![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 44, 31679-31685, October 29, 1999
From the Institute of Organic Chemistry, University of Zurich,
Winterthurerstrasse 190, 8057 Zurich, Switzerland
Isobutyryl-CoA mutase (ICM) catalyzes the
reversible, coenzyme B12-dependent
rearrangement of isobutyryl-CoA to n-butyryl-CoA, which is
similar to, but distinct from, that catalyzed by methylmalonyl-CoA mutase. ICM has been detected so far in a variety of aerobic and anaerobic bacteria, where it appears to play a key role in valine and
fatty acid catabolism. ICM from Streptomyces cinnamonensis is composed of a large subunit (IcmA) of 62.5 kDa and a small subunit
(IcmB) of 14.3 kDa. icmB encodes a protein of 136 residues with high sequence similarity to the cobalamin-binding domains of
methylmalonyl-CoA mutase, glutamate mutase, methyleneglutarate mutase,
and cobalamin-dependent methionine synthase, including a
conserved DXHXXG cobalamin-binding motif. Using
IcmA and IcmB produced separately in Escherichia coli, we
show that IcmB is necessary and sufficient with IcmA and coenzyme
B12 to afford the active ICM holoenzyme. The large subunit
(IcmA) forms a tightly associated homodimer, whereas IcmB alone exists
as a monomer. In the absence of coenzyme B12, the
association between IcmA and IcmB is weak. The ICM holoenzyme appears
to comprise an The coenzyme B12-dependent isobutyryl-CoA
mutase (ICM1;
butanoyl-CoA:2-methylpropanoyl-CoA mutase, EC 5.4.99.13) catalyzes the
reversible rearrangement of isobutyryl-CoA to n-butyryl-CoA. Although closely related to the well known and widely distributed methylmalonyl-CoA mutase (MCM) reaction (1) (Fig.
1), MCM does not catalyze the
rearrangement of isobutyryl-CoA to n-butyryl-CoA (2, 3). ICM
has been detected in several polyketide antibiotic-producing streptomycetes, where it appears to play a key role in valine and fatty
acid catabolism as well as in the production of fatty acid-CoA
thioester building blocks for polyketide antibiotic biosynthesis (4).
In earlier work (5), purification of ICM from the monensin-producing microorganism Streptomyces cinnamonensis gave a protein
(IcmA) of ~65 kDa whose gene was subsequently cloned and expressed in Escherichia coli. However, recombinant IcmA alone showed no
ICM activity. Using IcmA with a His6 tag attached to its N
terminus, a second subunit of ICM with an apparent mass of The MCMs from S. cinnamonensis (2) and
Propionibacterium shermanii (6) are heterodimers with
subunits of The structure determination of the cobalamin-binding domain of MetH, a
member of the methyltransferase family, revealed for the first time a
protein-bound form of methylcobalamin, a vitamin B12
derivative (10). The cobalamin was shown bound to the protein with a
histidine residue providing an axial imidazole ligand to cobalt,
replacing the DMB group appended to the corrin ring. This key histidine
residue is found in the motif DXHXXG, which is
conserved in some (but not all) of the coenzyme
B12-dependent mutases (11). The crystal
structure of MCM from P. shermanii revealed not only an
active site, inaccessible to solvent, embedded along the axis of the
( Bacterial Strains--
S. cinnamonensis A3823.5, a
high-yield producer of monensin A, was a gift of Lilly. E. coli BL21(DE3) pLysS (12) was purchased from Novagen.
Production of IcmA and Assay--
IcmA was produced in E. coli BL21 pLysS[pET3a-icmA] as described earlier (5).
The ICM assay was as described earlier (2). Briefly,
n-butyryl-CoA (or isobutyryl-CoA; 280 µM final
concentration) was added to an assay mixture containing 50 µM coenzyme B12, 50 mM potassium
phosphate (pH 7.4), and IcmA and IcmB. The reaction was incubated in
the dark at 30 °C, typically until 10-15% conversion of substrate
to product, and then stopped by addition of 100 µl of 2 M
KOH containing 0.002% (v/v) n-valeric acid. After
acidifying with 100 µl of 15% (v/v) H2SO4
and saturating with NaCl, the solution was extracted with EtOAc. The
extract was analyzed directly by gas chromatography using a FFAP
capillary column (10 m × 0.53 mm; Hewlett-Packard Co.).
Purification of IcmB--
IcmB was purified from both S. cinnamonensis and Streptomyces lividans TK64 as
described earlier (5). The N-terminal amino acid sequences of both
proteins were determined by the Edman method using an automated
sequencer. The N-terminal sequences obtained were as follows: S. lividans, GVAAGPIRVVVAKPGLDGHD; and S. cinnamonensis, GVAAGPIRVVVAKPGLDGHDRGAKVIARAL.
Cloning icmB--
General DNA manipulations were performed in
E. coli (13) and Streptomyces (14) as described.
Two oligonucleotides were designed based on the N-terminal protein
sequence of IcmB (S = G and C) (Oligo-1 and -2).
Expression of icmB--
The 411-base pair icmB gene
was amplified by polymerase chain reaction using the following
oligonucleotides as primers and pOCI706 DNA as template: ICMBFOR,
AGTCATCATATGGGTGTGGCAGCCGGGCCGATCC; and ICMBBACK,
ATCATGGATCCTCAGACGGCCTGTCGCACGTTCC. The
NdeI and BamHI restriction sites in the primers
are underlined. After polymerase chain reaction, the product was
digested with NdeI and BamHI and ligated between
the corresponding restriction sites in pET3a (12). The resulting
plasmid (pOCI711) was introduced into E. coli BL21(DE3) pLysS for production of IcmB.
Cells containing pOCI711 were grown in 2 × 20 ml of LB medium
containing ampicillin (50 µg/ml) and chloramphenicol (34 µg/ml) to
A600 nm
The cell pellet from 1.5 liters of culture was sonicated in buffer A
(50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 1 mM benzamidine, 1 mM phenylmethanesulfonyl
fluoride, 1 mM dithiothreitol, 0.1% (v/v)
2-mercaptoethanol, and 5% (v/v) glycerol). The cell-free extract
(~35 mg of protein) was applied to a Q-Sepharose column (1.5 × 7 cm; Fast flow, Amersham Pharmacia Biotech) equilibrated with buffer B
(50 mM Tris-HCl (pH 7.5) and 5 mM EDTA). The
column was washed with 20 column volumes of buffer B and then eluted at
a flow rate of 3 ml/min with a linear gradient of 0-1 M
KCl in buffer B over 100 ml. The fraction containing IcmB eluted in the
range 100-350 mM KCl as detected by an ICM activity assay. The ICM-active fractions were pooled (20 mg of protein) and dialyzed against buffer C (50 mM Tris-HCl (pH 7.5) and 0.5 mM EDTA) containing 1 mM dithiothreitol.
The dialyzed sample (18 mg of protein) was applied to a MonoQ column
(HR 5/5, Amersham Pharmacia Biotech) equilibrated with buffer C. The
column was washed with 50 column volumes of buffer C and then eluted at
a flow rate of 1.5 ml/min using a 0-1 M KCl gradient in
buffer C over 100 ml. The fractions eluting between 90 and 200 mM KCl possessed the highest ICM activity and were pooled
and dialyzed against buffer C (yield of 5 mg of protein).
The dialyzed sample (4.5 mg of protein) from above was
rechromatographed on the MonoQ column under the same conditions as described above. IcmB eluted as a single peak (yield of 0.5 mg of
protein) at 200 mM KCl and was homogeneous as determined by SDS-polyacrylamide gel electrophoresis (see Fig. 4). The protein was
dialyzed against 50 mM potassium phosphate (pH 7.5)
containing 1 mM dithiothreitol and stored at 4 °C. IcmB
can be stored in this way for several weeks without significant loss of activity.
Characterization of IcmA and IcmB--
Native molecular masses
were determined by gel filtration chromatography (Superose 12 HR 10/26
column, Amersham Pharmacia Biotech) in buffer D (50 mM
potassium phosphate (pH 7.4), 150 mM KCl, and 0.5 mM EDTA). Standards for molecular mass calibration were
blue dextran (2000 kDa), catalase (232 kDa), aldolase (158 kDa), bovine
serum albumin (67 kDa), and ribonuclease A (13.6 kDa). The extinction
coefficients of IcmA and IcmB at 280 nm were determined using the
Beer-Lambert law and quantitative amino acid analysis for determination
of protein concentrations: Equilibrium Constant Determination--
The equilibrium constant
for the ICM reaction at pH 7.4 and 30 °C was obtained by determining
the equilibrium concentrations of both n-butyryl-CoA and
isobutyryl-CoA. Assays contained 25 nM IcmA, 25 nM IcmB, and 0.1 mM coenzyme B12 in
3.2 ml of 50 mM potassium phosphate buffer (pH 7.4)
equilibrated at 30 °C. n-Butyryl-CoA or isobutyryl-CoA
(140 µM) was added to start the reaction; and periodically, samples were taken to determine the ratio of
isobutyryl-CoA to n-butyryl-CoA. This experiment was then
repeated using 10 different starting ratios of n-butyryl-CoA
to isobutyryl-CoA (ratios in the range 0.4-2.1) roughly in the range
of the estimated equilibrium constant determined above. The equilibrium
constant for the ICM reaction was obtained by plotting the change in
[isobutyryl-CoA] versus the
[isobutyryl-CoA]/[n-butyryl-CoA] ratio. This gave
Keq = 1.7 ± 0.05 in favor of
isobutyryl-CoA.
Kinetic Analyses--
For determination of Km
and Vmax values, initial velocities were
determined using the gas chromatography assay (see above) in 50 mM potassium phosphate buffer (pH 7.4) at 30 °C. For the
measurement of Km values, IcmA and IcmB (each at 5 nM) were used in a 1:1 molar ratio. The conversion of
substrate to product was followed by withdrawing samples from the assay mixture (typically five time points for each assay) up to a maximum of
10-15% conversion, and these data were used to calculate initial rates. Typically, six different substrate concentrations were used in
the range 13.3-200 µM for n-butyryl-CoA and
13.3-300 µM for isobutyryl-CoA. At each fixed substrate
concentration, assays were performed with five different coenzyme
B12 concentrations in the range 4.8-200 µM.
All measurements were carried out in triplicate, and the S.D. in
Km values was approximately ±25% (see Table
II).
The general form of the rate equation for a bireactant mechanism is
represented by Equation 1,
The Vmax was determined from a Hanes plot (see
Fig. 7C) using saturating amounts of IcmB (75 nM) relative to IcmA (5 nM), at six different
n-butyryl-CoA concentrations in the range 40-1000 µM, and at a coenzyme B12 concentration of
0.2 mM.
The Hill constant (h) was measured by varying the IcmB
concentration (1-75 nM) at one fixed concentration of IcmA
(5 nM) and fitting initial rates to the following form of
the Hill equation (Equation 2),
Sequence and Expression of icmB--
The 1.65 kb of S. cinnamonensis genomic DNA, isolated from a library using
oligonucleotides encoding the N terminus of IcmB, were sequenced and
analyzed using CODONPREFERENCE in the GCG software (16). This revealed
two complete ORFs (ORF1 and ORF2) and one (ORF3) with incomplete
sequence data (Fig. 3). ORF1, starting at
nucleotide 422 and ending at nucleotide 832, was identified as the
icmB gene, encoding a protein of 136 residues with a mass of
14,333 Da. The putative ORF2, immediately upstream of ORF1, encodes a
protein of only 55 residues and, like ORF3, lacks significant similarity to proteins in the EBI/Swiss Protein Data Bank. The deduced
amino acid sequence of IcmB shows significant identity to several
cobalamin-dependent proteins in the data base, as shown in
Table I.
To produce IcmB in E. coli, NdeI and
BamHI sites were introduced at the 5'- and 3'-ends of
icmB such that the NdeI site encodes an ATG start
codon, and the gene was cloned in the expression vector pET3a (12).
After introduction into E. coli BL21(DE3) pLysS, the
production of active IcmB could be detected in cell extracts in an
assay with IcmA and coenzyme B12. After isolation by
standard methods (see "Experimental Procedures"), the protein was
homogeneous as determined by SDS-polyacrylamide gel electrophoresis (Fig. 4), with an apparent mass of ~17
kDa, as observed in earlier work (5). An electrospray mass spectrum of
IcmB gave a molecular ion with a mass of 14,203 Da, consistent with the
deduced protein sequence minus methionine.
Characterization of ICM--
Upon gel filtration chromatography,
IcmB eluted with an apparent mass of 17 kDa, suggesting a largely
monomeric protein. Under the same conditions, IcmA eluted from the
column with an apparent mass of 135 kDa, almost double the calculated
mass of 62.5 kDa, indicating a homodimer. Gel filtration of a 1:1 molar
ratio of IcmA to IcmB led to the elution of the two subunits separately from the column at the expected apparent masses. When IcmA and IcmB
were first incubated with coenzyme B12, a single major peak eluted from the gel filtration column with an apparent mass of Kinetics--
The steady-state kinetic properties of the enzyme
were investigated. The two subunits and coenzyme B12 are
necessary and sufficient to observe ICM activity with
n-butyryl-CoA or isobutyryl-CoA as substrate. The specific
activity of the enzyme was seen to vary with the molar ratio of IcmA to
IcmB in the assay. The activity approached saturation only after a
severalfold molar excess of IcmB to IcmA was present (Fig.
6). The plot of activity against IcmB
concentration appeared slightly sigmoidal, suggestive of some degree of
cooperativity in formation of the holoenzyme from IcmA, IcmB, and
coenzyme B12. Fitting the velocity data to Equation 2 gave
a Hill coefficient of 1.34 ± 0.02.
Under the standard assay conditions, as used during the earlier
purification of IcmA (5), the specific activity of the enzyme in the
presence of a 1:1 molar ratio of IcmA to IcmB was ~8.0 µmol/min/mg.
In the earlier work (5), after partial purification of IcmA from
extracts of S. cinnamonensis, the specific activity was
~0.023 µmol/min/mg, and after reconstitution of mutase from recombinant His6-IcmA and IcmB isolated from S. cinnamonensis, it was ~1.0 µmol/min/mg.
For the determination of Km values, the initial
rates were typically measured at six different substrate concentrations in the range 13.3-200 µM, and for each fixed
concentration of substrate, rates were typically determined at five
different coenzyme B12 concentrations between 4.8 and 200 µM. A 1:1 molar ratio of IcmA to IcmB was used
throughout. The data were fitted to Equation 1 by nonlinear
least-squares regression using the computer program Leonora Version 1.0 (Fig. 7, A and B).
The apparent Km values determined were 54 ± 12 µM for n-butyryl-CoA, 57 ± 13 µM for isobutyryl-CoA, and 12 ± 2 µM
for coenzyme B12. The Vmax was determined to be 38 ± 5 units/mg IcmA from a Hanes plot (Fig. 7C) using varying concentrations of n-butyryl-CoA
and saturating amounts of IcmB (15-fold molar excess compared with
IcmA). Assuming one active site per IcmA monomer,
kcat = 39 ± 3 s icmA and icmB are not adjacent in the
chromosome of S. cinnamonensis. In contrast, mutA
and mutB from this organism share overlapping start and stop
codons (2), a device that may lead to transcriptional coupling and
hence to the production of stoichiometric amounts of the two proteins.
It is presently unclear how far apart icmA and
icmB are in the S. cinnamonensis genome, although
the regions extending over 8 kb upstream and 11 kb downstream of
icmA, isolated in an earlier work (5), do not contain
sequences similar to icmB. Two hyperthermophilic bacteria,
Archeoglobus fulgidus (21) and Pyrococcus
horikoshii (22), whose genomes have now been completely sequenced,
each contain two ORFs of similar size and sequence to icmA
and icmB, although they were reported as MCM-like
sequences. mcmA1 and mcmA2 from A. fulgidus encode proteins of 548 and 144 residues and are located
only 2.5 kb apart, whereas the large and small ICM-like genes in
P. horikoshii encode proteins of 563 and 147 residues, but
are located ~230 kb apart. It is interesting to speculate that, in
both organisms, these MCM-like proteins might be components of ICM.
However, this remains to be proven. The distinguishing features of ICM
include an MCM-like large subunit of only ~65 kDa, with a separate
small subunit of ~14 kDa providing the cobalamin-binding domain. An
isolated report has appeared of a propionate-induced MCM from
Euglena gracilis that contains two mutases with apparent
molecular masses of 72,000 and 17,000 Da (23). Neither protein,
however, has yet been purified to homogeneity.
Although in MCM a single polypeptide chain comprises both the coenzyme
B12- and substrate-binding domains, the glutamate mutase from clostridia consists of two subunits, MutE (which forms a tightly
associated homodimer) and MutS (which is the coenzyme B12-binding domain). The active glutamate mutase holoenzyme
appears to be an The analysis of the kinetics for ICM is complicated by the fact that
IcmA and IcmB interact only weakly until coenzyme B12 is
added, and then IcmA binds to IcmB in a cooperative manner. This also
complicates any attempts to measure the stoichiometry of bound coenzyme
B12. As a result, the apparent kinetic parameters depend on
the relative concentrations of the two subunits, as observed earlier in
studies of glutamate mutase (24, 25). Here, the substrate
Km values with ICM were determined using equimolar
ratios of IcmA and IcmB, and the Vmax was
determined relative to the IcmA concentration at saturating
concentrations of IcmB.
The assay used for the determination of kinetic constants is a
discontinuous gas chromatography assay, which is not well suited for
accurate initial velocity measurements. Notwithstanding this, in the
determination of Km values, a nonlinear
least-squares regression fitting of the initial velocities to a
velocity equation for a bireactant system converged for both
substrates. Double-reciprocal plots gave sets of lines that intersected
on or close to the x axis (Fig. 7, A and
B). The results are consistent with either a random or
ordered sequential mechanism, involving the reversible formation of a
ternary complex between enzyme, substrate, and coenzyme
B12. The kcat value of 39 ± 3 s The apparent Km values for n-butyryl-CoA
and isobutyryl-CoA are in the same range as the Km
values reported elsewhere for methylmalonyl-CoA and succinyl-CoA with
MCM (26), but are at least an order of magnitude lower than the
apparent Km for glutamate with glutamate mutase,
measured under comparable conditions (1:1 molar ratio of MutE to MutS)
(Table II). It is interesting to note
that MCM and ICM have similar substrate structures and most likely
similar substrate-binding sites in their large subunits (see below),
reflecting the similar Km values for their
substrates. On the other hand, ICM and glutamate mutase share a similar
mode of cobalamin binding involving two independent subunits and have
similar Km values for coenzyme B12. In
comparison, a significantly lower Km is found for
coenzyme B12 with MCM (Table II).
Cloning and Sequencing of the Coenzyme B12-binding
Domain of Isobutyryl-CoA Mutase from Streptomyces
cinnamonensis, Reconstitution of Mutase Activity, and
Characterization of the Recombinant Enzyme Produced in
Escherichia coli*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2
2-heterotetramer with up
to two molecules of bound coenzyme B12. The equilibrium constant for the ICM reaction at 30 °C is 1.7 in favor of
isobutyryl-CoA, and the pH optimum is near 7.4. The
Km values for isobutyryl-CoA, n-butyryl-CoA, and coenzyme B12 determined with
an equimolar ratio of IcmA and IcmB are 57 ± 13, 54 ± 12, and 12 ± 2 µM, respectively. A
Vmax of 38 ± 3 units/mg IcmA and a
kcat of 39 ± 3 s
1 were
determined under saturating molar ratios of IcmB to IcmA.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
17 kDa as
determined by SDS-polyacrylamide gel electrophoresis (denoted IcmB) was
isolated by affinity chromatography from S. cinnamonensis,
which gave ICM activity when combined with IcmA and coenzyme
B12 (5). In this work, we describe for the first time the
cloning and sequencing of the gene encoding IcmB and the first
characterization of ICM reconstituted from small and large subunits
produced separately in E. coli.

View larger version (14K):
[in a new window]
Fig. 1.
Reactions catalyzed by MCM and
ICM.
79 kDa (MutB) and
65 kDa (MutA). Several crystal
structures of P. shermanii MCM were reported recently
(7-9), which revealed a single coenzyme B12 molecule bound
to the 728-residue MutB protein, sandwiched between a
(
/
)8-triosephosphate isomerase barrel and a
C-terminal, flavodoxin-like, cobalamin-binding domain. IcmA from
S. cinnamonensis, however, comprises only 566 residues (5),
corresponding to a loss of the entire
160-residue C-terminal
cobalamin-binding domain from MutB. The sequence of the
(
/
)8-barrel in MutB comprising residues A1-A400 is
highly conserved in IcmA. Residues A401-A559 in MutB correspond to a
largely helical linker, which connects the
(
/
)8-barrel with the cobalamin-binding domain
(residues A560-A728). The linker residues A401-A559 correspond in a
sequence alignment approximately with residues 393-560 in IcmA,
although the sequence identity in this region is only
18%. But
after just 6 more residues, IcmA terminates.
/
)8-barrel in MutB (7, 8), but also the coordination of cobalt in coenzyme B12 by the histidine in the conserved
DXHXXG motif within the C-terminal
cobalamin-binding domain. In the case of ICM, however, the large
subunit (IcmA) contains no contiguous cobalamin-binding domain, but
instead requires a separate small subunit (IcmB) to bind coenzyme
B12 and to afford active mutase (5). This suggested that
IcmB has taken on the role of a separate cobalamin-binding domain in
ICM, a conclusion that is confirmed here by the high sequence
similarity between IcmB and the cobalamin-binding domains of MutB,
methyleneglutarate mutase, and MetH as well as the small subunit (MutS)
of glutamate mutase.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
S. cinnamonensis genomic DNA digested with the
restriction enzyme SalI was shown by Southern blotting to
contain fragments of ~1.65 kb that hybridized to both oligonucleotide
probes. DNA fragments in the size range 1.6-1.8 kb were isolated from
SalI-digested genomic DNA and ligated into
SalI-cut pUC18 (15). A clone was isolated from this library
using Oligo-1 as a probe. This clone (pOCI706) contained an
1.65-kb
DNA insert, which was sequenced on both DNA strands by the dideoxy
method using dye terminator chemistry (Perkin-Elmer). The GCG Version
8.1-unix software package (Genetics Computer Group, Madison, WI) (16)
was used for sequence analysis. The sequence is shown in Fig.
2.

View larger version (52K):
[in a new window]
Fig. 2.
Nucleotide sequence of the cloned DNA from
S. cinnamonensis. The location of ORFs predicted
from a FRAME analysis are shown. ORF3 is encoded on the opposite strand
(not shown). The other ORFs are encoded on the DNA strand shown, and
the amino acid sequence in each ORF is given below the nucleotide
sequence. The predicted start codons are shown in boldface.
The predicted ribosome-binding site for ORF1 (icmB) is
underlined.
0.7 at 30 °C. The cells from
this preculture were used to inoculate 8 × 500 ml of 2YT medium
(Difco) containing ampicillin and chloramphenicol. The cells were grown
to A600 nm
0.6 with shaking at 200 rpm and
30 °C. Protein expression was induced with
isopropyl-
-D-thiogalactopyranoside to a final
concentration of 0.3 mM and shaken for an additional 4 h. The cells were harvested by centrifugation at 4 °C and stored at
20 °C.
280 = 122,000 ± 12,000 for IcmA and
280 = 10,280 ± 2100 for IcmB. Each
measurement was carried out in triplicate, and the means ± S.D.
are given. The protein concentrations determined in this way were in
good agreement with those from Bradford assays (17). The molecular mass
of recombinant IcmB in deionized water was determined by mass
spectrometry using an ion-spray source.
where v, Vmax, [A], and
[B] are the initial velocity, maximum velocity, and concentrations of
the first substrate A and second substrate B, respectively (18).
Km(A),
Km(B), and
Ki(A) are the Michaelis constants for
substrates A and B and the dissociation constant for the first
substrate A, respectively. The initial velocity data were fitted to
Equation 1 using the computer program Leonora Version 1.0 (19, 20) (see
Fig. 7, A and B).
(Eq. 1)
(Eq. 2)
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (10K):
[in a new window]
Fig. 3.
Organization of ORFs predicted by a FRAME
analysis using CODONPREFERENCE in the GCG software (16). See
"Results".
Protein sequence identities and similarities between IcmB from S. cinnamonensis and the small subunit (MutS) of glutamate mutase from C. tetanomorphum, the small subunit (GlmS) of glutamate mutase from
Clostridium cochlearium, the large subunit of MCM (MutB) from S. cinnamonensis, MutB from P. shermanii, methyleneglutarate mutase from
C. barkeri, MetH from E. coli, the MCM-like small protein from P. horikoshii, and the MCM-like small protein from A. fulgidus (GAP, GCG
software, Gap Weight 3.0) and their corresponding peptide chain lengths

View larger version (71K):
[in a new window]
Fig. 4.
Coomassie Blue-stained SDS-polyacrylamide gel
(20% homogeneous) of purified recombinant IcmA (lane
A) and IcmB (lane B). Molecular mass
standards are shown.
152
kDa. This peak showed a UV spectrum with
max at 522 and 375 nm, characteristic of enzyme-bound coenzyme B12, and
high ICM activity (3.3 µmol/min/mg). As determined by
SDS-polyacrylamide gel electrophoresis, this peak showed bands
corresponding to both IcmA and IcmB and, as determined by densitometric
scanning, in almost exactly a 1:1 molar ratio (Fig.
5). This indicates a likely
2
2-quaternary structure for native ICM
with bound coenzyme B12. The pH optimum for the ICM
reaction was ~7.4, and the activity diminished only slightly at pH
6.0 and 8.0.

View larger version (29K):
[in a new window]
Fig. 5.
Coomassie Blue-stained SDS-polyacrylamide gel
showing the IcmA and IcmB subunits of the protein complex corresponding
to a mass of ~152 kDa (lane C) (size markers are
indicated in lane D) eluted as a single peak from a
gel filtration column in the presence of coenzyme B12
(A) and plot of the relative densitometric intensities
of the IcmA and IcmB protein bands on the gel (as in
A) versus the molecular mass
(B).

View larger version (15K):
[in a new window]
Fig. 6.
Plots of initial velocity of ICM
versus IcmB concentration at a fixed concentration of
IcmA (5 nM). The two curves represent
experimental data from two independent measurements.
1 at
saturating concentrations of IcmB.

View larger version (19K):
[in a new window]
Fig. 7.
A and B, double-reciprocal
plots of 1/initial velocities (v) versus
1/substrate concentration for n-butyryl-CoA and
isobutyryl-CoA, respectively, as substrate. The experimental data
points are shown together with the best fit lines generated by the
program Leonora after fitting to Equation 1. The coenzyme
B12 concentration was varied between 4.8 and 200 µM or between 6.5 and 200 µM, as indicated
on each plot. All measurements were repeated in triplicate for
determination of Km values. In C, a Hanes
plot is shown with initial velocities (v) and
n-butyryl-CoA concentration and with saturating coenzyme
B12 (200 µM), as used to determine
Vmax and kcat (see
"Results").
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2
2-heterotetramer that
binds up to two molecules of coenzyme B12, as deduced here
for ICM.
1 determined for ICM (Fig. 7C) assumes one
active site per IcmA monomer subunit.
Apparent Km and kcat values for ICM determined in this
work compared with values for glutamate mutase (24) and MCM (1, 26, 28)
determined elsewhere
Early insights into the structures of cobalamin-dependent
enzymes came from a primary sequence comparison between the C-terminal domains (now also known as
/
-domains) of MetH and MCM (from both
prokaryotic and eukaryotic organisms) with MutS of bacterial glutamate
mutase (11). This revealed a region of highly conserved sequence
comprising the motif
DXHXXG (where X
is any amino acid), which was invariant in all the proteins examined.
After the determination of the crystal structure of the
cobalamin-binding fragment of MetH, Drennen et al. (10) were
able to define a sequence fingerprint for cobalamin binding that
included
D757XHXXG ...
S804XL ...
G833G. This fingerprint is also apparent in IcmB
(Fig. 8).
|
A notable feature in the crystal structures of both the cobalamin-binding fragment of MetH from E. coli (10) and MCM from P. shermanii (7) is the replacement of the DMB ligand from cobalt of the coenzyme by the histidine residue in the DXHXXG motif. The protein brings the cobalamin cofactor to a base-off/His-on form and places the DMB group in a central hydrophobic cleft in the cobalamin-binding domain. The histidine participates in a hydrogen-bonding network comprising 3 residues: His759-Asp757-Ser810 in MetH and His610-Asp608-Lys604 in MCM. In the case of IcmB, the corresponding residues appear to be well conserved and are represented by His20-Asp18-Lys14, which most likely are also involved in binding coenzyme B12. The other residues in the fingerprint sequence appear to line the hydrophobic cleft, to interact with the displaced DMB group, and thereby to anchor the cobalamin molecule to the protein. These comparisons therefore suggest that the residues contacting the lower face of the corrin ring are conserved in IcmB and these other cobalamin-binding proteins.
The structural conservation of the cobalamin-binding domain is readily
apparent from the available crystal structures of MetH and MCM as well
as the NMR solution structure of MutS (27). The tertiary structures of
the cobalamin-binding domains in MCM and MetH are essentially
superimposable (7). The core structure consists of a five-stranded
twisted parallel
-sheet surrounded by five
-helixes. The NMR
solution structure of the coenzyme B12-free form of MutS
also revealed a similar tertiary structure (27), except for the first
-helix, which in solution appeared slightly disordered. The
displacement of the DMB group of coenzyme B12 upon binding
to the cobalamin-binding domain appears to be a common feature of
several (but not all) coenzyme B12-dependent mutases.
As shown in earlier work (5), the sequence of the
(
/
)8-barrel in MutB comprising residues A1-A400 (7)
is highly conserved in IcmA. This suggests that the triosephosphate
isomerase barrel and much of the acyl-CoA-binding site identified in
the crystal structure of MutB are also conserved in IcmA. The
triosephosphate isomerase barrel uses a hole through its center to bind
substrate, but also appears to open in the absence of ligand (8). Many of the residues that interact with CoA along the hole seem to be highly
conserved in a sequence comparison with IcmA (Fig.
9). One residue, TyrA89 in
MutB, is conserved in all MCM sequences and is located near the
bottom of the substrate-binding hole near to the interface with
coenzyme B12. A Y89F mutant of MCM was prepared recently, and its structure was determined by crystallography (28). Although the
mutant enzyme structure was essentially superimposable on the wild-type
structure and the Km for succinyl-CoA was not
significantly affected, the kcat of the mutant
was 580-fold lower than that of the wild type. Hence, it was suggested
that TyrA89 plays a key role in the MCM reaction, although
not as a site for a protein-based radical. In the sequence comparison
with IcmA (5), this TyrA89 residue corresponds to
Phe80, so the hydrogen-bonding ability of a Tyr-OH is not
needed at this site in ICM. The kcat values for
ICM and wild-type MCM are very similar (Table II).
|
Very recently, a crystal structure of MCM with bound substrate revealed
an interaction between ArgA207 and the carboxyl group of
methylmalonyl-CoA (9). As far as the different substrate specificities
of MCM and ICM are concerned, it is intriguing to note that this
ArgA207 residue is replaced in IcmA by a glutamine, whereas
many other residues around the active site are highly conserved between
MutB and IcmA (Fig. 9). Presently, it seems reasonable to assume that the catalytic mechanisms of ICM and MCM will be largely similar or identical.
| |
ACKNOWLEDGEMENT |
|---|
We thank Annelies Meier for expert technical assistance.
| |
FOOTNOTES |
|---|
* This work was supported by the Swiss National Science Foundation and the Stipendium Commission of the Swiss Federal Government.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ246005.
To whom correspondence should be addressed. Tel.: 41-1-635-4242;
Fax: 41-1-635-6812; E-mail: robinson@oci.unizh.ch.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: ICM, isobutyryl-CoA mutase; MCM, methylmalonyl-CoA mutase; DMB, dimethylbenzimidazole; kb, kilobase pair(s); ORF, open reading frame.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Rétey, J. (1982) in B12 (Dolphin, D., ed), Vol. 2 , pp. 357-379, John Wiley & Sons, Inc., New York |
| 2. |
Birch, A.,
Leiser, A.,
and Robinson, J. A.
(1993)
J. Bacteriol.
175,
3511-3519 |
| 3. | Brendelberger, G., Retey, J., Ashworth, D. M., Reynolds, K., Willenbrock, F., and Robinson, J. A. (1988) Angew. Chem. Int. Ed. Engl. 27, 1089-1090[CrossRef] |
| 4. | Reynolds, K. A., O'Hagan, D., Gani, D., and Robinson, J. A. (1988) J. Chem. Soc. Perkin Trans. I 3195-3207 |
| 5. |
Zerbe-Burkhardt, K.,
Ratnatilleke, A.,
Philippon, N.,
Birch, A.,
Leiser, A.,
Vrijbloed, J. W.,
Hess, D.,
Hunziker, P.,
and Robinson, J. A.
(1998)
J. Biol. Chem.
273,
6508-6517 |
| 6. | Marsh, E. N., McKie, N., Davis, N. K., and Leadlay, P. F. (1989) Biochem. J. 260, 345-352[Medline] [Order article via Infotrieve] |
| 7. |
Mancia, F.,
Keep, N. H.,
Nakagawa, A.,
Leadlay, P. F.,
McSweeney, S.,
Rasmussen, B.,
Bösecke, P.,
Diat, O.,
and Evans, P. R.
(1996)
Structure
4,
339-350 |
| 8. | Mancia, F., and Evans, P. R. (1998) Structure 6, 711-720[Medline] [Order article via Infotrieve] |
| 9. | Mancia, F., Smith, G. A., and Evans, P. R. (1999) Biochemistry 38, 7999-8005[CrossRef][Medline] [Order article via Infotrieve] |
| 10. |
Drennan, C. L.,
Huang, S.,
Drummond, J. T.,
Matthews, R. G.,
and Ludwig, M. L.
(1994)
Science
266,
1669-1674 |
| 11. | Marsh, E. N. G., and Holloway, D. E. (1992) FEBS Lett. 310, 167-170[CrossRef][Medline] [Order article via Infotrieve] |
| 12. | Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990) Methods Enzymol. 185, 60-89[Medline] [Order article via Infotrieve] |
| 13. | Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1987) Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York |
| 14. | Hopwood, D. A., Bibb, M. J., Chater, K. F., Kieser, T., Bruton, C. J., Kieser, H. M., Lydiate, D. J., Smith, C. P., Ward, J. M., and Schrempf, H. (1985) Genetic Manipulation of Streptomyces: A Laboratory Manual , The John Innes Institute, Norwich, England |
| 15. | Norrander, J., Kempe, T., and Messing, J. (1983) Gene (Amst.) 26, 101-106[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Devereux, J., Haeberli, P., and Smithies, O. (1984) Nucleic Acids Res. 12, 387-395 |
| 17. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve] |
| 18. | Segel, I. H. (1993) Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-state Enzyme Systems , John Wiley & Sons, Inc., New York |
| 19. | Cornish-Bowden, A. (1994) Leonora, a Computer Program: Steady State Kinetics on the IBM , Oxford University Press, New York |
| 20. | Cornish-Bowden, A. (1995) Analysis of Enzyme Kinetic Data , Oxford University Press, New York |
| 21. | Klenk, H. P., Clayton, R. A. (J. F., T., O., W., K. E., N., K. A., K., R. J., D.,), Gwinn, M., Hickey, E. K., Peterson, J. D., Richardson, D. L., Kerlavage, A. R., Graham, D. E., Kyrpides, N. C., Fleischmann, R. D., Quackenbush, J., Lee, N. H., Sutton, G. G., Gill, S., Kirkness, E. F., Dougherty, B. A., McKenney, K., Adams, M. D., Loftus, B., and Venter, J. C. (1997) Nature 390, 364-370[CrossRef][Medline] [Order article via Infotrieve] |
| 22. | Kawarabayasi, Y., Sawada, M., Horikawa, H., Haikawa, Y., Hino, Y., Yamamoto, S., Sekine, M., Baba, S., Kosugi, H., Hosoyama, A., Nagai, Y., Sakai, M., Ogura, K., Otuka, R., Nakazawa, H., Takamiya, M., Ohfuku, Y., Funahashi, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi, A., Aoki, K., Nakamura, Y., Robb, T. F., Horikoshi, K., Masuchi, Y., Shizuya, H., and Kikuchi, H. (1998) DNA Res. 5, 55-76[Abstract] |
| 23. | Watanabe, F., Abe, K., Tamura, Y., and Nakano, Y. (1996) Microbiology 142, 2631-2634[Abstract] |
| 24. |
Holloway, D. E.,
and Marsh, E. N. G.
(1994)
J. Biol. Chem.
269,
20425-20430 |
| 25. | Chen, H. P., and Marsh, E. N. G. (1997) Biochemistry 36, 14939-14945[CrossRef][Medline] [Order article via Infotrieve] |
| 26. |
Kellermeyer, R. W.,
Allen, S. H. G.,
Stjernholm, R.,
and Wood, H. G.
(1964)
J. Biol. Chem.
239,
2562-2569 |
| 27. | Tollinger, M., Konrat, R., Hilbert, B. H., Marsh, E. N. G., and Krautler, B. (1998) Structure 6, 1021-1033[Medline] [Order article via Infotrieve] |
| 28. | Thoma, N. H., Meier, T. W., Evans, P. R., and Leadlay, P. F. (1998) Biochemistry 37, 14386-14393[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
R. H. Muller, T. Rohwerder, and H. Harms Carbon Conversion Efficiency and Limits of Productive Bacterial Degradation of Methyl tert-Butyl Ether and Related Compounds Appl. Envir. Microbiol., March 15, 2007; 73(6): 1783 - 1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rohwerder, U. Breuer, D. Benndorf, U. Lechner, and R. H. Muller The Alkyl tert-Butyl Ether Intermediate 2-Hydroxyisobutyrate Is Degraded via a Novel Cobalamin-Dependent Mutase Pathway. Appl. Envir. Microbiol., June 1, 2006; 72(6): 4128 - 4135. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Korotkova and M. E. Lidstrom MeaB Is a Component of the Methylmalonyl-CoA Mutase Complex Required for Protection of the Enzyme from Inactivation J. Biol. Chem., April 2, 2004; 279(14): 13652 - 13658. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Probian, A. Wulfing, and J. Harder Anaerobic Mineralization of Quaternary Carbon Atoms: Isolation of Denitrifying Bacteria on Pivalic Acid (2,2-Dimethylpropionic Acid) Appl. Envir. Microbiol., March 1, 2003; 69(3): 1866 - 1870. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Heinzelmann, S. Berger, O. Puk, B. Reichenstein, W. Wohlleben, and D. Schwartz A Glutamate Mutase Is Involved in the Biosynthesis of the Lipopeptide Antibiotic Friulimicin in Actinoplanes friuliensis Antimicrob. Agents Chemother., February 1, 2003; 47(2): 447 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang and K. A. Reynolds MeaA, a Putative Coenzyme B12-Dependent Mutase, Provides Methylmalonyl Coenzyme A for Monensin Biosynthesis in Streptomyces cinnamonensis J. Bacteriol., March 15, 2001; 183(6): 2071 - 2080. [Abstract] [Full Text] |
||||
![]() |
H.-P. Chen, S.-H. Wu, Y.-L. Lin, C.-M. Chen, and S.-S. Tsay Cloning, Sequencing, Heterologous Expression, Purification, and Characterization of Adenosylcobalamin-dependent D-Ornithine Aminomutase from Clostridium sticklandii J. Biol. Chem., November 21, 2001; 276(48): 44744 - 44750. [Abstract] [Full Text] [PDF] |
||||
| |||||||