrupted palindromic sequences present within the p97 promoter region (nt 14-106). The DNA substrate that has formed some degree of secondary structure (2ndS) was observed in the EMSA gels as an elevated band over the lower simple duplex (dup) DNA substrate. It is this higher band that is the preferred substrate for Rep78 recognition as demonstrated most clearly in Fig. 1B. This preference for DNA substrates with secondary structure has also been seen in Rep78 recognition of the TAR region DNA of human immunodeficiency virus type 1 (50). To test the possibility that Rep78 was recognizing secondary structure, the + and - strands of the p97 sequence were generated separately by single-sided PCR. Such single-stranded DNA should naturally form secondary structure just as single-stranded RNA does. The 32P-labeled + and - strands were compared by EMSA for Rep78 recognition as shown in Fig. 3. As shown, the - strand was strongly recognized by Rep78, whereas the + strand was not. These data suggest that Rep78 may be recognizing both secondary structure and the specific sequence of the DNA.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3.   Rep78 specifically binds the minus (-) strand of p97. Shown is an EMSA analysis of Rep78 interaction with either the + or the - strand of p97 (nt 14-106). The + and - strands were generated by asymmetric PCR amplification. Note that Rep78 preferentially binds the minus strand of p97.

Two Rep78 Amino Acid Substitution Mutants Are Defective for Binding p97 Promoter DNA-- Our laboratory has generated Rep78 mutant proteins with specific amino acid substitutions for study in dissecting the functions and domains of Rep78. The mutant Rep78 proteins were produced as fusions with the maltose binding protein, as described previously (45, 46). During the characterization of a MBP-Rep78 mutant protein, Rep-77LG (substituting a glutamine for a leucine at amino acid 77), it was found to be able to bind an AAV TR DNA substrate at levels comparable with wild type MBP-Rep78, as shown in Fig. 4A. In contrast, Rep-77LG was defective in recognizing the p97 promoter, as shown in Fig. 4B. In these experiments the wild type MBP-Rep78 and Rep-64LH65TM proteins served as the positive and negative controls, with Rep-64LH65TM unable to bind any DNA substrate thus far assayed by EMSA (46, 51). Thus, both Rep-64LH65TM and Rep-77LG were defective for binding p97. However, Rep-77LG was particularly interesting as it was able to distinguish between the TR and p97 substrates. This finding suggests to us that the mechanism of recognition used by Rep78 to bind the AAV TR was different, at least in part, than that for recognizing p97.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4.   Rep78 mutant proteins defective in binding AAV TR and the p97 DNA substrates. A. Shown is an EMSA analysis of wild type and mutant Rep78 proteins binding to AAV TR DNA. Note that Rep-64LH65TM does not bind the AAV TR, whereas wild type and Rep-77LG do. B, shown is an EMSA analysis of wild type and mutant Rep78 proteins binding to p97 DNA (nt 14-106). Note that in contrast to A, both Rep-64LH65TM and Rep-77LG are unable to bind p97. Thus, Rep-77LG can distinguish between the TR and p97 substrates.

Rep78 Mutants Defective for Binding p97 Are Also Defective for Inhibition of p97 Promoter Activity-- We next wanted to observe the possible effects of Rep78 protein DNA binding on p97 promoter activity. In vitro transcription was used to study the effects of these proteins. Thus, various amounts of all three proteins (wild type, Rep-64LH65TM, and Rep-77LG) were added to HeLa and T-47D cell nuclear extracts containing a p97 DNA template. The experiments were done four times using HeLa extracts and twice using T-47D extracts, and all gave similar results. Representative experiments are shown in Fig. 5. As seen, the addition of increasing amounts of MBP-Rep78 inhibited RNA initiation from the p97 promoter in a dosage-dependent manner. In sharp contrast to MBP-Rep78, the addition of increasing amounts of Rep-64LH65TM and Rep-77LG protein had little effect on p97 promoter activity in both cell types. Thus, both of the Rep78 mutants defective for binding p97 DNA were also defective for inhibition of p97 promoter activity. A CAT assay was also utilized to further verify the effect of Rep78 on the p97 promoter. SW13 breast cancer cells were calcium phosphate-transfected with the plasmid p16P, which contains the CAT coding sequences expressed from p97 (48). FLAG plasmids, pSM620 (wild type Rep78), FLAG-64LH65TM, and FLAG-77LG, were co-transfected with p16P. As indicated by their names, the FLAG plasmids contained the same mutated Rep78 sequences as were present in the pMal-based plasmids used to generate the mutant proteins. The basal expression control plate was transfected with the AAV plasmid dl10-37, which contains a large deletion within the Rep78 sequences. The results are shown in Fig. 6 and demonstrate, similar to the in vitro transcription assays, that Rep78 inhibits p97 activity although Rep-64LH65TM and Rep-77LG does not.


View larger version (87K):
[in this window]
[in a new window]
 
Fig. 5.   Rep78 mutant proteins Rep-64LH65TM and Rep-77LG are defective for inhibiting p97 promoter activity in in vitro transcription assays. Shown are representative in vitro transcription experiments based on HeLa cell nuclear extracts (HPV-positive) (A) or T-47D cell nuclear extracts (HPV-negative) (B). These experiments were carried out as described under "Experimental Procedures." Note that when MBP-Rep78 was added to the reaction, the generation of the p97 RNA product was inhibited in a dosage dependent manner in both the HeLa and T-47D extracts. In sharp contrast the addition of MBP-Rep78 mutant proteins Rep-64LH65TM and Rep-77LG had little or no effect on accumulated p97 transcript levels.


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 6.   AAV Rep78 mutant genomes FLAG-64LH65TM and FLAG-LG are defective for inhibiting p97 promoter activity by CAT assay. SW13 cells were calcium phosphate-co-transfected with 4 µg of p16P plasmid plus different amounts of one of four AAV plasmids. The plasmid p16P contains the CAT coding sequences expressed from the HPV-16 P97 promoter. Co-transfection of dl10-37 (large deletion within Rep78) served as a negative control for inhibition. Co-transfection with increasing doses of pSM620 (2, 4, and 8 µg, wild type Rep78) served as a positive control for inhibition. Mutants FLAG-64LH65TM and FLAG-77LG were similarly cotransfected. Two days after transfection, cellular extracts, equalized for protein content, were assayed for CAT activity. Note that pSM620 was able to inhibit p97 activity, whereas Rep-64LH65TM and Rep-77LG were defective.

Rep78 Mutants Defective for Binding p97 Are Also Defective for Full Inhibition of HPV-16-induced Oncogenic Transformation-- To further observe the biological significance of Rep78-p97 interaction, we assayed the above Rep78 mutants (Rep-77LG and Rep-64LH65TM), which were unable to bind p97 and unable to inhibit p97 transcription, for their ability to inhibit HPV-16 p97-directed oncogenic transformation. The FLAG-77LG and FLAG-64LH65TM mutant genomes were then tested in a C127 cell-based, HPV-16-induced focus formation assay. We utilized an HPV-16/ras chimeric plasmid, pL67R, in which the E1 gene is replaced by the EJ-H-ras coding sequences (11, 12). This construct, expressing three oncoproteins from the p97 promoter, has higher transforming activity than HPV-16 alone (11). Dl10-37 (Rep78-negative) and pSM620 served as the negative and positive controls, respectively. Plates of C127 cells were calcium phosphate-transfected with pL67R (3 µg) plus one of the indicated AAV plasmids (6 µg). After 2.5 weeks, the cells were formaldehyde-fixed and methylene blue-stained, and the foci were counted. The results are shown in Fig. 7. Note that both FLAG-64LH65TM and FLAG-77LG were defective when compared with pSM620 (wild type Rep78) for inhibiting pL67R. Two additional transfection sets gave similar results. As transformation by L67R is dependent on the p97 promoter, these data strongly suggest that the Rep78-p97 interaction is important for Rep78 inhibitory ability.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7.   AAV Rep78 mutant genomes FLAG-64LH65TM and FLAG-LG are defective for inhibiting HPV-16 oncogenic transformation. Shown is a representative of three focus formation assays. C127 contact-inhibited murine fibroblasts were calcium phosphate-transfected with 3 µg of pL67R plus 6 µg of the indicated AAV plasmid. Dl10-37 and pSM620 are the controls, encoding a large deleted Rep78 and wild type Rep78, respectively. Note that FLAG-64LH65TM and FLAG-77LG are significantly defective in inhibiting pL67R oncogenic transformation compared with pSM620.

Rep78-p97 Interaction Is Not as Strong as Rep78-TR Interaction-- To compare the affinities of Rep78 for the AAV TR and HPV-16 p97 DNA substrates, a series of competitive EMSA experiments was undertaken. As shown in Fig. 8A, unlabeled TR DNA competitor was able to strongly inhibit wild type Rep78-32P-TR interaction, whereas unlabeled p97 DNA (nt 14-106) competitor was not. Unlabeled p97 DNA competitor was also not able to inhibit Rep-77LG-TR interaction. In Fig. 8B it is shown that both unlabeled TR and p97 competitors are able to successfully inhibit wild type Rep78-32P-p97 interaction but that the TR is the more effective competitor. These data are consistent with Rep78 having a higher affinity for the AAV TR (its natural substrate with GCTC3) than the HPV-16 p97 promoter (lacking GCTC motifs). These data are also consistent with the interpretation of our other data (shown in Fig. 5) that the mechanism of Rep78 recognition of p97 DNA is different from Rep78 recognition of TR DNA.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 8.   Rep78-p97 interaction is not as strong as Rep78-TR interaction. A, shown is a competitive EMSA experiment analyzing wild type and 77LG Rep78 proteins binding to a 32P-labeled TR substrate with competition from unlabeled TR and p97 DNA. Three doses of competitor DNA (0.1, 0.5, and 1 µg) were added as indicated by the triangles. Note that TR DNA is a better competitor than p97. B, shown is a competitive EMSA experiment of wild type Rep78 protein binding to a 32P-labeled p97 substrate with competition from unlabeled TR and p97 DNA. Three doses of competitor DNA (0.1, 0.5, and 1 µg) were added as indicated by the triangles. Again, note that TR DNA is a better competitor than p97.

Rep78 Also Recognizes a Region of BPV-1, the p89 Promoter Region-- The BPV-1 LCR also contains multiple E2 motifs within the E6 promoter (p89). Thus, we tested whether Rep78 might bind to a sequence (nt 7758-7930) from p89, which contains two such motifs in close proximity. The EMSA results, shown in Fig. 9A, demonstrate that Rep78 is able to recognize and bind E2 motif DNA from BPV-1 p89. Fig. 9B shows that, as with the Rep78-p97 interaction, both the unlabeled BPV-1 p89 and the AAV TR DNAs were able to compete against Rep78-32P-BPV-1 LCR interaction; however, TR DNA was the better competitor.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 9.   Rep78 binds sequences of the BPV-1 long control region. A, shown is an EMSA in which Rep78 binds to the BPV-1 LCR (nt 7758-7030). Note that the DNA-protein complex occurs in a dosage-dependent manner with increasing addition of MBP-Rep78. These LCR sequences contain two E2 motifs. B, shown is a competitive EMSA demonstrating that the AAV TR is a better competitor than the BPV-1 LCR itself. 0.1 µg of MBP-Rep was added as indicated. Four doses of synthetic competitor DNA (1, 5, 20, and 40 ng) were added as indicated by the triangles. Note that the MSV-LTR DNA is not an effective competitor compared with the BPV LCR DNA.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study demonstrates that the AAV Rep78 protein meaningfully binds to the p97 promoter of HPV-16. This binding, although not as strong as Rep78-AAV TR interaction, is clearly above the so-called "nonspecific" DNA-binding ability of Rep78 as determined by the experiments presented in Fig. 1. The importance of this interaction is supported by the finding that two AAV mutants (FLAG-64LH65TM and FLAG-77LG) in which the Rep78 proteins are unable to recognize the HPV-16 LCR p97 target are defective for in vitro transcriptional inhibition of p97 and for the inhibition of HPV-16 directed oncogenic transformation. It should also be noted that Rep78 is unable to significantly affect expression from the MSV-LTR (18) and that Rep78 is also unable to bind the partial (33, 51) or the full-length sequence of this promoter (Fig. 1B). How the binding of Rep78 to p97 promoter DNA specifically affects HPV-16 expression is not known. As this region contains active Sp1 (52, 53) and E2 (54, 55) motifs, one mechanistic possibility might be that Rep78, while bound to p97, sterically inhibits these other transcription factors from binding. This hypothesis can be tested. It should be pointed out that Rep78 inhibition of pL67R gene expression cannot involve E2 because E2 is not present in this experiment. Another possibility might be that Rep78, by binding to p97, puts Rep78 in a favorable position to interact with other transcription factors that are also binding to the promoter DNA or other proteins within the transcription initiation complex. Yet a third possibility may be that by binding DNA an inhibitory domain of Rep78 is down-regulated. Rep78 is known to bind a variety of cellular proteins (36), including Sp1 (37), TBP (39), and TAFIIp110.2

One previous relevant study undertaken by Horer et al. (14) attempted to identify the cis-responsible element within the analogous p105 promoter of HPV-18 (14). Their results, obtained by the deletion and mutation of sequences along the length of the p105 promoter, were inconclusive for finding a specific responsible element. Their interpretation of this data was that the mechanism of inhibition was complex and involved multiple components. Our data may suggest such complexity, for although the phenotypes of mutants Rep-64LH65TM and Rep-77LG are quite strong in Figs. 4-6, it is also clear that they are still able to mildly inhibit oncogenic transformation (Fig. 7; only small foci were generated). It is reasonable to suggest that Rep78 protein-protein interactions may also be involved in these other inhibitory pathways. In addition to the ability of Rep78 to meaningfully interact with transcription factors, in preliminary experiments we have also been able to observe Rep78-E7 oncoprotein interaction using Western blot, affinity chromography, and yeast GAL4 two-hybrid cDNA analyses.2

Our finding that Rep78 binds HPV-16 p97 is mildly surprising because this target sequence contains no GAGC motifs, the core sequence of most Rep78 DNA recognitions. Rep78 binding to promoter sequences has been observed previously, including in the AAV p5 promoter (32), the c-H-ras promoter (33), the human immunodeficiency virus long terminal repeat TAR region (50, 51), and the cytomegalovirus immediate early promoter (34). All of these promoters have GAGC (or GCTC) motifs, and binding by the large Rep proteins (78/68) appears to be required for the inhibition of the AAV p5 promoter (56) and the HIV-LTR (51). In experiments using Rep78 affinity selection of random DNA sequences, the consensus target sequence contained a duplex GAGC motif (57). However a small subset of these selected sequences had no GAGC motifs. Thus, there is a precedent for Rep78 binding DNA without GAGC motifs. However, none of these sequences have significant homology with p97. Furthermore, none of the random selected sequences contain interrupted palindromes such as are present in p97. As we have also observed that Rep78 binds a region within the BPV-1 LCR, which contains two E2 motifs, we suspect that these motifs are the specific target for Rep78 recognition. The AAV TRs, the natural and favored substrate of Rep78, also have significant secondary structure; we believe this further strengthens the argument that such structures (E2 or otherwise) are possibly involved in Rep78 recognition of p97. However, the phenotype of Rep-77LG suggests that Rep78 recognition of AAV TR DNA is different from its recognition of p97. The finding that Rep78 specifically recognizes the negative strand of the p97 promoter is novel (Fig. 3). These data further indicate that Rep78 discriminates between single-stranded DNA substrates, by sequence, as it does for double-stranded substrates. Finally, Rep78 binding to p97 may also inhibit the E1-E2 complex from binding the origin of replication that is located just upstream (35, 58, 59). Rep78 is known to inhibit BPV-1 DNA replication (49). This study extends our knowledge of how AAV and papillomaviruses interact and will help to further reveal the mechanism of action of Rep78 regulation on gene expression.

    ACKNOWLEDGEMENTS

We thank Dr. Peter Howley for the plasmids p16P and p142-6 and Dr. Richard Schlegel for the plasmid pAT/HPV-16.

    FOOTNOTES

* This study was funded by National Institutes of Health Grants CA55051 and IA42764 (to P. L. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Obstetrics and Gynecology, Slot 518, University of Arkansas for Medical Sciences, 4301 West Markham St., Little Rock, AR 72205. Tel.: 501-686-5046; Fax: 501-686-5784; E-mail: HermonatPaulL@exchange.uams.edu.

2 D.-J. Zhan and P. L. Hermonat, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: HPV, human papillomavirus; AAV, adeno-associated virus; BPV, bovine papillomavirus; LTR, long terminal repeat; TR, terminal repeat; HIV, human immunodeficiency virus; MSV, murine osteosarcoma virus; LCR, long control region; nt, nucleotide(s); kb, kilobase (pairs); EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; FLAG, full-length AAV genomes; CAT, chloramphenicol acetyltransferase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Durst, M., Gissman, L., Ikenberg, H., and zur Hausen, H. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 3812-3815[Abstract/Free Full Text]
2. Cullen, A. P., Reid, R., Campion, M., and Lorincz, A. T. (1991) J. Virol. 65, 606-612[Abstract/Free Full Text]
3. Blacklow, N. R., Hoggan, M. D., and Rowe, W. P. (1967) Proc. Natl. Acad. Sci. U. S. A. 58, 1410-1415[Free Full Text]
4. Bantel-Schaal, U., and zur Hausen, H. (1984) Virology 134, 52-63[CrossRef][Medline] [Order article via Infotrieve]
5. Tobiasch, E., Rabreau, M., Geletneky, K., Larue-Charlus, S., Severin, F., Becker, N., and Schlehofer, J. R. (1995) J. Med. Virol. 44, 215-222
6. Han, L., Parmley, T. H., Keith, S., Kozlowski, K. J., Smith, L. J., and Hermonat, P. L. (1996) Virus Genes 12, 47-52[CrossRef][Medline] [Order article via Infotrieve]
7. Mayor, H. D., Drake, S., Stahmann, J., and Mumford, D. M. (1976) Am. J. Obstet. Gynecol. 126, 100-105[Medline] [Order article via Infotrieve]
8. Georg-Fries, B., Biederlack, S., Wolf, J., and zur Hausen, H. (1984) Virology 134, 64-71[CrossRef][Medline] [Order article via Infotrieve]
9. Walz, C., Deprez, A., Dupressoir, T., Durst, M., Rabreau, M., and Schlehofer, J. R. (1997) J. Gen. Virol. 78, 1441-1452[Abstract]
10. Hermonat, P. L. (1989) Virology 172, 253-261[CrossRef][Medline] [Order article via Infotrieve]
11. Hermonat, P. L. (1994) Cancer Res. 54, 2278-2281[Abstract/Free Full Text]
12. Hermonat, P. L., Plott, R. T., Santin, A. D., Parham, G. P., and Flick, J. T. (1997) Gynecol. Oncol. 66, 487-494[CrossRef][Medline] [Order article via Infotrieve]
13. Schmitt, J., Schlehofer, J. R., Mergener, K., Gissman, L., and zur Hausen, H. (1989) Virology 172, 73-81[CrossRef][Medline] [Order article via Infotrieve]
14. Horer, M., Weger, S., Butz, K., Hoppe-Seyler, F., Geisen, C., and Kleinschmidt, J. A. (1995) J. Virol. 69, 5485-5496[Abstract]
15. Su, P. F., and Wu, F. Y. (1996) Br. J. Cancer 73, 1533-1537[Medline] [Order article via Infotrieve]
16. Hermonat, P. L., Meyers, C., Parham, G. P., and Santin, A. D. (1998) Virology 247, 240-250[CrossRef][Medline] [Order article via Infotrieve]
17. Katz, E., and Carter, B. J. (1986) Cancer Res. 46, 3023-3026[Abstract/Free Full Text]
18. Hermonat, P. L. (1991) Cancer Res. 51, 3373-3377[Abstract/Free Full Text]
19. Khleif, S. N., Myers, T., Carter, B. J., and Trempe, J. P. (1991) Virology 181, 738-741[CrossRef][Medline] [Order article via Infotrieve]
20. Klein-Bauernschmitt, P., zur Hausen, H., and Schlehofer, J. R. (1992) J. Virol. 66, 419-4200
21. Hermonat, P. L. (1994b) Cancer Lett. 81, 129-136[CrossRef][Medline] [Order article via Infotrieve]
22. Rittner, K., Heilbronn, R., Kleinschmidt, J. A., and Sczakiel, G. (1992) J. Gen. Virol. 73, 2977-2981[Abstract/Free Full Text]
23. Antoni, B. A., Rabson, A. B., Miller, I. L., Trempe, J. P, Chejanovsky, N., and Carter, B. J. (1991) J. Virol. 64, 396-404
24. Wonderling, R. S., and Owens, R. A. (1996) J. Virol. 70, 4783-4786[Abstract]
25. Mendleson, E., Trempe, J. P., and Carter, B. J. (1986) J. Virol. 60, 823-832[Abstract/Free Full Text]
26. Hermonat, P. L., Labow, M. A., Wright, R., Berns, K. I., and Muzyczka, N. (1984) J. Virol. 51, 329-333[Abstract/Free Full Text]
27. Tratschin, J-D., Miller, I. L., and Carter, B. J. (1994) J. Virol. 51, 611-619
28. Labow, M. A., Hermonat, P. L., and Berns, K. I. (1986) J. Virol. 60, 251-258[Abstract/Free Full Text]
29. Tratschin, J-D., Tal, J., and Carter, B. J. (1986) Mol. Cell. Biol. 5, 3251-3260
30. Im, D. S., and Muzyczka, N. (1990) Cell 61, 447-457[CrossRef][Medline] [Order article via Infotrieve]
31. Ni, T. H., Zhou, X., McCarty, D. M., Zolotukhin, I., and Muzyczka, N. (1994) J. Virol. 68, 1128-1138[Abstract/Free Full Text]
32. McCarty, D. M., Pereira, D. J., Zolotukhin, I., Zhou, X., Ryan, J. H., and Muzyczka, N. (1994) J. Virol. 74, 4988-4997[Abstract/Free Full Text]
33. Batchu, R. B., Kotin, R. M., and Hermonat, P. L. (1994) Cancer Lett. 86, 23-31[CrossRef][Medline] [Order article via Infotrieve]
34. Wonderling, R. S., and Owens, R. A. (1996) J. Virol. 71, 2528-2534[Abstract]
35. Sarafi, T. R., and McBride, A. A. (1995) Virology 211, 385-396[CrossRef][Medline] [Order article via Infotrieve]
36. Hermonat, P. L., Santin, A. D., Carter, C. A., Parham, G. P., and Quirk, J. G. (1997b) Biochem. Mol. Biol. Int. 403, 409-420
37. Hermonat, P. L., Santin, A. D., and Batchu, R. B. (1996) Cancer Res. 56, 5299-5304[Abstract/Free Full Text]
38. Pereira, D. J., and Muzyczka, N. (1997) J. Virol. 71, 1747-1756[Abstract]
39. Hermonat, P. L., Santin, A. D., Batchu, R. B., and Zhan, D.-J. (1998) Virology 245, 120-127[CrossRef][Medline] [Order article via Infotrieve]
40. Weitzman, M. D., Kyostio, S. R., Carter, B. J., and Owens, R. A. (1996) J. Virol. 70, 2440-2448[Abstract]
41. Hermonat, P. L., and Batchu, R. B. (1997) FEBS Lett. 401, 180-184[CrossRef][Medline] [Order article via Infotrieve]
42. Smith, R. H., Spano, A. J., and Kotin, R. M. (1997) J. Virol. 71, 4461-4471[Abstract]
43. Bishop, B. M., Santin, A. D., Quirk, J. G., and Hermonat, P. L. (1996) FEBS Lett. 397, 97-100[CrossRef][Medline] [Order article via Infotrieve]
44. Gyllensten, U. B., and Erlich, H. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7652-7656[Abstract/Free Full Text]
45. Batchu, R. B., Miles, D. A., Rechtin, T. M., Drake, R. R., and Hermonat, P. L. (1995) Biochem. Biophy. Res. Commun. 208, 714-720[CrossRef][Medline] [Order article via Infotrieve]
46. Batchu, R. B., and Hermonat, P. L. (1995) Biochem. Biophy. Res. Commun. 210, 717-725[CrossRef][Medline] [Order article via Infotrieve]
47. Samulski, R. J., Berns, K. I., Tan, M., and Muzyczka, N. (1982) Proc. Natl. Acad. Scii. U. S. A. 79, 2077-2081[Abstract/Free Full Text]
48. Romanczuk, H., Therry, F. T., and Howley, P. M. (1990) J. Virol. 64, 2849-2859[Abstract/Free Full Text]
49. Hermonat, P. L. (1992) Virology 189, 329-333[CrossRef][Medline] [Order article via Infotrieve]
50. Batchu, R. B., and Hermonat, P. L. (1995) FEBS Lett. 367, 267-271[CrossRef][Medline] [Order article via Infotrieve]
51. Kokorina, N. A., Santin, A. D., Li, C., and Hermonat, P. L. (1998) J. Hum. Virol. 1, 441-450[Medline] [Order article via Infotrieve]
52. Gloss, B., and Bernard, H. U. (1990) J. Virol. 64, 5577-5584[Abstract/Free Full Text]
53. Hoppe-Seyler, F., and Butz, K. (1993) J. Gen. Virol. 74, 281-286[Abstract/Free Full Text]
54. Androphy, E. J., Schiller, J. T., and Lowy, D. R. (1987) Nature 325, 70-73[CrossRef][Medline] [Order article via Infotrieve]
55. Moskaluk, C., and Bastia, D. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1826-1830[Abstract/Free Full Text]
56. Kyostio, S. R., Wonderling, R. S., and Owens, R. A. (1995) J. Virol. 69, 6787-6796[Abstract]
57. Chiorini, J. A., Yang, L., Safer, B., and Kotin, R. M. (1995) J. Virol. 69, 7334-7338[Abstract]
58. Sedman, J., and Stenlund, A. (1996) EMBO J. 15, 5085-5092[Medline] [Order article via Infotrieve], 1996
59. Yasugi, T., Benson, J. D., Sakai, H., Vidal, M., and Howley, P. M. (1997) J. Virol. 71, 891-899[Abstract]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
A. Pautz, P. Rauschkolb, N. Schmidt, J. Art, M. Oelze, P. Wenzel, U. Forstermann, A. Daiber, and H. Kleinert
Effects of nitroglycerin or pentaerithrityl tetranitrate treatment on the gene expression in rat hearts: evidence for cardiotoxic and cardioprotective effects
Physiol Genomics, July 1, 2009; 38(2): 176 - 185.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. G. Needham, J. M. Casper, V. Kalman-Maltese, K. Verrill, J. D. Dignam, and J. P. Trempe
Adeno-associated virus rep protein-mediated inhibition of transcription of the adenovirus major late promoter in vitro.
J. Virol., July 1, 2006; 80(13): 6207 - 6217.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. M. Casper, J. M. Timpe, J. D. Dignam, and J. P. Trempe
Identification of an Adeno-Associated Virus Rep Protein Binding Site in the Adenovirus E2a Promoter
J. Virol., January 1, 2005; 79(1): 28 - 38.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Ponnazhagan, D. T. Curiel, D. R. Shaw, R. D. Alvarez, and G. P. Siegal
Adeno-associated Virus for Cancer Gene Therapy
Cancer Res., September 1, 2001; 61(17): 6313 - 6321.
[Full Text] [PDF]


Home page
J. Virol.Home page
A. Marcello, P. Massimi, L. Banks, and M. Giacca
Adeno-Associated Virus Type 2 Rep Protein Inhibits Human Papillomavirus Type 16 E2 Recruitment of the Transcriptional Coactivator p300
J. Virol., October 1, 2000; 74(19): 9090 - 9098.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhan, D.
Right arrow Articles by Hermonat, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhan, D.
Right arrow Articles by Hermonat, P. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement