|
J Biol Chem, Vol. 274, Issue 44, 31619-31624, October 29, 1999
Binding of the Human Papillomavirus Type 16 p97 Promoter by the
Adeno-associated Virus Rep78 Major Regulatory Protein Correlates with
Inhibition*
DeJin
Zhan ,
Alessandro D.
Santin ,
Yong
Liu ,
Groesbeck P.
Parham ,
Chunling
Li ,
Craig
Meyers§, and
Paul L.
Hermonat ¶
From the Department of Obstetrics and Gynecology,
University of Arkansas for Medical Sciences, Little Rock, Arkansas
72205 and the § Department of Microbiology and Immunology,
Pennsylvania State University College of Medicine, Hershey,
Pennsylvania 17033
 |
ABSTRACT |
Human papillomavirus type 16 (HPV-16) infection
is positively associated with cervical cancer, whereas adeno-associated
virus (AAV) infection is negatively associated with this same cancer. In earlier studies these two virus types have been shown to directly interact, with AAV inhibiting or enhancing papillomavirus functions depending upon the specific circumstances. One defined interaction between these two viruses is the ability of the AAV Rep78 major regulatory protein to inhibit gene expression of the E6 promoter of
BPV-1 (bovine papillomavirus type 1) and HPV types 16 and 18. As Rep78
is a DNA binding transcription factor, we considered whether Rep78
might bind HPV-16 DNA. Here, Rep78 is demonstrated to bind a 44-base
pair region (nucleotides 14-56) within the HPV-16 p97 promoter using
the electrophoretic mobility shift assay. This region is important for
HPV-16 because it includes functional Sp1 and E2 protein binding motifs
as well as part of the origin of replication. Furthermore, two Rep78
amino acid substitution mutants, at positions 77 or 64-65, were
identified that did not recognize p97 DNA. Both of these Rep78 mutants
were found to be defective for inhibition of p97 promoter activity in
HeLa and T-47D nuclear extracts in vitro, in a transient
chloramphenicol acetyltransferase assay, as well as defective for full
inhibition of HPV-16-directed focus formation. These data, taken
together, strongly suggest that the Rep78-p97 promoter interaction is
at least partially responsible for Rep78-mediated inhibition of HPV-16. Finally, the finding that Rep78 specifically recognizes p97 DNA is
surprising because the p97 promoter region contains no GAGC motifs, the
core motif for Rep78 recognition. These data suggest that the p97
promoter may represent a new prototypical DNA target type for Rep78.
 |
INTRODUCTION |
Infection and DNA integration by certain human papillomavirus
types (HPV)1 are central
events in the generation of cervical cancer (1, 2). The most common HPV
type associated with cervical cancer is HPV-16; roughly two-thirds of
cervical cancers contain the DNA of this virus. Adeno-associated virus
(AAV) is another virus commonly found in the anogenital region (3-6).
Infection by AAV, in sharp contrast to the HPVs, is negatively
associated with cervical cancer as demonstrated by the prevalence or
titer of anti-AAV antibodies (7, 8). Bidirectional interaction has been
observed between AAV and papillomaviruses. One such interaction is that papillomaviruses might serve as helpers for AAV (AAV is a
helper-dependent parvovirus) (9), allowing for AAV DNA
replication and virion production.
Our laboratory is exploring the hypothesis that AAV may regulate the
role of HPVs in cervical carcinogenesis. In earlier studies (10-12) we
demonstrated that AAV inhibits bovine papillomavirus type 1 (BPV-1) and
HPV-16-induced oncogenic transformation. Others (13-15) have also
observed AAV inhibition of BPV-1 and HPV-18. The effect has been mapped
to the AAV encoded Rep78 protein, and this protein has been shown to
inhibit expression of the papillomavirus promoter just upstream of the
E6 gene (p89 of BPV-1, p97 of HPV-16, and p105 of HPV-18) (11, 13, 14,
16). In addition, Rep78 regulates a variety of heterologous genes.
C-H-ras (17-19), c-fos (20, 21),
c-myc (20, 21), and the human immunodeficiency virus long
terminal repeat (HIV-LTR) (22, 23) are down-regulated by Rep78, whereas
the c-sis promoter is up-regulated (24). Still other genes
are not affected, such as the murine osteosarcoma virus long terminal
repeat (MSV-LTR) (18) and the human -actin promoter (14). The
largest of four products encoded by the AAV rep open reading
frame (25), Rep78 is required for AAV DNA replication (26, 27) and for
AAV gene regulation (28, 29). Rep78 carries out a range of biochemical
activities that are necessary for its biological phenotypes (30, 31),
including binding to promoter DNA (32-34) and to a variety of cellular
proteins (36), such as the transcription factors Sp1 (37, 38) and TBP
(39) as well as itself (40-42).
Because Rep78 is a DNA binding transcription factor, we considered
whether Rep78 might bind to HPV-16 DNA and investigated the importance
of this interaction by using Rep78 mutants in DNA binding. Here, it is
demonstrated that the favored site for Rep78 binding within the HPV-16
genome was a region within the p97 promoter of the long control region
(LCR), from nt 14 to 58. These findings are surprising because the p97
target sequence contains no GAGC (or GCTC) motifs, the core sequence of
almost all Rep78 DNA recognitions. Furthermore, Rep78 mutants that are
unable to bind DNA are also defective in their ability to fully inhibit
HPV-16 (pL67R)-induced oncogenic transformation, demonstrating the
importance of the Rep78-p97 DNA interaction.
 |
EXPERIMENTAL PROCEDURES |
Rep78 Affinity Chromatography Selection of HPV-16 DNA
Fragments--
The BamHI fragment containing the complete
HPV-16 genome (without plasmid sequences from pAT/HPV-16) was isolated
by gel electrophoresis using the GeneClean II kit. This DNA was further
digested with PstI, Klenow-labeled with
[ 32P[lrsqb]dCTP, and cleaned by phenol extraction and
ethanol precipitation. The Rep78 affinity chromatography was carried
out using 50 µg of MBP-Rep78 bound to 100 µl of amylose resin (New
England Biolabs). Klenow-labeled 32P-HPV-16 DNA (2 µg),
digested by PstI and BamHI, was applied to the
column in 100 µl of column buffer (20 mM Tris (pH 7.4),
200 mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol) and incubated for 15 min at room temperature. After
washing the column twice with 1 ml of column buffer, the bound DNA was
eluted with 100 µl of 1% SDS, 20 mM Tris, pH 7.5. The
eluted products were then analyzed by polyacrylamide gel
electrophoresis (4%), dried, and autoradiographed.
DNA Substrates and the Electrophoretic Mobility Shift Assay
(EMSA)--
HPV-16 and MSV-LTR DNA substrates were generated by
polymerase chain reaction (PCR) amplification. The AAV terminal repeat (TR) substrate was generated by the ligation of three separate synthetic oligonucleotides as described previously (43). The TR was 5'
end-labeled with polynucleotide kinase using [32P]ATP
(5000 Ci/mmol, Amersham Pharmacia Biotech). Single-stranded DNA
substrates were generated by asymmetric PCR amplification as described
previously (44). EMSA was carried out as follows; approximately 1 ng of
32P-labeled DNA substrate was incubated with increasing
amounts of MBP-Rep78 for 10 min at room temperature in binding buffer (25 mM HEPES KOH, pH 7.5, 10 mM
MgCl2, 1 mM dithiothreiotol, 2% glycerol, 25 µg of bovine serum albumin, 50 mM NaCl, 0.01% Nonidet P-40, and 0.5 µg poly(dI-dC)). Samples were electrophoresed in a 4%
polyacrylamide gel (40:1 acrylamide and bis-acrylamide weight ratio)
with 5% glycerol in 0.5× TBE buffer at 100 V for approx. 3 h.
Gels were dried and autoradiographed at 70 °C.
Construction of Rep78 Mutant Plasmids,
pMAL-Rep-64LH65TM and
pMal-Rep-77LG, and Production of MBP-Rep78 Chimeric
Proteins--
The construction of the plasmid
pMAL-Rep-64LH65TM from which mutant
MBP-64LH65TM protein is produced has been
described previously (45, 46). The plasmid pMal-Rep-77LG
was similarly constructed using a different mutagenic oligonucleotide (5'-CCCCGGAGGCCGAATTCTTTGTGCAA) and the M13-based plasmid pALTER-AAV3 (containing all of the AAV genes). A second oligonucleotide created a
SphI restriction site immediately upstream of the Rep78 open reading frame. The mutations were initially characterized by the generation of a new restriction site and were further verified by DNA
sequencing with Sequenase (U. S. Biochemical Corp.) according to the
manufacturer's recommendations. The mutant Rep78 open reading frames
were then transferred into pMALc2 on an SphI and
XhoI fragment (nt 321-2233) to generate
pMAL-Rep-64LH65TM and
pMAL-Rep-77LG. Both the mutant and wild type fusion
proteins with MBP were purified by affinity chromatography using
amylose resin following the kit directions of the manufacturer (Protein
Purification and Expression System, New England Biolabs). Fractions
were collected and analyzed by SDS-polyacrylamide gel electrophoresis.
Purified fractions were concentrated using Centricon 10-kDa cut-off
membrane filters (Amicon). These procedures routinely resulted in
MBP-Rep78 and 64LH65TM proteins of 70-90%
purity with a yield of 20 µg/100 ml bacterial culture.
Construction of Full-length AAV Genomes (FLAG) Carrying the Rep78
Mutations--
The Bsa I fragment (4.2 kb, containing all
of the AAV genes) from pALTER-AAV-64LH65TM and
pALTER-AAV-77LG were isolated and ligated to the
BsaI partial digestion fragment (4.9 kb, containing pBR322
plus the AAV TRs) from pSM620 (47) to generate
pFLAG-64LH65TM and pFLAG-77LG. To
ensure that the mutations were transferred into the full-length AAV
background, the region of the mutation was once again sequenced as
described above.
In Vitro Transcription Analysis of p97 Promoter Activity--
An
HPV-16 p97-CAT DNA fragment was used as a template for transcription.
The p97-CAT DNA fragment was generated by PCR amplification using
primer 1 (5'ACAAGCAGGATTGAAGGCCA, HPV-16 nt 7043-7065) complementary to the p97 sequences) and primer 2 (5' CATATCACCAGC TCACCGTC, nt
615-633 of pSV2CAT) complementary to the CAT sequences). The plasmid
p16P (p97-CAT) was used as the original PCR template (48). This
produced a 1.2-kb product. A 25-µl reaction mixture contained 0.5 µg of DNA template, 20 mM HEPES, pH 7.9, 5 mM
MgCl2, 100 mM KCl. 0.5 mM
dithiothreitol, 20% glycerol, 25 µM
[32P]GTP, 400 µM ATP, CTP, and UTP, and 8 units of Hela nuclear extract (Promega, HPV-positive cervical cancer)
or 5 µg of T-47D nuclear extract (Geneka Corp., HPV-negative breast
ductal carcinoma). Reactions were incubated at 30 °C for 60 min and
then terminated by adding 175 µl of Stop solution containing 300 mM Tris-HCl, pH 7.9, 0.5% SDS, 300 mM sodium
acetate, 2 mM EDTA, and 3 µg/ml tRNA. RNA was extracted
with phenol-chloroform, precipitated with ethanol, and finally
dissolved in 10 µl of formamide containing 0.1% each of xylene
cyanol and bromphenol blue. Samples were analyzed on a 6%
polyacrylamide, 7 M urea gel, dried, and autoradiographed. A p97-specifc RNA product of approximately 300 bases results.
Transient Chloramphenicol Acetyltransferase Assay--
Transient
CAT assays were carried out by calcium phosphate transfection of the
p16P (p97-CAT) plasmid plus several AAV plasmids (amounts indicated
within the figure legend). Forty-eight hours after transfection cell
extracts were prepared, equalized for protein content by spectroscopic
analysis at 280 nm, and assayed as described previously (48, 11).
Focus Formation Assay--
Contact-inhibited murine C127 mouse
fibroblasts were calcium phosphate-transfected with 3 µg of the
HPV-16/ras chimeric plasmid, pL67R (13) plus 6 ug of either
pSM620 (+Rep78, wild type), dl10-37 ( Rep78, large deletion) (26),
pFLAG-64LH65TM, or pFLAG-77LG. The
plasmid pL67R contains the EJ-H-ras coding sequences ligated in place of the E1 gene (11). Thus, pL67R contains three oncogenes (E6,
E7, and ras), all of which are expressed from the p97
promoter. The cells were fed for 2.5 weeks, fixed with formaldehyde,
and stained with methylene blue.
 |
RESULTS |
Rep78 Recognizes the p97 Promoter DNA--
To observe whether
Rep78 bound to HPV-16 DNA, we initially utilized Rep78 affinity
chromatography. MBP-Rep78, bound to amylose resin, was incubated with
32P-labeled HPV-16 DNA fragments generated from
PstI and BamHI double digestion. After washing
and elution, the products were agarose gel-electrophoresed adjacent to
unselected HPV-16 fragments. As shown in Fig.
1A, although a few partial
digestion products were present, it was clear that it was the 1.8-kb
fragment (nt 7003-875) of HPV-16 that was preferentially recognized by
Rep78.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
Rep78 recognizes sequences from the HPV-16
p97 promoter. Shown are affinity chromatography and EMSA
experiments identifying the region of HPV-16 to which Rep78 binds. The
amount of protein added is given in micrograms in
parentheses. A, Rep78 binds a 1.8-kb
PstI fragment from HPV-16 (nt 7003-875). Rep78 affinity
chromatography was used to select 32P-labeled
PstI, BamHI double-digested HPV-16 DNA. Note that
the 1.8-kb fragment, which contains the HPV-16 LCR, is preferentially
bound by Rep78. B, Rep78 preferentially binds sequences from
the HPV-16 LCR, nt 7841-106, compared with an equal size fragment from
the MSV-LTR by EMSA analysis. The number in
parentheses is the amount of protein added, shown in
micrograms. C, as determined by EMSA analysis, Rep78
preferentially binds nt 14-106 compared with 7841-13. D,
as determined by EMSA analysis, Rep78 preferentially binds nt 14-56
compared with 57-106.
|
|
Within the 1.8-kb fragment lies the LCR of HPV-16, which contains
central cis elements (origin of replication, enhancers, and
promoters) essential for HPV-16 biological function. Furthermore, Rep78
is a viral transcription factor known to bind promoter DNA (32-34).
Thus, we reasoned that Rep78 might be targeting the origin of
replication/p97 region within this fragment because of Rep78's known
modulation of the HPV-16 p97 and HPV-18 p105 promoters (10-12, 14) as
well as its modulation of BPV-1 DNA replication (49). To map the region
of binding, sequentially smaller substrates from this region were
tested for recognition by Rep78 (Fig. 1, B and C)
by EMSA analysis. In Fig. 1B, Rep78 was shown to strongly recognize the HPV-16 sequences from nt 7814 to 106 (p97), whereas it
does not significantly recognize a similarly sized analogous fragment
from the MSV-LTR. These data clearly indicate that there is a specific
recognition of the p97 DNA well above nonspecific binding. As mentioned
earlier, Rep78 is able to inhibit expression from p97, but it has
little effect on the MSV-LTR (18). Thus, we hypothesized that Rep78
binding of promoter DNA might be associated with an ability to regulate
p97 expression. In Fig. 1C, the target sequence was further
defined to be in the 3' half of this region (nt 14-106, hereinafter
referred to as "p97"). Finally, in Fig. 1D, a strong
target sequence for Rep78 binding is shown to be contained within nt
14-56. Fig. 2 shows the sequences of
this region. Note that the nt 14-56 sequences contain an intact E2 binding motif and an Sp1 binding motif. These sequences also partially overlap the HPV-16 origin of replication and E1 binding regions.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2.
Sequences of the HPV-16 p97 promoter.
Shown are important elements (labeled boxes) within the
immediate p97 region.
|
|
The E2 motifs are interrupted palindromes and can potentially form
hairpin structures. There are also other interrupted palindromic sequences present within the p97 promoter region (nt 14-106). The DNA
substrate that has formed some degree of secondary structure (2ndS) was
observed in the EMSA gels as an elevated band over the lower simple
duplex (dup) DNA substrate. It is this higher band that is the
preferred substrate for Rep78 recognition as demonstrated most clearly
in Fig. 1B. This preference for DNA substrates with
secondary structure has also been seen in Rep78 recognition of the TAR
region DNA of human immunodeficiency virus type 1 (50). To test the
possibility that Rep78 was recognizing secondary structure, the + and strands of the p97 sequence were generated separately by
single-sided PCR. Such single-stranded DNA should naturally form
secondary structure just as single-stranded RNA does. The
32P-labeled + and strands were compared by EMSA for
Rep78 recognition as shown in Fig. 3. As
shown, the strand was strongly recognized by Rep78, whereas the + strand was not. These data suggest that Rep78 may be recognizing both
secondary structure and the specific sequence of the DNA.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3.
Rep78 specifically binds the minus ( )
strand of p97. Shown is an EMSA analysis of Rep78 interaction with
either the + or the strand of p97 (nt 14-106). The + and strands were generated by asymmetric PCR amplification. Note that
Rep78 preferentially binds the minus strand of p97.
|
|
Two Rep78 Amino Acid Substitution Mutants Are Defective for Binding
p97 Promoter DNA--
Our laboratory has generated Rep78 mutant
proteins with specific amino acid substitutions for study in dissecting
the functions and domains of Rep78. The mutant Rep78 proteins were
produced as fusions with the maltose binding protein, as described
previously (45, 46). During the characterization of a MBP-Rep78 mutant protein, Rep-77LG (substituting a glutamine for a leucine
at amino acid 77), it was found to be able to bind an AAV TR DNA
substrate at levels comparable with wild type MBP-Rep78, as shown in
Fig. 4A. In contrast, Rep-77LG was defective in recognizing the p97 promoter, as
shown in Fig. 4B. In these experiments the wild type
MBP-Rep78 and Rep-64LH65TM proteins served as
the positive and negative controls, with
Rep-64LH65TM unable to bind any DNA substrate
thus far assayed by EMSA (46, 51). Thus, both
Rep-64LH65TM and Rep-77LG were
defective for binding p97. However, Rep-77LG was
particularly interesting as it was able to distinguish between the TR
and p97 substrates. This finding suggests to us that the mechanism of
recognition used by Rep78 to bind the AAV TR was different, at least in
part, than that for recognizing p97.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 4.
Rep78 mutant proteins defective in binding
AAV TR and the p97 DNA substrates. A. Shown is an EMSA analysis of
wild type and mutant Rep78 proteins binding to AAV TR DNA. Note that
Rep-64LH65TM does not bind the AAV TR, whereas
wild type and Rep-77LG do. B, shown is an EMSA
analysis of wild type and mutant Rep78 proteins binding to p97 DNA (nt
14-106). Note that in contrast to A, both
Rep-64LH65TM and Rep-77LG are
unable to bind p97. Thus, Rep-77LG can distinguish between
the TR and p97 substrates.
|
|
Rep78 Mutants Defective for Binding p97 Are Also Defective for
Inhibition of p97 Promoter Activity--
We next wanted to observe the
possible effects of Rep78 protein DNA binding on p97 promoter activity.
In vitro transcription was used to study the effects of
these proteins. Thus, various amounts of all three proteins (wild type,
Rep-64LH65TM, and Rep-77LG) were
added to HeLa and T-47D cell nuclear extracts containing a p97 DNA
template. The experiments were done four times using HeLa extracts and
twice using T-47D extracts, and all gave similar results.
Representative experiments are shown in Fig.
5. As seen, the addition of increasing
amounts of MBP-Rep78 inhibited RNA initiation from the p97 promoter in
a dosage-dependent manner. In sharp contrast to MBP-Rep78,
the addition of increasing amounts of
Rep-64LH65TM and Rep-77LG protein
had little effect on p97 promoter activity in both cell types. Thus,
both of the Rep78 mutants defective for binding p97 DNA were also
defective for inhibition of p97 promoter activity. A CAT assay was also
utilized to further verify the effect of Rep78 on the p97 promoter.
SW13 breast cancer cells were calcium phosphate-transfected with the
plasmid p16P, which contains the CAT coding sequences expressed from
p97 (48). FLAG plasmids, pSM620 (wild type Rep78),
FLAG-64LH65TM, and FLAG-77LG, were
co-transfected with p16P. As indicated by their names, the FLAG
plasmids contained the same mutated Rep78 sequences as were present in
the pMal-based plasmids used to generate the mutant proteins. The basal
expression control plate was transfected with the AAV plasmid dl10-37,
which contains a large deletion within the Rep78 sequences. The results
are shown in Fig. 6 and demonstrate, similar to the in vitro transcription assays, that Rep78
inhibits p97 activity although Rep-64LH65TM and
Rep-77LG does not.

View larger version (87K):
[in this window]
[in a new window]
|
Fig. 5.
Rep78 mutant proteins
Rep-64LH65TM and Rep-77LG are
defective for inhibiting p97 promoter activity in in vitro
transcription assays. Shown are representative in
vitro transcription experiments based on HeLa cell nuclear
extracts (HPV-positive) (A) or T-47D cell nuclear extracts
(HPV-negative) (B). These experiments were carried out as
described under "Experimental Procedures." Note that when MBP-Rep78
was added to the reaction, the generation of the p97 RNA product was
inhibited in a dosage dependent manner in both the HeLa and T-47D
extracts. In sharp contrast the addition of MBP-Rep78 mutant proteins
Rep-64LH65TM and Rep-77LG had
little or no effect on accumulated p97 transcript levels.
|
|

View larger version (73K):
[in this window]
[in a new window]
|
Fig. 6.
AAV Rep78 mutant genomes
FLAG-64LH65TM and FLAG-LG are
defective for inhibiting p97 promoter activity by CAT assay. SW13
cells were calcium phosphate-co-transfected with 4 µg of p16P plasmid
plus different amounts of one of four AAV plasmids. The plasmid p16P
contains the CAT coding sequences expressed from the HPV-16 P97
promoter. Co-transfection of dl10-37 (large deletion within Rep78)
served as a negative control for inhibition. Co-transfection with
increasing doses of pSM620 (2, 4, and 8 µg, wild type Rep78) served
as a positive control for inhibition. Mutants
FLAG-64LH65TM and FLAG-77LG were
similarly cotransfected. Two days after transfection, cellular
extracts, equalized for protein content, were assayed for CAT activity.
Note that pSM620 was able to inhibit p97 activity, whereas
Rep-64LH65TM and Rep-77LG were
defective.
|
|
Rep78 Mutants Defective for Binding p97 Are Also Defective for Full
Inhibition of HPV-16-induced Oncogenic Transformation--
To further
observe the biological significance of Rep78-p97 interaction, we
assayed the above Rep78 mutants (Rep-77LG and
Rep-64LH65TM), which were unable to bind p97
and unable to inhibit p97 transcription, for their ability to inhibit
HPV-16 p97-directed oncogenic transformation. The FLAG-77LG
and FLAG-64LH65TM mutant genomes were then
tested in a C127 cell-based, HPV-16-induced focus formation assay. We
utilized an HPV-16/ras chimeric plasmid, pL67R, in which the
E1 gene is replaced by the EJ-H-ras coding sequences (11,
12). This construct, expressing three oncoproteins from the p97
promoter, has higher transforming activity than HPV-16 alone (11).
Dl10-37 (Rep78-negative) and pSM620 served as the negative and
positive controls, respectively. Plates of C127 cells were calcium
phosphate-transfected with pL67R (3 µg) plus one of the indicated AAV
plasmids (6 µg). After 2.5 weeks, the cells were formaldehyde-fixed
and methylene blue-stained, and the foci were counted. The results are
shown in Fig. 7. Note that both FLAG-64LH65TM and FLAG-77LG were
defective when compared with pSM620 (wild type Rep78) for inhibiting
pL67R. Two additional transfection sets gave similar results. As
transformation by L67R is dependent on the p97 promoter, these data
strongly suggest that the Rep78-p97 interaction is important for Rep78
inhibitory ability.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 7.
AAV Rep78 mutant genomes
FLAG-64LH65TM and FLAG-LG are
defective for inhibiting HPV-16 oncogenic transformation. Shown is
a representative of three focus formation assays. C127
contact-inhibited murine fibroblasts were calcium phosphate-transfected
with 3 µg of pL67R plus 6 µg of the indicated AAV plasmid. Dl10-37
and pSM620 are the controls, encoding a large deleted Rep78 and wild
type Rep78, respectively. Note that
FLAG-64LH65TM and FLAG-77LG are
significantly defective in inhibiting pL67R oncogenic transformation
compared with pSM620.
|
|
Rep78-p97 Interaction Is Not as Strong as Rep78-TR
Interaction--
To compare the affinities of Rep78 for the AAV TR and
HPV-16 p97 DNA substrates, a series of competitive EMSA experiments was
undertaken. As shown in Fig.
8A, unlabeled TR DNA
competitor was able to strongly inhibit wild type
Rep78-32P-TR interaction, whereas unlabeled p97 DNA (nt
14-106) competitor was not. Unlabeled p97 DNA competitor was also not
able to inhibit Rep-77LG-TR interaction. In Fig.
8B it is shown that both unlabeled TR and p97 competitors
are able to successfully inhibit wild type Rep78-32P-p97
interaction but that the TR is the more effective competitor. These
data are consistent with Rep78 having a higher affinity for the AAV TR
(its natural substrate with GCTC3) than the HPV-16 p97
promoter (lacking GCTC motifs). These data are also consistent with the
interpretation of our other data (shown in Fig. 5) that the mechanism
of Rep78 recognition of p97 DNA is different from Rep78 recognition of
TR DNA.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 8.
Rep78-p97 interaction is not as strong as
Rep78-TR interaction. A, shown is a competitive EMSA
experiment analyzing wild type and 77LG Rep78 proteins
binding to a 32P-labeled TR substrate with competition from
unlabeled TR and p97 DNA. Three doses of competitor DNA (0.1, 0.5, and
1 µg) were added as indicated by the triangles. Note that
TR DNA is a better competitor than p97. B, shown is a
competitive EMSA experiment of wild type Rep78 protein binding to a
32P-labeled p97 substrate with competition from unlabeled
TR and p97 DNA. Three doses of competitor DNA (0.1, 0.5, and 1 µg)
were added as indicated by the triangles. Again, note that
TR DNA is a better competitor than p97.
|
|
Rep78 Also Recognizes a Region of BPV-1, the p89 Promoter
Region--
The BPV-1 LCR also contains multiple E2 motifs within the
E6 promoter (p89). Thus, we tested whether Rep78 might bind to a sequence (nt 7758-7930) from p89, which contains two such motifs in
close proximity. The EMSA results, shown in Fig.
9A, demonstrate that Rep78 is
able to recognize and bind E2 motif DNA from BPV-1 p89. Fig.
9B shows that, as with the Rep78-p97 interaction, both the
unlabeled BPV-1 p89 and the AAV TR DNAs were able to compete against
Rep78-32P-BPV-1 LCR interaction; however, TR DNA was the
better competitor.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 9.
Rep78 binds sequences of the BPV-1 long
control region. A, shown is an EMSA in which Rep78
binds to the BPV-1 LCR (nt 7758-7030). Note that the DNA-protein
complex occurs in a dosage-dependent manner with increasing
addition of MBP-Rep78. These LCR sequences contain two E2 motifs.
B, shown is a competitive EMSA demonstrating that the AAV TR
is a better competitor than the BPV-1 LCR itself. 0.1 µg of MBP-Rep
was added as indicated. Four doses of synthetic competitor DNA (1, 5, 20, and 40 ng) were added as indicated by the triangles.
Note that the MSV-LTR DNA is not an effective competitor compared with
the BPV LCR DNA.
|
|
 |
DISCUSSION |
This study demonstrates that the AAV Rep78 protein meaningfully
binds to the p97 promoter of HPV-16. This binding, although not as
strong as Rep78-AAV TR interaction, is clearly above the so-called
"nonspecific" DNA-binding ability of Rep78 as determined by the
experiments presented in Fig. 1. The importance of this interaction is
supported by the finding that two AAV mutants
(FLAG-64LH65TM and FLAG-77LG) in
which the Rep78 proteins are unable to recognize the HPV-16 LCR p97
target are defective for in vitro transcriptional inhibition of p97 and for the inhibition of HPV-16 directed oncogenic
transformation. It should also be noted that Rep78 is unable to
significantly affect expression from the MSV-LTR (18) and that Rep78 is
also unable to bind the partial (33, 51) or the full-length sequence of
this promoter (Fig. 1B). How the binding of Rep78 to p97
promoter DNA specifically affects HPV-16 expression is not known. As
this region contains active Sp1 (52, 53) and E2 (54, 55) motifs, one
mechanistic possibility might be that Rep78, while bound to p97,
sterically inhibits these other transcription factors from binding.
This hypothesis can be tested. It should be pointed out that Rep78
inhibition of pL67R gene expression cannot involve E2 because E2 is not
present in this experiment. Another possibility might be that Rep78, by
binding to p97, puts Rep78 in a favorable position to interact with
other transcription factors that are also binding to the promoter DNA
or other proteins within the transcription initiation complex. Yet a
third possibility may be that by binding DNA an inhibitory domain of
Rep78 is down-regulated. Rep78 is known to bind a variety of cellular
proteins (36), including Sp1 (37), TBP (39), and
TAFIIp110.2
One previous relevant study undertaken by Horer et al. (14)
attempted to identify the cis-responsible element within the analogous p105 promoter of HPV-18 (14). Their results, obtained by the
deletion and mutation of sequences along the length of the p105
promoter, were inconclusive for finding a specific responsible element.
Their interpretation of this data was that the mechanism of inhibition
was complex and involved multiple components. Our data may suggest such
complexity, for although the phenotypes of mutants
Rep-64LH65TM and Rep-77LG are quite
strong in Figs. 4-6, it is also clear that they are still able to
mildly inhibit oncogenic transformation (Fig. 7; only small foci were
generated). It is reasonable to suggest that Rep78 protein-protein
interactions may also be involved in these other inhibitory pathways.
In addition to the ability of Rep78 to meaningfully interact with
transcription factors, in preliminary experiments we have also been
able to observe Rep78-E7 oncoprotein interaction using Western blot,
affinity chromography, and yeast GAL4 two-hybrid cDNA
analyses.2
Our finding that Rep78 binds HPV-16 p97 is mildly surprising because
this target sequence contains no GAGC motifs, the core sequence of most
Rep78 DNA recognitions. Rep78 binding to promoter sequences has been
observed previously, including in the AAV p5 promoter (32), the
c-H-ras promoter (33), the human immunodeficiency virus long
terminal repeat TAR region (50, 51), and the cytomegalovirus immediate
early promoter (34). All of these promoters have GAGC (or GCTC) motifs,
and binding by the large Rep proteins (78/68) appears to be required
for the inhibition of the AAV p5 promoter (56) and the HIV-LTR (51). In
experiments using Rep78 affinity selection of random DNA sequences, the
consensus target sequence contained a duplex GAGC motif (57). However a
small subset of these selected sequences had no GAGC motifs. Thus,
there is a precedent for Rep78 binding DNA without GAGC motifs.
However, none of these sequences have significant homology with p97.
Furthermore, none of the random selected sequences contain interrupted
palindromes such as are present in p97. As we have also observed that
Rep78 binds a region within the BPV-1 LCR, which contains two E2
motifs, we suspect that these motifs are the specific target for Rep78 recognition. The AAV TRs, the natural and favored substrate of Rep78,
also have significant secondary structure; we believe this further
strengthens the argument that such structures (E2 or otherwise) are
possibly involved in Rep78 recognition of p97. However, the phenotype
of Rep-77LG suggests that Rep78 recognition of AAV TR DNA
is different from its recognition of p97. The finding that Rep78
specifically recognizes the negative strand of the p97 promoter is
novel (Fig. 3). These data further indicate that Rep78 discriminates
between single-stranded DNA substrates, by sequence, as it does for
double-stranded substrates. Finally, Rep78 binding to p97 may also
inhibit the E1-E2 complex from binding the origin of replication that
is located just upstream (35, 58, 59). Rep78 is known to inhibit BPV-1
DNA replication (49). This study extends our knowledge of how AAV and
papillomaviruses interact and will help to further reveal the mechanism
of action of Rep78 regulation on gene expression.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Peter Howley for the plasmids
p16P and p142-6 and Dr. Richard Schlegel for the plasmid
pAT/HPV-16.
 |
FOOTNOTES |
*
This study was funded by National Institutes of Health
Grants CA55051 and IA42764 (to P. L. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of
Obstetrics and Gynecology, Slot 518, University of Arkansas for Medical Sciences, 4301 West Markham St., Little Rock, AR 72205. Tel.: 501-686-5046; Fax: 501-686-5784; E-mail:
HermonatPaulL@exchange.uams.edu.
2
D.-J. Zhan and P. L. Hermonat, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
HPV, human
papillomavirus;
AAV, adeno-associated virus;
BPV, bovine
papillomavirus;
LTR, long terminal repeat;
TR, terminal repeat;
HIV, human immunodeficiency virus;
MSV, murine osteosarcoma virus;
LCR, long
control region;
nt, nucleotide(s);
kb, kilobase (pairs);
EMSA, electrophoretic mobility shift assay;
PCR, polymerase chain reaction;
FLAG, full-length AAV genomes;
CAT, chloramphenicol
acetyltransferase.
 |
REFERENCES |
| 1.
|
Durst, M.,
Gissman, L.,
Ikenberg, H.,
and zur Hausen, H.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
3812-3815[Abstract/Free Full Text]
|
| 2.
|
Cullen, A. P.,
Reid, R.,
Campion, M.,
and Lorincz, A. T.
(1991)
J. Virol.
65,
606-612[Abstract/Free Full Text]
|
| 3.
|
Blacklow, N. R.,
Hoggan, M. D.,
and Rowe, W. P.
(1967)
Proc. Natl. Acad. Sci. U. S. A.
58,
1410-1415[Free Full Text]
|
| 4.
|
Bantel-Schaal, U.,
and zur Hausen, H.
(1984)
Virology
134,
52-63[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Tobiasch, E.,
Rabreau, M.,
Geletneky, K.,
Larue-Charlus, S.,
Severin, F.,
Becker, N.,
and Schlehofer, J. R.
(1995)
J. Med. Virol.
44,
215-222
|
| 6.
|
Han, L.,
Parmley, T. H.,
Keith, S.,
Kozlowski, K. J.,
Smith, L. J.,
and Hermonat, P. L.
(1996)
Virus Genes
12,
47-52[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Mayor, H. D.,
Drake, S.,
Stahmann, J.,
and Mumford, D. M.
(1976)
Am. J. Obstet. Gynecol.
126,
100-105[Medline]
[Order article via Infotrieve]
|
| 8.
|
Georg-Fries, B.,
Biederlack, S.,
Wolf, J.,
and zur Hausen, H.
(1984)
Virology
134,
64-71[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Walz, C.,
Deprez, A.,
Dupressoir, T.,
Durst, M.,
Rabreau, M.,
and Schlehofer, J. R.
(1997)
J. Gen. Virol.
78,
1441-1452[Abstract]
|
| 10.
|
Hermonat, P. L.
(1989)
Virology
172,
253-261[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Hermonat, P. L.
(1994)
Cancer Res.
54,
2278-2281[Abstract/Free Full Text]
|
| 12.
|
Hermonat, P. L.,
Plott, R. T.,
Santin, A. D.,
Parham, G. P.,
and Flick, J. T.
(1997)
Gynecol. Oncol.
66,
487-494[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Schmitt, J.,
Schlehofer, J. R.,
Mergener, K.,
Gissman, L.,
and zur Hausen, H.
(1989)
Virology
172,
73-81[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Horer, M.,
Weger, S.,
Butz, K.,
Hoppe-Seyler, F.,
Geisen, C.,
and Kleinschmidt, J. A.
(1995)
J. Virol.
69,
5485-5496[Abstract]
|
| 15.
|
Su, P. F.,
and Wu, F. Y.
(1996)
Br. J. Cancer
73,
1533-1537[Medline]
[Order article via Infotrieve]
|
| 16.
|
Hermonat, P. L.,
Meyers, C.,
Parham, G. P.,
and Santin, A. D.
(1998)
Virology
247,
240-250[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Katz, E.,
and Carter, B. J.
(1986)
Cancer Res.
46,
3023-3026[Abstract/Free Full Text]
|
| 18.
|
Hermonat, P. L.
(1991)
Cancer Res.
51,
3373-3377[Abstract/Free Full Text]
|
| 19.
|
Khleif, S. N.,
Myers, T.,
Carter, B. J.,
and Trempe, J. P.
(1991)
Virology
181,
738-741[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Klein-Bauernschmitt, P.,
zur Hausen, H.,
and Schlehofer, J. R.
(1992)
J. Virol.
66,
419-4200
|
| 21.
|
Hermonat, P. L.
(1994b)
Cancer Lett.
81,
129-136[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Rittner, K.,
Heilbronn, R.,
Kleinschmidt, J. A.,
and Sczakiel, G.
(1992)
J. Gen. Virol.
73,
2977-2981[Abstract/Free Full Text]
|
| 23.
|
Antoni, B. A.,
Rabson, A. B.,
Miller, I. L.,
Trempe, J. P,
Chejanovsky, N.,
and Carter, B. J.
(1991)
J. Virol.
64,
396-404
|
| 24.
|
Wonderling, R. S.,
and Owens, R. A.
(1996)
J. Virol.
70,
4783-4786[Abstract]
|
| 25.
|
Mendleson, E.,
Trempe, J. P.,
and Carter, B. J.
(1986)
J. Virol.
60,
823-832[Abstract/Free Full Text]
|
| 26.
|
Hermonat, P. L.,
Labow, M. A.,
Wright, R.,
Berns, K. I.,
and Muzyczka, N.
(1984)
J. Virol.
51,
329-333[Abstract/Free Full Text]
|
| 27.
|
Tratschin, J-D.,
Miller, I. L.,
and Carter, B. J.
(1994)
J. Virol.
51,
611-619
|
| 28.
|
Labow, M. A.,
Hermonat, P. L.,
and Berns, K. I.
(1986)
J. Virol.
60,
251-258[Abstract/Free Full Text]
|
| 29.
|
Tratschin, J-D.,
Tal, J.,
and Carter, B. J.
(1986)
Mol. Cell. Biol.
5,
3251-3260
|
| 30.
|
Im, D. S.,
and Muzyczka, N.
(1990)
Cell
61,
447-457[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Ni, T. H.,
Zhou, X.,
McCarty, D. M.,
Zolotukhin, I.,
and Muzyczka, N.
(1994)
J. Virol.
68,
1128-1138[Abstract/Free Full Text]
|
| 32.
|
McCarty, D. M.,
Pereira, D. J.,
Zolotukhin, I.,
Zhou, X.,
Ryan, J. H.,
and Muzyczka, N.
(1994)
J. Virol.
74,
4988-4997[Abstract/Free Full Text]
|
| 33.
|
Batchu, R. B.,
Kotin, R. M.,
and Hermonat, P. L.
(1994)
Cancer Lett.
86,
23-31[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Wonderling, R. S.,
and Owens, R. A.
(1996)
J. Virol.
71,
2528-2534[Abstract]
|
| 35.
|
Sarafi, T. R.,
and McBride, A. A.
(1995)
Virology
211,
385-396[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Hermonat, P. L.,
Santin, A. D.,
Carter, C. A.,
Parham, G. P.,
and Quirk, J. G.
(1997b)
Biochem. Mol. Biol. Int.
403,
409-420
|
| 37.
|
Hermonat, P. L.,
Santin, A. D.,
and Batchu, R. B.
(1996)
Cancer Res.
56,
5299-5304[Abstract/Free Full Text]
|
| 38.
|
Pereira, D. J.,
and Muzyczka, N.
(1997)
J. Virol.
71,
1747-1756[Abstract]
|
| 39.
|
Hermonat, P. L.,
Santin, A. D.,
Batchu, R. B.,
and Zhan, D.-J.
(1998)
Virology
245,
120-127[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Weitzman, M. D.,
Kyostio, S. R.,
Carter, B. J.,
and Owens, R. A.
(1996)
J. Virol.
70,
2440-2448[Abstract]
|
| 41.
|
Hermonat, P. L.,
and Batchu, R. B.
(1997)
FEBS Lett.
401,
180-184[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Smith, R. H.,
Spano, A. J.,
and Kotin, R. M.
(1997)
J. Virol.
71,
4461-4471[Abstract]
|
| 43.
|
Bishop, B. M.,
Santin, A. D.,
Quirk, J. G.,
and Hermonat, P. L.
(1996)
FEBS Lett.
397,
97-100[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Gyllensten, U. B.,
and Erlich, H. A.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
7652-7656[Abstract/Free Full Text]
|
| 45.
|
Batchu, R. B.,
Miles, D. A.,
Rechtin, T. M.,
Drake, R. R.,
and Hermonat, P. L.
(1995)
Biochem. Biophy. Res. Commun.
208,
714-720[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Batchu, R. B.,
and Hermonat, P. L.
(1995)
Biochem. Biophy. Res. Commun.
210,
717-725[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Samulski, R. J.,
Berns, K. I.,
Tan, M.,
and Muzyczka, N.
(1982)
Proc. Natl. Acad. Scii. U. S. A.
79,
2077-2081[Abstract/Free Full Text]
|
| 48.
|
Romanczuk, H.,
Therry, F. T.,
and Howley, P. M.
(1990)
J. Virol.
64,
2849-2859[Abstract/Free Full Text]
|
| 49.
|
Hermonat, P. L.
(1992)
Virology
189,
329-333[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Batchu, R. B.,
and Hermonat, P. L.
(1995)
FEBS Lett.
367,
267-271[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Kokorina, N. A.,
Santin, A. D.,
Li, C.,
and Hermonat, P. L.
(1998)
J. Hum. Virol.
1,
441-450[Medline]
[Order article via Infotrieve]
|
| 52.
|
Gloss, B.,
and Bernard, H. U.
(1990)
J. Virol.
64,
5577-5584[Abstract/Free Full Text]
|
| 53.
|
Hoppe-Seyler, F.,
and Butz, K.
(1993)
J. Gen. Virol.
74,
281-286[Abstract/Free Full Text]
|
| 54.
|
Androphy, E. J.,
Schiller, J. T.,
and Lowy, D. R.
(1987)
Nature
325,
70-73[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Moskaluk, C.,
and Bastia, D.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
1826-1830[Abstract/Free Full Text]
|
| 56.
|
Kyostio, S. R.,
Wonderling, R. S.,
and Owens, R. A.
(1995)
J. Virol.
69,
6787-6796[Abstract]
|
| 57.
|
Chiorini, J. A.,
Yang, L.,
Safer, B.,
and Kotin, R. M.
(1995)
J. Virol.
69,
7334-7338[Abstract]
|
| 58.
|
Sedman, J.,
and Stenlund, A.
(1996)
EMBO J.
15,
5085-5092[Medline]
[Order article via Infotrieve], 1996
|
| 59.
|
Yasugi, T.,
Benson, J. D.,
Sakai, H.,
Vidal, M.,
and Howley, P. M.
(1997)
J. Virol.
71,
891-899[Abstract]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Pautz, P. Rauschkolb, N. Schmidt, J. Art, M. Oelze, P. Wenzel, U. Forstermann, A. Daiber, and H. Kleinert
Effects of nitroglycerin or pentaerithrityl tetranitrate treatment on the gene expression in rat hearts: evidence for cardiotoxic and cardioprotective effects
Physiol Genomics,
July 1, 2009;
38(2):
176 - 185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Needham, J. M. Casper, V. Kalman-Maltese, K. Verrill, J. D. Dignam, and J. P. Trempe
Adeno-associated virus rep protein-mediated inhibition of transcription of the adenovirus major late promoter in vitro.
J. Virol.,
July 1, 2006;
80(13):
6207 - 6217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Casper, J. M. Timpe, J. D. Dignam, and J. P. Trempe
Identification of an Adeno-Associated Virus Rep Protein Binding Site in the Adenovirus E2a Promoter
J. Virol.,
January 1, 2005;
79(1):
28 - 38.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ponnazhagan, D. T. Curiel, D. R. Shaw, R. D. Alvarez, and G. P. Siegal
Adeno-associated Virus for Cancer Gene Therapy
Cancer Res.,
September 1, 2001;
61(17):
6313 - 6321.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Marcello, P. Massimi, L. Banks, and M. Giacca
Adeno-Associated Virus Type 2 Rep Protein Inhibits Human Papillomavirus Type 16 E2 Recruitment of the Transcriptional Coactivator p300
J. Virol.,
October 1, 2000;
74(19):
9090 - 9098.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|