HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Booth, J. W. Articles by Davis, L. I. Search for Related Content PubMed PubMed Citation Articles by Booth, J. W. Articles by Davis, L. I. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 45, 32360-32367, November 5, 1999

The Yeast Nucleoporin Nup2p Is Involved in Nuclear Export of Importin /Srp1p^*

James W. Booth^§, Kenneth D. Belanger^¶, Maria I. Sannella, and Laura I. Davis^**

From the  W. M. Keck Institute for Cellular Visualization, Rosenstiel Center and Department of Biology, Brandeis University, Waltham, Massachusetts 02454 and the ^¶ Department of Cell Biology, Duke University Medical Center, Durham, North Carolina 27710

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The importin · heterodimer mediates nuclear import of proteins containing classical nuclear localization signals. After carrying its cargo into the nucleus, the importin dimer dissociates, and Srp1p (the yeast importin  subunit) is recycled to the cytoplasm in a complex with Cse1p and RanGTP. Nup2p is a yeast FXFG nucleoporin that contains a Ran-binding domain. We find that export of Srp1p from the nucleus is impaired in nup2 mutants. Also, Srp1p fusion proteins accumulate at the nuclear rim in wild-type cells but accumulate in the nuclear interior in nup2 cells. A deletion of NUP2 shows genetic interactions with mutants in SRP1 and PRP20, which encodes the Ran nucleotide exchange factor. Srp1p binds directly to an N-terminal domain of Nup2p. This region of Nup2p is sufficient to allow accumulation of an Srp1p fusion protein at the nuclear rim, but the C-terminal Ran-binding domain of Nup2p is required for efficient Srp1p export. Formation of the Srp1p·Cse1p·RanGTP export complex releases Srp1p from its binding site in Nup2p. We propose that Nup2p may act as a scaffold that facilitates formation of the Srp1p export complex.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Transport of macromolecules between the cytoplasm and nucleus in eukaryotic cells is mediated by soluble transport receptors. These receptors bind to specific protein or RNA cargoes and ferry them across the nuclear pore complex (NPC)¹ (reviewed in Refs. 1 and 2). Several different nuclear import and export pathways have been identified (reviewed in Ref. 3). The first nuclear transport pathway that was described mediates import of proteins that contain a classical nuclear localization signal (NLS) (4). The NLS is recognized by importin /Srp1p, which forms a heterodimeric complex with importin /Kap95p. By virtue of its interaction with importin , importin  and its associated NLS-containing protein are carried through the NPC into the nucleus (5, 6). Binding of the GTP-bound form of the small GTPase Ran to importin  causes dissociation of the import complex in the nucleus (7, 8). Importin /Srp1p then must be recycled to the cytoplasm to allow for multiple rounds of NLS protein import. Importin /Srp1p is exported from the nucleus as part of a trimeric complex containing the exportin CAS/Cse1p and RanGTP (9-12). The export complex is ultimately dissociated in the cytoplasm by RanBP1/Yrb1p (13, 14) and RanGAP1/Rna1p (15, 16), acting to trigger GTP hydrolysis on Ran (9, 11).

All nucleocytoplasmic transport of macromolecules takes place through the NPC (17). The NPC consists of a large number of proteins termed nucleoporins (18). Many of the nucleoporins have repeated sequence motifs containing the dipeptide Phe-Gly (e.g. FXFG and GLFG). Numerous binding interactions have been identified between FG nucleoporins and soluble transport factors (7, 19-25). However, in most cases, the functional significance of these interactions is unclear. We previously showed that Srp1p binds to the yeast nucleoporins Nup1p and Nup2p (26). Nup2p is an FXFG nucleoporin that contains a Ran-binding domain (RanBD) homologous to that of RanBP1 (14, 27, 28). Nup2p is the only yeast nucleoporin that contains such a Ran-binding domain. In this report, we further investigate the interaction of Srp1p with Nup2p and its functional significance. Our results indicate that Nup2p is involved in the nuclear export of Srp1p and that Nup2p may act as a scaffold to facilitate formation of the Srp1p export complex at the NPC.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Reagents

Enzymes for molecular biology were purchased from New England Biolabs (Beverly, MA), Roche Molecular Biochemicals, and Amersham Pharmacia Biotech. 5-Fluoroorotic acid was obtained through the Genetics Society of America consortium. pRS vectors (29) were furnished by Dr. Phil Hieter. Rabbit-anti--galactosidase antibodies were obtained from Organon Technica (West Chester, PA), and anti-Xpress mAb was from Invitrogen (Carlsbad, CA).

Strains and Microbial Techniques

Unless otherwise specified, all yeast strains are isogenic with W303 (ade2-1 ura3-1 trp1-1 leu2-3, 112 his3-11, 15 can1-100 (Mata and Mat); a gift of Susan Wente). Yeast cell culture, medium preparation, and genetic manipulations were performed essentially as described (30). Yeast shuttle plasmids and linear fragments were introduced into yeast by lithium acetate transformation (31). DNA cloning was performed using standard techniques outlined by Sambrook et al. (32).

Disruption of NUP2

NUP2 was disrupted in W303 by transformation with a KAN^R cassette (33) created by PCR using oligonucleotides 5'-CATACATCATTTTTCATACAAGTCCTTGTTAAGCAGCTGAAGCTTCGTACGC and 5'-GGGTTCTATTCTATTTAAAATTGTTAACTGGCATAGGCCACTAGTGGATCTG to generate LDY680 (Mata nup2::KAN^R). NUP2 was also disrupted with the TRP1 gene by transforming W303 with pJON133 (34), generating LDY626 (Mata nup2::TRP1).

Genetic Crosses

NOY612 (srp1-31) (35) covered with pLDB283 (SRP1 URA3 CEN, pRS315 with an HpaI-BglII fragment containing SRP1 cloned in at SmaI-BamHI) was crossed to LDY627 (nup2::TRP1). From 28 tetrads dissected, 13 Trp⁺ spores were obtained that were 5-fluoroorotic acid-sensitive at 37 °C (nup2 srp1-31). All of these were also 5-fluoroorotic acid-sensitive at 25 °C. LDY626 (nup2::TRP1) was crossed to LDY551 (prp20/mtr1-1, second backcross of mtr1-1 from T127 (36) into W303), SWY3 (nup100 (37)), and LDY 544 (rna1-1, second backcross of rna1-1 from LDY431 (38) into W303). LDY 627 (nup2::TRP1) was crossed to SWY29 (nup116 (37)). LDY 680 (nup2::KAN^R) was crossed to Y1705 (cse1-1 (39)). LDY462 (nup82^ts)² was crossed to nup2::TRP1.

Yeast Expression Plasmids

SRP1-GFP-- Superglow GFP was cut out of pJK19-1 (40) with NheI and inserted into the XbaI site of pRS305 (LEU2) to generate pLDB349. A promoterless SRP1 gene was amplified by PCR with oligonucleotides introducing a BamHI site at the start codon and an SpeI site before the stop codon and was inserted into pLDB349 at XhoI-SpeI to generate an in-frame fusion of SRP1 with GFP (pLDB520). pLDB520 was linearized with PstI, which cuts in SRP1, and transformed into W303 or LDY680 (nup2::KAN^R) to integrate at SRP1, generating JBY1 and JBY14, respectively.

SRP1-LacZ-- A fusion of the SRP1 coding region to the Escherichia coli LacZ gene was created as follows. A fragment containing the SRP1 promoter and initiator methionine was amplified by PCR and cloned into YIp368R (41) to produce an in-frame fusion with LacZ. Next, the region of SRP1 encoding residues 463-542 was amplified and inserted into this plasmid. The resulting plasmid was linearized at a site between the SRP1 promoter and the C-terminal region, and transformed into W303. In vivo gap repair followed by integration of the vector resulted in the formation of full-length SRP1-LacZ fusions (transformants screened by Western blotting). The plasmid was rescued from this strain by cutting genomic DNA with PstI, followed by ligation and transformation into E. coli. The rescued plasmid (pLDB360) was cut with PstI and transformed into W303 or LDY627 (nup2::TRP1) to integrate at SRP1, generating LDY970 and LDY969, respectively.

NUP2 Constructs-- A Myc epitope was inserted after amino acid 428 of Nup2p by PCR mutagenesis of pJON76 (NUP2 URA3 CEN, pRS315 carrying a 6.1-kilobase BamHI fragment containing NUP2; gift of Jonathan Loeb) to generate pLDB60. Residues 547 to 720 of NUP2^myc were removed from pLDB60 by deletion PCR (42) followed by gap repair to generate pLDB427. Plasmids pLDB652 (NUP2(1-174) TRP1, ApaI-EcoRI fragment from pLDB60 in pRS304 at ApaI-EcoRI), pLDB683 (NUP2^myc TRP1, EcoRI fragment from pLDB60 in pRS304 at EcoRI), and pLDB690 (NUP2^myc(1-546) TRP1, BamHI fragment from pLDB427 in pRS304 at BamHI) were linearized with BglII and transformed into JBY14 (nup2::KAN ^R SRP1-GFP) to integrate at NUP2, generating JBY11, JBY12, and JBY16, respectively.

Bacterial Fusion Proteins

His₆ Constructs-- pLDB291, encoding His₆-Srp1p (28-542), was created by subcloning a BamHI/BglII fragment from pSWB17 (26) into pTrcHisC (InVitrogen) at BamHI. pLDB424, encoding His₆-Srp1p (74-542), was constructed by cloning a SacI-KpnI fragment from pLDB291 into pTrcHisB (Invitrogen) at SacI-KpnI. pLDB426, encoding His₆-Srp1p (full-length), was created by PCR amplification of the 5' end of SRP1, digestion of the PCR product with BamHI and SacI, and subcloning into pLDB291 similarly cut, and then cutting this plasmid with BamHI, filling in, and religating to put SRP1 in frame. pLDB627, encoding His₆-Cse1p, was constructed by amplifying CSE1 from template plasmid p314P3.5 (39) with BamHI and XhoI ends and cloning into pTrcHisC at BamHI-XhoI. His₆-tagged proteins were expressed in bacterial strain TOP10 (Invitrogen) and purified on Ni-NTA agarose (Qiagen).

GST and Maltose-binding Protein Constructs-- Plasmids encoding GST fusions to Nup1p (5-385), Nup1p (432-816), Nup1p (142-385), and Nup1p (778-1076) were described previously (26, 43). pLDB321, encoding GST-Nup1p(1002-1041), was created by cloning an NsiI-ApaI fragment of NUP1 into pGEX-2TK (Amersham Pharmacia Biotech) at EcoRI. pLDB318, encoding GST-Nup1p(778-999), was constructed by removing a EcoRI-NsiI fragment of NUP1 from pSWB6 (26). pLDB356, encoding GST-Nup1p (1041-1076) was produced by first deleting sequence encoding residues 1004-1040 of Nup1p from pLDB107 (44) by deletion PCR followed by gap repair. The resulting plasmid was rescued from yeast and digested with NsiI and EcoRI, and the fragment encoding Nup1p residues 1041-1076 was filled in and blunt-end ligated into the pGEX-2TK at EcoRI. pLDB361 (GST-Nup2p), pLDB554 (GST-Nup2p (182-546)), and pLDB405 (GST-Gsp1p) were created by PCR amplification of appropriate sequences with introduction of restriction site ends followed by cloning into pGEX-2TK at BamHI-EcoRI, pGEX-4T1 at BamHI-XhoI, and pGEX-2TK at BamHI, respectively. Expression of GST fusion proteins in E. coli and preparation of cell lysates were performed as described (45). pLDB357 encoding maltose-binding protein fused to Kap95p was a gift from Megan Neville. Expression and purification of maltose-binding protein-Kap95p was performed as recommended by New England Biolabs.

Immunofluorescence and Fluorescence Microscopy

Rabbit polyclonal anti-Srp1p antibodies were raised by injection with affinity-purified His₆-Srp1p (28-542). The antibodies were affinity-purified from serum using His₆-Srp1p (28-542) bound to nitrocellulose (46). Cells were treated for immunofluorescence essentially as described by Wente et al. (37) except that they were fixed for 12 min in buffer containing 10% formaldehyde and 10% methanol. Primary antibodies were used at a dilution of 1:200 and secondary antibodies at a dilution of 1:100. For visualizing Srp1p-GFP or Yap1p-GFP, cells were grown overnight in selective medium and then diluted to OD₆₀₀ = 0.1 and grown for 6 h in YPD to log phase. Cells were then harvested by centrifugation, washed once with phosphate-buffered saline, resuspended in ice cold 75% ethanol, incubated on ice for 10 min, and then washed once with phosphate-buffered saline and resuspended in phosphate-buffered saline containing DAPI (0.2 mg/ml) for viewing using a Nikon Optiphot microscope.

Solution Binding Assays and Protein Analysis

Binding experiments were performed in 0.5-ml siliconized tubes (Sigma) containing 100-200 µl of binding buffer (50 mM HEPES, pH 7.0, 200 mM NaCl, 50 mM KOAc, 10 mM Mg(OAc)₂, 0.1% Tween, 0.5 mM dithiothreitol, protease inhibitors (44)) and 15 µl of glutathione-Sepharose beads with adsorbed GST fusion proteins. GST-Gsp1p adsorbed to glutathione-Sepharose beads was loaded with GTP by incubating for 30 min at 30°C in 5 mM EDTA, 20 mM potassium phosphate, pH 7.5, 2 mM dithiothreitol, 10 mM GTP, followed by addition of MgCl₂ to a final concentration of 10 mM. Cleavage of GST-Gsp1p and GST-Nup2p(9-172) with thrombin (Sigma) was performed after precipitation with glutathione-Sepharose as described (47), followed by addition of a 1.5× molar excess of hirudin (Sigma).

For analysis of Nup2p protein expression, yeast cell extracts were prepared by vortexing with glass beads in trichloroacetic acid (48). Western blotting was performed essentially as described (26) with either mAb 9E10 or mAb 414 ascites fluids, both at a dilution of 1:1000.

Overlay of GST-Nups

Glutathione-Sepharose beads were used to precipitate GST-Nup fusion proteins from bacterial lysates. The beads were washed, and bound protein was eluted in SDS sample buffer containing 6 M urea and subjected to SDS-PAGE without boiling. Two hundred nanograms of purified GST fusion was loaded in each lane, as determined by Coomassie Blue staining. Blot overlays were performed as described by Lee and Melese (49), using affinity-purified His₆-Srp1p (74-542) as a ligand at a concentration of 125 ng/ml. Overlays were probed with anti-Xpress antibody diluted 1:5000, and bound antibody was detected using the ECL detection system (Amersham Pharmacia Biotech).

Precipitation of NLS-Human Serum Albumin (HSA)

HSA was coupled to oligopeptides consisting of the SV40 large T antigen NLS Pro-Lys-Lys¹²⁸-Lys-Arg-Lys-Val or mutant peptides containing a substitution of Thr for Lys¹²⁸. Bacterial lysates containing GST fusion proteins were bound to glutathione-Sepharose and washed one time with wash buffer (250 mM NaCl, 50 mM Hepes, pH 7.0, 5 mM EDTA, 0.5 mM dithiothreitol, 0.1% Tween 20) before further additions. Incubations with His₆-Srp1p (28-542) or NLS-HSA were performed in wash buffer plus 1% nonfat dry milk; washes were with wash buffer.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Srp1p Export Defect in nup2 Mutants-- The observation that Srp1p binds to Nup2p (26, 50) suggested that Nup2p might play a role in Srp1p trafficking. To investigate this possibility, we examined the subcellular localization of Srp1p in yeast mutants carrying a disruption in NUP2 by immunofluorescence using anti-Srp1p antibodies (Fig. 1). In wild-type cells, Srp1p is distributed in a largely uniform manner throughout the cytoplasm and nucleus, with some nuclear concentration in some cells (Fig. 1a). In nup2 mutants, however, there is a pronounced nuclear accumulation of Srp1p, indicating a defect in its export from the nucleus (Fig. 1, panel c).

View larger version (65K): [in this window] [in a new window]   Fig. 1.   Nuclear export of Srp1p is defective in nup2 cells. a-d, yeast strains W303 (wild-type, a and b) or LDY680 (nup2, c and d) were grown at 30 °C and then prepared for immunofluorescence. Srp1p was localized by probing with polyclonal anti-Srp1p antibodies followed by DTAF-conjugated secondary antibodies (a and c). For comparison, nuclear DNA was visualized using DAPI (b and d). e-h, strains JBY1 (wild-type, e and f) or JBY14 (nup2, g and h) expressing Srp1p-GFP were fixed and viewed by fluorescence microscopy to detect the GFP signal (e and g) or DAPI (f and h). i-l, strains LDY970 (wild-type, i and j) or LDY969 (nup2, k and l) expressing Srp1p-LacZ were grown at 30 °C and then prepared for immunofluorescence and probed with anti--galactosidase antibodies followed by FITC-conjugated secondary antibodies (i and k). j and l, DAPI.

As additional tools for studying Srp1p localization, fusions of Srp1p to either the green fluorescent protein (Srp1p-GFP) or -galactosidase (Srp1p-LacZ) were constructed. These fusion proteins were expressed in yeast and localized by direct fluorescence (for Srp1p-GFP) or by immunofluorescence with anti--galactosidase antibodies (for Srp1p-LacZ). In wild-type cells, localization of either Srp1p-GFP (Fig. 1e) or Srp1p-LacZ (Fig. 1i) revealed a punctate fluorescence at the nuclear rim typical of NPC localization. This stands in contrast to the lack of nuclear rim accumulation of endogenous Srp1p (Fig. 1a). Whatever the reason for the accumulation of the fusion proteins, their localization in nup2 cells is markedly different, with both Srp1p-GFP (Fig. 1g) and Srp1p-LacZ (Fig. 1k) showing a uniform nuclear localization. Thus, as is seen with Srp1p, a lack of Nup2p causes nuclear accumulation of Srp1p fusion proteins. Furthermore, the lack of fusion protein accumulation at the nuclear rim in nup2 mutants suggests that a site critical for Srp1p binding at the NPC has been lost. Srp1p-GFP was able to complement an srp1::KAN^R disruption, showing that this fusion protein is functional; Srp1p-LacZ does not complement. Srp1p-GFP and Srp1p-LacZ were expressed at similar levels in wild-type and nup2 cells (data not shown).

No nuclear accumulation of Srp1p is seen in nup1 mutants (Fig. 2A), nup100 or nup116 mutants (data not shown), or numerous other nuclear transport mutants (11, 51). Moreover, deletion of NUP2 does not cause a general defect in nuclear export, as Crm1p-mediated nuclear export proceeds normally in the absence of Nup2p (Fig. 2B). Thus, the effects of loss of Nup2p on Srp1p export are specific.

View larger version (62K): [in this window] [in a new window]   Fig. 2.   Specificity of Nup2p function in Srp1p export. A, strain LDY460 (nup1::LEU2) was grown at 25 °C, and Srp1p was localized by immunofluorescence with anti-Srp1p antibodies (left panels) as in Fig. 1. DAPI fluorescence is shown in the right panels. B, pLDB461 (YAP1-GFP) was expressed in strains W303 (wild-type), LDY936 (crm1-1), and LDY680 (nup2), and Yap1p-GFP was visualized by fluorescence microscopy (left panels). Right panels show DAPI fluorescence.

Mapping of Srp1p-binding Regions in Nup2p and Nup1p-- We previously showed that Srp1p interacts with Nup1p and Nup2p in yeast extracts (26). To determine whether the binding of Srp1p to Nup1p and Nup2p is direct, interactions between bacterially expressed fusion proteins were measured. To this end, regions of Nup1p and Nup2p were fused to GST, whereas amino acids 73-542 of Srp1p were expressed with an N-terminal His₆ tag. Binding of His₆-Srp1p (73-542) to the GST-Nup fusions was measured by gel overlay.

His₆-Srp1p (73-542) binds directly to regions in both Nup1p and Nup2p (Fig. 3). A nup1 mutant has previously been shown to have a defect in Srp1p-mediated protein import (44). For Nup1p, the strongest Srp1p-binding region is found at the C terminus of the protein (Fig. 3, lanes 7, 9, and 10). Binding of Srp1p to the C terminus of Nup1p has also been reported by Floer et al. (52). We note that two nonoverlapping stretches at the C terminus both bind to Srp1p (Fig. 3, lanes 9 and 10), indicating the presence of multiple Srp1p binding sites. With Nup2p, Srp1p binds directly to the region N-terminal of the FXFG repeats (lane 2). A fusion of GST to the full-length Nup2 protein is highly degraded (lane 1), and Srp1p binds to the degradation products, which presumably represent a series of truncations of GST-Nup2p all containing the N terminus of the protein.

View larger version (33K): [in this window] [in a new window]   Fig. 3.   Discrete regions of Nup1p and Nup2p bind Srp1p. GST-Nup fusions were affinity-purified and then subjected to SDS-PAGE and transferred to nitrocellulose. Blots were overlaid with His6-Srp1p(73-542) as described under "Experimental Procedures." Bound His6-Srp1p(73-542) was detected by probing with anti-Xpress mAb. Lanes 1-10 contained the Nup fusions indicated below; lane 11 contained GST alone. Hatched regions in the schematic represent the FXFG repeats of Nup1p and Nup2p. The positions of the 116-, 97.5-, 66-, 45-, 31-, and 21.5-kDa molecular mass markers are indicated.

Srp1p does not bind to the FXFG repeat-containing regions of Nup1p or Nup2p (Fig. 3, lanes 3 and 6). Such repeats have been implicated in binding to importin  family members (7, 19, 21). We also note that the experiment shown in Fig. 3 was performed with Srp1p protein lacking the N-terminal 72 amino acids of Srp1p, which contain the IBB domain required for binding to Kap95p (5, 6). This demonstrates that binding of Srp1p to Nup1p and Nup2p does not require the IBB domain. An identical pattern of binding affinities for the GST-Nup fusions was seen using a His₆-tagged full-length Srp1p, although binding to all the Nups was weaker, possibly due to the presence of Srp1p breakdown products in the protein preparation (data not shown).

One possible reason for Srp1p binding to Nup1p and Nup2p is that it binds to NLS-like sequences in these nucleoporins. No NLS consensus sequences are found in the Srp1p-binding regions of Nup1p or Nup2p; however, to further address this possibility, we tested whether Srp1p could simultaneously bind to an NLS and to Nup1p or Nup2p by assaying for the ability of Srp1p to precipitate an NLS-HSA conjugate when bound to GST-Nup fusions (Fig. 4). His₆-Srp1p (28-542) was incubated with GST-Nup fusions adsorbed to glutathione-Sepharose and then washed to remove unbound Srp1p. The Srp1p·Nup complex was then incubated with HSA conjugated to either a wild-type or mutant NLS peptide. Wild-type NLS-HSA was precipitated by each of the GST-Nup fusions when His₆-Srp1p was present (Fig. 4, lanes 1 and 4) but was not detected in those samples to which His₆-Srp1p was not added (lanes 2 and 5). A NLS-HSA conjugate containing a mutant NLS peptide was not precipitated (lanes 3 and 6). These data indicate that Srp1p can simultaneously bind to an NLS and to Nup2p or Nup1p. Because Srp1p has been shown to contain two adjacent NLS-binding sites (53), it is conceivable that these sites could mediate simultaneous binding to NLS-HSA and to an NLS in Nup1p or Nup2p; however, we consider this unlikely due to steric considerations. Thus, these results strongly suggest that binding of Srp1p to the nucleoporins is not via NLS-like sequences.

View larger version (26K): [in this window] [in a new window]   Fig. 4.   Simultaneous binding of Srp1p to nucleoporins and NLS peptide. GST fusions containing Nup1p residues 778-1076 (Nup1-C), Nup2p residues 9-172 (Nup2-N), or GST alone were adsorbed to glutathione-Sepharose beads and incubated with 0.5 µg/ml His6-Srp1p(28-542) (lanes 1, 3, 4, 6, 7, and 9) or buffer alone (lanes 2, 5, and 8) for 1 h at 4 °C. Samples were washed one time and then incubated with 2 mg/ml HSA conjugated to NLS peptide (lanes 1, 2, 4, 5, 7, and 8) or to mutant NLS peptide (lanes 3, 6, and 9) for 1 h at 4 °C. The beads were washed six times, and bound material was subjected to SDS-PAGE, transferred to nitrocellulose, and probed with anti-HSA antiserum.

Domains of Nup2p Involved in Srp1p Export-- In addition to the N-terminal Srp1p-binding domain and the central FXFG repeat domain, Nup2p contains a C-terminal RanBD (14, 28). To determine which domains are involved in Srp1p export, we constructed Nup2p truncations lacking the RanBD or the RanBD and the FXFG repeats and tested their ability to restore the wild-type pattern of Srp1p-GFP localization to a nup2 strain (Fig. 5A).

View larger version (54K): [in this window] [in a new window]   Fig. 5.   Localization of Srp1p-GFP in cells expressing Nup2p truncations. A, Srp1p-GFP was visualized in the following nup2 strains carrying the indicated integrated plasmids: JBY10 (empty vector, a), JBY12 (NUP2myc, c), JBY16 (NUP2myc(1-546), e), and JBY11 (NUP2(1-174), g). Arrows in g indicate cells showing fluorescence at the nuclear rim. Corresponding DAPI fields are shown in b, d, f, and h. B, cell extracts were made from wild-type cells (JBY1, lanes 1 and 4) or from nup2 cells expressing Nup2pmyc (JBY12, lanes 2 and 5) or Nup2pmyc(1-546) (JBY16, lane 3). Equal amounts of protein were subjected to SDS-PAGE, transferred to nitrocellulose, and probed with mAb 9E10 (left panel) to compare expression of Nup2pmyc(1-546) and Nup2pmyc or with mAb 414 (right panel) to compare expression of Nup2pmyc with endogenous Nup2p. The arrow indicates the position of Nup2p. The top band in the right panel is Nsp1p, and the bottom band is an unknown yeast protein recognized by mAb 414. The positions of the 116-, 97.5-, and 66-kDa molecular mass markers are indicated on the left.

Expression of a full-length Myc-tagged version of Nup2p (Nup2p^myc) in nup2 cells restored the wild-type pattern of Srp1p-GFP fluorescence at the nuclear rim, with no accumulation in the nuclear interior (Fig. 5A, c). Expression of Nup2p^myc(1-546), lacking the C-terminal RanBD, resulted in increased fluorescence at the nuclear rim. However, significant nuclear accumulation of Srp1p-GFP remained relative to what was observed with full-length Nup2p^myc (Fig. 5A, e). Thus, Nup2p lacking the RanBD but containing the N-terminal Srp1p-binding domain appears to be sufficient to allow docking of Srp1p at the pore, but insufficient to restore wild-type levels of export. We confirmed that Nup2p^myc(1-546) is expressed at the same level as full-length Nup2p^myc by Western blotting (Fig. 5B).

A further truncation of Nup2p, Nup2p(1-174), contains only the region N-terminal of the FXFG repeats. When this truncation was expressed in nup2 cells, Srp1p-GFP remained largely nuclear, but some fluorescence at the nuclear rim was still visible in many cells (Fig. 5A, g, arrows). The difference between Nup2p(1-174) and Nup2p^myc(1-546) may indicate a role for the FXFG repeats in Srp1p export, or it may be that Nup2p(1-174) is expressed or targeted to the NPC to a lesser extent than Nup2p^myc(1-546). In any case, these observations suggest that the N-terminal Srp1p-binding domain alone is sufficient to provide partial docking function, although export is very inefficient. Another indication that Nup2p(1-174) is partially functional comes from our observation that replacement of Srp1p with Srp1p-GFP results in slow growth in nup2 cells, but not wild-type cells, and that this growth defect is largely suppressed by expression of either Nup2p(1-174) or Nup2p^myc(1-546). Thus, our observations indicate that the N-terminal Srp1p-binding domain of Nup2p is sufficient to provide partial function, but that efficient export requires the Ran-binding domain in addition.

Genetic Interactions-- Independent evidence for a role for Nup2p in Srp1p export comes from genetic considerations. Deletion of NUP2 has no effect on growth (34), despite the observed defect in Srp1p export, implying that the residual level of Srp1p export is sufficient to sustain wild-type growth rates. If so, one might expect that deletion of NUP2 would have synergistic effects in combination with other mutants that affect the export or function of Srp1p.

To test this we crossed nup2 to several nuclear transport mutants. First, nup2 cells were crossed to cells bearing the srp1-31 temperature-sensitive mutation (35) and carrying wild-type SRP1 on a URA3-containing plasmid. nup2 srp1-31 haploid progeny were unable to grow on plates containing 5-fluoroorotic acid (Fig. 5A), indicating that they were unable to lose the SRP1 URA3 plasmid and thus that nup2 and srp1-31 are synthetically lethal. Moreover, as noted above, nup2 cells but not wild-type cells show a growth defect when endogenous Srp1p is replaced with Srp1p-GFP. These synthetic phenotypes would be expected if Nup2p plays a role in Srp1p export, because any defect in Srp1p function could be exacerbated by inhibition of its cycling between the nucleus and cytoplasm.

The nup2 mutation was also crossed to a temperature-sensitive mutant in PRP20/MTR1, the nucleotide exchange factor for Ran. mtr1-1 nup2 double mutants failed to grow at 30.5 °C, whereas mtr1-1 single mutants grew at this temperature (Fig. 5B). prp20-1 mutants, like nup2 mutants, have been shown to have a defect in Srp1p export (51), presumably because of a decrease in nuclear RanGTP, which is required for export complex formation. In contrast, we saw no obvious synthetic growth phenotype in nup2 cse1-1 double mutants, where cse1-1 is a cold-sensitive allele of the exportin Cse1p that carries Srp1p out of the nucleus (39). However, nup2 cse1-1 spores appeared to be slow to germinate (data not shown). The idea that Nup2p functions in export of Srp1p also suggests a possible explanation for the previously observed lethality of nup2 nup1 double mutants (34). As nup1 mutants are defective for Srp1p-mediated protein import (44), a decrease in the cytoplasmic pool of Srp1p in the absence of Nup2p may be lethal in the context of the nup1 mutation. nup2 showed no synergistic growth defects with rna1-1 or nup82^ts mutations (Fig. 5B) or with nup100 or nup116 (data not shown), suggesting that the interactions we observe with srp1 and prp20 are specific.

Competition for Srp1p Binding-- Srp1p export from the nucleus depends on its incorporation into a trimeric complex with Cse1p and RanGTP (10-12). To better understand the role of Nup2p during export of Srp1p, we performed solution binding assays with recombinant proteins to examine the modulation of Srp1p binding to Nup2p by Cse1p and RanGTP. To this end, Srp1p and Cse1p were expressed as His₆-tagged proteins. Gsp1p (yeast Ran) and Nup2p(9-172) (containing the Srp1p-binding region), were expressed as GST fusion proteins. The latter were either used as fusion proteins or were cleaved from GST with thrombin as necessary.

First, we confirmed that the recombinant Srp1p, Cse1p, and Gsp1p proteins were competent for forming trimeric export complexes in vitro (see Fig. 7A). GST-Gsp1p was bound to glutathione-Sepharose beads and loaded with GTP. Neither His₆-Srp1p nor His₆-Cse1p bound to GST-Gsp1p-GTP when added alone (lanes 1 and 2), but when added together, they bound efficiently (lane 3), consistent with the cooperative formation of trimeric export complexes (9, 11). Binding was not observed if GST-Gsp1p was loaded with GDP instead of GTP (data not shown).

Next, GST-Nup2p(9-172) was bound to glutathione-Sepharose beads. His₆-Srp1p was prebound to the immobilized GST-Nup2p(9-172), and the resulting His₆-Srp1p·Nup2p(9-172) complex was incubated under a number of conditions (see Fig. 7B). The complex was stable when incubated in binding buffer alone (see Fig. 7B, lanes 1 and 2). Addition of excess free Nup2p(9-172) competed His₆-Srp1p off of the immobilized GST-Nup2p(9-172), as expected (Fig. 6B, lane 3). Addition of Gsp1p-GTP or His₆-Cse1p alone had no effect on the amount of His₆-Srp1p bound to GST-Nup2p(9-172) (Fig. 7B, lanes 4 and 6). However, when Gsp1p-GTP and His₆-Cse1p were added together, allowing the Srp1p·Cse1p·Gsp1p-GTP export complex to form, Srp1p was competed off GST-Nup2p(9-172) (Fig. 7B, lane 5).

View larger version (36K): [in this window] [in a new window]   Fig. 6.   Genetic interactions of nup2. A, NOY612 (srp1-31) (35) carrying a SRP1 URA3 CEN plasmid was crossed to LDY627 (nup2::TRP1). After sporulation and dissection of the resulting tetrads, haploid progeny with the indicated genotypes were spotted onto a uracil drop-out plate (-ura) or a plate with 1 mg/ml 5-fluoroorotic acid (5FOA) and grown at 25 °C. B, yeast strains of the indicated genotypes were obtained by crosses described under "Experimental Procedures." Cells were spotted onto YPD plates and grown at 25, 30.5, or 37 °C.

View larger version (25K): [in this window] [in a new window]   Fig. 7.   Interactions of Srp1p with Nup2p and Cse1p/RanGTP. A, GST-Gsp1p (3 µg) was adsorbed to glutathione-Sepharose beads and loaded with GTP. The beads were washed and then incubated with 2 µg of His6-Srp1p (lane 1), 10 µg of His6Cse1p (lane 2), or both (lane 3) or with 16 µg of maltose-binding protein-Kap95p (lane 4) in a total volume of 100 µl of binding buffer for 3 h at 4 °C. Aliquots of the unbound material were taken, and the beads were washed six times in cold binding buffer and resuspended in SDS sample buffer. Bound and unbound proteins were analyzed by SDS-PAGE and Coomassie Blue staining. B, GST-Nup2p(9-172) (0.5 µg) was bound to glutathione-Sepharose beads. The beads were washed six times, incubated with 1.2 µg of His6-Srp1p in 0.5 ml of binding buffer for 2 h at 4 °C, washed four times, and then resuspended in 200 µl of binding buffer containing no additions (lanes 1 and 2), 2 µg of Nup2p(9-172) (lane 3), 3 µg of Gsp1p-GTP (lane 4), 14 µg of His6Cse1p (lane 6), or both Nup2p(9-172) and Cse1p (lane 5). In lane 1, the beads were immediately spun and resuspended in SDS sample buffer; in lanes 2-6, the tubes were incubated with rotation for 2 h at 4 °C and then the beads were washed five times and resuspended in SDS sample buffer. Bound His6-Srp1p was detected by Western blotting with anti-Xpress mAb. C, GST-Gsp1p-GTP on beads was incubated with 1 µg of His6-Srp1p and 5 µg of His6-Cse1p in the presence of 0 (lane 1), 0.6 (lane 2), or 1.2 (lane 3) µg of Nup2p(9-172). The top panel shows analysis by SDS-PAGE and Coomassie Blue staining of 20% of the bound proteins; the bottom panel shows 5% of the unbound Nup2p(9-172).

To confirm the competitive nature of the binding of Cse1p·Gsp1p-GTP or Nup2p to Srp1p, a converse experiment was also performed in which GST-Gsp1p-GTP on beads was incubated with His₆-Srp1p and His₆-Cse1p in the presence of free Nup2p(9-172). Increasing amounts of Nup2p(9-172) progressively inhibited formation of the Srp1p·Cse1p·Gsp1p complex (Fig. 7C), presumably by titrating Srp1p.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Our observations indicate that Nup2p is involved in Srp1p export, yet it binds to free Srp1p rather than to the Srp1p·Cse1p·RanGTP export complex. This suggests two possibilities for Nup2p function: either Nup2p acts at an early step in export, during export complex assembly, or at a late step, during complex disassembly. In the first case, Nup2p may facilitate formation of the Srp1p·Cse1p·RanGTP export complex at the NPC. Nup2p would provide a site to dock Srp1p, targeting complex formation directly to the NPC. In addition, docking of Srp1p and RanGTP near each other at two sites on Nup2p may improve the kinetics of assembly of the Srp1p·Cse1p·RanGTP complex. Export complex formation is a highly cooperative event in which all three components must assemble with each other, despite the fact that no two of the components interact pairwise in a stable manner. This process could be enhanced by bringing two of the binding partners into close proximity. Molecular scaffolds that bind to multiple proteins and thus facilitate their interaction are important in a number of systems (54, 55). Formation of the Srp1p·Cse1p·RanGTP export complex would release Srp1p from Nup2p (Fig. 7B), allowing subsequent translocation of the complex through the NPC. The coupling of complex formation to dissociation from Nup2p would prevent Nup2p from being an unproductive sink for these complexes. Instead, it could act catalytically to facilitate complex formation.

Alternatively, Nup2p might be involved in the terminal step of nuclear export, i.e. complex disassembly. The metazoan RanBD-containing nucleoporin RanBP2/Nup358 (56, 57), which is located on the cytoplasmic side of the NPC (58), and the cytosolic protein RanBP1/Yrb1p have been proposed to play such a role, acting to dissociate export complexes after their transit through the NPC by binding to RanGTP (59, 60). Subsequent hydrolysis of GTP on the RanBD-bound Ran makes the dissociation irreversible (59). Nup2p may perform a similar function by competing RanGTP and Srp1p off Cse1p; however, we consider it more likely that Nup2p is involved in complex assembly than in disassembly. RanBP2 and RanBP1/Yrb1p bind RanGTP with high affinity, which is necessary for the proteins to function efficiently in complex disassembly. In contrast, Nup2p has a much lower affinity for RanGTP (28, 61). In this respect, it is similar to Yrb2p (62, 63). Yrb2p, like Nup2p, is involved in a nuclear export process, namely export of proteins that contain a nuclear export sequence (64). This export pathway is mediated by Crm1p and is distinct from the one used by Srp1p. Yrb2p is located in the nuclear interior (63), implying that it acts at an early step in Crm1p-mediated export. Like Nup2p, Yrb2p binds to two components of a trimeric export complex: RanGTP and Crm1p. It was therefore proposed that Yrb2p might function by stabilizing the Crm1p·nuclear export sequence·RanGTP export complex (64). Alternatively, it may play a more catalytic role in export complex formation, similar to that proposed above for Nup2p. Binding to RanGTP with low rather than high affinity would allow Nup2p and Yrb2p to act as scaffolds for complex formation without being irreversible sinks for RanGTP. Consistent with the idea that low affinity binding is required, a chimeric protein in which the Yrb2p RanBD is replaced with that of Yrb1p does not rescue the nuclear export sequence export defect of yrb2 mutants (64). Thus, an attractive model is that Nup2p and Yrb2p facilitate formation of the Srp1p·Cse1p·RanGTP and Crm1p·nuclear export sequence·RanGTP export complexes, respectively. Future localization of Nup2p within the NPC may help to suggest whether Nup2p acts at an early or late step in Srp1p export.

The role, if any, of the FXFG repeat domain of Nup2p in Srp1p export is unclear. Because several members of the importin  superfamily have been shown to bind to FG repeats, an attractive possibility would be that this region binds to Cse1p, thus providing a third binding activity to interact with the third member of the Srp1p export complex. However, we saw no binding of Cse1p to the Nup2p FXFG repeats either in vitro or in the two-hybrid assay (data not shown).

One possibility for Nup2p function is that it acts as a scaffold for Srp1p export complex formation. More generally, although assembly and disassembly of import and export complexes can be recapitulated in vitro with soluble components, in vivo these processes may take part largely at the NPC, rather than in the bulk cytoplasm or nucleoplasm. Dissociation of the importin ·importin  complex occurs at a site on the nuclear side of the NPC (65), and RanGAP1 targeted to the NPC by SUMO-1 modification (66, 67) may dissociate export complexes at the cytosolic face of the NPC (59). Assembly of import/export complexes may also take place at scaffolding sites at the NPC.

	ACKNOWLEDGEMENTS

We thank Jonathan Loeb, Megan Neville, Masayasu Nomura, Pam Silver, Andrew Schroeder, Alan Tartakoff, and Susan Wente for providing strains and plasmids. We are grateful to Linda Lee and Jan Hoffman for reagents. We thank members of the Rosbash and Davis laboratories for critical review of the manuscript.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant GM-54768-04 (to L. I. D.) and by a Postdoctoral Fellowship from the Natural Sciences and Engineering Research Council of Canada (to J. W. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Present address: Division of Cell Biology, The Hospital for Sick Children, 555 University Ave., Toronto, Ontario M5G 1X8, Canada.

Present address: Dept. of Biology, 106 Loyola Hall, University of Scranton, Scranton, PA 18510.

^** To whom correspondence should be addressed: Rosenstiel Center, MS 029, Brandeis University, 415 South St., Waltham, MA 02454. Tel.: 781-736-2451; Fax: 781-736-2405; E-mail: davis@hydra.rose.brandeis.edu.

² J. A. Hoffman and L. I. Davis, unpublished data.

	ABBREVIATIONS

The abbreviations used are: NPC, nuclear pore complex; NLS, nuclear localization signal; RanBD, Ran-binding domain; GST, glutathione S-transferase; GFP, green fluorescent protein; PAGE, polyacrylamide gel electrophoresis; DAPI, 4',6-diamidino-2-phenylindole; HSA, human serum albumin; mAb, monoclonal antibody; PCR, polymerase chain reaction.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore