JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inoue, T.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inoue, T.
Right arrow Articles by Sakai, T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 45, 32309-32317, November 5, 1999


Sp1 and NF-Y Synergistically Mediate the Effect of Vitamin D3 in the p27Kip1 Gene Promoter That Lacks Vitamin D Response Elements*

Toshiaki Inoue, Jun Kamiyama, and Toshiyuki SakaiDagger

From the Department of Preventive Medicine, Kyoto Prefectural University of Medicine, Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Vitamin D3 promotes myeloid leukemic cell lines to differentiate terminally into monocytes/macrophages. It has been reported that overexpression of the cdk inhibitor p27Kip1 results in the differentiation of the myelomonocytic U937 cell line and that this gene is the target of vitamin D3. To identify the sequences required for the positive regulation of p27Kip1 transcription by vitamin D3, a 3.6-kilobase 5'-flanking region of the human p27Kip1 gene was examined by transiently transfecting luciferase reporter constructs into U937 cells. The transcriptional activity of this construct was activated by vitamin D3. Deletion and mutational analysis revealed that both a GGGCGG sequence (-545/-539) and a CCAAT sequence (-525/-520) were necessary to induce p27Kip1 gene expression. Importantly, the region containing both of these elements conferred positive responsiveness to vitamin D3 to a heterologous promoter. Gel shift assays showed that Sp1 binds to the GGGCGG sequence and that NF-Y binds to the CCAAT sequence. Consistent with the roles of these transcription factors, treatment with vitamin D3 stimulated the DNA binding activities of these factors to each element and induced the change of one NF-Y subunit. We conclude that vitamin D3 stimulates transcription of the p27Kip1 gene by a novel mechanism involving Sp1 and NF-Y, but not the vitamin D receptor, during the early stages of U937 cell differentiation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1,25-Dihydroxyvitamin D3 is not only a major regulator of mineral homeostasis but also a potent modulator of differentiation in several types of cells including monoblastic cells and osteoblasts (1). Recent studies have revealed that the cdk inhibitors p21Cip1 and p27Kip1 act as molecular switches that facilitate the vitamin D3-induced differentiation of the U937 myeloid leukemic cell line. These genes are regulated both at the transcriptional level and the post-transcriptional level by vitamin D3 during the early stages of this process (2). Vitamin D3 transduces its signal to the nucleus directly, mainly through a regulatable DNA-binding transcription factor, the vitamin D receptor (VDR)1 (3), and ligand-inducible effects on differentiation are initiated through the direct activation of target genes by VDR. In fact, vitamin D3 induces p21Cip1 transcription in a VDR-dependent manner through a functional vitamin D response element (VDRE) in its promoter (2). To investigate the regulatory mechanisms of p27Kip1 by vitamin D3, we previously characterized the human p27Kip1 gene promoter (4). We found no canonical VDRE (5'-RGKTCANNNRGKTCA-3') within a 3.6-kilobase 5'-flanking region upstream of the translation start site. This implies that p27Kip1 is regulated by mechanisms that are different from those of other vitamin D3 target genes, such as p21Cip1 (2), c-fos (5), and osteocalcin (6). In addition, recent studies have shown the involvement of a VDR-independent mechanism in the regulation of vitamin D3-induced cell differentiation. For instance, monocyte differentiation is mediated by vitamin D3 without requiring binding to VDR (7), and keratinocyte differentiation-related genes are stimulated by vitamin D3 without the presence of VDRE (8). Clarification of the regulatory mechanisms of p27Kip1 transcription is crucial for the understanding of the molecular mechanisms of vitamin D3 action and for the understanding of the early processes during monocyte/macrophage differentiation. Although the post-transcriptional regulation of p27Kip1 has been studied intensively (9-11), very little is known about the transcriptional regulation of the p27Kip1 gene.

In this study, we have analyzed the p27Kip1 promoter in order to identify elements required for vitamin D3-induced up-regulation of transcription, which might reveal the early and novel mechanism of differentiation induction by vitamin D3.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of the Luciferase Reporter Plasmid-- The promoter region of the human p27Kip1 gene (p27PF) or enzyme-generated 5'-deletion sequences (p27Apa I, p27Afl II, p27No. 2, p27No. 12, p27No. 1, p27MB-435, and p27Sac II) were subcloned into the XhoI site of the pGL2 Basic vector (Promega) as described previously (4). The plasmids with point mutations in p27PF (p27mSp1-1, p27mSp1-2, and p27mCTF) were generated by in vitro mutagenesis as described previously (12). Furthermore, we generated constructs containing four tandem copies of the specific sequence of the p27Kip1 promoter fused to a minimal promoter. A double-stranded 52-bp DNA fragment containing a 44-bp sequence corresponding to the -555/-512 region of the human p27Kip1 promoter and linker sites (indicated by lowercase letters below) at both ends was generated from two oligonucleotides. The top strand (5'-agggAGCCTCGGCGGGGCGGCTCCCGCCGCCGCAACCAATGGATCTCC-3') and the bottom strand (5'-ccctGGAGATCCATTGGTTGCGGCGGCGGGAGCCGCCCCGCCGAGGCT-3') were annealed, ligated, blunted, and subcloned into the SmaI site upstream of the SV40 early promoter in the PicaGene Promoter Vector 2 (Nippon Gene, Tokyo, Japan) in a forward or reverse orientation to generate PGPV2[-555/-512wild]4 and PGPV2[R-555/-512wild]4, respectively. Similarly, three types of double-stranded mutated oligonucleotides of the 44-bp sequence were also inserted the same vector to generate the mutated constructs PGPV2[-555/-512mSp1-1]4, PGPV2[-555/-512mSp1-2]4, and PGPV2[-555/-512mCTF]4 (see Table I).

                              
View this table:
[in this window]
[in a new window]
 
Table I
Oligonucleotides used in this study
The Sp1 and NF-Y consensus sequences are indicated by bold letters. The mutated sequences are underlined. The linker sequences at the end of the oligomers are indicated by lowercase letters.

Cell Culture and Differentiation Induction-- The human myelomonocytic cell line U937 (a kind gift from Dr. Y. Honma at Saitama Cancer Center Research Institute) was maintained in RPMI 1640 supplemented with 10% (v/v) fetal bovine serum in an atmosphere of 5% CO2. Cells were induced toward monocytic differentiation in the presence of 1,25-dihydroxyvitamin D3 (Wako, Tokyo, Japan).

Luciferase Assay-- Transfections into U937 cells were performed as described (13). Briefly, cells were electroporated at 250 V, 960 microfarads (Bio-Rad Gene Pulser; Bio-Rad), incubated for 15 min on ice, and then transferred to 20 ml of prewarmed RPMI 1640 containing 10% fetal bovine serum and divided equally into two cultures. They were incubated with either 1 × 10-7 M vitamin D3 or 10 µl of equivalent vehicle (ethanol). Cells were harvested 40 h after treatment, and preparation of extracts and the luciferase assay were performed using the Dual-Luciferase Reporter Assay (Promega), according to the manufacturer's instructions. All transfections included a reference sample with pGL2 Basic Vector or PicaGene Promoter Vector 2. For normalization of transfection efficiencies, 2 µg of renilla (sea pangy) luciferase expression plasmid (pRL-TK, Promega) was included in the transfections. The experimental reporter luciferase activity was calculated by subtracting the intrinsic activity as measured by samples corresponding to the pGL2 Basic Vector or PicaGene Promoter Vector 2 and then normalized to transfection efficiency as measured by the activity deriving from pRL-TK.

Gel Shift Assay-- Nuclear extracts of U937 cells were prepared according to the procedure of Andrews and Faller (14). The cells were treated with either 10-7 M vitamin D3 or vehicle for 36 h before extraction. Gel shift assays were carried out as described by Orita et al. (15). The reaction mixture for the gel shift assay (25-µl final volume) contained 20 mM Tris-HCl (pH 8.0), 100 mM KCl, 10% glycerol, 1 µg of poly(dI-dC), and 2 µg of nuclear extract. After preincubation for 15 min at 23 °C, probe DNA (approximately 0.5 ng, 10,000 cpm) was added to the mixture, and the binding reaction was allowed to proceed at 23 °C for 20 min. The product was then resolved by electrophoresis on 4% acrylamide:bisacrylamide (29:1), 0.5 × TBE nondenaturing gel at 10 V/cm for 150 min. Competition analyses were performed by mixing the indicated amount of appropriate competitor DNA to the binding reaction prior to addition of nuclear extracts. In supershift experiments, antibodies against Sp1 (sc-59X; Santa Cruz), Sp3 (sc-644X; Santa Cruz), and C/EBP-alpha (sc-7204X; Santa Cruz) were purchased. The antibodies against NF-YA, -YB, and -YC (IgG fraction) were kindly provided by Drs. T. Orita and S. Nagata at Osaka University Medical School. These antibodies were added to the incubation mixture containing nuclear protein before the addition of probe DNA.

Western Blotting-- U937 cells treated with either 10-7 M vitamin D3 or vehicle at different time points were harvested. Cells (3 × 107) were washed in cold phosphate-buffered saline twice and then resuspended in 150 µl of lysis buffer (50 mM Tris-HCl (pH 7.9), 150 mM NaCl, 0.1% SDS, 0.5% deoxycholate, 1% Nonidet P-40, 10% glycerol, 0.2 mM phenylmethylsulfonyl fluoride, and 10 µg/ml aprotinin). This was subjected to mild sonication and used as whole cell extracts. Extracts (from 1 × 106 cells) were subjected to 12% SDS-polyacrylamide gel electrophoresis and blotted onto polyvinylidene difluoride membranes (Millipore). The membranes were incubated with the primary antibodies and then incubated with horseradish peroxidase-conjugated secondary antibody. The immune complexes were visualized using an enhanced chemiluminescence system (Amersham Pharmacia Biotech). The antibodies against NF-YA, -YB, and -YC and the antibody against Sp1 (sc-59) were used at a 1:1,000 and 1:200 dilution in blocking buffer (3% milk powder in phosphate-buffered saline), respectively.

Analysis of NF-YA mRNA-- Total RNA was prepared using the TRIZOLTM (Life Technologies, Inc.)/chloroform method from U937 cells treated with either 10-7 M vitamin D3 or vehicle at different time points. Reverse transcriptase PCR was performed using the RNA PCR Kit Ver. 2.1 (Takara, Tokyo, Japan). The forward (F) and reverse (R) primers for NF-YA-short and -long were AATAGTTCGACAGAGCAGATTG (primer F1), CCTCCTGATTGGGTTTCGGAGT (primer F2), and GGGGTTAGGACACTCGGATGAT (primer R). The forward and reverse primers for glyceraldehyde-3-P-dehydrogenase were ACCACAGTCCATGCCTCA and TCCACCACCCTGTTGCTGTA. 1 µg of total RNA was used for reverse transcriptase PCR. PCR was performed for 25 and 20 cycles to detect NF-YA subunits and glyceraldehyde-3-P-dehydrogenase, respectively. PCR products were subjected to electrophoresis in a 3% agarose gel. The primers for NF-YA were designed to detect two different isoforms simultaneously and were located in regions that were conserved in the two isoforms (16).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Vitamin D3-responsive Elements in the Human p27Kip1 Promoter-- It has been reported that p27Kip1 and p21Cip1 are transcriptionally induced by vitamin D3 (2). We also observed that p27Kip1 mRNA was induced after treatment of U937 cells with vitamin D3, and it peaked between 24 h and 48 h (approximately 4-fold compared with 0 h), whereas p21Cip1 mRNA induction was more rapid (data not shown). This suggests that vitamin D3 regulates transcription of p27Kip1 in a VDR/VDRE-independent manner unlike the case of p21Cip1 transcription. To investigate the regulatory mechanisms behind p27Kip1 gene expression, we first investigated the effect of vitamin D3 on the transcriptional activity of the promoter of the p27Kip1 gene. The effect of vitamin D3 on the wild type p27Kip1 promoter-luciferase fusion plasmid, p27PF, was examined by transient transfection. Following a 40-h exposure to vitamin D3, the luciferase activity from p27PF plasmid was increased approximately 3-4-fold of that of the vehicle-treated control (Fig. 1). This result was consistent with our observation of the effect of vitamin D3 on p27Kip1 expression by Northern analysis, indicating that this 3.6-kilobase promoter fragment was necessary and sufficient for the response of p27Kip1 gene to vitamin D3. Next, we tried to determine whether any particular regions in the 3.6-kilobase fragment were responsive to vitamin D3. For this purpose, a series of 5'-deletion constructs of the p27Kip1 promoter was examined. Fig. 1 shows that deletion up to position -549 (relative to the translation start site) did not result in significant changes in the response to vitamin D3 and that the responsiveness was abolished completely using deletions up to -511, whereas deletions up to -311 exhibited some promoter activities in the absence of vitamin D3. These results indicated that potential vitamin D3 regulatory elements appeared to be located between -549 and -511.


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 1.   Differential effects of vitamin D3 on the human p27Kip1 promoter activities with a series of 5'-deletions. 18 µg of each constructed plasmid was transiently transfected into U937 cells with 2 µg of pRL-TK, and luciferase activities were analyzed after a 40-h treatment of 10-7 M vitamin D3. Relative luciferase activities are shown as percentages of that of p27PF in the absence of vitamin D3. Data are shown as means (bars, standard deviation) (n = 3). *, p < 0.01; **, p < 0.05.

The region between -549 and -511 harbored two Sp1 sites (-544 and -534) and a CCAAT box (-522) which were adjacent to each other and were conserved between the human and mouse p27Kip1 promoters (4, 17). In this study, we termed the two upstream Sp1 sites Sp1-1 and Sp1-2 (Fig. 2). To determine whether the two Sp1 sites and the CCAAT box were involved in activation by vitamin D3, a series of mutants of p27PF with mutations in the Sp1-1 site, the Sp1-2 site, or the CCAAT box was constructed and termed p27mSp1-1, p27mSp1-2, and p27mCTF, respectively (Fig. 2). As shown in Fig. 2, the response to vitamin D3 was abolished using p27mSp1-1 and p27mCTF but not p27mSp1-2. On the other hand, all mutants retained some promoter activities in the absence of vitamin D3. Therefore we concluded that at least both the Sp1-1 and the CCAAT box were the vitamin D3-responsive elements and that the Sp1-2 site was not involved in the activation by vitamin D3.


View larger version (10K):
[in this window]
[in a new window]
  		Fig. 2.   Mutation analysis to identify the vitamin D3-responsive sites in the p27Kip1promoter. Three different mutants, shown on the left, are identical to the wild type p27PF except for the mutation indicated in bold letters. 18 µg of each constructed plasmid was transiently transfected into U937 cells with 2 µg of pRL-TK. Luciferase activities were analyzed after a 40-h treatment with 10-7 M vitamin D3 compared with p27PF without vitamin D3 treatment. Data are shown as means (bars, standard deviation) (n = 3). *, p < 0.01.

A 44-bp Regulatory Sequence between -555 and -512 Which Contains the Sp1-1 Site and the CCAAT Box Confers Response to Vitamin D3 to a Heterologous Promoter-- To examine vitamin D3 regulation via the Sp1-1 site and the CCAAT box that are located near each other downstream from -555, four tandem copies of the sequences corresponding to -555/-512 with or without mutations of the Sp1-1 site, the Sp1-2 site, or the CCAAT box were inserted upstream of the SV40 early promoter in the PicaGene Promoter Vector 2 in a normal (PGPV2[-555/-512wild]4, PGPV2[-555/-512mSp1-1]4, PGPV2[-555/-512mSp1-2]4, and PGPV2[-555/-512 mCTF]4) or a reverse orientation (PGPV2[R-555/-512wild]4) (Fig. 3). As shown in Fig. 3, four copies of the 44-bp fragment corresponding to between -555 and -512 of the p27Kip1 promoter conferred significant response to vitamin D3 to the SV40 early promoter in an orientation-dependent manner following transient transfection of U937 cells, although one copy of the same fragment did not respond to vitamin D3 (data not shown). Mutations introduced in either the Sp1-1 or the CCAAT box (PGPV2[-555/-512mSp1-1]4, PGPV2[-555/-512mCTF]4, respectively) abolished any stimulatory effect by vitamin D3, whereas luciferase activity of a construct containing mutations in the Sp1-2 site (PGPV2[-555/-512mSp1-2]4) was activated by vitamin D3 in a manner similar to that of p27PF and PGPV2[-555/-512wild]4. We concluded that the region between -555 and -512 relative to the translation start site (-118 and -75 relative to the transcription start site2) was sufficient for vitamin D3-induced transcription of the p27Kip1 gene, although we could not exclude the possibility that other sequences in the p27Kip1 promoter were also required. Furthermore, both the Sp1-1 site and the CCAAT box in this region were vitamin D3-responsive elements and were required for vitamin D3-induced transcription of the p27Kip1 gene.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 3.   Four tandem repeat of a 44-bp regulatory sequence between -555 and -512 which contains the Sp1-1 site, and the CCAAT box confers response to vitamin D3 to a heterologous promoter. Five constructs, PGPV2[-555/-512wild]4, PGPV2[-555/-512mSp1-1]4, PGPV2[-555/-512mSp1-2]4, PGPV2[-555/-512mCTF]4, and PGPV2[R-555/-512wild]4, were generated as described under "Materials and Methods." 18 µg of each constructed plasmid was transiently transfected into U937 cells with 2 µg of pRL-TK, and luciferase activities were analyzed after a 40-h treatment with 10-7 M vitamin D3 compared with p27PF without vitamin D3 treatment. Data are shown as means (bars, standard deviation) (n = 3). *, p < 0.01; **, p < 0.03.

Identification of Nuclear Proteins Interacting with the Vitamin D3-responsive Sequence-- To identify the nuclear factors binding to the vitamin D3-responsive sequence, a set of oligonucleotides spanning -555 to -512 was used as a probe for gel shift assays (-555/-512wild, see Table I). Nuclear extracts were prepared from U937 cells treated with vitamin D3 for 36 h. As shown in Fig. 4A, the oligonucleotides -555/-512wild yielded a single major retarded band (lane 1), which was competed away by an excess of unlabeled oligonucleotide (lanes 2 and 3). To localize the sequence that binds to nuclear factor(s), a series of oligonucleotides that carried point mutations in the Sp1-1, the Sp1-2, or the CCAAT box (-555/-512mSp1-1, -555/-512mSp1-2, and -555/-512mCTF, respectively), oligonucleotides carrying canonical wild type or a mutated sequence for the sequence Sp1 site or CCAAT box (Sp1wild, Sp1mt, and NF-Ywild), and oligonucleotides spanning -534 to -512 (-534/-511) were used as competitors. As shown in lanes 4-17, the retarded band was not competed out by the addition of -555/-512mSp1-1, Sp1mt, NF-Ywild, or -534/-512wild, indicating that Sp1 family protein(s) bind to the Sp1-1 site. To elucidate whether the retarded band represents the binding of Sp1 or Sp3, gel shift assays were performed with nuclear extracts that were preincubated with anti-Sp1 or -Sp3 antibody for band supershift experiments (18). As shown in Fig. 4B, in the presence of anti-Sp1 antibody but not anti-Sp3 antibody, the complex was supershifted. We concluded that Sp1 binds to the Sp1-1 site of the vitamin D3 regulatory region of the p27Kip1 promoter in U937 cells.


View larger version (48K):
[in this window]
[in a new window]
  		Fig. 4.   Sp1 can interact with the Sp1-1 site, one of the vitamin D3-responsive elements. Panel A, gel shift assays were carried out with nuclear extracts prepared from vitamin D3-treated U937 cells. A set of oligonucleotides containing the Sp1-1 and CTF sites between -555 and -512 (-555/-512wild) was used as a probe. Nuclear extracts were incubated with 32P-labeled -555/-512wild in the absence (-) (lane 1) or in the presence of 15- or 45-fold amounts of various unlabeled oligonucleotides. Panel B, effects of anti-Sp1 and anti-Sp3 antibodies on the formation of the complexes. Complexes were formed in the absence (lane 1) or in the presence of anti-Sp1 (lane 2) or anti-Sp3 antibodies (lane 3).

We also analyzed the sequence between -534 and -512 which carries the CCAAT box but not the Sp1-1 and Sp1-2 sites. A set of oligonucleotides spanning this region was used as a probe for gel shift assays. As shown in Fig. 5A, we observed a single major retarded band, which was competed away by excess unlabeled wild type oligonucleotides (-534/-512wild) but not those carrying a mutation in the CCAAT box (-534/-512mCTF) (lanes 1-5). This indicated that nuclear factor(s) bind to the CCAAT box of the p27Kip1 promoter. So far, it has been reported that several different transcriptional factors including NF-Y, C/EBP, CAT-binding protein, and NF-I are capable of binding to CCAAT sequences (19-22). To elucidate which transcription factor binds to the CCAAT box in the regulatory region of the p27Kip1 promoter, we performed competition experiments using unlabeled oligonucleotides carrying the CCAAT sequence that had been reported to bind to NF-Y, C/EBP-alpha , or NF-I with a high affinity (NF-Ywild, C/EBP-alpha wild, and NF-Iwild, respectively). As shown in Fig. 5A, the retarded band was competed by the addition of NF-Ywild but not NF-Iwild or C/EBP-alpha wild. This suggested that NF-Y binds to this CTF site. To confirm this result, we performed supershift assays using anti-NF-Y antibodies. NF-Y is composed of three subunits, NF-YA, NF-YB, and NF-YC. We used anti-NF-YA, -YB, and -YC antibodies (15, 23) and anti-C/EBP-alpha antibody for supershift experiments. As shown in Fig. 5B, in the presence of anti-NF-YA, -YB, or -YC antibodies, the complex was supershifted. The addition of anti-C/EBP-alpha did not affect the complex. These results demonstrated that trimeric NF-Y binds to the CCAAT box of the regulatory region of the p27Kip1 promoter, although we could not observe NF-Y binding to -555/-512wild probe. To verify that NF-Y could bind not only to the CCAAT box in the -534/-512wild sequence but also to the site in the -555/-512 wild sequence, we again used oligonucleotides spanning -555 to -512, with or without mutations in the Sp1-1, Sp1-2, or CTF site as competitors. For the same purpose, we investigated the effects of the addition of anti-NF-YA, -YB, or -YC antibodies on the formation of the complexes of -555/-512wild probe and nuclear proteins by gel shift assays. The addition of anti-NF-YA, -YB, or -YC antibody did not affect the complexes of -555/-512wild and nuclear proteins (data not shown). However, as shown in Fig. 5A, NF-Y binding to the probe -534/-512wild was competed by -555/-512wild, -555/-512mSp1-1, and -555/-512mSp1-2, although these oligonucleotides were less effective than -534/-512wild, while NF-Y binding to -534/-512wild was not affected by -555/-512mCTF. These results indicated that NF-Y binds to the CCAAT box in -555/-512wild as well as the site in -534/-512wild. Therefore, we concluded that Sp1 and NF-Y bind to the Sp1-1 site and the CCAAT box, respectively, the regulatory elements that are required for vitamin D3-induced transcription of the p27Kip1 gene.


View larger version (48K):
[in this window]
[in a new window]
  		Fig. 5.   NF-Y can interact with the CTF site, the other vitamin D3-responsive element. Panel A, gel shift assays were carried out with nuclear extracts prepared from vitamin D3-treated U937 cells. A set of oligonucleotides containing the CTF site between -534 and -512 (-534/-512wild) was used as a probe. Nuclear extracts were incubated with 32P-labeled -534/-512wild in the absence (lane 1) or in the presence of 15- or 45-fold amounts of various unlabeled oligonucleotides. Panel B, effects of anti-NF-Y and anti-C/EBP-alpha antibodies on the formation of the complexes. Complexes were formed in the absence (lane 1) or in the presence of anti-NF-YA, -YB, or YC antibodies (lanes 2-4) or anti-C/EBP-alpha antibody (lane 5).

To confirm further the involvement of NF-Y in the vitamin D3-induced transcription of p27Kip1, we cotransfected p27PF or p27mCTF with a dominant negative NF-YA mutant expression plasmid (pNF-YA29) (24). As shown in Fig. 6, pNF-YA29 suppressed the vitamin D3-induced luciferase activities from p27PF but not p27mCTF in a dose-dependent manner. This result demonstrates directly that NF-Y mediates the up-regulation of p27Kip1 transcription by vitamin D3 via the CTF site of its promoter.


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 6.   A dominant-negative NF-YA expression plasmid (pNF-YA29) suppresses the vitamin D3 responsiveness of the p27 promoter. 9 µg of p27PF or p27mCTF was cotransfected into U937 cells with various amounts of expression plasmid for the dominant negative NF-YA (pNF-YA29) with 2 µg of pRL-TK. Luciferase activities were analyzed after a 40-h treatment with 10-7 M vitamin D3 compared with p27PF without vitamin D3 treatment. Data are shown as means (bars, standard deviation) (n = 3). *, p < 0.01.

Analysis of Sp1 and NF-Y Subunits after Vitamin D3 Treatment-- The results described above suggested strongly that Sp1 and NF-Y are the essential regulators in vitamin D3-induced transcription of the p27Kip1 gene. To investigate the mechanism how Sp1 and NF-Y regulate transcription of the p27Kip1 gene, we examined whether binding of Sp1 and NF-Y to the p27Kip1 promoter was altered following vitamin D3 treatment, using gel shift assays. Nuclear extracts were prepared from U937 cells treated with either vitamin D3 or vehicle alone for 36 h. As a probe, -555/-512wild oligonucleotides or -534/-512wild oligonucleotides were used to detect Sp1 and NF-Y, respectively. As shown in Fig. 7, we observed that Sp1 and NF-Y binding activities increased significantly after vitamin D3 treatment. Because the DNA binding activity of an unrelated transcription factor, NF-I, was not changed by the treatment of vitamin D3, we concluded that the treatment of vitamin D3 specifically stimulates the binding of Sp1 and NF-Y to the p27Kip1 promoter. To analyze the protein levels of Sp1 and NF-Y subunits, whole cell extracts were prepared from U937 cells treated with vitamin D3 or vehicle alone at different time points. The amounts of these proteins were analyzed by Western blotting. As shown in Fig. 8, the level of Sp1 increased slightly from 12 h to 18 h after the vitamin D3 treatment, and after 36 h the level of Sp1 was reduced and barely detectable. The increase in the level of Sp1 occurred prior to the increase of p27Kip1 mRNA following the vitamin D3 treatment (data not shown). Interestingly, the level of Sp1 protein showed little difference between vitamin D3 and vehicle-treated cells after 36 h, when we could observe a significant increase in the binding of Sp1 to the Sp1-1 site of the human p27Kip1 promoter (Fig. 7). These results indicate that post-translational regulation of Sp1 such as phosphorylation (25) and glycosylation (26) could contribute to up-regulation of p27Kip1 transcription by vitamin D3 in combination with slight induction of Sp1 protein. On the other hand, as reported previously, we also observed two bands for NF-YA (36 kDa and 39 kDa) which are thought to result from differential splicing (15, 16, 27) (Fig. 8). To our surprise, the level of the 39-kDa form of NF-YA decreased from 12 h to 48 h after the vitamin D3 treatment. To confirm that this change resulted from the decrease of long form NF-YA mRNA, we performed reverse transcriptase PCR analysis of NF-YA mRNA using primers F1 and R that were located in the regions that are conserved in the two isoforms. As shown in Fig. 8B, we obtained two bands that were derived from two isoforms of NF-YA mRNA judging from restriction enzyme analysis (data not shown). As expected, the long form of NF-YA decreased gradually in vitamin D3-treated cells. The same results were obtained with a different combination of PCR primers (primer F2 and R). These results suggested that a decrease of the band for 39-kDa NF-YA protein resulted from the decrease of its mRNA and not protein modification. This decrease in the low molecular weight form of NF-YA was observed prior to the increase of p27Kip1 mRNA after vitamin D3 treatment. A significant change was not seen in the level of NF-YB and NF-YC between vitamin D3 and vehicle-treated cells (Fig. 8A). Taken together, these results suggest that NF-Y acts as a mediator of vitamin D3 in the regulation of p27Kip1 transcription via the decrease in the high molecular weight form of NF-YA, although the precise mechanism remains to be solved.


View larger version (49K):
[in this window]
[in a new window]
  		Fig. 7.   Change of Sp1 and NF-Y binding activities to the p27Kip1 promoter after vitamin D3 treatment. Nuclear extracts were prepared from either vitamin D3-treated or vehicle (ethanol)-treated U937 cells for 36 h. 2 µg of each nuclear extract was incubated with the -555/-512wild probe (lanes 1-3), the -534/-512wild probe (lanes 4-6), or the NF-Iwild probe (lanes 7-12) to detect Sp1, NF-Y, and NF-I, respectively.


View larger version (53K):
[in this window]
[in a new window]
  		Fig. 8.   Change of Sp1 and NF-Y subunits after vitamin D3 treatment. Panel A, whole cell extracts were prepared from U937 cells at the indicated time points after the treatment of vitamin D3. Extracts were subjected to 12% SDS-polyacrylamide gel electrophoresis, followed by Western blotting with anti-Sp1 or with anti-NF-YA, -YB, -YC antibodies. Panel B, total RNAs were prepared from U937 cells at the indicated time after the treatment of vitamin D3. Reverse transcriptase PCR was carried out using different combinations of PCR primers. Top panel, primers F1 and R; middle panel, primers F2 and R; bottom panel, primers for glyceraldehyde-3-P-dehydrogenase.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we analyzed the vitamin D3-induced transcription of p27Kip1 as a model to understand a possible novel pathway of vitamin D3 action which does not directly involve VDR/VDRE and the mechanism of U937 differentiation. From transient transfection studies, we conclude that Sp1 and NF-Y mediate the vitamin D3-induced transcription via elements that are closely located adjacent to each other in the promoter region of p27Kip1. Importantly, the 44-bp element in the p27Kip1 promoter that carries Sp1 and NF-Y binding sites is sufficient for the response to vitamin D3, and both elements are required for this response. We believe that this is the first report that explains the molecular mechanism of vitamin D3-induced transcription that does not directly require VDR, although vitamin D3-dependent transcriptional repression that does not require VDR has been reported previously (28, 29).

The next question to be solved was how vitamin D3 activated the p27Kip1 gene expression via Sp1 and NF-Y. Binding activities of Sp1 and NF-Y to each element in the p27Kip1 promoter were stimulated significantly after vitamin D3 treatment. Furthermore, Western blotting analysis showed that Sp1 increased slightly, and one subunit of NF-Y changed to a low molecular weight form prior to the accumulation of p27Kip1 mRNA. These findings raise the hypothesis that post-translational modification of Sp1 and differential splicing of NF-YA induced by vitamin D3 lead to the activation of p27Kip1 transcription through enhanced binding of these factors to regulatory elements in the p27Kip1 promoter. It has been shown that Sp1 can mediate responses to several inducers of myeloid differentiation, and several myeloid promoters are dependent on a functional Sp1 site (30-32). NF-Y also can mediate responses to several inducers of myeloid differentiation and macrophage maturation (15, 33, 34), However, little is known about the mechanism of how NF-Y mediates these responses. We found that the form of NF-YA changes after differentiation induced by vitamin D3. Existence of two isoforms of NF-YA, which result from differential splicing, has been reported in human and mouse (16, 27). The functional difference between the two isoforms is not clear. However, there is a possibility that the two forms have different biological activities since two forms are expressed in various types of cells with a strong tissue-specific bias (16, 27). Our data indicate that a switch in isoform resulting in the decrease of high molecular weight form of NF-YA protein may be involved in the transcriptional activation of p27Kip1 by vitamin D3.

Another question to be solved is why both Sp1 and NF-Y are required for the vitamin D3-induced transcription of p27Kip1. The possible mechanism is the involvement of histone acetyltransferases, known as transcriptional cofactors including p300, GCN5, and P/CAF (35). Recently it was shown that NF-Y interacts with p300 in vivo, and NF-Y establishes a pre-set promoter architecture that can facilitate transcription within chromatin by recruiting p300 protein (36). Similarly, NF-Y has been shown to be associated with GCN5 and P/CAF in vitro, and GCN5 activates NF-Y-dependent transcription in vivo (37). We reported previously that histone deacetylase inhibitors activate the p21Cip1 gene promoter through Sp1 sites that can interact with Sp1 and Sp3 (18, 38). Thus, it is possible that NF-Y activates p27Kip1 transcription through modification of Sp1 sites by recruiting histone acetyltransferases.

In this study, we found a novel pathway to mediate vitamin D3 action which does not directly involve VDR. We then searched for the genes that carry Sp1 and CCAAT sequence in their promoter regions. We found that both elements exist in the promoter region of VDR, whose transcription is also up-regulated by vitamin D3 (39, 40). Moreover, no VDRE exists in the promoter region of the VDR gene. This suggests that the regulatory mechanism we found might be more generally applicable to other genes that are regulated by vitamin D3.

In U937 cell differentiation induced by vitamin D3, p21Cip1 acts as a molecular switch to trigger U937 cell differentiation, and its transcription is up-regulated along with p27Kip1 (2). In this experimental system, transcription of the p21Cip1 gene is activated during the initial processes by VDR/VDRE. The present study shows that p27Kip1 is activated at a slightly later stage by Sp1 and NF-Y in a cooperative manner. Such phased regulation of molecular switches by different transcriptional regulatory mechanisms will be important for the commitment event between growth and differentiation during development and cellular differentiation.

    ACKNOWLEDGEMENTS

We thank Drs. T. Orita, S. Nagata, R. Mantovani, and Y. Honma for generous gifts of materials and Drs. K.-I. Matsuda, N. Iijima, and H. Kojima for useful advice on Western blotting and electroporation methods. We also thank Drs. T. C. Schulz, H. Tanaka, M. Oshimura, M. Obinata, T. Endo, and S. Ikawa for critical reading of the manuscript.

    FOOTNOTES

* This work was supported in part by a grant-in-aid from the Ministry of Education, Science, Sports, and Culture of Japan and by a Smoking Research Foundation grant for biomedical research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 81-75-251-5339; Fax: 81-75-241-0792; E-mail: tsakai@basic.kpu-m.ac.jp.

2 J. Kamiyama, unpublished data.

    ABBREVIATIONS

The abbreviations used are: VDR, vitamin D receptor; VDRE, vitamin D response element; bp, base pair; PCR, polymerase chain reaction. CTF, CCAAT box binding transcriptional factor; C/EBP, CCAAT/ enhancer-binding protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Minghetti, P. P., and Norman, A. W. (1988) FASEB J. 2, 3043-3053[Abstract]
2. Liu, M., Lee, M. H., Cohen, M., Bommakanti, M., and Freedman, L. P. (1996) Genes Dev. 10, 142-153[Abstract/Free Full Text]
3. Evans, R. M. (1988) Science 240, 889-895[Abstract/Free Full Text]
4. Minami, S., Ohtani-Fujita, N., Igata, E., Tamaki, T., and Sakai, T. (1997) FEBS Lett. 411, 1-6[CrossRef][Medline] [Order article via Infotrieve]
5. Schrader, M., Kahlen, J. P., and Carlberg, C. (1997) Biochem. Biophys. Res. Commun. 230, 646-651[CrossRef][Medline] [Order article via Infotrieve]
6. Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 369-373[Abstract/Free Full Text]
7. Bhatia, M., Kirkland, J. B., and Meckling-Gill, K. A. (1995) J. Biol. Chem. 270, 15962-15965[Abstract/Free Full Text]
8. Bouillon, R., Okamura, W. H., and Norman, A. W. (1995) Endocr. Rev. 16, 200-257[CrossRef][Medline] [Order article via Infotrieve]
9. Pagano, M., Tam, S. W., Theodoras, A. M., Beer-Romero, P., Del Sal, G., Chau, V., Yew, P. R., Draetta, G. F., and Rolfe, M. (1995) Science 269, 682-685[Abstract/Free Full Text]
10. Vlach, J., Hennecke, S., and Amati, B. (1997) EMBO J. 16, 5334-5344[CrossRef][Medline] [Order article via Infotrieve]
11. Tomoda, K., Kubota, Y., and Kato, J.-Y. (1999) Nature 398, 160-165[CrossRef][Medline] [Order article via Infotrieve]
12. Kamiyama, J., Inoue, T., Ohtani-Fujita, N., Minami, S., Yamagishi, H., and Sakai, T. (1999) FEBS Lett. 455, 281-285[CrossRef][Medline] [Order article via Infotrieve]
13. Pahl, H. L., Burn, T. C., and Tenen, D. G. (1991) Exp. Hematol. 19, 1038-1041[Medline] [Order article via Infotrieve]
14. Andrews, N. C., and Faller, D. V. (1991) Nucleic Acids Res. 19, 2499[Free Full Text]
15. Orita, T., Shimozaki, K., Murakami, H., and Nagata, S. (1997) J. Biol. Chem. 272, 23216-23223[Abstract/Free Full Text]
16. Li, X. Y., Hooft van Huijsduijnen, R., Mantovani, R., Benoist, C., and Mathis, D. (1992) J. Biol. Chem. 267, 8984-8990[Abstract/Free Full Text]
17. Zhang, Y., and Lin, S. C. (1997) Biochim. Biophys. Acta 1353, 307-317[Medline] [Order article via Infotrieve]
18. Nakano, K., Mizuno, T., Sowa, Y., Orita, T., Yoshino, T., Okuyama, Y., Fujita, T., Ohtani-Fujita, N., Matsukawa, Y., Tokino, T., Yamagishi, H., Oka, T., Nomura, H., and Sakai, T. (1997) J. Biol. Chem. 272, 22199-22206[Abstract/Free Full Text]
19. Dorn, A., Bollekens, J., Staub, A., Benoist, C., and Mathis, D. (1987) Cell 50, 863-872[CrossRef][Medline] [Order article via Infotrieve]
20. Graves, B. J., Johnson, P. F., and McKnight, S. L. (1986) Cell 44, 565-576[CrossRef][Medline] [Order article via Infotrieve]
21. Hooft van Huijsduijnen, R. A., Bollekens, J., Dorn, A., Benoist, C., and Mathis, D. (1987) Nucleic Acids Res. 15, 7265-7282[Abstract/Free Full Text]
22. Chodosh, L. A., Baldwin, A. S., Carthew, R. W., and Sharp, P. A. (1988) Cell 53, 11-24[CrossRef][Medline] [Order article via Infotrieve]
23. Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L., Benoist, C., and Mathis, D. (1992) EMBO J. 11, 3315-3322[Medline] [Order article via Infotrieve]
24. Mantovani, R., Li, X. Y., Pessara, U., Hooft van Huijsduijnen, R., Benoist, C., and Mathis, D. (1994) J. Biol. Chem. 269, 20340-20346[Abstract/Free Full Text]
25. Jackson, S. P., MacDonald, J. J., Lees-Miller, S., and Tjian, R. (1990) Cell 63, 155-165[CrossRef][Medline] [Order article via Infotrieve]
26. Jackson, S. P., and Tjian, R. (1988) Cell 55, 125-133[CrossRef][Medline] [Order article via Infotrieve]
27. Ishimaru, F., Mari, B., and Shipp, M. A. (1997) Blood 89, 4136-4145[Abstract/Free Full Text]
28. Ezura, Y., Tournay, O., Nifuji, A., and Noda, M. (1997) J. Biol. Chem. 272, 29865-29872[Abstract/Free Full Text]
29. Alroy, I., Towers, T. L., and Freedman, L. P. (1995) Mol. Cell. Biol. 15, 5789-5799[Abstract]
30. Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E., and Tenen, D. G. (1993) J. Biol. Chem. 268, 8230-8239[Abstract/Free Full Text]
31. Hauses, M., Tonjes, R. R., and Grez, M. (1998) J. Biol. Chem. 273, 31844-31852[Abstract/Free Full Text]
32. Zhang, D. E., Hetherington, C. J., Tan, S., Dziennis, S. E., Gonzalez, D. A., Chen, H. M., and Tenen, D. G. (1994) J. Biol. Chem. 269, 11425-11434[Abstract/Free Full Text]
33. Marziali, G., Perrotti, E., Ilari, R., Testa, U., Coccia, E. M., and Battistini, A. (1997) Mol. Cell. Biol. 17, 1387-1395[Abstract]
34. Marziali, G., Perrotti, E., Ilari, R., Coccia, E. M., Mantovani, R., Testa, U., and Battistini, A. (1999) Blood 93, 519-526[Abstract/Free Full Text]
35. Wade, P. A., Pruss, D., and Wolffe, A. P. (1997) Trends Biochem. Sci. 22, 128-132[CrossRef][Medline] [Order article via Infotrieve]
36. Li, Q., Herrler, M., Landsberger, N., Kaludov, N., Ogryzko, V. V., Nakatani, Y., and Wolffe, A. P. (1998) EMBO J. 17, 6300-6315[CrossRef][Medline] [Order article via Infotrieve]
37. Currie, R. A. (1998) J. Biol. Chem. 273, 1430-1434[Abstract/Free Full Text]
38. Sowa, Y., Orita, T., Minamikawa, S., Nakano, K., Mizuno, T., Nomura, H., and Sakai, T. (1997) Biochem. Biophys. Res. Commun. 241, 142-150[CrossRef][Medline] [Order article via Infotrieve]
39. Jehan, F., and DeLuca, H. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10138-10143[Abstract/Free Full Text]
40. Kamei, Y., Kawada, T., Kazuki, R., Ono, T., Kato, S., and Sugimoto, E. (1993) Biochem. Biophys. Res. Commun. 193, 948-955[CrossRef][Medline] [Order article via Infotrieve]
41. Kriwacki, R. W., Schultz, S. C., Steitz, T. A., and Caradonna, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9759-9763[Abstract/Free Full Text]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Cancer Res.Home page
B. Cen, A. Deguchi, and I. B. Weinstein
Activation of Protein Kinase G Increases the Expression of p21CIP1, p27KIP1, and Histidine Triad Protein 1 through Sp1
Cancer Res., July 1, 2008; 68(13): 5355 - 5362.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. van Wageningen, M. C. Breems-de Ridder, J. Nigten, G. Nikoloski, C. A. J. Erpelinck-Verschueren, B. Lowenberg, T. de Witte, D. G. Tenen, B. A. van der Reijden, and J. H. Jansen
Gene transactivation without direct DNA binding defines a novel gain-of-function for PML-RAR{alpha}
Blood, February 1, 2008; 111(3): 1634 - 1643.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
Y.-H. Ling, T. Li, Z. Yuan, M. Haigentz Jr., T. K. Weber, and R. Perez-Soler
Erlotinib, an Effective Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, Induces p27KIP1 Up-Regulation and Nuclear Translocation in Association with Cell Growth Inhibition and G1/S Phase Arrest in Human Non-Small-Cell Lung Cancer Cell Lines
Mol. Pharmacol., August 1, 2007; 72(2): 248 - 258.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
F. Gizard, R. Robillard, B. Gross, O. Barbier, F. Revillion, J.-P. Peyrat, G. Torpier, D. W. Hum, and B. Staels
TReP-132 Is a Novel Progesterone Receptor Coactivator Required for the Inhibition of Breast Cancer Cell Growth and Enhancement of Differentiation by Progesterone.
Mol. Cell. Biol., October 1, 2006; 26(20): 7632 - 7644.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. Y. Zhao, Y. Niu, A. Santiago, J. Liu, S. H. Albert, K. D. Robertson, and D. Liao
An EBF3-Mediated Transcriptional Program That Induces Cell Cycle Arrest and Apoptosis
Cancer Res., October 1, 2006; 66(19): 9445 - 9452.
[Abstract] [Full Text] [PDF]