![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 46, 32803-32809, November 12, 1999
,From the Diabetes Research Center, Vrije Universiteit Brussel, Brussels, B-1090 Belgium
| |
ABSTRACT |
|---|
|
|
|---|
Transgenic or tumoral pancreatic
islet beta cells with enhanced expression of low Km
hexokinases (HK) exhibit a leftward shift of the normal dose-response
curve for glucose-induced insulin release. Furthermore, HK catalyzes
roughly 50% of total glucose phosphorylation measured in extracts from
freshly isolated rodent islets, suggesting that HK participates in the
process of glucose sensing in beta cells. We previously observed that
HK activity represents 20% of total glucose phosphorylation in
purified rat beta cell preparations and that HK is not homogenously
distributed over these cells. The present study provides several
arguments for the idea that HK detected in freshly isolated rat islets
or islet cell preparations originates mainly from contaminating
exocrine cells. First, reverse transcriptase-polymerase chain reaction using isoform-specific primers allowed detection of hexokinase I and IV
mRNA in rat beta cells, whereas the messenger levels encoding the
hexokinase II and III isoforms were undetectably low. However,
immunoblots indicated that hexokinase I protein was 10-fold more
abundant in freshly isolated islets and flow-sorted exocrine cells than
in purified rat beta cell preparations. Second, comparison of HK
activity in the different pancreatic cell types resulted in 15-25-fold
higher values in exocrine than in endocrine cells (acinar cells:
21 ± 3 pmol of glucose 6-phosphate formed/h/ng of DNA; duct
cells: 30 ± 8 pmol/h/ng of DNA; islet beta cells: 1.2 ± 0.2 pmol/h/ng DNA; alpha cells: 0.9 ± 0.4 pmol/h/ng of DNA). Since
freshly purified beta cell preparations contain 3 ± 1% exocrine cells, at least 50% of their HK activity can be accounted for by
exocrine contamination. Third, after 5 days of culture of purified islet beta cells, both HK activity and the proportion of exocrine cells
decreased by more than 1 order of magnitude, while the ratio of
glucokinase over hexokinase activity increased more than 10-fold. Finally, preincubating the cells with 50 mmol/liter 2-deoxyglucose did
not affect glucose stimulation of insulin biosynthesis and release. In
conclusion, the observation that pancreatic exocrine cells are
responsible for a major part of HK activity in islet cell preparations
cautions against the use of HK measurements in islet extracts in the
study of these enzymes in glucose sensing by pancreatic beta cells.
Differentiated pancreatic beta cells isolated from both rodents
(1) and man (2) possess the capacity to rapidly respond to changes in
extracellular glucose concentration between 3 and 20 mmol/liter with
adapted rates of proinsulin biosynthesis and insulin release. In
addition to the rapid onset of these cellular processes, both the
inactivity at basal glucose (below 3 mmol/liter) and the steep
concentration-dependent activation at glucose levels between 5 and 10 mmol/liter are considered important aspects of the
glucose-regulation of beta cells (3). It is well known that such
regulatory properties of glucose proceed via metabolic steps in beta
cells, comprising the uptake and phosphorylation of the sugar (4).
Phosphorylation in islets is mediated by two classes of isoenzymes (5,
6), hexokinases I-III (HK)1
and glucokinase (GK), which can be distinguished biochemically by their
molecular mass, enzyme kinetics, and allosteric properties (7). The
concept that GK plays a crucial physiological role in glucose
recognition by mammalian beta cells has been documented extensively
(for review, see Ref. 3). Furthermore, genetically determined
abnormalities in GK structure or protein expression levels are the
cause of abnormal insulin secretion caused by abnormal threshold
concentration for glucose-stimulated insulin release, both in
transgenic animals (8) and man (9, 10). Depending on the shift of such
threshold, these mutations can be the cause of diabetes (8, 9) or
familial hyperinsulinism (10).
Strikingly, in extracts of mouse (5, 6) and rat (11) islets, at least
50% of total glucose phosphorylation seems to be catalyzed by HK. On
basis of this high activity on the one hand and because of the
observation that up-regulation of hexokinase expression in tumoral or
transgenic beta cells causes a leftward shift of the normal
concentration-dependent activation of glucose-induced insulin release on the other hand (12, 13), the possibility has been
considered that low Km hexokinases influence the
process of glucose sensing, for instance, by decreasing the threshold
for glucose-induced insulin release or increasing insulin secretion at
basal plasma glucose levels. Four studies may be interpreted along this
view. First, Heimberg et al. (14) noted that hexokinase
activity was associated with a rat beta cell subset with high
sensitivity to glucose, prepared by fluorescence-activated cell sorting
(FACS) on the basis of glucose-induced changes in NAD(P)H
autofluorescence (15), which could indicate that low Km glucose phosphorylation sets the threshold point
for glucose-induced beta cell activation. Second, Hosokawa et
al. (16) observed that islets isolated from 90% pancreatectomized rats exhibited more than 2-fold up-regulation of hexokinase expression which was associated with a moderate shift to the left of the dose-response curve of glucose-induced insulin release. Third, Rabuazzo
et al. (17) showed that 3-h exposure of rat islets to 16.7 mmol/liter glucose caused both translocation of islet-associated hexokinase I protein from a cytosolic pool to the outer mitochondrial membrane and leftward shift of the concentration-dependent
activation of glucose-induced insulin release. The correlation between
the two events led to the suggestion that glucose-induced
redistribution of hexokinase I in beta cells contributes to glucose
regulation of insulin secretion (17). Fourth, in a model of conditional knockout of the rat islet glucokinase gene, Piston et al.
(18) recently observed some residual glucose-induced shift in NAD(P)H autofluorescence in the subset of islet beta cells that recombined both
GK alleles, indirectly suggesting the participation of HK in glucose
metabolism of these cells.
A number of observations are more difficult to reconcile with the idea
that HK is important in the process of glucose recognition by beta
cells. First, low Km glucose phosphorylation in
islet extracts occurs much more rapidly than low Km glucose utilization in whole islets, suggesting that intracellular mediators such as glucose 6-phosphate and glucose 1,6-bisphosphate repress most islet HK allosterically (19). Second, HK activity on the
one hand and insulin release on the other could be dissociated from
each other by maintaining rat islets in tissue culture, the former
disappearing almost completely after 5 days of culture, whereas the
latter could be well preserved (20, 21). Third, HK is undetectably low
(14) in the subset of the beta cells that was flow-sorted on the basis
of a low glucose-induced shift in NAD(P)H autofluorescence at 7.5 mM glucose (approximately 50% of the cells, Ref. 15).
Altogether, the concept that HK is required together with GK for normal
glucose regulation is controversial and still insufficiently documented. We have therefore assessed in the present study mRNA expression of different hexokinase isoforms as well as hexokinase I
protein abundance and HK enzymatic activity in FACS-purified rat
pancreatic cell populations. Our results show that both acinar cells
and ducts of the exocrine pancreas which are co-isolated with the
islets of Langerhans and contaminate to a minor extent the
FACS-purified beta cells, express hexokinase-I at very high levels. As
a consequence, when this factor is not taken into account, major
artifacts are introduced in the study of HK and its role in glucose
regulation of beta cells.
Cell Isolation and Purification--
Pancreata were isolated
from adult male Wistar rats (proefdiercentrum Heverlee, Belgium) which
were bred according to Belgian regulations of animal welfare. Islets of
Langerhans were prepared in isolation medium (123 mmol/liter NaCl, 5.4 mmol/liter KCl, 1.8 mmol/liter CaCl2, 4.2 mmol/liter
NaHCO3, 0.8 mmol/liter MgSO4, 10 mmol/liter
HEPES, 5.6 mmol/liter glucose, 0.01% kanamycin, and 0.25% bovine
serum albumin (BSA), pH 7.4) using a modified collagenase technique
which has been described (22). The freshly isolated islets were
dissociated into dispersed islet cells (23) using dissociation medium
(123 mmol/liter NaCl, 5.4 mmol/liter KCl, 4.2 mmol/liter
NaHCO3, 0.8 mmol/liter MgSO4, 10 mmol/liter HEPES, 1 mmol/liter EGTA, 5.6 mmol/liter glucose, and 0.5% BSA, pH
7.4) containing trypsin (final concentration 25 µg/ml) and DNase (2 µg/ml). Islet beta cells were FACS purified from endocrine non-beta
cells via autofluorescence-activated cell sorting at 2.8 mmol/liter
glucose (22) on the basis of FAD/scatter using an argon laser (Spectra
Physics, Mountain View, Ca) at 488 nm (excitation) and 510-550 nm
(emission). In some experiments, the flow-sorted total beta cell
population was further subdivided into beta cell subsets on basis of
low and high NAD(P)H autofluorescence at 2.8 mmol/liter glucose (15),
using a UV-laser (351-363 nm excitation/400-470 nm emission; Spectra
Physics). Analysis of the cellular composition of the sorted or
non-sorted islet cell preparations was performed by electron microscopy
and immunocytochemistry for pancreatic hormones as described previously
(22). For the determination of the percentage of exocrine cells in the
purified beta cell preparations, approximately 500 cells/sample were
counted in the electron microscopical analysis. To assess the effect of tissue culture on HK associated with flow-sorted rat beta cells, the
cells were cultured for 5 days in serum-free Ham's F-10 medium (Life
Technologies, Inc., Strathclyde, United Kingdom) containing 0.075 mg/ml
penicillin, 0.1 mg/ml streptomycin, 50 µmol/liter 3-isobutyl-1-methylxanthine, 1% (w/v) charcoal-extracted BSA (fraction V, RIA grade, Sigma), 2 mmol/liter glutamine, and 10 mmol/liter glucose
(24).
Pancreatic acinar cells were prepared from the total collagenase digest
of the pancreas and enriched by countercurrent elutriation (23) using
the cellular fraction with particle size below 100 µm. The elutriated
cell clumps were washed by two sedimentations, resuspended in isolation
medium and then cleared from debris and dead cells via sedimentation
through a Percoll layer of density 1.040. After one wash in isolation
medium and two washes in dissociation medium (250 g for 3 min), the
cells were preincubated for 10 min at 30 °C in dissociation medium
under continuous shaking. Enzymatic dissociation (23) was started by
addition of trypsin (final concentration 25 µg/ml) and DNase (2 µg/ml) and followed under a phase-contrast microscope. Dissociation
was stopped (median required time of 30 min) when 50-60% of the cells
occurred as single units. After three washes in isolation medium (250 g
for 3 min) the cells were filtered through a 5-µm nylon filter to remove undigested material and finally submitted to
autofluorescence-activated cell sorting at 2.8 mmol/liter glucose in
order to remove dead cells and cell debris. This isolation procedure
yielded a FACS-purified cell preparation with >90% acinar cells and
viability exceeding 95%.
Preparation of ducts from the countercurrent elutriation fraction with
particle size below 100 µm was performed according to a previously
published method (25). Isolated ducts were cultured for 7 days in
Ham's F-10 basal medium (Life Technologies, Inc., Gaithersburg, MD)
supplemented with 6 mmol/liter glucose, 2 mmol/liter L-glutamine, 1% BSA (fraction V, RIA grade, Sigma), 0.075 mg/ml penicillin (Sigma), 0.1 mg/ml streptomycin (Sigma), and 5%
heat-inactivated fetal calf serum. The cell density was 15 ducts per 3 ml in a bacteriological Petri dish.
Analysis of Amplified cDNA--
Total RNA (0.5 µg) was
extracted from beta cells and control tissues (brain, liver, and
muscle) reverse transcribed and amplified as described before (26) with
appropriate blanks in each assay. Specific primer sequences used for
PCR were as follows: hexokinase-I (5'-codon 17-23):
GACCAAGTCAAAAAGATTGA, hexokinase-I (3'-codon 95-102):
TCTTCTCGTGGTTCACCTGC, yielding an amplified fragment of 256 base pairs;
hexokinase-II (5'-codon 18-24): 5'-CAAGTGCAGAAGGTTGACCA, hexokinase-II
(3'-codon 18-24): 5'-CTCTGGAGGCCATTGTCCGT (259-base pair fragment);
hexokinase-III (5'-codon 12-18): 5'GACAAAGAGACTCAAGCTGC, hexokinase-III (3'-codon 106-112): 5'-CCCGTCAGTGTTACCCACAA (300-base pair fragment); glucokinase beta cell-specific variant (see Ref. 27:
5'-codon 9-15): 5'-AGGCCACCAAGAAGGAAAAG, glucokinase beta cell variant
(3'-codon 97-104): 5'-TTGTCTTCACGCTCCACTGC (288-base pair fragment).
As a control for the quality and quantity of the RNA, a primer mixture
(equimolar concentrations) recognizing the glucose transporters GLUT1,
GLUT2, and GLUT4 was used; the sequences of these primers were as
described before (26) yielding an amplified fragment of 540 base pairs.
The cycling profile for each of the PCR experiments was as follows: 2.5 min at 95 °C followed by 1 min at 94 °C, 1.5 min at 65 °C, and
1.5 min at 72 °C for 10 cycles and 0.5 min at 94 °C, 1 min at
60 °C, and 1.5 min at 72 °C for 20 cycles, bringing the total
number of cycles on 30. PCR products were controlled for their
nucleotide sequence by fluorescent cycle sequencing on an ABI
PrismTM 310 Genetic Analyzer (Perkin-Elmer Cetus,
Emeryville, CA).
Immunoblotting of Hexokinase-I, GK, and Measurement of Glucose Phosphorylation--
Glucose
phosphorylation was measured by a radiochemical assay (28). Cells or
ducts (2 × 103 cells/µl (beta cells) or 5 ng of
DNA/µl (acinar cells and ducts)) were homogenized via sonification in
20 mmol/liter HEPES buffer (pH 7.1) containing 50 mmol/liter KCl, 1 mmol/liter dithiothreitol, 0.5 mmol/liter EDTA, 20 µg/ml antipaine,
and 20 µg/ml leupeptin. The phosphorylation assay was started by
addition of 12.5 µl of cell homogenate to 12.5 µl of HEPES (40 mmol/liter) buffer (pH 7.1), containing 125 mmol/liter KCl, 1.5 mmol/liter dithiothreitol, 40 mmol/liter potassium fluoride, 0.75 mmol/liter EDTA, 10 mmol/liter Mg-ATP, 30 µg/ml antipaine, 30 µg/ml
leupeptin, 0.2 mg/ml BSA, and 0.125 µCi of
[U-14C]glucose in the presence of 0.5 or 20 mmol/liter
glucose. Glucose 6-phosphate (Glu-6-P, final concentration = 2.5 mmol/liter) was absent or present in order to distinguish between low
Km hexokinase (Glu-6-P-sensitive) and GK which is
Glu-6-P-insensitive and which exhibits a high
s0.5 value for glucose (3). After 90 min
incubation at 37 °C, the amount of reaction product was measured by
spotting duplicates of 10 µl of the incubation medium on DE-81 paper.
Non-phosphorylated glucose was removed by three washes in water
followed by one wash in ethanol and a final wash in ether.
Radioactivity bound to the paper was counted after mixing the dried
papers with liquid scintillation mixture (OptiPhase "Hisafe" II,
Wallac, Turku, Finland).
Insulin Biosynthesis and Release--
FACS-purified beta cells
were reaggregated for 1 h at 37 °C in Ham's F-10 medium
supplemented with 2 mmol/liter L-glutamine, 1% BSA
(fraction V, RIA grade), 0.075 mg/ml penicillin (Continental Pharma,
Brussels, Belgium), 0.1 mg/ml streptomycin (Laboratories Diamant,
Puteau, France), and 2 mmol/liter Ca2+ (basal medium)
supplemented with 10 mmol/liter glucose. Insulin release and proinsulin
biosynthesis were measured after 30 min preincubation in basal medium
plus 1 mmol/liter glucose (control condition) or basal medium
supplemented with 1 mmol/liter glucose and 50 mmol/liter 2-deoxyglucose
which is converted in the cells to 2-deoxyglucose 6-phosphate to
inhibit HK (29). After washing the cells three times in basal medium,
batches corresponding to 5 × 104 cells per condition
were incubated for 1 h at 37 °C in 200 µl of basal medium
with 0, 1, or 20 mmol/liter glucose either with or without 20 mmol/liter mannoheptulose and 50 µCi of
L-[3,5-3H]tyrosine (Amersham Pharmacia
Biotech), resulting in a final specific activity of 16.7 Ci/mmol and a
tyrosine concentration of 15 µmol/liter, in order to measure release
and biosynthesis from the same cells (24, 30).
DNA Measurements--
DNA was measured using Hoechst 33258 (22).
Duct cells and acinar cells were washed in calcium-free buffer
containing 150 mmol/liter NaCl, 15 mmol/liter citrate, and 3 mmol/liter
EDTA (pH 7.0) and extracted for 15 min at 37 °C in 100 mmol/liter
NaCl, 10 mmol/liter Tris, and 10 mmol/liter EDTA (pH 7.0). The
fluorimetric assay at 355 nm (excitation)/455 nm (emission) was carried
out after addition of Hoechst 33258 solution (100 ng/ml) to the samples.
Statistical Analysis--
Data are expressed as mean ± S.E. of n independent experiments. Unless stated otherwise,
the significance of differences between conditions was tested by
unpaired two-tailed Student's t test.
Amplification of Different Hexokinase Transcripts from Flow-sorted
Rat Pancreatic Cells--
We first assessed the abundance of various
hexokinase transcripts in FACS-purified beta cells, using
isoform-specific primer sets and taking total RNA extracted from rat
brain, liver, and muscle as positive and negative controls. The
amplification reaction utilizing the GK-primer set from which the
5'-primer is directed against beta cell-specific codons 9-15 of
GK-mRNA, resulted in the expected (27, 31) 288-base pair fragment
when RNA was used from flow-sorted rat beta cells (Fig.
1). Moreover, the same primers gave
negative results starting from rat liver RNA (Fig. 1). RNA extracted
from FACS-purified rat beta cell preparations appeared also positive
for hexokinase-I messenger, since with hexokinase-I-specific primers a
PCR product of the same length and nucleotide sequence could be
amplified as when the reaction was performed with rat brain RNA. On the
contrary, amplification of hexokinase-II or -III cDNA fragments was
negative when starting from rat beta cell RNA, while rat muscle and
liver, respectively, gave positive results.
Detection of Hexokinase-I and GK Protein in Rat Pancreatic Cell
Preparations--
To determine whether the hexokinase-I mRNA that
was detected in flow-sorted rat beta cells is translated, we performed
immunoblots starting from total protein from collagenase-isolated rat
islets as well as from purified beta cells and exocrine acinar cells (Fig. 2). In freshly purified beta cells,
the hexokinase-I abundance appeared low, at least 10-fold less abundant
than in freshly isolated islets of Langerhans: the OD ratios
normalized for Glucose Phosphorylation in Endocrine and Exocrine Pancreas--
To
assess the functional integrity of HK and GK protein, we measured
glucose phosphorylation in FACS-purified beta and alpha cells as well
as in purified pancreatic acinar and ductal cells (Table
I). In agreement with the protein blots,
HK activity, when expressed per microgram of cellular DNA, was at least
1 order of magnitude higher in exocrine pancreas (both ducts and acinar cells) than in flow-sorted islet beta and alpha cells. Since the examined beta cell preparations were contaminated by 2.6 ± 0.7% acinar cells (mean ± S.E.; n = 15) and 0.6 ± 0.2% non-granulated cells (mostly duct cells), the calculated
activity in beta cells after correction for the exocrine cell
contamination becomes 0.5 ± 0.1 pmol/h/ng DNA (mean ± S.E.;
n = 15). Therefore, about 60% of the HK activity
associated with FACS-purified beta cells can be accounted for by
exocrine cellular contamination rather than genuine HK expression in
the insulin-producing cells. This interpretation is further
strengthened by the linear correlation between the amount of HK
activity associated with 31 individual beta cell or islet cell
preparations on the one hand and the percentage contaminating acinar
cells in these preparations on the other hand (Fig.
3: r = 0.94;
p < 0.0001 in F-test). On the contrary, no such
correlation was observed between GK activity associated with beta cells
and acinar cell contamination (data not shown). By sorting the total
rat beta cell population on the basis of low and high NAD(P)H
autofluorescence at a particular glucose concentration (15), much
higher HK activity is found in the cellular subset with high NAD(P)H
than in that with low NAD(P)H (Ref. 14). When this experiment was
performed at 2.8 mmol/liter glucose, the FACS preparation corresponding
to high NAD(P)H autofluorescence contained preferentially the acinar
cells that were present in the total rat beta cell population (data not
shown); in this cellular fraction at least 10-fold more HK activity was
found than in the low beta cells which contained virtually no acinar
cells (Fig. 3). Please note that dissociated rat islet cells, analyzed
before flow sorting, contained both high HK activity (40 ± 3 pmol/h/1000 cells) and high percentage (20 ± 4) of contaminating
acinar cells, so that the data from these cells fitted to the other
data sets of Fig. 3. When extrapolated to a beta cell population devoid of acinar cells, the remaining hexokinase activity (approximately 3 pmol/h/103 cells) would represent less than 10% of the
mean GK activity present in purified beta cells (31 ± 2 pmol/h/103 cells; mean ± S.E.; n = 15).
To further investigate the cellular origin of HK in flow- sorted rat
beta cells, we compared freshly isolated and 5-day cultured beta cell
preparations in terms of hexokinase activity and acinar/duct cell
contamination. As was previously reported for whole
collagenase-isolated islets of Langerhans (20, 21), hexokinase activity
dropped dramatically, by roughly 95%, during tissue culture (Table
II), while the GK content of the cells
decreased nonsignificantly. Consequently, the GK/hexokinase ratio in
5-day cultured beta cell preparations was 1 order of magnitude higher
than in freshly isolated FACS-purified beta cells. This severe
reduction in HK was parallelled by a more than 95% decrease in the
number of surviving acinar cells (Table II).
In summary, these data suggest that the measured HK activity in
collagenase-isolated islets is influenced to a large extent by adherent
acinar cells. Even in FACS-purified rat beta cells, with acinar cell
contamination of less than 10%, at least half of the low
Km glucose phosphorylation can be attributed to this artifact.
Effect of 2-Deoxyglucose and Mannoheptulose on Glucose-induced
Insulin Release and Proinsulin Biosynthesis--
To examine the
possible functional relevance of any low Km glucose
phosphorylation that is present in these cells, we assessed the effect
of two well known inhibitors of HK on glucose-induced proinsulin
biosynthesis and insulin release. Mannoheptulose is known to block
competitively all hexokinases including GK (6). In contrast,
2-deoxyglucose inhibits only HK after the sugar is phosphorylated by
the cells to 2-deoxyglucose-6-phosphate (29). In control cells,
glucose-induced proinsulin biosynthesis and insulin release were not
responsive to 1 mmol/liter glucose, but were stimulated 15 ± 4 and 75 ± 15-fold, respectively, when medium glucose was raised
from 1 to 20 mmol/liter (Table III).
Furthermore, the potent stimulation by 20 mmol/liter glucose could not
be prevented by preincubating the cells to 2-deoxyglucose. On the
contrary, the addition of mannoheptulose blocked the stimulatory effect of glucose upon insulin and proinsulin synthesis by more than 98%
(Table III). Therefore, these data indicate that if HK contributes to
glucose metabolism in rat beta cells, its enzymatic role in glucose
regulation of proinsulin biosynthesis and insulin secretion is
undetectably low, at least in the experimental conditions that were
tested.
From a theoretical standpoint, the low Km
hexokinase isoforms are poorly adapted to participate in the process of glucose sensing in differentiated mammalian beta cells: both their kinetic and allosteric properties preclude any role in the
glucose-induced metabolic flux control operating within the
physiological range of substrate concentrations. Because islet blood
flow is very high, islet capillaries are fenestrated, and glucose
uptake in beta cells is rapid, it can be assumed (32) that both
interstitial and intracellular glucose concentrations equilibrate
within seconds to physiologic changes in plasma glucose which range
normally between 3 and 10 mM. Unlike glucokinase, which
requires approximately 10 mM glucose for half-maximal
activity (3), the low Km hexokinase isoforms are
characterized by Km values well below 1 mmol/liter,
so they are fully saturated over the range of physiological blood
glucose concentrations when glucose transport into the cell is not
rate-limiting. Moreover, these enzymes are negatively regulated by
Glu-6-P, causing a buffering effect on the Glu-6-P-concentration within
the cell (32).
In rodent (14) and human (33) beta cells, sugar transport appears not
to be rate-limiting for glucose metabolism, so that the
Km of the glucose phosphorylation step seems
directly related to the Km of glucose-stimulated
insulin release. In agreement with this idea, the beta cell line
RINm5F, which expresses HK and almost no GK (29, 34, 35), is virtually glucose unresponsive between 1 and 20 mmol/liter glucose, whereas beta
cell lines with a relatively good glucose responsiveness such as MIN6
(13), INS-1 (34), HIT-T15 (35), and As was demonstrated in this paper, only a tiny fraction of HK remained
"associated" with beta cells after correction for the contaminating
acinar and duct cells. Our experiments with 2-deoxyglucose, the
metabolic precursor of a potent HK inhibitor (29), do not support the
idea that this low amount of HK, which might or might not be present in
normal rat beta cells, contributes functionally to glucose regulation
of these cells, since glucose-induced insulin biosynthesis and release
were completely preserved after preincubation with 2-deoxyglucose. One
possible caveat of these observations is that the accumulated
2-deoxyglucose-6-phosphate, a potent inhibitor of HK (29), could have
been degraded in the cells during the washing period after
2-deoxyglucose loading. Direct measurements of
2-deoxyglucose-6-phosphate content in beta cells after the (pre)incubation period would perhaps provide an answer but, given the
limited supply of FACS-purified cells, this appears to be technically
difficult and demanding. Furthermore, given the shortness of the
washing period (a few minutes), the low cellular density during
incubation (2.5 × 105 cells/ml) and the fact that the
used 2-deoxyglucose concentration was high (50 mmol/liter), we propose
it is reasonable to interpret our observations as evidence for the lack
of functional amounts of hexokinases I, II, or III in adult rat beta cells.
This interpretation might be of physiological importance, since it
underlines the idea that the presence of extremely low amounts of
hexokinases I, II, or III is a hallmark of differentiated adult beta
cells, very similar to what was previously demonstrated for adult
differentiated hepatocytes (41). In physiological terms this makes
sense, since co-expression of HK and GK would not only shift the
glucose sensitivity of insulin-secreting cells to inappropriately low
values, but also because of the allosteric properties of HK which would
buffer glucose 6-phosphate content in the cells, thereby limiting the
range of metabolic control by glucose (32). An important question to be
answered in future work is whether or not de-differentiation of animal
and human beta cells, either as a consequence of chronic stress or
because of DNA mutations associated with beta cell immortality, is a
major cause of up-regulation of hexokinase I gene expression on the one
hand and loss of normal glucose-induced insulin release on the other.
In other words, could a rise in HK over GK in human beta cells be one
of the mechanisms by which diabetes is caused? A series of recent
studies in rodent islets of Langerhans (16, 18, 43-47) seem to
suggests indirectly that chronic stress indeed up-regulates HK activity
and loss of the normal beta cell phenotype in parallel. In a model of
chronic stress imposed upon remaining beta cells after 85-95%
pancreatectomy, Hosakowa et al. (16) observed more than
2-fold up-regulation of HK activity in isolated islets from these
animals, while Jonas et al. (43) recently described multiple
abnormalities in gene expression in these islets, comprising a clear
increase in the abundance of hexokinase I mRNA, an animal model of
obesity and hyperinsulinism, a parallel increase in HK activity and
alterations in the glucose-induced function of isolated islets has been
observed (44). It is possible that these abnormalities are caused by
increased concentrations of free fatty acids which can induce similar
perturbations after in vitro exposure of normal islets (45,
46). Cellular stress may also be induced by the homozygous null
mutation of the glucokinase gene, for instance, after deletion of the
beta cell-specific GK promoter (8), or via a strategy including
conditional activation of Cre-recombinase in islet beta cells (18).
Following the latter approach, Piston et al. (18) suggested
the presence of low Km glucose metabolism in those
islet beta cells which underwent recombination of the glucokinase gene,
indicating that HK can be up-regulated under such conditions (18).
However, it should be mentioned that the interpretation in this paper
was indirect, so that HK gene expression should still be assessed in
GK In summary, our observations strongly indicate that differentiated
adult rat beta cells express extremely low amounts of low Km hexokinases, a characteristic which can
contribute to the powerful glucose regulation of these cells within the
millimolar concentration range. Our data also draw attention to
potential pitfalls in the interpretation of biochemical data obtained
from mixed cell populations as is illustrated by the fact that most HK
associated with rat islets of Langerhans originates from non-endocrine pancreatic cells. This methodological concern seems equally relevant for any other enzyme or molecule which is expressed more abundantly in
exocrine pancreas than in endocrine beta cells.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-Actin--
Cell and
tissue samples were washed twice in phosphate-buffered saline and
homogenized by sonication in lysis buffer containing 80 mmol/liter
Tris-Cl (pH 6.8), 5 mmol/liter EDTA, 5% SDS, 5%
-mercaptoethanol,
and 10% glycerol in the presence of 1 mmol/liter phenylmethylsulfonyl
fluoride. Aliquots were taken for protein determination using the BCA
protein assay kit (Pierce, Rockford, IL) using BSA as standard.
Homogenates (20-40 µg of total cellular protein per lane) were
separated on a 10% SDS-polyacrylamide gel (Mini-Protean, Bio-Rad) and
electroblotted overnight onto nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany). Blotting efficiency as well as the position
of the protein standards was assessed by Ponceau staining. The blots
were blocked for 1 h at room temperature in 5% non-fat dry milk
(pH 7.6). Hexokinase-I was detected using a monoclonal anti-hexokinase
I antibody (Chemicon, Temakula, CA) at 1/1.000 dilution (16). The
second antibody (sheep anti-mouse peroxidase, 1/2000, Amersham
Pharmacia Biotech) was incubated at room temperature for 50 min.
Peroxidase activity was detected via chemiluminiscence (ECL, Amersham
Pharmacia Biotech). The intensity of the signals was quantified via
laser densitometry. Stripped blots were re-exposed subsequently to
sheep polyclonal anti-GK antibody at 1/4000 dilution (kindly donated by
Dr. H. Seitz, University of Hamburg, Germany) and goat polyclonal
antibody against
-actin at 1/1000 dilution (Santa Cruz, San Diego,
CA), the latter to validate quality and quantity of the loaded protein.
Exposure times were 20 min for hexokinase-I, 1 min for GK, and 1 min
for
-actin.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (62K):
[in a new window]
Fig. 1.
Reverse transcription polymerase chain
reaction of different hexokinase transcripts in FACS-purified beta
cells. Total RNA was reverse transcribed and amplified using
hexokinase-specific primers. A set of primers that recognize the
glucose transporter isoforms 1, 2, and 4 (Glut1-2-4) was
used as a control for the integrity and quantity of amplified RNA (26).
Amplification of cDNA from purified beta cells generated a PCR
fragment with the hexokinase type I and hexokinase type IV
(beta
cell-specific variant of glucokinase; Ref. 27) primers but not with the
hexokinase type II- or III-specific primers. The Glut1-2-4 signal was
similar in all cell and tissue types under examination. Blank PCR
conditions contained water instead of added cDNA. The results in
this figure are representative for three experiments.
-actin were 0.4 (islets) and 0.02 (beta cells). The
cellular origin of the detected hexokinase-I protein in whole islets is
suggested by high hexokinase-I expression in exocrine pancreatic cells
(virtually as abundant as in rat brain). In contrast to the large
difference in hexokinase-I expression in whole islets and purified beta
cells, GK abundance in isolated islets and FACS-purified beta cells
were comparable, the observed OD ratio of GK over
-actin being 0.45 and 0.65 in islets and in beta cells, respectively.

View larger version (52K):
[in a new window]
Fig. 2.
Analysis of pancreatic cell preparations for
the presence of hexokinase-I and glucokinase. As positive control
tissues for the expression of hexokinase-I and glucokinase we used,
respectively, rat brain and liver. Western blots were carried out with
20 µg of total protein/lane extracted from rat brain, exocrine
pancreas, pancreatic islets, liver, or total protein from 2 × 105 flow sorted rat pancreatic beta cells. Blotting
efficiency was established by Ponceau staining. Exposure times were 20 min for hexokinase-I, 1 min for GK, and 1 min for
-actin. The blot
shown here is representative for three experiments.
Hexokinase enzymatic activities in different pancreatic cell types

View larger version (14K):
[in a new window]
Fig. 3.
Low Km hexokinase in
function of the percent of acinar cells in rat pancreatic islet cell
preparations. Measured activities of HK and % acinar cells are
plotted for:
, non-sorted dissociated islet cells (n = 7);
, FAD/scatter flow-sorted beta cells (n = 15);
, flow-sorted beta cells with high NAD(P)H autofluorescence at 2.8 mM glucose (n = 4);
, flow-sorted beta
cells with low NAD(P)H autofluorescence at 2.8 mM glucose
(n = 4).
Effect of culture on hexokinase/glucokinase activity and exocrine cell
contamination of flow-sorted rat beta cells
Effect of 2-deoxyglucose and mannoheptulose on insulin release and
proinsulin biosynthesis from rat beta cells
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
TC7 (36) exhibit a relatively
high GK over HK expression ratio. Furthermore, up-regulation of HK in
MIN6-cells via in vitro gene transfer (13) shifts the
dose-response curve for glucose-induced insulin release to the left,
similar to what has been observed in vivo by expressing the
yeast hexokinase transgene in mouse islet beta cells (37). In view of
these results it has been difficult to reconcile the large amounts of
HK activity in extracts of whole islets (5, 6, 11) with the virtual
absence of a secretory response of islet beta cells to glucose
concentrations between 0 and 3 mmol/liter. One possible explanation has
been suggested by Giroix et al. (19) who proposed on the
basis of Glu-6-P and glucose 1,6-bisphosphate content of rat islets and
flow-sorted beta cells, that allosteric inhibition of hexokinase
in situ reduces enzymatic activity below 25% of what is
measured in extracts. This line of reasoning needs, however, some
revision in the context of the biochemical association of HK with the
outer mitochondrial membrane (17), a subcellular localization which
renders the enzyme less sensitive to allosteric inhibition by Glu-6-P
(38). Importantly, it should be emphasized that direct evidence for the
presence of low Km hexokinase(s) in any
-subcellular compartment, e.g. using ultrastructural or laser confocal microscopic analysis, has not been published so far. The
results presented in this study provide direct support for the idea
that most of the measured islet HK gene expression, either in the form
of hexokinase-I protein abundance or HK enzymatic activity, does not
reflect events occurring inside beta cells but represent protein
activity associated with a low percentage of other cells contaminating
the beta cell preparations. One potential source could be
glucagon-producing alpha cells, which normally amount to up 5% of
FACS-purified beta cells (22). However, since the measured HK in
FACS-purified alpha cells was lower than in beta cells and rat alpha
cells were reported to express GK (31), we propose that the few
contaminating alpha cells are not responsible for the measured HK
activity in flow sorted beta cell preparations. Our data rather suggest
that a large fraction of islet-associated hexokinase is not localized
in endocrine pancreatic cells but originates from acinar or ductal
cells which are co-purified with the collagenase-isolated rat islets
and, consequently, contaminate the flow-sorted beta cells to a minor
degree. Since HK enzymatic activity in exocrine pancreas appears at
least 1 order of magnitude higher than in the FACS-purified beta cells
(with impurities included) it is easy to understand why even
flow-sorted beta cells contain detectable amounts of HK. Freshly
isolated rat islets using collagenase and handpicking under a stereo
dissecting microscope usually still contain acinar cells which adhere
to the islet collagen capsule. Surprisingly little information on
quantitative aspects of this subject can be found in the literature.
Since the procedure of handpicking involves a phenomenon of selection,
the degree of exocrine co-purification will probably vary from batch to
batch and from laboratory to laboratory. We noted that during a 5-day culture period most acinar cells die, while the functional integrity of
endocrine beta cells can be preserved (24). Our observation fits well
with the reproducible, but hitherto unexplained, observation that HK
activity of isolated islets decreases profoundly during culture, while
the concentration-response curve of glucose-induced insulin release is
very well preserved (20, 21). The current data also explain our
previous observation that HK activity is only detected in one
particular subset of flow-sorted beta cells (14). Indeed, our present
data show that the rare acinar cells contaminating the total beta cell
preparation are preferentially sorted into the high NAD(P)H cellular
subset. Some biochemical parameters measured in non-sorted islet cells,
e.g. the cellular (ATP)/(ADP) ratio or total glucose
utilization (39), reflect quite well the situation present in beta
cells which occupy the largest part of the islet volume. For HK,
however, the situation seems to be quite different. The expression
level of HK in acinar and duct cells is at least 1, perhaps 2, orders
of magnitude higher than in flow-sorted endocrine beta and non-beta
cells. Therefore, HK values from islet cell preparations with only a
few percent of acinar cells do not reflect glucose phosphorylation in
beta cells. Since most acinar cells are known to die during tissue culture, it seems indicated to conduct future studies of glucose phosphorylation in non-tumoral beta cells in models where the islets or
beta cells were cultured for at least several days. Therefore, although
experiments in transfected or transgenic beta cells clearly show that
the presence of HK has an effect on insulin secretion at basal glucose
concentrations (12, 13, 36, 37, 40), the present study did not support
the idea that HK together with GK sets the threshold point of glucose
sensing in rat adult differentiated beta cells. This would imply that
cells of the endocrine pancreas (at least both alpha and beta cells)
expresses GK only, while the exocrine pancreas expresses low
Km hexokinases, analogous to the clear distinction
between parenchymal hepatic versus non-parenchymal cells
(41). Interestingly, mathematical modeling data of glycolysis in the
beta cell compartment of rodent islets (42) are in close agreement with
the experimental results presented in this present paper.
/
cells, either by mRNA or protein analysis. Furthermore, the
functional consequence of up-regulated HK expression in beta cells
defective in GK expression is still uncertain, since Sakura et
al. (47) did not observe any functional beta cell response in
terms of KATP channel activity between 0 and 1 mM glucose in islets isolated from homozygous GK knockout
mice. Nevertheless, the concept that up-regulation of HK perturbs the
normal phenotype of differentiated beta cells which are virtually
devoid of low Km glucose phosphorylation, and hence
contributes to a diabetic state, is interesting and deserves further analysis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Geert Stangé, Marleen Berghmans, Ann Nuyts, Erik Quartier, and René De Proft for technical assistance and An Gielen for secretarial help.
| |
FOOTNOTES |
|---|
* This work was supported by the Flemish Fund for Scientific Research FWO-Vlaanderen Research Grants G.3127.93 and G.0376.97, a postdoctoral fellowship (to H. H.), the Ministerie van de Vlaamse Gemeenschap, Department Onderwijs (Geconcerteerde Onderzoeksactie 1807), and the Services of the Belgian Prime Minister Interuniversity Attraction Pole P4/21.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biochemistry,
Diabetes Research Center, Faculty of Medicine, Vrije Universiteit Brussel, Laarbeeklaan 103, B-1090 Brussels, Belgium. Tel.:
32-2-4774470; Fax: 32-2-4774472; E-mail: fschuit@minf.vub.ac.be.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HK, hexokinases I, II, or III; BSA, bovine serum albumin; FACS, fluorescence-activated cell sorting; Glu-6-P, glucose 6-phosphate; GK, hexokinase IV (glucokinase); PCR, polymerase chain reaction.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Pipeleers, D. (1987) Diabetologia 30, 277-291[CrossRef][Medline] [Order article via Infotrieve] |
| 2. | Ling, Z., and Pipeleers, D. G. (1996) J. Clin. Invest. 98, 2805-2812[Medline] [Order article via Infotrieve] |
| 3. | Matschinsky, F. M. (1996) Diabetes 45, 223-241[Abstract] |
| 4. | Newgard, C. B., and McGarry, J. D. (1995) Annu. Rev. Biochem. 64, 689-719[CrossRef][Medline] [Order article via Infotrieve] |
| 5. |
Matschinsky, F. M.,
and Ellerman, J. E.
(1968)
J. Biol. Chem.
243,
2730-2736 |
| 6. | Ashcroft, S. J. H., and Randle, P. J. (1970) Biochem. J. 119, 5-15[Medline] [Order article via Infotrieve] |
| 7. | Iynedjian, P. B. (1995) Biochem. J. 293, 231-243 |
| 8. | Grupe, A., Hultgren, B., Ryan, A., Ma, Y. H., Bauer, M., and Stewart, T. A. (1995) Cell 83, 69-78[CrossRef][Medline] [Order article via Infotrieve] |
| 9. |
Froguel, Ph.,
Zouali, H.,
Vionnet, N.,
Velho, G.,
Vaxillaire, M.,
Sun, F.,
Lesage, S.,
Stoffel, M.,
Takeda, J.,
Passa, Ph.,
Permutt, A.,
Beckmann, J. S.,
Bell, G. I.,
and Cohen, D.
(1993)
N. Engl. J. Med.
328,
697-702 |
| 10. |
Glaser, B.,
Kesavan, P.,
Heyman, M.,
Davis, E.,
Cuesta, A.,
Buchs, A.,
Stanley, C. A.,
Thornton, P. S.,
Permutt, M. A.,
Matschinsky, F. M.,
and Herold, K. C.
(1998)
N. Engl. J. Med.
338,
226-230 |
| 11. |
Malaisse, W. J.,
Sener, A.,
and Levy, J.
(1976)
J. Biol. Chem.
251,
1731-1737 |
| 12. |
German, M. S.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1781-1785 |
| 13. |
Ishihara, H.,
Asano, T.,
Tsukuda, K.,
Katagiri, H.,
Inukai, K.,
Anai, M.,
Kikuchi, M.,
Yazaki, Y.,
Miyazaki, J. I.,
and Oka, Y.
(1994)
J. Biol. Chem.
269,
3081-3087 |
| 14. | Heimberg, H., De Vos, A., Vandercammen, A., Van Schaftingen, E., Pipeleers, D., and Schuit, F. (1993) EMBO J. 12, 2873-2879[Medline] [Order article via Infotrieve] |
| 15. | Kiekens, R., in't Veld, P., Mahler, T., Schuit, F., Van De Winkel, M., and Pipeleers, D. (1992) J. Clin. Invest. 89, 117-125 |
| 16. | Hosakowa, H., Hosakowa, Y. A., and Leahy, J. L. (1995) Diabetes 44, 1328-1333[Abstract] |
| 17. | Rabuazzo, A. M., Patanè, G., Anello, M., Piro, S., Vigneri, R., and Purrello, F. (1997) Diabetes 46, 1148-1452[Abstract] |
| 18. |
Piston, D. W.,
Knobel, S. M.,
Postic, C.,
Shelton, K. D.,
and Magnuson, M. A.
(1999)
J. Biol. Chem.
274,
1000-1004 |
| 19. | Giroix, M. H., Sener, A., Pipeleers, D. G., and Malaisse, W. J. (1984) Biochem. J. 223, 447-453[Medline] [Order article via Infotrieve] |
| 20. |
Liang, Y.,
Najafi, H.,
and Matschinsky, F. M.
(1990)
J. Biol. Chem.
265,
16863-16866 |
| 21. | Weinhaus, A. J., Stout, L. E., and Sorenson, R. L. (1996) Endocrinology 137, 1640-1649[Abstract] |
| 22. | Pipeleers, D. G., in't Veld, P., Van De Winkel, M., Maes, E., Schuit, F. C., and Gepts, W. (1985) Endocrinology 117, 806-816[Abstract] |
| 23. | Pipeleers, D. G., and Pipeleers-Marichal, M. A. (1981) Diabetologia 20, 654-663[Medline] [Order article via Infotrieve] |
| 24. | Ling, Z., Kiekens, R., Mahler, T., Schuit, F. C., Pipeleers-Marichal, M., Sener, A., Klöppel, G., Malaisse, W. J., and Pipeleers, D. G. (1996) Diabetes 45, 1774-1782[Abstract] |
| 25. | Bouwens, L., Braet, F., and Heimberg, H. (1995) J. Histochem. Cytochem. 43, 245-253[Abstract] |
| 26. |
Heimberg, H.,
De Vos, A.,
Pipeleers, D.,
Thorens, B.,
and Schuit, F.
(1995)
J. Biol. Chem.
270,
8971-8975 |
| 27. | Magnuson, M. A., and Shelton, K. D. (1989) J. Biol. Chem. 289, 15936-15942 |
| 28. | Van Schaftingen, E. (1989) Eur. J. Biochem. 179, 179-184[Medline] [Order article via Infotrieve] |
| 29. |
Ferber, S.,
BeltrandelRio, H.,
Johnson, J.,
Noel, R. J.,
Cassidy, L. E.,
Clark, S.,
Becker, T. C.,
Hughes, S.,
and Newgard, C. B.
(1994)
J. Biol. Chem.
269,
11523-11529 |
| 30. | Schuit, F. C., Kiekens, R., and Pipeleers, D. G. (1991) Biochem. Biophys. Res. Commun. 178, 1182-1187[CrossRef][Medline] [Order article via Infotrieve] |
| 31. |
Heimberg, H.,
De Vos, A.,
Moens, K.,
Quartier, E.,
Bouwens, L.,
Pipeleers, D.,
Van Schaftingen, E.,
Madsen, O.,
and Schuit, F.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
7036-7041 |
| 32. |
Van Schaftingen, E.,
and Schuit, F.
(1999)
in
Advances in Molecular and Cellular Biology: The Biology of the Pancreatic -Cell
(Howell, S. L., ed), Vol. 29
, pp. 199-226, JAI Press, Stamford, CT
|
| 33. | De Vos, A., Heimberg, H., Quartier, E., Huypens, P., Bouwens, L., Pipeleers, D., and Schuit, F. (1995) J. Clin. Invest. 96, 2489-2495 |
| 34. |
Sekine, N.,
Cirulli, V.,
Regazzi, R.,
Brown, L. J.,
Gine, E.,
Tamarit-Rodriguez, J.,
Girotti, M.,
Marie, S.,
MacDonald, M. J.,
Wollheim, C. B.,
and Rutter, G. A.
(1994)
J. Biol. Chem.
269,
4895-4902 |
| 35. | Shimizu, T., Parker, J. C., Najafi, H., and Matschinsky, F. M. (1988) Diabetes 37, 1524-1530[Abstract] |
| 36. | Efrat, S., Leiser, M., Surana, M., Tal, M., Fusco-Demaine, D., and Fleischer, N. (1993) Diabetes 42, 901-907[Abstract] |
| 37. |
Epstein, P. N.,
Boschero, A. C.,
Atwater, I.,
Cai, X.,
and Overbeek, P. A.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
12038-12042 |
| 38. |
Lynch, R. M.,
Fogarty, K. E.,
and Fay, F. S.
(1991)
J. Cell Biol.
112,
385-395 |
| 39. |
Detimary, P.,
Dejonghe, S.,
Ling, Z.,
Pipeleers, D.,
Schuit, F.,
and Henquin, J. C.
(1998)
J. Biol. Chem.
273,
33905-33908 |
| 40. |
Becker, T. C.,
Noel, R. J.,
Johnson, J. H.,
Lynch, R. M.,
Hirose, H.,
Tokuyama, Y.,
Bell, G. I.,
and Newgard, C. B.
(1996)
J. Biol. Chem.
271,
390-394 |
| 41. | Bontemps, F., Hue, L., and Hers, H. G. (1978) Biochem. J. 174, 603-611[Medline] [Order article via Infotrieve] |
| 42. |
Sweet, I. R.,
Li, G.,
Najafi, H.,
Berner, D.,
and Matschinsky, F. M.
(1996)
Am. J. Physiol.
271,
E606-E625 |
| 43. |
Jonas, J. C.,
Sharma, A.,
Hasenkamp, W.,
Ilkova, H.,
Patane, G.,
Laybutt, R.,
Bonner-Weir, S.,
and Weir, G. C.
(1999)
J. Biol. Chem.
274,
14112-14121 |
| 44. |
Milburn, J. L., Jr.,
Hirose, H.,
Lee, Y. H.,
Nagasawa, Y.,
Ogawa, A.,
Ohneda, M.,
BeltrandelRio, H.,
Newgard, C. B.,
Johnson, J. H.,
and Unger, R. H.
(1995)
J. Biol. Chem.
270,
1295-1299 |
| 45. |
Hirose, H.,
Lee, Y. H.,
Inman, L. R.,
Nagasawa, Y.,
Johnson, J. H.,
and Unger, R. H.
(1996)
J. Biol. Chem.
271,
5633-5637 |
| 46. | Hosokawa, H., Corkey, B. E., and Leahy, J. L. (1997) Diabetologia 40, 392-397[CrossRef][Medline] [Order article via Infotrieve] |
| 47. | Sakura, H., Ashcroft, S. J., Terauchi, Y., Kadowaki, T., and Ashcroft, F. M. (1998) Diabetologia 41, 654-659[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
B Maiztegui, M I Borelli, M L Massa, H Del Zotto, and J J Gagliardino Enhanced expression of hexokinase I in pancreatic islets induced by sucrose administration. J. Endocrinol., May 1, 2006; 189(2): 311 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Martens, Y. Cai, S. Hinke, G. Stange, M. Van de Casteele, and D. Pipeleers Glucose Suppresses Superoxide Generation in Metabolically Responsive Pancreatic {beta} Cells J. Biol. Chem., May 27, 2005; 280(21): 20389 - 20396. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-J. Yang, L.-M. Kow, D. W. Pfaff, and C. V. Mobbs Metabolic Pathways That Mediate Inhibition of Hypothalamic Neurons by Glucose Diabetes, January 1, 2004; 53(1): 67 - 73. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. R. Papa, C. Zhang, K. Shokat, and P. Walter Bypassing a Kinase Activity with an ATP-Competitive Drug Science, November 28, 2003; 302(5650): 1533 - 1537. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. O. Westermark and A. Lansner A Model of Phosphofructokinase and Glycolytic Oscillations in the Pancreatic {beta}-cell Biophys. J., July 1, 2003; 85(1): 126 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, T. Hansotia, B. Yusta, F. Ris, P. A. Halban, and D. J. Drucker Glucagon-like Peptide-1 Receptor Signaling Modulates beta Cell Apoptosis J. Biol. Chem., January 3, 2003; 278(1): 471 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Schuit, D. Flamez, A. De Vos, and D. Pipeleers Glucose-Regulated Gene Expression Maintaining the Glucose-Responsive State of {beta}-Cells Diabetes, December 1, 2002; 51(90003): S326 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. PAPAS, C. K. COLTON, J. S. GOUNARIDES, E. S. ROOS, M. A. C. JAREMA, M. J. SHAPIRO, L. L. CHENG, G. W. CLINE, G. I. SHULMAN, H. WU, et al. NMR Spectroscopy in {beta} Cell Engineering and Islet Transplantation Ann. N.Y. Acad. Sci., November 1, 2001; 944(1): 96 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L.F. Chan, M. Mourtada, and N. G. Morgan Characterization of a KATP Channel--Independent Pathway Involved in Potentiation of Insulin Secretion by Efaroxan Diabetes, February 1, 2001; 50(2): 340 - 347. [Abstract] [Full Text] |
||||
![]() |
F. C. Schuit, P. Huypens, H. Heimberg, and D. G. Pipeleers Glucose Sensing in Pancreatic {beta}-Cells: A Model for the Study of Other Glucose-Regulated Cells in Gut, Pancreas, and Hypothalamus Diabetes, January 1, 2001; 50(1): 1 - 11. [Abstract] [Full Text] |