![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 45, 32376-32381, November 5, 1999
,25-Dihydroxyvitamin D3 Analogue
toward Vitamin D Receptor Function*
§,
,
,
, and
From the We have recently reported that
23(S)-25-dehydro-1 1 The VDR consists of several functional domains such as DNA-binding and
ligand-binding domains (1, 2). Heterodimerization of the VDR with
retinoid X receptor (RXR) is also important for the binding to a
vitamin D-responsive element (VDRE) with high affinity (1, 2, 5, 10).
Ligand-dependent activation of transcription requires the
extreme C-terminal portion of the VDR, which is designated as the AF-2
core domain (1, 11, 12). The interaction of these domains is required
for the VDR to regulate the transcription of target genes.
A large number of 1 In contrast to the case of VDR, several antagonists have been reported
for other members of the nuclear hormone receptor superfamily, and have
contributed to the understanding of the functions of nuclear hormones
(16-18). For example, RXR-selective antagonist acted differently
against retinoic acid receptor and RXRs (19). Although the molecular
mechanism of the antagonism is still under investigation, the
structural basis of the antagonism was reported; a different
conformation in the transactivation domain of the estrogen receptor
liganded by 17 In this report, we have characterized the effects of the novel vitamin
D analogue TEI-9647 on the various functions of the vitamin D receptor
including activation of promoter activity, interaction with RXR and
coactivator SRC-1, and binding to VDRE in several types of cells and
have detected strong antagonistic activity in cells with an
osteoblastic phenotype.
Chemicals--
1 Cell Culture--
The monkey kidney epithelial cell line COS-7,
the human fibroblastic cell line HeLa, and the human osteoblastic cell
lines Saos-2 and MG-63 (ATCC HTB-85 and CRL-1427, respectively) were maintained in Dulbecco's modified Eagle's medium (Nissui
Pharmaceutical Co., Tokyo, Japan) supplemented with 10% dextran-coated
charcoal-stripped fetal bovine serum (JRH Bioscience, Dexton, KS) and
penicillin/streptomycin at 37 °C under an atmosphere of 5%
CO2.
Plasmid Construct and Transcription Activation Assay--
The
polymerase chain reaction product corresponding to the region
(
Each plasmid together with the hVDR expression vector, pSG5-hVDR (Ref.
25; a gift from Dr. M. R. Haussler, University of Arizona), and
Fusion Protein Consisting of GAL4 DBD and VDR--
An expression
vector which contains the GAL4 DNA-binding domain (pM) was purchased
from CLONTECH. The human VDR cDNA was released by EcoRI from pSG5 vector and fused in-frame to pM (pM-VDR).
The cDNA of the VDR lacking its own DNA-binding domain (DBD) was
also generated by digestion with NaeI and EcoRI,
and cloned into pM vector (pM-VDRdDBD). The luciferase reporter plasmid
was generated by insertion of 5 copies of consensus GAL4 binding sites
into pGVP2 vector (Toyo Ink) and designated as pGVP2-GAL4BS.
Modified Mammalian Two-hybrid Assay--
Whole cDNA of human
RXR In Vitro VDR/VDRE Binding Assay--
An electrophoretic mobility
shift assay (EMSA) was carried out as previously reported (27), with
slight modification. Briefly, vehicle, 10 Localization of hVDR-Green Fluorescent Protein Fusion
Protein--
The expression vector of green fluorescent protein (GFP),
pGreen Lantern, is driven by the cytomegalovirus promoter (Life Technologies, Inc.). The termination codon (TGA) was mutated to CTT,
generating a unique HindIII site. cDNA encoding hVDR was released by digestion with EcoRI from pSG5-hVDR and
subcloned into pGreen Lantern after the blunting of both ends. As a
result, the expression vector of the fusion protein (GFP N-terminal to hVDR), pGreen Lantern-hVDR was generated. pGreen Lantern-hVDR was
introduced into COS-7 cells or Saos-2 cells by the lipofection method.
Twenty four hours after the transfection, vehicle, 10 Statistical Analysis--
The data were analyzed by analysis of
variance using StatView software (SAS Institute Inc., Cary, NC).
TEI-9647 Did Not Induce Activity of the Promoter Which Contains
VDREs, but Dose-dependently Suppressed the Transcription
Activation Induced by
1 The Antagonistic Effect of TEI-9647 Was Stronger in Osteoblastic
Cells--
10 TEI-9647 Exhibited an Antagonistic Effect via the VDR Fused to GAL4
DNA-binding Domain and GAL4 Binding Element--
To examine the
independence of the antagonistic effect on the interaction between the
DNA-binding domain (DBD) of the VDR and a VDRE, GAL4 DBD that was fused
to VDR (pM-VDR) or substituted for the DBD of the VDR (pM-VDRdDBD) was
generated and assayed for its activity of gene regulation together with
the SV40 promoter-driven reporter plasmid containing the GAL4 binding
site and luciferase gene (pGVP2-GAL4BS) (Fig.
3A). 10 TEI-9647 Inhibited the VDR and RXR Heterodimer Formation Detected
by the Modified Mammalian Two-hybrid System in Saos-2 Cells--
As
the next step in the activation of the gene transcription by VDR, the
protein-protein interaction between the VDR and RXR was examined by the
modified mammalian two-hybrid system using the expression vectors of
the cDNA of the human RXR VDR/RXR Binds to a VDRE with TEI-9647--
In vitro
binding of the VDR/RXR heterodimer to the VDRE was examined by EMSA.
The VDR/RXR/VDRE complex was observed in lanes using extracts from
cells transfected with the hVDR expression vector (Fig.
5). The addition of 10 Interaction of VDR Liganded by TEI-9647 with Coactivator SRC-1 Is
Impaired--
As another critical step in the activation of the gene
transcription by VDR, the protein-protein interaction between the VDR and SRC-1 was examined by the mammalian two-hybrid system using the
expression vectors of the human SRC-1 fused to GAL4DBD (pM-SRC-1) and
of the human VDR (pVP16-hVDR). 10 Localization of hVDR-Green Fluorescent Protein Fusion
Protein--
The GFP indicated that the VDR localized predominantly in
nucleus rather than cytoplasm, and that 10 TEI-9647 is the first synthetic ligand for the VDR that
efficiently blocks the differentiation of HL-60 cells, human
promyelocytic leukemia cells, induced by
1 10 1 To investigate the interaction between the VDR and coactivators, we
used the mammalian two-hybrid system with a VDR expression vector
containing the activation domain of a herpesvirus, pVP16-hVDR, and the
plasmid construct expressing GAL4 DBD fused to SRC-1, which was
originally found as a representative coactivator of the thyroid hormone
and retinoic acid receptor superfamily (26). SRC-1 is now recognized as
a general coactivator for the nuclear receptor superfamily including
VDR. Recently, deletion-mutation analysis revealed that an activation
domain of VDR is required for the interaction between VDR and SRC-1
(32). Although the reason is unclear, this ligand-dependent
interaction between SRC-1 and VDR was observed in Saos-2 cells, but not
in HeLa cells in our system. In Saos-2 cells, the interaction between
VDR and SRC-1 was reduced by TEI-9647, suggesting that the
conformational change of VDR elicited by the ligand differs between
1 The results described above suggest that the multi-step inhibitory
action of TEI-9647 on VDR function confers the strong antagonism of
this metabolite in Saos-2 cells. Interestingly, TEI-9647 did not have
an antagonistic effect in two distinct experiments using pM-VDR or
pM-RXR The subcellular distribution of VDR in the absence of the ligand
remains controversial (39-41). We generated chimera proteins in which
wild-type human VDR was fused to GFP at the C-terminal position and
found that the GFP-tagged wild-type VDRs were located predominantly in
nuclei with a significant cytoplasmic distribution, while GFP alone was
uniformly distributed in both nuclei and cytoplasm (this paper and Ref.
42). Addition of 10 In conclusion, we have found that TEI-9647 antagonizes the function of
VDR elicited by 1 We thank Dr. Mark R. Haussler (University of
Arizona) and Dr. M. J. Tsai (Baylor College of Medicine) for
generously donating the human VDR and RXR *
This work was supported in part by grants from the Ministry
of Education of Japan (to K. O.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom all correspondence should be addressed: Dept. of
Environmental Medicine, Osaka Medical Center and Research Inst. for Maternal and Child Health, 840 Murodo-cho, Izumi, Osaka 594-1101, Japan. Tel.: 81-725-56-1220; Fax: 81-725-57-3021; E-mail:
j61642@center.osaka-u.ac.jp.
The abbreviations used are:
1
Department of Environmental Medicine,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-hydroxyvitamin
D3-26,23-lactone (TEI-9647) efficiently blocks the
differentiation of HL-60 cells induced by 1
,25-dihydroxyvitamin
D3 (1
,25(OH)2D3) (Miura, D.,
Manabe, K., Ozono, K., Saito, M., Gao, Q., Norman, A. W., and
Ishizuka, S. (1999) J. Biol. Chem. 274, 16392-16399). To clarify the molecular mechanisms of this antagonism, we examined whether TEI-9647 antagonizes the genomic effects of
1
,25(OH)2D3. 10
7 to
10
9 M TEI-9647 inhibited the transactivation
effect of 10
8 M
1
,25(OH)2D3 in a dose-dependent
manner, while TEI-9647 alone did not activate the reporter activity
driven by SV40 promoter containing two vitamin D response elements in
Saos-2 cells. The antagonistic effect of TEI-9647 was also observed
using the rat 24-hydroxylase gene promoter, but the effect was weaker
in HeLa and COS-7 cells than in Saos-2 cells. TEI-9647 also exhibited antagonism in an assay system where the VDR fused to the GAL4 DNA-binding domain and the reporter plasmid containing the GAL4 binding
site were used in Saos-2 cells, but did not in HeLa cells. TEI-9647
reduced the interaction between VDR and RXR
according to the results
obtained from the mammalian two-hybrid system in Saos-2 cells, but did
not in HeLa cells. The two-hybrid system also revealed that the
interaction between VDR and SRC-1 was reduced by TEI-9647 in Saos-2
cells. These results demonstrate that the novel
1
,25(OH)2D3 analogue, TEI-9647, is the first
synthetic ligand for the VDR that efficiently antagonizes the action of 1
,25(OH)2D3, although the extent of its
antagonism depends on cell type.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
,25-Dihydroxyvitamin D3
(1
,25(OH)2D3)1
regulates various biological events including bone and calcium
metabolism and cell differentiation (1, 2). The vitamin D receptor
(VDR), a member of the nuclear hormone receptor superfamily, mediates
1
,25(OH)2D3 action by modulating the
transcription of target genes (1-5). The effects exerted via the VDR
are called genomic effects, in contrast to non-genomic effects, which
means that 1
,25(OH)2D3 acts within a short
period without transcription of target genes (6). The VDR-mediated
effects of 1
,25(OH)2D3 in vivo
are well known, since there is a human disease associated with the
abnormality of the VDR gene, which is called vitamin D dependence type
II (7). In addition, a mouse model of the disease was generated by
targeting the VDR gene and has been used the analysis of the VDR
function in vivo (8, 9).
,25(OH)2D3 analogues have
been synthesized in an attempt to dissociate various biological
activities including hypercalcemic effects, bone-forming effects, and
promotion of cell differentiation (for review, see Ref. 13). Generally,
these analogues have been screened in terms of the affinity for the VDR
and vitamin D-binding protein. Certain synthetic analogues like
22-oxa-1
,25(OH)2D3 appear to succeed in the
dissection of various effects of 1
,25(OH)2D3
by taking advantage of the difference in binding to the VDR and vitamin
D-binding protein and metabolic pathway (14). To date, however, no
anti-vitamin D compounds that oppose the genomic actions of the natural
ligand 1
,25(OH)2D3, have been reported (13).
We have recently synthesized a novel analogue
23(S)-25-dehydro-1
-hydroxyvitamin D3-26,23-lactone
(TEI-9647) and found that it efficiently blocks the differentiation of
HL-60 cells induced by 1
,25(OH)2D3 (15).
Although this differentiation is believed to be mediated by VDR, more
direct evidence is needed to establish whether TEI-9647 is an
antagonist of the genomic action of vitamin D. Antagonists, if
obtained, would be useful for determining whether each of the effects
of 1
,25(OH)2D3 is mediated by the VDR. In
addition, a potentially promising way to achieve the differential
effect of vitamin D is to use analogues that antagonize particular
effects elicited by vitamin D.
-estradiol and raloxifene was revealed by a crystal
structure study (20). Interestingly, some antagonists exhibit agonistic
effects in selective tissues. For example, tamoxifen exerts a
breast-selective and bone-sparing antagonistic action on estrogen (21).
The mechanism of the tissue specificity is unclear. Since the
structures of receptors liganded with agonist and antagonist are
distinct, the interaction with different coactivators or corepressors
in each tissue may play a role in the tissue-selective action of the
partial antagonist (22).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
,25-(OH)2D3 and
TEI-9647 were synthesized in our laboratory as described previously
(15).
367/
57) regulating expression of the human 24-hydroxylase gene,
which contains two VDREs (23), was inserted into a luciferase reporter
vector pGVP2 containing SV40 promoter (Toyo Ink Co. Ltd., Tokyo,
Japan). The promoter region of the rat 24-hydroxylase gene (
291/+9),
which also contains two VDREs (a gift from Dr. Y. Ohyama, Hiroshima
University, Japan) (24), was cloned into a luciferase reporter vector
pGVB2 (Toyo Ink). The DNA sequences of these plasmids were confirmed
using an ABI 373A DNA sequencer (PE Applied Biosystems, Tokyo, Japan).
-galactosidase expression vector, was introduced into COS-7, Saos-2,
and HeLa cells by lipofection (LipofectAMINE, Life Technologies, Inc.).
The same plasmids except pSG5-hVDR were introduced in MG-63 cells by
Tfx-50 (Promega, Madison, WI). Sixteen hours after the transfection,
vehicle, 1
,25-(OH)2D3, TEI-9647, or both
agents were added. Forty-eight hours after the addition, cells were
harvested in the cell lysate solution provided with the luciferase
assay kit (Toyo Ink). The luciferase activities of the cell lysates
were measured with the luciferase assay kit according to the
manufacturer's instructions. Transactivation evaluated using
luciferase activities was standardized with the galactosidase
activities of the same cell lysates determined with a
-galactosidase
enzyme assay system (Promega).
(a gift from Dr. M. R. Haussler) was released by
EcoRI from pSG5 vector and fused in frame to pM vector
(pM-hRXR
). Steroid receptor coactivator-1 (SRC-1) cDNA (Ref. 26;
a gift from Dr. M. J. Tsai, Baylor College of Medicine) was
released by EcoRI, and the mutation was introduced at the site just before the translation initiation site to be cut by SmaI. Then, the SRC-1 cDNA was digested by
SmaI and SalI and inserted in pM vector
(pM-SRC-1). Whole cDNA of human VDR was released by
EcoRI from pSG5 vector and fused in-frame to pVP16 vector, which contains the activation domain of a herpesvirus
(CLONTECH) (pVP16-hVDR). To examine the interaction
of RXR and VDR, 0.5 µg of pM-RXR
, 0.5 µg of pSG5-hVDR, and 0.5 µg of pGVP2-GAL4BS together with 0.25 µg of plasmids containing
-galactosidase cDNA were transfected into HeLa cells or Saos-2
cells using LipofectAMINE. Next, to investigate the interaction of
SRC-1 and VDR, 0.5 µg of pM-SRC-1, 0.5 µg of pVP16-hVDR, and 0.5 µg of pGVP2-GAL4BS together with 0.25 µg of plasmids containing
-galactosidase cDNA were transfected into Saos-2 cells also by
LipofectAMINE. Twenty four hours later, vehicle, 10
8
M 1
,25(OH)2D3, 10
7
M TEI-9637, or both were added. After 24 h of
incubation, the luciferase activity of the cell lysate was examined and
adjusted using
-gal activity.
8 M
1
,25(OH)2D3, 10
7 M
TEI-9647, or both were administered to the COS-7 or Saos-2 cells
transfected with the hVDR expression vector. Five hours after the
addition, cellular extracts were obtained. Five µg of each cell
extract was incubated with 32P-labeled synthetic DR3-type
VDRE (sense strand: CTAGCAGGTCAAGGAGGTCAG).
8
M 1
,25(OH)2D3, 10
7
M TEI-9647, or both were administered to the COS-7 or
Saos-2 cells and the subcellular distribution of the VDR was observed by fluorescent microscopy (BH-2, Olympus, Tokyo, Japan) 3 h after the addition.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
,25(OH)2D3--
10
9 to
10
7 M TEI-9647 did not enhance the reporter
activity driven by the heterologous SV40 promoter fused to two VDREs of
the human 24-hydroxylase gene in Saos-2 cells. However, the promoter activity induced by 10
8 M
1
,25(OH)2D3 was suppressed by TEI-9647 in a
dose-dependent manner (Fig.
1). 10
7 M
TEI-9647 inhibited by 80% the transactivation function of
10
8 M 1
,25(OH)2D3,
at which concentration TEI-9647 corresponded to 10
8
M 1
,25(OH)2D3 in terms of the
VDR-bound amount, because the relative binding affinities of TEI-9647
to VDR prepared from chick intestine were 1/9.8 compared with those of
1
,25(OH)2D3 (designated 1) (15). In
subsequent experiments, 10
7 M and
10
8 M were chosen as the concentrations of
TEI-9647 and 1
,25(OH)2D3, respectively.

View larger version (12K):
[in a new window]
Fig. 1.
Dose response of the suppressive effect of
TEI-9647 on the promoter activity enhanced by
1,25(OH)2D3. The -fold induction which
indicates the activity of the SV40 promoter fused to two VDREs of the
human 24-hydroxylase gene obtained by the addition of TEI-9647,
1,25(OH)2D3, or both divided by the activity
obtained by the addition of vehicle is described. The reporter
construct, the VDR expression vector, and
-gal expression vector
were introduced in Saos-2 cells. After the transfection,
10
8 M 1
,25(OH)2D3,
10
7 M to 10
9 M
TEI-9647, or vehicle (indicated by
) was added, and the reporter
activity was measured 48 h after the addition. Data are expressed
as the mean ± S.E. * and ** represent p < 0.0001 and p < 0.0005, respectively, compared with activity
induced by 10
8 M
1
,25(OH)2D3 alone.
7 M TEI-9647 also exhibited a
suppressive effect on the function of 10
8 M
1
,25(OH)2D3 in the assay using the
homologous promoter of the rat 24-hydroxylase gene, which contains two
VDREs in Saos-2 cells (Fig.
2A). In this sense, the
suppressive effect of TEI-9647 did not depend on the promoter context.
In MG-63 cells, 10
7 M TEI-9647 also
suppressed the effect of 10
8 M
1
,25(OH)2D3 to 27% and did not act as an
agonist, when no expression vector of VDR was introduced.
10
7 M TEI-9647 inhibited the promoter
activity induced by 10
8 M
1
,25(OH)2D3 in HeLa cells, although the
suppressive effect was weaker in HeLa cells than in Saos-2 and MG-63
cells (Fig. 2B). In COS-7 cells, 10
7
M TEI-9647 also suppressed the effect of 10
8
M 1
,25(OH)2D3, to 54%.

View larger version (18K):
[in a new window]
Fig. 2.
The magnitude of the antagonistic effect of
TEI-9647 depends on cell type. A, TEI-9647 markedly
suppressed the effect of 1
,25(OH)2D3 in
Saos-2 cells. The reporter plasmid containing the rat 24-hydroxylase
gene, which possesses two VDREs (pGVB2-r24OHase), the VDR expression
vector, and
-gal expression vector, were introduced in Saos-2 cells.
Vehicle (control), 10
8 M
1
,25(OH)2D3, 10
7 M
TEI-9647, or both (1
,25(OH)2D3 + TEI-9647)
were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.0001 and
p < 0.0005, respectively, compared with activity
induced by 10
8 M
1
,25(OH)2D3 alone. B, TEI-9647
significantly suppressed the effect of
1
,25(OH)2D3 in HeLa cells. The same plasmids
described in A were introduced in HeLa cells. Vehicle
(control), 10
8 M
1
,25(OH)2D3, 10
7 M
TEI-9647, or both (1
,25(OH)2D3 + TEI-9647)
were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.0005 and
p < 0.05, respectively, compared with activity induced
by 10
8 M
1
,25(OH)2D3 alone.
7
M TEI-9647 inhibited the promoter activity induced by
10
8 M 1
,25(OH)2D3
via the interaction between GAL4-DBD and the GAL4 binding site in
Saos-2 cells (Fig. 3B). The results were very similar to
those using pM-VDRdDBD (data not shown). In contrast, TEI-9647 did not
inhibit the promoter activity induced by 10
8
M 1
,25(OH)2D3 via either pM-VDR
or pM-VDRdDBD in HeLa cells (Fig. 3C).

View larger version (18K):
[in a new window]
Fig. 3.
A suppressive effect of TEI-9647 was observed
in plasmid constructs which contain a GAL4 DNA-binding domain and GAL4
binding site. A, schematic illustration of pM-VDR and
pM-VDRdDBD. The human VDR cDNA was inserted at the EcoRI
site of pM vector, which contains a GAL4 DNA-binding domain (pM-VDR).
The digestion of the human VDR cDNA with NaeI and
EcoRI deleted the DNA-binding domain of the VDR, and the
remaining cDNA was inserted in the pM vector (pM-VDRdDBD). The
amino acids generated by the procedure to make the fusion protein are
described by a single letter. The amino acid
number is designated according to the original paper describing the
human VDR cDNA (44). B. TEI-9647 significantly suppressed the
effect of 1
,25(OH)2D3 via pM-VDR on the
promoter activity in Saos-2 cells. The reporter plasmid containing the
SV40 promoter and GAL4 binding sites (pGVP2-GAL4BS), the pM-VDR, and
-gal expression vector were introduced in Saos-2 cells. Vehicle
(control), 10
8 M
1
,25(OH)2D3, 10
7 M
TEI-9647, or both (1
,25(OH)2D3 + TEI-9647)
were added after the transfection. Data are expressed as the mean ± S.E. * and ** represent p < 0.005 and p < 0.05, respectively, compared with activity
induced by 10
8 M
1
,25(OH)2D3 alone. C, TEI-9647
did not suppress the effect of 1
,25(OH)2D3
via pM-VDR on the promoter activity in HeLa cells. The same plasmids
described in B were introduced in HeLa cells. Vehicle
(control), 10
8 M
1
,25(OH)2D3, 10
7 M
TEI-9647, or both (1
,25(OH)2D3 + TEI-9647)
were added after the transfection. Data are expressed as the mean ± S.E. * represents p < 0.0001 compared with activity
induced by 10
8 M
1
,25(OH)2D3 alone.
fused to GAL4DBD (pM-RXR
) and the
human VDR (pSG5-hVDR). 10
8 M
1
,25(OH)2D3 induced the heterodimer
formation between the VDR and RXR
as indicated by the reporter
activity and 10
7 M TEI-9647 significantly
inhibited the heterodimer formation in Saos-2 cells (Fig.
4A). In contrast, no
suppression against the effect of 10
8 M
1
,25(OH)2D3 was exerted by 10
7
M TEI-9647 in HeLa cells (Fig. 4B).

View larger version (25K):
[in a new window]
Fig. 4.
TEI-9647 reduces the interaction between VDR
and RXR in Saos-2 cells, but not in HeLa cells. The human RXR
cDNA was inserted at the EcoRI site of the pM vector,
which contains a GAL4 DNA-binding domain (pM-RXR
). The interaction
between VDR and RXR was examined by determining the reporter activity
in Saos-2 (A) or HeLa (B) cells transfected with
pM-RXR
, pSG5-hVDR, and the reporter plasmid containing the GAL4
binding sites (pGVP2-GAL4BS). Vehicle (control), 10
8
M 1
,25(OH)2D3, 10
7
M TEI-9647, or both (1
,25(OH)2D3 + TEI-9647) were added after the transfection. Data are expressed as
the mean ± S.E. * and ** represent p < 0.001 and
p < 0.01, respectively, compared with activity induced
by 10
8 M
1
,25(OH)2D3 alone (A). *
represents p < 0.005 compared with activity induced by
10
8 M 1
,25(OH)2D3
alone (B).
8
M 1
,25(OH)2D3 or
10
7 M TEI-9647 increased the intensity of the
complex, and 10
7 M TEI-9647 did not impair
this effect of 10
8 M
1
,25(OH)2D3 in COS-7 cells. Essentially the
same results were observed in Saos-2 cells, although the enhancing
effect of 1
,25(OH)2D3 was not as high as in
COS-7 cells, making it difficult to examine the antagonistic effect of
TEI-9647.

View larger version (112K):
[in a new window]
Fig. 5.
The DNA binding of VDR to VDRE was not
affected by TEI-9647. The effect of TEI-9647 on the binding of the
VDR/RXR to DR3-type VDRE was examined in EMSA. Recombinant VDR (45) or
cell lysates of untransfected COS-7 cells or cells transfected with VDR
expression vector were mixed with 32P-labeled double-strand
oligonucleotides containing DR3-type VDRE sequence, and electrophoresed
on 5% native polyacrylamide gel. Ligand was added to cells 5 h
before the harvest. Lane 1, without transfection
of VDR expression vector; lanes 2-5, with
transfection of VDR (lane 2, vehicle;
lane 3, 10
8 M
1
,25(OH)2D3; lane 4,
10
7 M TEI-9647; lane 5,
10
8 M 1
,25(OH)2D3 + 10
7 M TEI-9647; lane
6, vehicle + recombinant VDR; lane 7,
recombinant VDR and RXR.
8 M
1
,25(OH)2D3 induced the interaction between
the VDR and SRC-1, as indicated by the reporter activity and
10
7 M TEI-9647 significantly inhibited the
heterodimer formation in Saos-2 cells (Fig.
6).

View larger version (21K):
[in a new window]
Fig. 6.
TEI-9647 reduced the interaction between VDR
and SRC-1. The SRC-1 cDNA was inserted at the EcoRI
site of the pM vector, which contains a GAL4 DNA-binding domain
(pM-SRC-1). The interaction of VDR and SRC-1 was examined by studying
the reporter activity in Saos-2 cells transfected with pM-SRC-1,
pVP16-hVDR, and the reporter plasmid containing the GAL4 binding sites
(pGVP2-GAL4BS). Vehicle (control), 10
8 M
1
,25(OH)2D3, 10
7 M
TEI-9647, or both (1
,25(OH)2D3 + TEI-9647)
were added after the transfection. Data are expressed as the mean ± S.E. * represents p < 0.05 compared with activity
induced by 10
8 M
1
,25(OH)2D3 alone.
8 M
1
,25(OH)2D3 shifted the VDR to the nucleus
of COS-7 cells (Fig. 7, A and
B). TEI-9647 also facilitated the localization of the VDR to
nuclei, but did not block the effect of
1
,25(OH)2D3 (Fig. 7, C and
D). The results were the same when pGreen Lantern-hVDR was
introduced into Saos-2 cells. The fusion of GFP and the VDR was
confirmed by Western blotting using monoclonal antibody 9A7
against
the VDR and anti-GFP antibody (Roche Molecular Biochemicals; data not
shown).

View larger version (63K):
[in a new window]
Fig. 7.
TEI-9647 did not affect the nuclear
localization of VDR. The VDR was visualized in living COS-7 cells
by the construction of a fusion protein of VDR and GFP (GFP-VDR).
10
8 M 1
,25(OH)2D3,
10
7 M TEI-9647, or both were added 24 h
after the transfection, and the cells were observed by fluorescence
microscopy 3 h after the addition. A, vehicle;
B, 10
8 M
1
,25(OH)2D3; C, 10
7
M TEI-9647; D, both.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
,25(OH)2D3 (15). Although such differentiation of HL-60 cells was speculated to be mediated by the
VDR, we have presented direct evidence that TEI-9647 antagonizes the
action of the VDR induced by 1
,25(OH)2D3,
and further studied the mechanism of this antagonistic effect of
TEI-9647 in other types of cells.
7 to 10
9 M TEI-9647 inhibited
the transactivation effect of 10
8 M
1
,25(OH)2D3 dose-dependently in
the reporter system using the VDREs of the human 24-hydroxylase gene in
Saos-2 cells. The binding affinity of TEI-9647 for the VDR was
one-tenth of that of 1
,25(OH)2D3, and
10
9 M and 10
7 M
TEI-9647 significantly inhibited the function of
1
,25(OH)2D3 by 41% and 74%, respectively.
These results suggest that the antagonistic effect of TEI-9647 was more
efficient than the simple competitive inhibition of binding to the
ligand-binding domain of the VDR, and confirm that TEI-9647 is the
first ligand for the VDR to have an antagonistic effect on the
VDR-mediated action of 1
,25(OH)2D3. Although
1
,25(OH)2D3 was reported to be a potent
antagonist of the non-genomic action of
1
,25(OH)2D3 such as transcaltachia and
45Ca2+ uptake (28), no antagonists of the
genomic action of 1
,25(OH)2D3 have been
reported to date.
,25(OH)2D3 exerts its effect via the VDR
through multi-step events; first binding to the VDR, then forming a
heterodimer with RXR, binding to the VDRE and interacting with a
coactivator. To investigate the interaction of the VDR with RXR
, we
used the modified mammalian two-hybrid system with the VDR expression
vector, pSG5-VDR, and the plasmid construct expressing GAL4 DBD fused to RXR
. In our experiments, 10
8 M
1
,25(OH)2D3 enhanced the direct interaction
between the VDR and RXR
5-fold as indicated by the reporter
activity, and the result was consistent with data reported previously
(29, 30). A 10 M excess of TEI-9647 markedly inhibited the
interaction between the VDR and RXR
induced by
1
,25(OH)2D3 in Saos-2 cells, suggesting that
one of the mechanisms for the antagonistic effect of TEI-9647 on the
function of 1
,25(OH)2D3 is reduced
interaction between the VDR and RXR. In contrast, the interaction of
the VDR with RXR was not affected in HeLa cells. The interaction of VDR
and RXR was previously investigated in a yeast two-hybrid system, and a
close correlation was found between the ability to activate transcription and the degree of heterodimerization of VDR-RXR liganded
with several vitamin D analogues (31). The binding of VDR-RXR complex
to a VDRE was detected in EMSA even with the addition of TEI-9647,
suggesting that binding of VDR to RXR was not blocked by the metabolite
despite the inhibitory effect of TEI-9647 on the enhancement by
1
,25(OH)2D3 of the interaction between VDR
and RXR.
,25(OH)2D3 and TEI-9647 as suggested by
studies using other vitamin D analogues (22, 33, 34).
with pSG5-hVDR in HeLa cells (Figs. 3C and
4B). Thus, TEI-9647 appears to be a weaker antagonist in
HeLa cells than in Saos-2 cells because of the difference in the number
of inhibitory steps. In general, an antagonist exerts its effect in a
manner that is either ubiquitous (a pure antagonist) or tissue-specific (a partial antagonist). Representative analogues of estrogen are tamoxifen and raloxifene, tissue-specific antagonists and agonists referred to as SERMs, or selective estrogen receptor modulators (35,
36). TEI-9647 showed tissue-specific antagonism in vitro; the effect was marked in Saos-2 cells, MG-63 cells, and HL-60 cells
(this paper and Ref. 15), and weak in HeLa and COS-7 cells where it
acts as a weak agonist. The difference in the inhibitory activity may
explain the difference in the efficiency of the antagonism in various
cells. The precise mechanism of partial antagonism remains to be
elucidated, but the balance of coactivator and corepressor regulation
or some regulating factors such as L7/SPA may be involved in the
tissue-specific activity of the antagonist (37, 38). In addition, the
antagonism at various stages of the receptor function required for
activation of transcription may contribute to the marked inhibitory effect.
8 M
1
,25(OH)2D3 accelerated the nuclear transfer
of VDR in a few hours. The nuclear translocation of VDR was not
affected by addition of TEI-9647 in COS-7 and Saos-2 cells. These
results are consistent with the finding that TEI-9647 is not a pure
antagonist of 1
,25(OH)2D3, because estrogen
receptor liganded by pure antagonist is reported to be localized in the
cytoplasm (43).
,25(OH)2D3. The extent of
the antagonism of TEI-9647 differed between cells. The inhibitory
action of TEI-9647 against the interaction between VDR and SRC-1 as
well as between VDR and RXR contributes to the antagonistic effect in
Saos-2 cells.
![]()
ACKNOWLEDGEMENTS
expression vectors and
SRC-1 expression vector, respectively. We also thank Dr. Y. Ohyama
(Hiroshima University) for providing clone including rat 24-hydroxylase
gene promoter. We gratefully acknowledge Chika Shimizu and Noriko Tsuda
for excellent technical assistance, and Tomoko Hayashi for secretarial help.
![]()
FOOTNOTES
Present address: Dept. of Pediatrics, Faculty of Medicine,
Osaka University, Osaka 565-0871, Japan.
![]()
ABBREVIATIONS
, 25(OH)2D3, 1
,25-dihydroxyvitamin
D3;
VDR, vitamin D receptor;
VDRE, vitamin D response
element;
DBD, DNA-binding domain;
EMSA, electrophoretic mobility shift
assay;
RXR, retinoid X receptor;
GFP, green fluorescent protein;
SRC-1, steroid receptor coactivator-1;
-gal,
-galactosidase.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Haussler, M. R.,
Whitfield, G. K.,
Haussler, C. A.,
Hsieh, J-C.,
Thompson, P. D.,
Selznick, S. H.,
Dominguez, C. E.,
and Jurutka, P. W.
(1998)
J. Bone Miner. Res.
13,
325-349[CrossRef][Medline]
[Order article via Infotrieve]
2.
Pike, J. W.
(1997)
in
Vitamin D
(Feldman, D.
, Glorieux, F. H.
, and Pike, J. W., eds)
, pp. 105-125, Academic Press, San Diego
3.
Evans, R. M.
(1988)
Science
240,
889-895 4.
Mangelsdorf, D. J.,
Thummel, C.,
Beato, M.,
Herrlich, P.,
Schütz, G.,
Umesono, K.,
Blumberg, B.,
Kastner, P.,
Mark, M.,
Chambon, P.,
and Evans, R. M.
(1995)
Cell
83,
835-839[CrossRef][Medline]
[Order article via Infotrieve]
5.
Kliewer, S. A.,
Umesono, K.,
Mangelsdorf, D. J.,
and Evans, R. M.
(1992)
Nature
355,
446-449[CrossRef][Medline]
[Order article via Infotrieve]
6.
Norman, A. W.
(1998)
J. Bone Miner. Res.
13,
1360-1369[CrossRef][Medline]
[Order article via Infotrieve]
7.
Hughes, M. R.,
Malloy, P. J.,
Kieback, D. G.,
Kesterson, R. A,
Pike, J. W.,
Feldman, D.,
and O'Malley, B. W.
(1988)
Science
242,
1702-1705 8.
Yoshizawa, T.,
Handa, Y.,
Uematsu, Y.,
Takeda, S.,
Sekine, K.,
Yoshihara, Y.,
Kawakami, T.,
Arioka, K.,
Sato, H.,
Uchiyama, Y.,
Masushige, S.,
Fukamizu, A.,
Matsumoto, T.,
and Kato, S.
(1997)
Nat. Genet.
16,
391-396[CrossRef][Medline]
[Order article via Infotrieve]
9.
Li, Y. C.,
Pirro, A. E.,
Amling, M.,
Delling, G.,
Baron, R.,
Bronson, R.,
and Demay, M. B.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
9831-9835 10.
Lemon, B. D.,
Fondell, J. D.,
and Freedman, L. P.
(1997)
Mol. Cell. Biol.
17,
1923-1937[Abstract]
11.
Masuyama, H.,
Brownfield, C. M.,
St-Arnaud, R.,
and MacDonald, P. N.
(1997)
Mol. Endocrinol.
11,
1507-1517 12.
Nakajima, S.,
Yamagata, M.,
Sakai, N.,
and Ozono, K.
(1998)
Mol. Cell. Endocrinol.
139,
15-24[CrossRef][Medline]
[Order article via Infotrieve]
13.
Bouillon, R.,
Okamura, W. H.,
and Norman, A. W.
(1995)
Endocr. Rev.
16,
200-257[CrossRef][Medline]
[Order article via Infotrieve]
14.
Dusso, A. S.,
Negrea, L.,
Gunawardhana, S.,
Lopez-Hilker, S.,
Finch, J.,
Mori, T.,
Nishii, Y.,
Slatopolsky, E.,
and Brown, A. J.
(1991)
Endocrinology
128,
1687-1692[Abstract]
15.
Miura, D.,
Manabe, K.,
Ozono, K.,
Saito, M.,
Gao, Q.,
Norman, A. W.,
and Ishizuka, S.
(1999)
J. Biol. Chem.
274,
16392-16399 16.
Vegeto, E.,
Allan, G. F.,
Schrader, W. T.,
Tsai, M.-J.,
McDonnell, D. P.,
and O'Malley, B. W.
(1992)
Cell
69,
703-713[CrossRef][Medline]
[Order article via Infotrieve]
17.
Kraus, W. L.,
Weis, K. E.,
and Katzenellenbogen, B. S.
(1995)
Mol. Cell. Biol.
15,
1847-1857[Abstract]
18.
Lee, M. O.,
Dawson, M. I.,
Picard, N.,
Hobbs, P. D.,
and Pfahl, M.
(1996)
J. Biol. Chem.
271,
11897-11903 19.
Lala, D. S.,
Mukherjee, R.,
Schulman, I. G.,
Koch, S. S. C.,
Dardashti, L. J.,
Nadzan, A. M.,
Croston, G. E.,
Evans, R. M.,
and Heyman, R. A.
(1996)
Nature
383,
450-453[CrossRef][Medline]
[Order article via Infotrieve]
20.
Brzozowski, A. M.,
Pike, A. C. W.,
Dauter, Z.,
Hubbard, R. E.,
Bonn, T.,
Engström, O.,
Öhman, L.,
Greene, G. L.,
Gustafsson, J.-Å.,
and Carlquist, M.
(1997)
Nature
389,
753-758[CrossRef][Medline]
[Order article via Infotrieve]
21.
Grese, T. A.,
Sluka, J. P.,
Bryant, H. U.,
Cullinan, G. J.,
Glasebrook, A. L.,
Jones, C. D.,
Matsumoto, K.,
Palkowitz, A. D.,
Sato, M.,
Termine, J. D.,
Winter, M. A.,
Yang, N. N.,
and Dodge, J. A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
14105-14110 22.
Takeyama, K.,
Masuhiro, Y.,
Fuse, H.,
Endoh, H.,
Murayama, A.,
Kitanaka, S.,
Suzawa, M.,
Yanagisawa, J.,
and Kato, S.
(1999)
Mol. Cell. Biol.
19,
1049-1055 23.
Chen, K.-S.,
and DeLuca, H. F.
(1995)
Biochim. Biophys. Acta
1263,
1-9[Medline]
[Order article via Infotrieve]
24.
Ohyama, Y.,
Ozono, K.,
Uchida, M.,
Yoshimura, M.,
Shinki, T.,
Suda, T.,
and Yamamoto, O.
(1996)
J. Biol. Chem.
271,
30381-30385 25.
Nakajima, S.,
Hsieh, J.-C.,
MacDonald, P. N.,
Galligan, M. A.,
Haussler, C. A.,
Whitfield, G. K.,
and Haussler, M. R.
(1994)
Mol. Endocrinol.
8,
159-172[Abstract]
26.
Oñate, S. A.,
Tsai, S. Y.,
Tsai, M. J.,
and O'Malley, B. W.
(1995)
Science
270,
1354-1357 27.
Ohyama, Y.,
Ozono, K.,
Uchida, M.,
Shinki, T.,
Kato, S.,
Suda, T.,
Yamamoto, O.,
Noshiro, M.,
and Kato, Y.
(1994)
J. Biol. Chem.
269,
10545-10550 28.
Norman, A. W.,
Bouillon, R.,
Farach-Carson, M. C.,
Bishop, J. E.,
Zhou, L. X.,
Nemere, I.,
Zhao, J.,
Muralidharan, K. R.,
and Okamura, W. H.
(1993)
J. Biol. Chem.
268,
20022-20030 29.
Sone, T.,
Ozono, K.,
and Pike, J. W.
(1991)
Mol. Endocrinol.
5,
1578-1586[Abstract]
30.
MacDonald, P. N.,
Dowd, D. R.,
Nakajima, S.,
Galligan, M. A.,
Reeder, M. C.,
Haussler, C. A.,
Ozato, K.,
and Haussler, M. R.
(1993)
Mol. Cell. Biol.
13,
5907-5917 31.
Zhao, X.-Y.,
Eccleshall, T. R.,
Krishnan, A. V.,
Gross, C.,
and Feldman, D.
(1997)
Mol. Endocrinol.
11,
366-378 32.
Gill, R. K.,
Atkins, L. M.,
Hollis, B. W.,
and Bell, N. H.
(1998)
Mol. Endocrinol.
12,
57-65 33.
van den Bemd, G.-J. C. M.,
Pols, H. A. P.,
Birkenhäger, J. C.,
and van Leeuwen, J. P. T. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10685-10690 34.
Peleg, S.,
Nguyen, C.,
Woodard, B. T.,
Lee, J.-K.,
and Posner, G. H.
(1998)
Mol. Endocrinol.
12,
525-535 35.
McDonnell, D. P.,
Clemm, D. L.,
Hermann, T.,
Goldman, M. E.,
and Pike, J. W.
(1995)
Mol. Endocrinol.
9,
659-669[Abstract]
36.
MacGregor, J. I.,
and Jordan, V. C.
(1998)
Pharmacol. Rev.
50,
151-196 37.
Smith, C. L.,
Nawaz, Z.,
and O'Malley, B. W.
(1997)
Mol. Endocrinol.
11,
657-666 38.
Jackson, T. A.,
Richer, J. K.,
Bain, D. L.,
Takimoto, G. S.,
Tung, L.,
and Horwitz, K. B.
(1997)
Mol. Endocrinol.
11,
693-705 39.
Clemens, T. L.,
Garrett, K. P.,
Zhou, X.-Y.,
Pike, J. W.,
Haussler, M. R.,
and Dempster, D. W.
(1988)
Endocrinology
122,
1224-1230[Abstract]
40.
Barsony, J.,
Renyi, I.,
and McKoy, W.
(1997)
J. Biol. Chem.
272,
5774-5782 41.
Hsieh, J.-C.,
Shimizu, Y.,
Minoshima, S.,
Shimizu, N.,
Haussler, C. A.,
Jurutka, P. W.,
and Haussler, M. R.
(1998)
J. Cell. Biochem.
70,
94-109[CrossRef][Medline]
[Order article via Infotrieve]
42.
Michigami, T.,
Shimizu, C.,
Suga, A.,
and Ozono, K.
(1998)
Bone
23,
S257[CrossRef] (abstr.)
43.
Devin-Leclerc, J.,
Meng, X.,
Delahaye, F.,
Leclerc, P.,
Baulieu, E.-E.,
and Catelli, M.-G.
(1998)
Mol. Endocrinol.
12,
842-854 44.
Baker, A. R.,
McDonnell, D. P.,
Hughes, M.,
Crisp, T. M.,
Mangelsdorf, D. J.,
Haussler, M. R.,
Pike, J. W.,
Shine, J.,
and O'Malley, B. W.
(1988)
Proc. Natl. Acad Sci. U. S. A.
85,
3294-3298 45.
Nakajima, S.,
Yanagihara, I.,
and Ozono, K.
(1997)
Biochem. Biophys. Res. Commun.
232,
806-809[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
Y. Inaba, K. Yamamoto, N. Yoshimoto, M. Matsunawa, S. Uno, S. Yamada, and M. Makishima Vitamin D3 Derivatives with Adamantane or Lactone Ring Side Chains are Cell Type-Selective Vitamin D Receptor Modulators Mol. Pharmacol., May 1, 2007; 71(5): 1298 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nijenhuis, B. C. J. van der Eerden, U. Zugel, A. Steinmeyer, H. Weinans, J. G. J. Hoenderop, J. P. T. M. van Leeuwen, and R. J. M. Bindels The novel vitamin D analog ZK191784 as an intestine-specific vitamin D antagonist FASEB J, October 1, 2006; 20(12): 2171 - 2173. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ochiai, D. Miura, H. Eguchi, S. Ohara, K. Takenouchi, Y. Azuma, T. Kamimura, A. W. Norman, and S. Ishizuka Molecular Mechanism of the Vitamin D Antagonistic Actions of (23S)-25-Dehydro-1{alpha}-Hydroxyvitamin D3-26,23-Lactone Depends on the Primary Structure of the Carboxyl-Terminal Region of the Vitamin D Receptor Mol. Endocrinol., May 1, 2005; 19(5): 1147 - 1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ishizuka, N. Kurihara, S. V. Reddy, J. Cornish, T. Cundy, and G. D. Roodman (23S)-25-Dehydro-1{alpha}-Hydroxyvitamin D3-26,23-Lactone, a Vitamin D Receptor Antagonist that Inhibits Osteoclast Formation and Bone Resorption in Bone Marrow Cultures from Patients with Paget's Disease Endocrinology, April 1, 2005; 146(4): 2023 - 2030. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ismail, C. V. Nguyen, A. Ahene, J. C. Fleet, M. R. Uskokovic, and S. Peleg Effect of Cellular Environment on the Selective Activation of the Vitamin D Receptor by 1{alpha},25-Dihydroxyvitamin D3 and Its Analog 1{alpha}-Fluoro-16-Ene-20-Epi-23-Ene-26,27-Bishomo-25-Hydroxyvitamin D3 (Ro-26-9228) Mol. Endocrinol., April 1, 2004; 18(4): 874 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Peleg, M. Uskokovic, A. Ahene, B. Vickery, and Z. Avnur Cellular and Molecular Events Associated with the Bone-Protecting Activity of the Noncalcemic Vitamin D Analog Ro-26-9228 in Osteopenic Rats Endocrinology, May 1, 2002; 143(5): 1625 - 1636. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Toell, M. M. Gonzalez, D. Ruf, A. Steinmeyer, S. Ishizuka, and C. Carlberg Different Molecular Mechanisms of Vitamin D3 Receptor Antagonists Mol. Pharmacol., June 1, 2001; 59(6): 1478 - 1485. [Abstract] [Full Text] |
||||
![]() |
S. Ishizuka, D. Miura, K. Ozono, M. Chokki, H. Mimura, and A. W. Norman Antagonistic Actions in Vivo of (23S)-25-Dehydro-1{{alpha}}-Hydroxyvitamin D3-26,23-Lactone on Calcium Metabolism Induced by 1{{alpha}},25-Dihydroxyvitamin D3 Endocrinology, January 1, 2001; 142(1): 59 - 67. |