Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ozono, K.
Right arrow Articles by Ishizuka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ozono, K.
Right arrow Articles by Ishizuka, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 45, 32376-32381, November 5, 1999


Analysis of the Molecular Mechanism for the Antagonistic Action of a Novel 1alpha ,25-Dihydroxyvitamin D3 Analogue toward Vitamin D Receptor Function*

Keiichi OzonoDagger §, Mariko SaitoDagger , Daishiro Miura, Toshimi MichigamiDagger , Shigeo NakajimaDagger parallel , and Seiichi Ishizuka

From the Dagger  Department of Environmental Medicine, Osaka Medical Center and Research Institute for Maternal and Child Health, 840 Murodo-cho, Izumi, Osaka 594-1101 and the  Teijin Institute for Bio-Medical Research, 4-3-2 Asahigaoka, Hino, Tokyo 191-8512, Japan

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We have recently reported that 23(S)-25-dehydro-1alpha -hydroxyvitamin D3-26,23-lactone (TEI-9647) efficiently blocks the differentiation of HL-60 cells induced by 1alpha ,25-dihydroxyvitamin D3 (1alpha ,25(OH)2D3) (Miura, D., Manabe, K., Ozono, K., Saito, M., Gao, Q., Norman, A. W., and Ishizuka, S. (1999) J. Biol. Chem. 274, 16392-16399). To clarify the molecular mechanisms of this antagonism, we examined whether TEI-9647 antagonizes the genomic effects of 1alpha ,25(OH)2D3. 10-7 to 10-9 M TEI-9647 inhibited the transactivation effect of 10-8 M 1alpha ,25(OH)2D3 in a dose-dependent manner, while TEI-9647 alone did not activate the reporter activity driven by SV40 promoter containing two vitamin D response elements in Saos-2 cells. The antagonistic effect of TEI-9647 was also observed using the rat 24-hydroxylase gene promoter, but the effect was weaker in HeLa and COS-7 cells than in Saos-2 cells. TEI-9647 also exhibited antagonism in an assay system where the VDR fused to the GAL4 DNA-binding domain and the reporter plasmid containing the GAL4 binding site were used in Saos-2 cells, but did not in HeLa cells. TEI-9647 reduced the interaction between VDR and RXRalpha according to the results obtained from the mammalian two-hybrid system in Saos-2 cells, but did not in HeLa cells. The two-hybrid system also revealed that the interaction between VDR and SRC-1 was reduced by TEI-9647 in Saos-2 cells. These results demonstrate that the novel 1alpha ,25(OH)2D3 analogue, TEI-9647, is the first synthetic ligand for the VDR that efficiently antagonizes the action of 1alpha ,25(OH)2D3, although the extent of its antagonism depends on cell type.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1alpha ,25-Dihydroxyvitamin D3 (1alpha ,25(OH)2D3)1 regulates various biological events including bone and calcium metabolism and cell differentiation (1, 2). The vitamin D receptor (VDR), a member of the nuclear hormone receptor superfamily, mediates 1alpha ,25(OH)2D3 action by modulating the transcription of target genes (1-5). The effects exerted via the VDR are called genomic effects, in contrast to non-genomic effects, which means that 1alpha ,25(OH)2D3 acts within a short period without transcription of target genes (6). The VDR-mediated effects of 1alpha ,25(OH)2D3 in vivo are well known, since there is a human disease associated with the abnormality of the VDR gene, which is called vitamin D dependence type II (7). In addition, a mouse model of the disease was generated by targeting the VDR gene and has been used the analysis of the VDR function in vivo (8, 9).

The VDR consists of several functional domains such as DNA-binding and ligand-binding domains (1, 2). Heterodimerization of the VDR with retinoid X receptor (RXR) is also important for the binding to a vitamin D-responsive element (VDRE) with high affinity (1, 2, 5, 10). Ligand-dependent activation of transcription requires the extreme C-terminal portion of the VDR, which is designated as the AF-2 core domain (1, 11, 12). The interaction of these domains is required for the VDR to regulate the transcription of target genes.

A large number of 1alpha ,25(OH)2D3 analogues have been synthesized in an attempt to dissociate various biological activities including hypercalcemic effects, bone-forming effects, and promotion of cell differentiation (for review, see Ref. 13). Generally, these analogues have been screened in terms of the affinity for the VDR and vitamin D-binding protein. Certain synthetic analogues like 22-oxa-1alpha ,25(OH)2D3 appear to succeed in the dissection of various effects of 1alpha ,25(OH)2D3 by taking advantage of the difference in binding to the VDR and vitamin D-binding protein and metabolic pathway (14). To date, however, no anti-vitamin D compounds that oppose the genomic actions of the natural ligand 1alpha ,25(OH)2D3, have been reported (13). We have recently synthesized a novel analogue 23(S)-25-dehydro-1alpha -hydroxyvitamin D3-26,23-lactone (TEI-9647) and found that it efficiently blocks the differentiation of HL-60 cells induced by 1alpha ,25(OH)2D3 (15). Although this differentiation is believed to be mediated by VDR, more direct evidence is needed to establish whether TEI-9647 is an antagonist of the genomic action of vitamin D. Antagonists, if obtained, would be useful for determining whether each of the effects of 1alpha ,25(OH)2D3 is mediated by the VDR. In addition, a potentially promising way to achieve the differential effect of vitamin D is to use analogues that antagonize particular effects elicited by vitamin D.

In contrast to the case of VDR, several antagonists have been reported for other members of the nuclear hormone receptor superfamily, and have contributed to the understanding of the functions of nuclear hormones (16-18). For example, RXR-selective antagonist acted differently against retinoic acid receptor and RXRs (19). Although the molecular mechanism of the antagonism is still under investigation, the structural basis of the antagonism was reported; a different conformation in the transactivation domain of the estrogen receptor liganded by 17beta -estradiol and raloxifene was revealed by a crystal structure study (20). Interestingly, some antagonists exhibit agonistic effects in selective tissues. For example, tamoxifen exerts a breast-selective and bone-sparing antagonistic action on estrogen (21). The mechanism of the tissue specificity is unclear. Since the structures of receptors liganded with agonist and antagonist are distinct, the interaction with different coactivators or corepressors in each tissue may play a role in the tissue-selective action of the partial antagonist (22).

In this report, we have characterized the effects of the novel vitamin D analogue TEI-9647 on the various functions of the vitamin D receptor including activation of promoter activity, interaction with RXR and coactivator SRC-1, and binding to VDRE in several types of cells and have detected strong antagonistic activity in cells with an osteoblastic phenotype.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chemicals-- 1alpha ,25-(OH)2D3 and TEI-9647 were synthesized in our laboratory as described previously (15).

Cell Culture-- The monkey kidney epithelial cell line COS-7, the human fibroblastic cell line HeLa, and the human osteoblastic cell lines Saos-2 and MG-63 (ATCC HTB-85 and CRL-1427, respectively) were maintained in Dulbecco's modified Eagle's medium (Nissui Pharmaceutical Co., Tokyo, Japan) supplemented with 10% dextran-coated charcoal-stripped fetal bovine serum (JRH Bioscience, Dexton, KS) and penicillin/streptomycin at 37 °C under an atmosphere of 5% CO2.

Plasmid Construct and Transcription Activation Assay-- The polymerase chain reaction product corresponding to the region (-367/-57) regulating expression of the human 24-hydroxylase gene, which contains two VDREs (23), was inserted into a luciferase reporter vector pGVP2 containing SV40 promoter (Toyo Ink Co. Ltd., Tokyo, Japan). The promoter region of the rat 24-hydroxylase gene (-291/+9), which also contains two VDREs (a gift from Dr. Y. Ohyama, Hiroshima University, Japan) (24), was cloned into a luciferase reporter vector pGVB2 (Toyo Ink). The DNA sequences of these plasmids were confirmed using an ABI 373A DNA sequencer (PE Applied Biosystems, Tokyo, Japan).

Each plasmid together with the hVDR expression vector, pSG5-hVDR (Ref. 25; a gift from Dr. M. R. Haussler, University of Arizona), and beta -galactosidase expression vector, was introduced into COS-7, Saos-2, and HeLa cells by lipofection (LipofectAMINE, Life Technologies, Inc.). The same plasmids except pSG5-hVDR were introduced in MG-63 cells by Tfx-50 (Promega, Madison, WI). Sixteen hours after the transfection, vehicle, 1alpha ,25-(OH)2D3, TEI-9647, or both agents were added. Forty-eight hours after the addition, cells were harvested in the cell lysate solution provided with the luciferase assay kit (Toyo Ink). The luciferase activities of the cell lysates were measured with the luciferase assay kit according to the manufacturer's instructions. Transactivation evaluated using luciferase activities was standardized with the galactosidase activities of the same cell lysates determined with a beta -galactosidase enzyme assay system (Promega).

Fusion Protein Consisting of GAL4 DBD and VDR-- An expression vector which contains the GAL4 DNA-binding domain (pM) was purchased from CLONTECH. The human VDR cDNA was released by EcoRI from pSG5 vector and fused in-frame to pM (pM-VDR). The cDNA of the VDR lacking its own DNA-binding domain (DBD) was also generated by digestion with NaeI and EcoRI, and cloned into pM vector (pM-VDRdDBD). The luciferase reporter plasmid was generated by insertion of 5 copies of consensus GAL4 binding sites into pGVP2 vector (Toyo Ink) and designated as pGVP2-GAL4BS.

Modified Mammalian Two-hybrid Assay-- Whole cDNA of human RXRalpha (a gift from Dr. M. R. Haussler) was released by EcoRI from pSG5 vector and fused in frame to pM vector (pM-hRXRalpha ). Steroid receptor coactivator-1 (SRC-1) cDNA (Ref. 26; a gift from Dr. M. J. Tsai, Baylor College of Medicine) was released by EcoRI, and the mutation was introduced at the site just before the translation initiation site to be cut by SmaI. Then, the SRC-1 cDNA was digested by SmaI and SalI and inserted in pM vector (pM-SRC-1). Whole cDNA of human VDR was released by EcoRI from pSG5 vector and fused in-frame to pVP16 vector, which contains the activation domain of a herpesvirus (CLONTECH) (pVP16-hVDR). To examine the interaction of RXR and VDR, 0.5 µg of pM-RXRalpha , 0.5 µg of pSG5-hVDR, and 0.5 µg of pGVP2-GAL4BS together with 0.25 µg of plasmids containing beta -galactosidase cDNA were transfected into HeLa cells or Saos-2 cells using LipofectAMINE. Next, to investigate the interaction of SRC-1 and VDR, 0.5 µg of pM-SRC-1, 0.5 µg of pVP16-hVDR, and 0.5 µg of pGVP2-GAL4BS together with 0.25 µg of plasmids containing beta -galactosidase cDNA were transfected into Saos-2 cells also by LipofectAMINE. Twenty four hours later, vehicle, 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9637, or both were added. After 24 h of incubation, the luciferase activity of the cell lysate was examined and adjusted using beta -gal activity.

In Vitro VDR/VDRE Binding Assay-- An electrophoretic mobility shift assay (EMSA) was carried out as previously reported (27), with slight modification. Briefly, vehicle, 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both were administered to the COS-7 or Saos-2 cells transfected with the hVDR expression vector. Five hours after the addition, cellular extracts were obtained. Five µg of each cell extract was incubated with 32P-labeled synthetic DR3-type VDRE (sense strand: CTAGCAGGTCAAGGAGGTCAG).

Localization of hVDR-Green Fluorescent Protein Fusion Protein-- The expression vector of green fluorescent protein (GFP), pGreen Lantern, is driven by the cytomegalovirus promoter (Life Technologies, Inc.). The termination codon (TGA) was mutated to CTT, generating a unique HindIII site. cDNA encoding hVDR was released by digestion with EcoRI from pSG5-hVDR and subcloned into pGreen Lantern after the blunting of both ends. As a result, the expression vector of the fusion protein (GFP N-terminal to hVDR), pGreen Lantern-hVDR was generated. pGreen Lantern-hVDR was introduced into COS-7 cells or Saos-2 cells by the lipofection method. Twenty four hours after the transfection, vehicle, 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both were administered to the COS-7 or Saos-2 cells and the subcellular distribution of the VDR was observed by fluorescent microscopy (BH-2, Olympus, Tokyo, Japan) 3 h after the addition.

Statistical Analysis-- The data were analyzed by analysis of variance using StatView software (SAS Institute Inc., Cary, NC).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

TEI-9647 Did Not Induce Activity of the Promoter Which Contains VDREs, but Dose-dependently Suppressed the Transcription Activation Induced by 1alpha ,25(OH)2D3-- 10-9 to 10-7 M TEI-9647 did not enhance the reporter activity driven by the heterologous SV40 promoter fused to two VDREs of the human 24-hydroxylase gene in Saos-2 cells. However, the promoter activity induced by 10-8 M 1alpha ,25(OH)2D3 was suppressed by TEI-9647 in a dose-dependent manner (Fig. 1). 10-7 M TEI-9647 inhibited by 80% the transactivation function of 10-8 M 1alpha ,25(OH)2D3, at which concentration TEI-9647 corresponded to 10-8 M 1alpha ,25(OH)2D3 in terms of the VDR-bound amount, because the relative binding affinities of TEI-9647 to VDR prepared from chick intestine were 1/9.8 compared with those of 1alpha ,25(OH)2D3 (designated 1) (15). In subsequent experiments, 10-7 M and 10-8 M were chosen as the concentrations of TEI-9647 and 1alpha ,25(OH)2D3, respectively.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 1.   Dose response of the suppressive effect of TEI-9647 on the promoter activity enhanced by 1,25(OH)2D3. The -fold induction which indicates the activity of the SV40 promoter fused to two VDREs of the human 24-hydroxylase gene obtained by the addition of TEI-9647, 1,25(OH)2D3, or both divided by the activity obtained by the addition of vehicle is described. The reporter construct, the VDR expression vector, and beta -gal expression vector were introduced in Saos-2 cells. After the transfection, 10-8 M 1alpha ,25(OH)2D3, 10-7 M to 10-9 M TEI-9647, or vehicle (indicated by -) was added, and the reporter activity was measured 48 h after the addition. Data are expressed as the mean ± S.E. * and ** represent p < 0.0001 and p < 0.0005, respectively, compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone.

The Antagonistic Effect of TEI-9647 Was Stronger in Osteoblastic Cells-- 10-7 M TEI-9647 also exhibited a suppressive effect on the function of 10-8 M 1alpha ,25(OH)2D3 in the assay using the homologous promoter of the rat 24-hydroxylase gene, which contains two VDREs in Saos-2 cells (Fig. 2A). In this sense, the suppressive effect of TEI-9647 did not depend on the promoter context. In MG-63 cells, 10-7 M TEI-9647 also suppressed the effect of 10-8 M 1alpha ,25(OH)2D3 to 27% and did not act as an agonist, when no expression vector of VDR was introduced. 10-7 M TEI-9647 inhibited the promoter activity induced by 10-8 M 1alpha ,25(OH)2D3 in HeLa cells, although the suppressive effect was weaker in HeLa cells than in Saos-2 and MG-63 cells (Fig. 2B). In COS-7 cells, 10-7 M TEI-9647 also suppressed the effect of 10-8 M 1alpha ,25(OH)2D3, to 54%.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 2.   The magnitude of the antagonistic effect of TEI-9647 depends on cell type. A, TEI-9647 markedly suppressed the effect of 1alpha ,25(OH)2D3 in Saos-2 cells. The reporter plasmid containing the rat 24-hydroxylase gene, which possesses two VDREs (pGVB2-r24OHase), the VDR expression vector, and beta -gal expression vector, were introduced in Saos-2 cells. Vehicle (control), 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both (1alpha ,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.0001 and p < 0.0005, respectively, compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone. B, TEI-9647 significantly suppressed the effect of 1alpha ,25(OH)2D3 in HeLa cells. The same plasmids described in A were introduced in HeLa cells. Vehicle (control), 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both (1alpha ,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.0005 and p < 0.05, respectively, compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone.

TEI-9647 Exhibited an Antagonistic Effect via the VDR Fused to GAL4 DNA-binding Domain and GAL4 Binding Element-- To examine the independence of the antagonistic effect on the interaction between the DNA-binding domain (DBD) of the VDR and a VDRE, GAL4 DBD that was fused to VDR (pM-VDR) or substituted for the DBD of the VDR (pM-VDRdDBD) was generated and assayed for its activity of gene regulation together with the SV40 promoter-driven reporter plasmid containing the GAL4 binding site and luciferase gene (pGVP2-GAL4BS) (Fig. 3A). 10-7 M TEI-9647 inhibited the promoter activity induced by 10-8 M 1alpha ,25(OH)2D3 via the interaction between GAL4-DBD and the GAL4 binding site in Saos-2 cells (Fig. 3B). The results were very similar to those using pM-VDRdDBD (data not shown). In contrast, TEI-9647 did not inhibit the promoter activity induced by 10-8 M 1alpha ,25(OH)2D3 via either pM-VDR or pM-VDRdDBD in HeLa cells (Fig. 3C).


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 3.   A suppressive effect of TEI-9647 was observed in plasmid constructs which contain a GAL4 DNA-binding domain and GAL4 binding site. A, schematic illustration of pM-VDR and pM-VDRdDBD. The human VDR cDNA was inserted at the EcoRI site of pM vector, which contains a GAL4 DNA-binding domain (pM-VDR). The digestion of the human VDR cDNA with NaeI and EcoRI deleted the DNA-binding domain of the VDR, and the remaining cDNA was inserted in the pM vector (pM-VDRdDBD). The amino acids generated by the procedure to make the fusion protein are described by a single letter. The amino acid number is designated according to the original paper describing the human VDR cDNA (44). B. TEI-9647 significantly suppressed the effect of 1alpha ,25(OH)2D3 via pM-VDR on the promoter activity in Saos-2 cells. The reporter plasmid containing the SV40 promoter and GAL4 binding sites (pGVP2-GAL4BS), the pM-VDR, and beta -gal expression vector were introduced in Saos-2 cells. Vehicle (control), 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both (1alpha ,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.005 and p < 0.05, respectively, compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone. C, TEI-9647 did not suppress the effect of 1alpha ,25(OH)2D3 via pM-VDR on the promoter activity in HeLa cells. The same plasmids described in B were introduced in HeLa cells. Vehicle (control), 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both (1alpha ,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as the mean ± S.E. * represents p < 0.0001 compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone.

TEI-9647 Inhibited the VDR and RXR Heterodimer Formation Detected by the Modified Mammalian Two-hybrid System in Saos-2 Cells-- As the next step in the activation of the gene transcription by VDR, the protein-protein interaction between the VDR and RXR was examined by the modified mammalian two-hybrid system using the expression vectors of the cDNA of the human RXRalpha fused to GAL4DBD (pM-RXRalpha ) and the human VDR (pSG5-hVDR). 10-8 M 1alpha ,25(OH)2D3 induced the heterodimer formation between the VDR and RXRalpha as indicated by the reporter activity and 10-7 M TEI-9647 significantly inhibited the heterodimer formation in Saos-2 cells (Fig. 4A). In contrast, no suppression against the effect of 10-8 M 1alpha ,25(OH)2D3 was exerted by 10-7 M TEI-9647 in HeLa cells (Fig. 4B).


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 4.   TEI-9647 reduces the interaction between VDR and RXR in Saos-2 cells, but not in HeLa cells. The human RXRalpha cDNA was inserted at the EcoRI site of the pM vector, which contains a GAL4 DNA-binding domain (pM-RXRalpha ). The interaction between VDR and RXR was examined by determining the reporter activity in Saos-2 (A) or HeLa (B) cells transfected with pM-RXRalpha , pSG5-hVDR, and the reporter plasmid containing the GAL4 binding sites (pGVP2-GAL4BS). Vehicle (control), 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both (1alpha ,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.001 and p < 0.01, respectively, compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone (A). * represents p < 0.005 compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone (B).

VDR/RXR Binds to a VDRE with TEI-9647-- In vitro binding of the VDR/RXR heterodimer to the VDRE was examined by EMSA. The VDR/RXR/VDRE complex was observed in lanes using extracts from cells transfected with the hVDR expression vector (Fig. 5). The addition of 10-8 M 1alpha ,25(OH)2D3 or 10-7 M TEI-9647 increased the intensity of the complex, and 10-7 M TEI-9647 did not impair this effect of 10-8 M 1alpha ,25(OH)2D3 in COS-7 cells. Essentially the same results were observed in Saos-2 cells, although the enhancing effect of 1alpha ,25(OH)2D3 was not as high as in COS-7 cells, making it difficult to examine the antagonistic effect of TEI-9647.


View larger version (112K):
[in this window]
[in a new window]
  		Fig. 5.   The DNA binding of VDR to VDRE was not affected by TEI-9647. The effect of TEI-9647 on the binding of the VDR/RXR to DR3-type VDRE was examined in EMSA. Recombinant VDR (45) or cell lysates of untransfected COS-7 cells or cells transfected with VDR expression vector were mixed with 32P-labeled double-strand oligonucleotides containing DR3-type VDRE sequence, and electrophoresed on 5% native polyacrylamide gel. Ligand was added to cells 5 h before the harvest. Lane 1, without transfection of VDR expression vector; lanes 2-5, with transfection of VDR (lane 2, vehicle; lane 3, 10-8 M 1alpha ,25(OH)2D3; lane 4, 10-7 M TEI-9647; lane 5, 10-8 M 1alpha ,25(OH)2D3 + 10-7 M TEI-9647; lane 6, vehicle + recombinant VDR; lane 7, recombinant VDR and RXR.

Interaction of VDR Liganded by TEI-9647 with Coactivator SRC-1 Is Impaired-- As another critical step in the activation of the gene transcription by VDR, the protein-protein interaction between the VDR and SRC-1 was examined by the mammalian two-hybrid system using the expression vectors of the human SRC-1 fused to GAL4DBD (pM-SRC-1) and of the human VDR (pVP16-hVDR). 10-8 M 1alpha ,25(OH)2D3 induced the interaction between the VDR and SRC-1, as indicated by the reporter activity and 10-7 M TEI-9647 significantly inhibited the heterodimer formation in Saos-2 cells (Fig. 6).


View larger version (21K):
[in this window]
[in a new window]
  		Fig. 6.   TEI-9647 reduced the interaction between VDR and SRC-1. The SRC-1 cDNA was inserted at the EcoRI site of the pM vector, which contains a GAL4 DNA-binding domain (pM-SRC-1). The interaction of VDR and SRC-1 was examined by studying the reporter activity in Saos-2 cells transfected with pM-SRC-1, pVP16-hVDR, and the reporter plasmid containing the GAL4 binding sites (pGVP2-GAL4BS). Vehicle (control), 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both (1alpha ,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as the mean ± S.E. * represents p < 0.05 compared with activity induced by 10-8 M 1alpha ,25(OH)2D3 alone.

Localization of hVDR-Green Fluorescent Protein Fusion Protein-- The GFP indicated that the VDR localized predominantly in nucleus rather than cytoplasm, and that 10-8 M 1alpha ,25(OH)2D3 shifted the VDR to the nucleus of COS-7 cells (Fig. 7, A and B). TEI-9647 also facilitated the localization of the VDR to nuclei, but did not block the effect of 1alpha ,25(OH)2D3 (Fig. 7, C and D). The results were the same when pGreen Lantern-hVDR was introduced into Saos-2 cells. The fusion of GFP and the VDR was confirmed by Western blotting using monoclonal antibody 9A7gamma against the VDR and anti-GFP antibody (Roche Molecular Biochemicals; data not shown).


View larger version (63K):
[in this window]
[in a new window]
  		Fig. 7.   TEI-9647 did not affect the nuclear localization of VDR. The VDR was visualized in living COS-7 cells by the construction of a fusion protein of VDR and GFP (GFP-VDR). 10-8 M 1alpha ,25(OH)2D3, 10-7 M TEI-9647, or both were added 24 h after the transfection, and the cells were observed by fluorescence microscopy 3 h after the addition. A, vehicle; B, 10-8 M 1alpha ,25(OH)2D3; C, 10-7 M TEI-9647; D, both.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

TEI-9647 is the first synthetic ligand for the VDR that efficiently blocks the differentiation of HL-60 cells, human promyelocytic leukemia cells, induced by 1alpha ,25(OH)2D3 (15). Although such differentiation of HL-60 cells was speculated to be mediated by the VDR, we have presented direct evidence that TEI-9647 antagonizes the action of the VDR induced by 1alpha ,25(OH)2D3, and further studied the mechanism of this antagonistic effect of TEI-9647 in other types of cells.

10-7 to 10-9 M TEI-9647 inhibited the transactivation effect of 10-8 M 1alpha ,25(OH)2D3 dose-dependently in the reporter system using the VDREs of the human 24-hydroxylase gene in Saos-2 cells. The binding affinity of TEI-9647 for the VDR was one-tenth of that of 1alpha ,25(OH)2D3, and 10-9 M and 10-7 M TEI-9647 significantly inhibited the function of 1alpha ,25(OH)2D3 by 41% and 74%, respectively. These results suggest that the antagonistic effect of TEI-9647 was more efficient than the simple competitive inhibition of binding to the ligand-binding domain of the VDR, and confirm that TEI-9647 is the first ligand for the VDR to have an antagonistic effect on the VDR-mediated action of 1alpha ,25(OH)2D3. Although 1beta ,25(OH)2D3 was reported to be a potent antagonist of the non-genomic action of 1alpha ,25(OH)2D3 such as transcaltachia and 45Ca2+ uptake (28), no antagonists of the genomic action of 1alpha ,25(OH)2D3 have been reported to date.

1alpha ,25(OH)2D3 exerts its effect via the VDR through multi-step events; first binding to the VDR, then forming a heterodimer with RXR, binding to the VDRE and interacting with a coactivator. To investigate the interaction of the VDR with RXRalpha , we used the modified mammalian two-hybrid system with the VDR expression vector, pSG5-VDR, and the plasmid construct expressing GAL4 DBD fused to RXRalpha . In our experiments, 10-8 M 1alpha ,25(OH)2D3 enhanced the direct interaction between the VDR and RXRalpha 5-fold as indicated by the reporter activity, and the result was consistent with data reported previously (29, 30). A 10 M excess of TEI-9647 markedly inhibited the interaction between the VDR and RXRalpha induced by 1alpha ,25(OH)2D3 in Saos-2 cells, suggesting that one of the mechanisms for the antagonistic effect of TEI-9647 on the function of 1alpha ,25(OH)2D3 is reduced interaction between the VDR and RXR. In contrast, the interaction of the VDR with RXR was not affected in HeLa cells. The interaction of VDR and RXR was previously investigated in a yeast two-hybrid system, and a close correlation was found between the ability to activate transcription and the degree of heterodimerization of VDR-RXR liganded with several vitamin D analogues (31). The binding of VDR-RXR complex to a VDRE was detected in EMSA even with the addition of TEI-9647, suggesting that binding of VDR to RXR was not blocked by the metabolite despite the inhibitory effect of TEI-9647 on the enhancement by 1alpha ,25(OH)2D3 of the interaction between VDR and RXR.

To investigate the interaction between the VDR and coactivators, we used the mammalian two-hybrid system with a VDR expression vector containing the activation domain of a herpesvirus, pVP16-hVDR, and the plasmid construct expressing GAL4 DBD fused to SRC-1, which was originally found as a representative coactivator of the thyroid hormone and retinoic acid receptor superfamily (26). SRC-1 is now recognized as a general coactivator for the nuclear receptor superfamily including VDR. Recently, deletion-mutation analysis revealed that an activation domain of VDR is required for the interaction between VDR and SRC-1 (32). Although the reason is unclear, this ligand-dependent interaction between SRC-1 and VDR was observed in Saos-2 cells, but not in HeLa cells in our system. In Saos-2 cells, the interaction between VDR and SRC-1 was reduced by TEI-9647, suggesting that the conformational change of VDR elicited by the ligand differs between 1alpha ,25(OH)2D3 and TEI-9647 as suggested by studies using other vitamin D analogues (22, 33, 34).

The results described above suggest that the multi-step inhibitory action of TEI-9647 on VDR function confers the strong antagonism of this metabolite in Saos-2 cells. Interestingly, TEI-9647 did not have an antagonistic effect in two distinct experiments using pM-VDR or pM-RXRalpha with pSG5-hVDR in HeLa cells (Figs. 3C and 4B). Thus, TEI-9647 appears to be a weaker antagonist in HeLa cells than in Saos-2 cells because of the difference in the number of inhibitory steps. In general, an antagonist exerts its effect in a manner that is either ubiquitous (a pure antagonist) or tissue-specific (a partial antagonist). Representative analogues of estrogen are tamoxifen and raloxifene, tissue-specific antagonists and agonists referred to as SERMs, or selective estrogen receptor modulators (35, 36). TEI-9647 showed tissue-specific antagonism in vitro; the effect was marked in Saos-2 cells, MG-63 cells, and HL-60 cells (this paper and Ref. 15), and weak in HeLa and COS-7 cells where it acts as a weak agonist. The difference in the inhibitory activity may explain the difference in the efficiency of the antagonism in various cells. The precise mechanism of partial antagonism remains to be elucidated, but the balance of coactivator and corepressor regulation or some regulating factors such as L7/SPA may be involved in the tissue-specific activity of the antagonist (37, 38). In addition, the antagonism at various stages of the receptor function required for activation of transcription may contribute to the marked inhibitory effect.

The subcellular distribution of VDR in the absence of the ligand remains controversial (39-41). We generated chimera proteins in which wild-type human VDR was fused to GFP at the C-terminal position and found that the GFP-tagged wild-type VDRs were located predominantly in nuclei with a significant cytoplasmic distribution, while GFP alone was uniformly distributed in both nuclei and cytoplasm (this paper and Ref. 42). Addition of 10-8 M 1alpha ,25(OH)2D3 accelerated the nuclear transfer of VDR in a few hours. The nuclear translocation of VDR was not affected by addition of TEI-9647 in COS-7 and Saos-2 cells. These results are consistent with the finding that TEI-9647 is not a pure antagonist of 1alpha ,25(OH)2D3, because estrogen receptor liganded by pure antagonist is reported to be localized in the cytoplasm (43).

In conclusion, we have found that TEI-9647 antagonizes the function of VDR elicited by 1alpha ,25(OH)2D3. The extent of the antagonism of TEI-9647 differed between cells. The inhibitory action of TEI-9647 against the interaction between VDR and SRC-1 as well as between VDR and RXR contributes to the antagonistic effect in Saos-2 cells.

    ACKNOWLEDGEMENTS

We thank Dr. Mark R. Haussler (University of Arizona) and Dr. M. J. Tsai (Baylor College of Medicine) for generously donating the human VDR and RXRalpha expression vectors and SRC-1 expression vector, respectively. We also thank Dr. Y. Ohyama (Hiroshima University) for providing clone including rat 24-hydroxylase gene promoter. We gratefully acknowledge Chika Shimizu and Noriko Tsuda for excellent technical assistance, and Tomoko Hayashi for secretarial help.

    FOOTNOTES

* This work was supported in part by grants from the Ministry of Education of Japan (to K. O.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom all correspondence should be addressed: Dept. of Environmental Medicine, Osaka Medical Center and Research Inst. for Maternal and Child Health, 840 Murodo-cho, Izumi, Osaka 594-1101, Japan. Tel.: 81-725-56-1220; Fax: 81-725-57-3021; E-mail: j61642@center.osaka-u.ac.jp.

parallel Present address: Dept. of Pediatrics, Faculty of Medicine, Osaka University, Osaka 565-0871, Japan.

    ABBREVIATIONS

The abbreviations used are: 1alpha , 25(OH)2D3, 1alpha ,25-dihydroxyvitamin D3; VDR, vitamin D receptor; VDRE, vitamin D response element; DBD, DNA-binding domain; EMSA, electrophoretic mobility shift assay; RXR, retinoid X receptor; GFP, green fluorescent protein; SRC-1, steroid receptor coactivator-1; beta -gal, beta -galactosidase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Haussler, M. R., Whitfield, G. K., Haussler, C. A., Hsieh, J-C., Thompson, P. D., Selznick, S. H., Dominguez, C. E., and Jurutka, P. W. (1998) J. Bone Miner. Res. 13, 325-349[CrossRef][Medline] [Order article via Infotrieve]
2. Pike, J. W. (1997) in Vitamin D (Feldman, D. , Glorieux, F. H. , and Pike, J. W., eds) , pp. 105-125, Academic Press, San Diego
3. Evans, R. M. (1988) Science 240, 889-895[Abstract/Free Full Text]
4. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schütz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) Cell 83, 835-839[CrossRef][Medline] [Order article via Infotrieve]
5. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355, 446-449[CrossRef][Medline] [Order article via Infotrieve]
6. Norman, A. W. (1998) J. Bone Miner. Res. 13, 1360-1369[CrossRef][Medline] [Order article via Infotrieve]
7. Hughes, M. R., Malloy, P. J., Kieback, D. G., Kesterson, R. A, Pike, J. W., Feldman, D., and O'Malley, B. W. (1988) Science 242, 1702-1705[Abstract/Free Full Text]
8. Yoshizawa, T., Handa, Y., Uematsu, Y., Takeda, S., Sekine, K., Yoshihara, Y., Kawakami, T., Arioka, K., Sato, H., Uchiyama, Y., Masushige, S., Fukamizu, A., Matsumoto, T., and Kato, S. (1997) Nat. Genet. 16, 391-396[CrossRef][Medline] [Order article via Infotrieve]
9. Li, Y. C., Pirro, A. E., Amling, M., Delling, G., Baron, R., Bronson, R., and Demay, M. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 9831-9835[Abstract/Free Full Text]
10. Lemon, B. D., Fondell, J. D., and Freedman, L. P. (1997) Mol. Cell. Biol. 17, 1923-1937[Abstract]
11. Masuyama, H., Brownfield, C. M., St-Arnaud, R., and MacDonald, P. N. (1997) Mol. Endocrinol. 11, 1507-1517[Abstract/Free Full Text]
12. Nakajima, S., Yamagata, M., Sakai, N., and Ozono, K. (1998) Mol. Cell. Endocrinol. 139, 15-24[CrossRef][Medline] [Order article via Infotrieve]
13. Bouillon, R., Okamura, W. H., and Norman, A. W. (1995) Endocr. Rev. 16, 200-257[Abstract/Free Full Text]
14. Dusso, A. S., Negrea, L., Gunawardhana, S., Lopez-Hilker, S., Finch, J., Mori, T., Nishii, Y., Slatopolsky, E., and Brown, A. J. (1991) Endocrinology 128, 1687-1692[Abstract/Free Full Text]
15. Miura, D., Manabe, K., Ozono, K., Saito, M., Gao, Q., Norman, A. W., and Ishizuka, S. (1999) J. Biol. Chem. 274, 16392-16399[Abstract/Free Full Text]
16. Vegeto, E., Allan, G. F., Schrader, W. T., Tsai, M.-J., McDonnell, D. P., and O'Malley, B. W. (1992) Cell 69, 703-713[CrossRef][Medline] [Order article via Infotrieve]
17. Kraus, W. L., Weis, K. E., and Katzenellenbogen, B. S. (1995) Mol. Cell. Biol. 15, 1847-1857[Abstract]
18. Lee, M. O., Dawson, M. I., Picard, N., Hobbs, P. D., and Pfahl, M. (1996) J. Biol. Chem. 271, 11897-11903[Abstract/Free Full Text]
19. Lala, D. S., Mukherjee, R., Schulman, I. G., Koch, S. S. C., Dardashti, L. J., Nadzan, A. M., Croston, G. E., Evans, R. M., and Heyman, R. A. (1996) Nature 383, 450-453[CrossRef][Medline] [Order article via Infotrieve]
20. Brzozowski, A. M., Pike, A. C. W., Dauter, Z., Hubbard, R. E., Bonn, T., Engström, O., Öhman, L., Greene, G. L., Gustafsson, J.-Å., and Carlquist, M. (1997) Nature 389, 753-758[CrossRef][Medline] [Order article via Infotrieve]
21. Grese, T. A., Sluka, J. P., Bryant, H. U., Cullinan, G. J., Glasebrook, A. L., Jones, C. D., Matsumoto, K., Palkowitz, A. D., Sato, M., Termine, J. D., Winter, M. A., Yang, N. N., and Dodge, J. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 14105-14110[Abstract/Free Full Text]
22. Takeyama, K., Masuhiro, Y., Fuse, H., Endoh, H., Murayama, A., Kitanaka, S., Suzawa, M., Yanagisawa, J., and Kato, S. (1999) Mol. Cell. Biol. 19, 1049-1055[Abstract/Free Full Text]
23. Chen, K.-S., and DeLuca, H. F. (1995) Biochim. Biophys. Acta 1263, 1-9[Medline] [Order article via Infotrieve]
24. Ohyama, Y., Ozono, K., Uchida, M., Yoshimura, M., Shinki, T., Suda, T., and Yamamoto, O. (1996) J. Biol. Chem. 271, 30381-30385[Abstract/Free Full Text]
25. Nakajima, S., Hsieh, J.-C., MacDonald, P. N., Galligan, M. A., Haussler, C. A., Whitfield, G. K., and Haussler, M. R. (1994) Mol. Endocrinol. 8, 159-172[Abstract/Free Full Text]
26. Oñate, S. A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1995) Science 270, 1354-1357[Abstract/Free Full Text]
27. Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., Yamamoto, O., Noshiro, M., and Kato, Y. (1994) J. Biol. Chem. 269, 10545-10550[Abstract/Free Full Text]
28. Norman, A. W., Bouillon, R., Farach-Carson, M. C., Bishop, J. E., Zhou, L. X., Nemere, I., Zhao, J., Muralidharan, K. R., and Okamura, W. H. (1993) J. Biol. Chem. 268, 20022-20030[Abstract/Free Full Text]
29. Sone, T., Ozono, K., and Pike, J. W. (1991) Mol. Endocrinol. 5, 1578-1586[Abstract/Free Full Text]
30. MacDonald, P. N., Dowd, D. R., Nakajima, S., Galligan, M. A., Reeder, M. C., Haussler, C. A., Ozato, K., and Haussler, M. R. (1993) Mol. Cell. Biol. 13, 5907-5917[Abstract/Free Full Text]
31. Zhao, X.-Y., Eccleshall, T. R., Krishnan, A. V., Gross, C., and Feldman, D. (1997) Mol. Endocrinol. 11, 366-378[Abstract/Free Full Text]
32. Gill, R. K., Atkins, L. M., Hollis, B. W., and Bell, N. H. (1998) Mol. Endocrinol. 12, 57-65[Abstract/Free Full Text]
33. van den Bemd, G.-J. C. M., Pols, H. A. P., Birkenhäger, J. C., and van Leeuwen, J. P. T. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 10685-10690[Abstract/Free Full Text]
34. Peleg, S., Nguyen, C., Woodard, B. T., Lee, J.-K., and Posner, G. H. (1998) Mol. Endocrinol. 12, 525-535[Abstract/Free Full Text]
35. McDonnell, D. P., Clemm, D. L., Hermann, T., Goldman, M. E., and Pike, J. W. (1995) Mol. Endocrinol. 9, 659-669[Abstract/Free Full Text]
36. MacGregor, J. I., and Jordan, V. C. (1998) Pharmacol. Rev. 50, 151-196[Abstract/Free Full Text]
37. Smith, C. L., Nawaz, Z., and O'Malley, B. W. (1997) Mol. Endocrinol. 11, 657-666[Abstract/Free Full Text]
38. Jackson, T. A., Richer, J. K., Bain, D. L., Takimoto, G. S., Tung, L., and Horwitz, K. B. (1997) Mol. Endocrinol. 11, 693-705[Abstract/Free Full Text]
39. Clemens, T. L., Garrett, K. P., Zhou, X.-Y., Pike, J. W., Haussler, M. R., and Dempster, D. W. (1988) Endocrinology 122, 1224-1230[Abstract/Free Full Text]
40. Barsony, J., Renyi, I., and McKoy, W. (1997) J. Biol. Chem. 272, 5774-5782[Abstract/Free Full Text]
41. Hsieh, J.-C., Shimizu, Y., Minoshima, S., Shimizu, N., Haussler, C. A., Jurutka, P. W., and Haussler, M. R. (1998) J. Cell. Biochem. 70, 94-109[CrossRef][Medline] [Order article via Infotrieve]
42. Michigami, T., Shimizu, C., Suga, A., and Ozono, K. (1998) Bone 23, S257[CrossRef] (abstr.)
43. Devin-Leclerc, J., Meng, X., Delahaye, F., Leclerc, P., Baulieu, E.-E., and Catelli, M.-G. (1998) Mol. Endocrinol. 12, 842-854[Abstract/Free Full Text]
44. Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J., Haussler, M. R., Pike, J. W., Shine, J., and O'Malley, B. W. (1988) Proc. Natl. Acad Sci. U. S. A. 85, 3294-3298[Abstract/Free Full Text]
45. Nakajima, S., Yanagihara, I., and Ozono, K. (1997) Biochem. Biophys. Res. Commun. 232, 806-809[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
Y. Inaba, K. Yamamoto, N. Yoshimoto, M. Matsunawa, S. Uno, S. Yamada, and M. Makishima
Vitamin D3 Derivatives with Adamantane or Lactone Ring Side Chains are Cell Type-Selective Vitamin D Receptor Modulators
Mol. Pharmacol., May 1, 2007; 71(5): 1298 - 1311.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
T. Nijenhuis, B. C. J. van der Eerden, U. Zugel, A. Steinmeyer, H. Weinans, J. G. J. Hoenderop, J. P. T. M. van Leeuwen, and R. J. M. Bindels
The novel vitamin D analog ZK191784 as an intestine-specific vitamin D antagonist
FASEB J, October 1, 2006; 20(12): 2171 - 2173.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
E. Ochiai, D. Miura, H. Eguchi, S. Ohara, K. Takenouchi, Y. Azuma, T. Kamimura, A. W. Norman, and S. Ishizuka
Molecular Mechanism of the Vitamin D Antagonistic Actions of (23S)-25-Dehydro-1{alpha}-Hydroxyvitamin D3-26,23-Lactone Depends on the Primary Structure of the Carboxyl-Terminal Region of the Vitamin D Receptor
Mol. Endocrinol., May 1, 2005; 19(5): 1147 - 1157.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Ishizuka, N. Kurihara, S. V. Reddy, J. Cornish, T. Cundy, and G. D. Roodman
(23S)-25-Dehydro-1{alpha}-Hydroxyvitamin D3-26,23-Lactone, a Vitamin D Receptor Antagonist that Inhibits Osteoclast Formation and Bone Resorption in Bone Marrow Cultures from Patients with Paget's Disease
Endocrinology, April 1, 2005; 146(4): 2023 - 2030.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
A. Ismail, C. V. Nguyen, A. Ahene, J. C. Fleet, M. R. Uskokovic, and S. Peleg
Effect of Cellular Environment on the Selective Activation of the Vitamin D Receptor by 1{alpha},25-Dihydroxyvitamin D3 and Its Analog 1{alpha}-Fluoro-16-Ene-20-Epi-23-Ene-26,27-Bishomo-25-Hydroxyvitamin D3 (Ro-26-9228)
Mol. Endocrinol., April 1, 2004; 18(4): 874 - 887.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Peleg, M. Uskokovic, A. Ahene, B. Vickery, and Z. Avnur
Cellular and Molecular Events Associated with the Bone-Protecting Activity of the Noncalcemic Vitamin D Analog Ro-26-9228 in Osteopenic Rats
Endocrinology, May 1, 2002; 143(5): 1625 - 1636.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
A. Toell, M. M. Gonzalez, D. Ruf, A. Steinmeyer, S. Ishizuka, and C. Carlberg
Different Molecular Mechanisms of Vitamin D3 Receptor Antagonists
Mol. Pharmacol., June 1, 2001; 59(6): 1478 - 1485.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
S. Ishizuka, D. Miura, K. Ozono, M. Chokki, H. Mimura, and A. W. Norman
Antagonistic Actions in Vivo of (23S)-25-Dehydro-1{{alpha}}-Hydroxyvitamin D3-26,23-Lactone on Calcium Metabolism Induced by 1{{alpha}},25-Dihydroxyvitamin D3
Endocrinology, January 1, 2001; 142(1): 59 - 67.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
C. M. Bula, J. E. Bishop, S. Ishizuka, and A. W. Norman
25-Dehydro-1{alpha}-Hydroxyvitamin D3- 26,23S-Lactone Antagonizes the Nuclear Vitamin D Receptor by Mediating a Unique Noncovalent Conformational Change
Mol. Endocrinol., November 1, 2000; 14(11): 1788 - 1796.
[Abstract] [Full Text]

Home page
 Mol. Pharmacol.Home page
Y. Bury, A. Steinmeyer, and C. Carlberg
Structure Activity Relationship of Carboxylic Ester Antagonists of the Vitamin D3 Receptor
Mol. Pharmacol., November 1, 2000; 58(5): 1067 - 1074.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
M. Herdick, A. Steinmeyer, and C. Carlberg
Antagonistic Action of a 25-Carboxylic Ester Analogue of 1alpha ,25-Dihydroxyvitamin D3 Is Mediated by a Lack of Ligand-induced Vitamin D Receptor Interaction with Coactivators
J. Biol. Chem., May 26, 2000; 275(22): 16506 - 16512.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ozono, K.
Right arrow Articles by Ishizuka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ozono, K.
Right arrow Articles by Ishizuka, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement