|
J Biol Chem, Vol. 274, Issue 46, 32889-32896, November 12, 1999
The NH2 Terminus of the Epithelial Sodium Channel
Contains an Endocytic Motif*
Michael L.
Chalfant ,
Jerod S.
Denton ,
Anne Lynn
Langloh§,
Katherine H.
Karlson ,
Johannes
Loffing¶,
Dale J.
Benos§, and
Bruce A.
Stanton
From the Department of Physiology, Dartmouth Medical
School, Hanover, New Hampshire 03755, the § Department
of Physiology and Biophysics, University of Alabama, Birmingham,
Alabama 35233, and the ¶ Institute of Anatomy, University of
Zurich, Zurich, Switzerland CH-8057
 |
ABSTRACT |
An epithelial sodium channel (ENaC) is composed
of three homologous subunits: , , and . To elucidate the
function of the cytoplasmic, NH2 terminus of rat ENaC
(rENaC) subunits, a series of mutant cDNAs was constructed and the
cRNAs for all three subunits were expressed in Xenopus
oocytes. Amiloride-sensitive Na+ currents (INa)
were measured by the two-electrode voltage clamp technique. Deletion of
the cytoplasmic, NH2 terminus of ( 2-109), ( 2-49), or -rENaC ( 2-53) dramatically reduced
INa. A series of progressive, NH2-terminal
deletions of -rENaC were constructed to identify motifs that
regulate INa. Deletion of amino acids 2-46 had no effect
on INa: however, deletion of amino acids 2-51, 2-55,
2-58, and 2-67 increased INa by ~4-fold. By contrast,
deletion of amino acids 2-79, 2-89, 2-100, and 2-109 eliminated
INa. To evaluate the mechanism whereby 2-67- -rENaC
increased INa, single channels were evaluated by patch
clamp. The single-channel conductance and open probability of
, , -rENaC and 2-67- , , -rENaC were similar. However,
the number of active channels in the membrane increased from 6 ± 1 channels per patch with , , -rENaC to 11 ± 1 channels
per patch with 2-67- , , -rENaC. Laser scanning confocal
microscopy confirmed that there were more 2-67- , , -rENaC channels in the plasma membrane than , , -rENaC channels.
Deletion of amino acids 2-67 in -rENaC reduced the endocytic
retrieval of channels from the plasma membrane and increased the
half-life of the channel in the membrane from 1.1 ± 0.2 to
3.5 ± 1.1 h. We conclude that the cytoplasmic,
NH2 terminus of -, -, and -rENaC is required for
channel activity. The cytoplasmic, NH2 terminus of
-rENaC contains two key motifs. One motif regulates the endocytic
retrieval of the channel from the plasma membrane. The second motif is
required for channel activity.
 |
INTRODUCTION |
An amiloride-sensitive, epithelial sodium channel
(ENaC)1 mediates
Na+ transport across the apical membrane of a variety of
epithelia including the kidney, lung, and intestine and, thereby, plays a vital role in maintaining Na+ and fluid homeostasis
(1-4). ENaC is composed of three subunits: , , and (5, 6).
The expression of the subunit in Xenopus oocytes
produces very small currents, and the expression of and/or subunits generates no current (5, 6). However, coexpression of -,
-, and -rENaC produces large Na+ currents in oocytes
(5, 6). The ENaC subunits are members of a growing family of ion
channels that include the FMRFamide-gated Na+ channel,
Na+ channels in brain (BNC1 and BNC2), and the degenerins
of Caenorhabditis elegans that encode mechanosensitive
channels (e.g. DEG-1, MEC-4, and MEC-10) (4, 7).
Amino acid sequence analysis and biochemical studies suggest that the
ENaC subunits have cytoplasmic NH2 and COOH termini, two
hydrophobic transmembrane domains (M1 and M2) and a large extracellular
domain (4-8). Several lines of evidence suggest that the -, -,
and -subunits interact to form a heteromultimeric channel complex
and that this complex is required for maximum Na+ currents
(4-8). However, relatively little is known about the function of the
different domains of ENaC. The region immediately preceding the second
transmembrane domain contains an amiloride-binding site and determines
ion selectivity, suggesting that it forms part of the channel pore
(9-11). The extracellular domain plays a role in subunit interaction,
targeting channels to the plasma membrane and channel gating (4, 7-9,
11). The COOH terminus plays an important role in localizing ENaC to
the apical membrane, and it contains an NPXY motif that is
important in the endocytic retrieval of the channel from the plasma
membrane (1-4, 12-15). For example, in Liddle's syndrome mutations
and/or deletions of the NPXY motif in - or -ENaC
reduces subunit ubiquitination and endocytic retrieval of ENaC from the
plasma membrane. This results in an increase in the number of channels
in the membrane, which causes hyperabsorption of Na+ and
hypertension (12-15). Although recent studies suggest that the
NH2 terminus may play a role in channel assembly and gating (16-18), a complete understanding of the function of the
NH2 terminus of any ENaC subunit is not available. Thus,
the goal of this study was to test the hypothesis that the
NH2 termini of ENaC's are critical for channel activity.
To elucidate the function of the cytoplasmic, NH2 terminus
of each rENaC subunit, a series of mutant cDNAs was constructed and
the cRNAs were expressed in Xenopus oocytes.
Amiloride-sensitive Na+ currents (INa) were
measured by the two-electrode voltage-clamp technique. We report that
the cytoplasmic, NH2 terminus of -, -, and -rENaC
is required for channel activity. Our data demonstrate that the
NH2 terminus of -rENaC contains two key regions: one that regulates the half-life of the channel in the plasma membrane. Deletion of this motif increases INa by reducing the rate
of channel endocytosis. The second region is required for normal
channel activity. Deletion of this region eliminates
INa.
 |
EXPERIMENTAL PROCEDURES |
cDNA Constructs--
Plasmids containing cDNAs encoding
the wt -, -, and -subunits of rENaC, cloned into the pSport
vector, were a generous gift of Dr. Bernard C. Rossier, Lausanne,
Switzerland (5, 19). Deletions of the cytoplasmic, NH2
termini of -, -, and -rENaC were made by PCR-based
mutagenesis. Because all deletions were generated using a similar
approach, details will be given for only one construct. The sequence of
all PCR products and cDNAs with deletions was confirmed by dye
terminator cycle sequencing (ABI PRISM: PE Applied Biosystems, Foster
City, CA).
pSport/ 2-41- -rENaC, encoding a protein in which the
NH2-terminal 41 amino acids of -rENaC were deleted, was
constructed in two steps. First, a 476-bp PCR fragment was synthesized
using pSport/ -rENaC cDNA as a template, with a sense
primer (CGACGTCGACCATGCAAGGACTGGGGAAGGGGGAC-3') corresponding to
nucleotides 127-147 of -rENaC and an antisense primer
(CTGGCGAGTGTAGGAAGAGTTGTA) corresponding to nucleotides 565-588. The sense primer also contained an upstream SalI
restriction site, a partial Kozak consensus sequence, and an initiator
methionine codon. The antisense primer was located downstream of a
unique BsrGI restriction site. The 476-bp PCR product
was isolated, purified (Wizard, Promega, Madison, WI), subcloned into
pcR 2.1 (TA Cloning Kit, Invitrogen), and sequenced. In the second
step, pSport/ -rENaC and pcR 2.1 containing the 476-bp PCR product
were digested with SalI/BsrGI, and the
gel-purified 440-bp PCR fragment was ligated into digested
pSport/ -rENaC.
To monitor the expression of rENaC in the plasma membrane the 5' end of
-rENaC and -rENaC cDNA were ligated in-frame to the 3' end of
the cDNA encoding the enhanced green fluorescent protein (EGFP-C1
and EGFP-C2: CLONTECH, Palo Alto, CA).
GFP- -rENaC was constructed in two steps. First, -rENaC was
excised from pSport/ -rENaC with SalI/KpnI, and
the excised fragment was ligated into SalI/KpnI
digested pEGFP-C1 to construct pEGFP-C1- -rENaC (i.e.
GFP- -rENaC). To remove two pre-existing stop codons between the
SalI site and an initiator methionine in pEGFP-C1- -rENaC a 563-bp PCR fragment was synthesized using -rENaC cDNA as a template with a sense primer
(ACGCGTCGACGGTGCCACCATGCCAGTGAAGAAGTACCT) corresponding to
nucleotides 1-20 of -rENaC and an antisense primer
(GGTGCTTCCTGGGGCTGGGTTGCTGCTGTT) corresponding to nucleotides 514-543
of -rENaC. The sense primer also contained an upstream SalI restriction site and a Kozak consensus site sequence.
The PCR product contained a unique BsmBI restriction site
just upstream of the anitsense primer sequence. The 563-bp PCR product
was isolated, purified (Wizard, Promega), and subcloned into pcR 2.1 (TA Cloning Kit, Invitrogen) for sequencing. In the second step,
pEGFP-C1- -rENaC and pcR 2.1 containing the 563-bp PCR product were
digested with SalI/BsmBI and the gel-purified
316-bp PCR fragment was ligated into digested pEGFP-C1- -rENaC.
Subsequently, GFP- -rENaC was subcloned from pEGFP-C1- -rENaC
into pcDNA3.1 (Invitrogen, Carlsbad, CA) using
NheI/KpnI.
GFP- -rENaC was constructed by excising -rENaC from
pSport/ -rENaC with SalI/KpnI, and ligating the
excised fragment into SalI/KpnI digested
pEGFP-C2. GFP- -rENaC was subcloned from pEGFP-C2- -rENaC into
pcDNA3.1 using NheI.
pcDNA3.1 was digested with NheI and calf
intestinal alkaline phosphatase-treated to prevent self-ligation (to
generate pcDNA3.1 /EGFP/ -rENaC).
cRNA Preparation--
pSport vectors were linearized with
NotI and pcDNA3.1 vectors were linearized
with AfflI. The linearized cDNAs were used as a template
for cRNA synthesis using a kit containing T7 RNA polymerase, ribonucleotides, and a 7-methylguanosine cap analog following the
manufacturer's instructions (mMessage mMachine, Ambion Inc., Austin TX).
Isolation of Xenopus Oocytes and Injection of cRNA--
Oocytes
were isolated and injected with cRNA as described previously (20, 21).
Briefly, ovarian lobes were removed from Xenopus laevis and
stored in calcium-free OR-2 solution. Oocytes were isolated and
defolliculated using a combination of enzymatic treatment and manual
dissection. Defolliculated Stage V and VI oocytes were transferred to
L-15 medium modified for use with amphibian cells and supplemented with
gentamycin sulfate. cRNA transcribed from wt or truncated -, -,
and -rENaC cDNAs was injected into oocytes as described under
"Results."
Two-electrode Voltage Clamp--
As described in detail
elsewhere (21), the amiloride-sensitive current (INa) was
measured in oocytes 1-3 days after injection of cRNA using the
two-microelectrode voltage-clamp technique in oocytes bathed in a
solution containing (in mM): NaCl, 110; KCl, 2;
CaCl2, 0.4; MgCl2, 1.0; HEPES, 5, pH 7.4 (21).
All experiments were performed at 22-24 °C. Unless otherwise noted
oocytes were co-injected with equal amounts of -, -, and
-rENaC cRNA (2.5 ng/subunit). INa was measured as the
difference in the whole cell current at 100 mV before and after
amiloride (100 µM), a concentration sufficient to
completely inhibit rENaC currents (22).
Single-channel Currents--
Single channel currents were
measured in the cell-attached mode using the patch-clamp technique in
de-vitellated oocytes as described in detail (21, 23). Currents were
amplified, filtered with a low-pass, 4-pole Bessel filter with a cutoff
frequency of 200 Hz, digitized at a sampling rate of 2 kHz, and stored
on the hard disc of a DOS-based computer for subsequent analysis using
pCLAMP software version 6.03. Single-channel currents were measured at
voltages from 40 to 100 mV (21, 24). Po, the single channel open probability, and n, the number of active
channels in the membrane, were calculated as described in detail
(24).
Immunofluorescent Localization of ENaC in Oocytes--
To
examine the effect of NH2-terminal truncations of -rENaC
on the expression of rENaC in the plasma membrane, stage V or VI
oocytes were injected with cRNAs coding for wt, 2-67- -rENaC, or
2-109- -rENa (4 ng/subunit) in combination with GFP- -rENaC (4 ng/subunit) and GFP- -rENaC (4 ng/subunit). Four groups of oocytes
(10 oocytes/group) were studied: 1) wt- -rENaC + GFP- -rENaC + GFP- -rENaC; 2) 2-67- -rENaC + GFP- -rENaC + GFP- -rENaC;
3) 2-109- -rENaC + GFP- -rENaC + GFP- -rENaC, and 4) water.
48 h after cRNA injection the cellular localization of GFP-tagged
rENaC was determined by laser scanning confocal microscopy as described in detail previously (25). Proteins in the plasma membrane were biotinylated using EZ-Link Sulfo-NHS-LC-Biotin (Pierce, Rockford, IL).
Subsequent to biotinylation, oocytes were washed in ND-48 and the
biotin was labeled at 4 °C with stepavidin conjugated to Texas Red
(Molecular Probes, Eugene, OR). Confocal images were acquired using an
Olympus Flouview BX50 upright microscope equipped with an air-cooled
krypton/argon laser scanning head and viewed with a UplanF1 × 10X/0.3 NA air objective. GFP fluorescence was excited using the 488-nm
laser line and collected using a standard fluorescein isothiocyanate
filter set (530 ± 30 nm). Texas red fluorescence was excited
using the 568-nm laser line and collected using a standard Texas Red
filter set (605 ± 32 nm). XY scans were obtained at 12-bit
resolution at approximately the midpoint of each oocyte. All images
were acquired, processed (Adobe Photoshop 5.0), and printed using the
same settings in each of the three groups of oocytes.
Statistical Analysis--
Differences between means were
compared by ANOVA and the Bonferroni post hoc comparison test, or the
paired or unpaired Student's t test, as appropriate.
Statistical analyses were performed with the InStat statistical
software package (Graphpad, San Diego, CA). Data were expressed as the
mean ± S.E. p < 0.05 was considered significant.
 |
RESULTS |
-, -, and -Subunits of rENaC Are Required for Maximum ENaC
Currents--
As illustrated in Fig. 1,
expression of -rENaC in Xenopus oocytes, produced a small
amiloride-sensitive INa. Co-expression of -rENaC with
-rENaC or -rENaC elicited larger currents compared with -rENaC
alone. Maximum currents were expressed when oocytes expressed all three
rENaC subunits. In the absence of -rENaC, -rENaC and -rENaC
did not produce a current in oocytes (data not shown). These data
confirm earlier studies (5, 22).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
All three subunits of rENaC are required for
the expression of maximum, amiloride-sensitive, sodium currents in
oocytes. Oocytes were injected with cRNA (2.5 ng/subunit/oocyte)
and the INa (100 µM) was measured at 100 mV
in experiments presented in this and all subsequent figures. The number
of oocytes per group was between 8 and 14. Asterisks
indicate p < 0.001 versus wt- , , and
and, in addition, that the current was significantly different from
a value of 0 µA.
|
|
The Amino Terminus of -, -, and -rENaC Is Required to
Produce Maximum Amiloride-sensitive Na+ Currents--
The
cytoplasmic, amino (NH2) termini of -rENaC (amino acids
1-109), -rENaC (amino acids 1-49), and -rENaC (amino acids 1-53) have regions of highly conserved sequences among species. This
suggests that the NH2 terminus of all three subunits may subserve important functional roles. To test this hypothesis we deleted
the NH2-terminal, cytoplasmic domain ( N) of each rENaC subunit and examined the effect of the truncation on INa.
In oocytes expressing wt- -rENaC, wt- -rENaC, and wt- -rENaC, the
INa was 4.0 ± 0.7 µA (Fig.
2). Truncation of the NH2
terminus of -, -, or -rENaC dramatically reduced
INa (Fig. 2). For example, in oocytes expressing
N -rENaC with wt- -rENaC and wt- -rENaC we could not detect an
amiloride-sensitive current (Fig. 2). Similarly, in oocytes expressing
wt- -rENaC with N -rENaC and N -rENaC no
amiloride-sensitive current could be detected (Fig. 2). Co-expression of wt- -rENaC with N -rENaC and wt- -rENaC dramatically and
significantly reduced INa compared with oocytes expressing
-, -, and -rENaC (p < 0.001). Finally,
co-expression of wt- -rENaC with wt- -rENaC and N -rENaC also
dramatically and significantly reduced INa compared with
oocytes expressing -, -, and -rENaC (p < 0.001). These data demonstrate that the NH2 termini of
-, -, and -rENaC are required to produce maximum
INa in oocytes.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
Truncation of the NH2 terminus
of -, -, or
-rENaC reduces the amiloride-sensitive
current. The number of oocytes per group was 5-14.
Asterisks indicate INa significantly different
from , , -rENaC (p < 0.001). N lacks
amino acids 2-109, N lacks amino acids 2-49, and N lacks
amino acids 2 to 53.
|
|
NH2-terminal Deletion of - and -rENaC Produces a
Dominant Negative Mutant--
To determine if truncation of the
NH2 terminus of each rENaC subunit eliminated the
contribution of that subunit to a functional channel or if the mutant
subunit interacted with the wild type subunits, in a negative way, we
examined the effect of co-expressing NH2-terminal truncated
subunits with only one or two wild type subunits. In oocytes
co-expressing wt- -rENaC and wt- -rENaC, INa was
222 ± 25 nA (Fig. 3). Co-expression
of N -rENaC with wt- -rENaC and wt- -rENaC significantly
reduced INa to 135 ± 24 nA (p < 0.02: Fig. 3). By contrast, coexpression of wt- -rENaC with
wt- -rENaC and wt- -rENaC dramatically and significantly increased
INa (Fig. 1). Thus, N -rENaC interacts negatively with wt- -rENaC and wt- -rENaC. In oocytes expressing wt- -rENaC and wt- -rENaC INa was 84 ± 18 nA (Fig. 3).
Co-expression of N -rENa with wt- -rENaC and wt- -rENaC did
not significantly alter INa (Fig. 3). Thus, N -rENaC
did not functionally interact with wt- -rENaC and wt- -rENaC. By
contrast, coexpression of wt- -rENaC with wt- -rENaC and
wt- -rENaC dramatically increased INa (Fig. 1). Finally,
in oocytes expressing wt- -rENaC alone INa was 19 ± 2 nA (Fig. 3). Co-expression of N -rENaC and N -rENaC with
wt- -rENaC reduced INa to 5 ± 2 nA (Fig. 3). By
contrast, co-expression of wt- -rENaC and wt- -rENaC and
wt- -rENaC dramatically increased INa (Fig. 1). Thus,
N -rENaC and N -rENaC interact negatively with
wt- -rENaC.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Co-expression of NH2-terminal
truncated rENaC subunits with wt-subunits inhibits
INa. The number of oocytes per group was 8-14.
Asterisks indicate that INa is significantly
different from the data immediately above (p < 0.001).
Because deletion of the NH2 terminus of -rENaC ( N )
eliminated INa (5 ± 13 nA: p = NS) we
did not co-express N with N and N .
|
|
Recently it was demonstrated that , , -rENaC channels and
, -rENaC channels are more permeable to Li+ than to
Na+, whereas , -rENaC channels are more permeable to
Na+ than to Li+ (22). To determine if
co-expression of N-rENaC with wt-ENaC subunits not only reduced
INa but also affected cationic permeability, the relative
permeability of rENaC channels to Li+ versus
Na+ (ILi/INa) was determined by
calculating the ratio of amiloride-sensitive current in a
Li+-containing bath solution (100 mM LiCl) to
the amiloride-sensitive current in a Na+-containing bath
solution (100 mM NaCl). In oocytes expressing -, -,
and N -rENaC, the ILi/INa was 0.81 ± 0.06, indistinguishable from that observed with , -rENaC
(0.79 ± 0.04; p > 0.5). These observations are
consistent with the conclusion that whereas -rENaC affects cation
permeability, N -rENaC does not. In oocytes expressing -,
N -, and -rENaC the ILi/INa was
1.15 ± 0.06, indistinguishable from that observed with
, -rENaC (1.15 ± 0.05; p > 0.9). Thus, although truncation of the NH2 terminus of -rENaC
decreased INa when co-expressed with - and -rENaC,
this truncation did not affect the permeability of the channel to
Li+ over Na+. Taken together these observations
are consistent with the conclusion that N -rENaC combines with the
- and -subunit channel complex.
Overexpression of -, -, and -rENaC Modulates
INa--
The data presented in Fig. 3 demonstrate that
deletion of the cytoplasmic, NH2 terminus of and
perhaps -rENaC produced a subunit that reduced INa.
Moreover, studies on other multimeric ion channels have shown that the
interaction of nonfunctional channel subunits with functional ones
disrupts channel function and/or expression in the plasma membrane
(26-28). In addition, overexpression of the cytoplasmic
NH2 terminus of degenerins, which are closely related to
ENaC, inhibits channel activity (16). Thus, to determine if
overexpression of wt or N subunits of rENaC affects INa,
oocytes were injected with equal amounts of cRNA for the -, -,
and -subunits (2.5 ng/subunit/oocyte) plus a 10-fold excess (25 ng/subunit/oocyte) of either a wild-type subunit or a corresponding
NH2-terminal truncated mutant (Fig.
4). Overexpression of either wt- or
N-rENaC subunits had a significant effect on INa (Fig.
4). A 10 times excess of wt- -rENaC significantly reduced INa (Fig. 4). By contrast, a 10 times excess of
wt- -rENaC significantly increased INa (Fig. 4). However,
a 10 times excess of wt- -rENaC had no effect on INa. On
the other hand, 10-fold overexpression of NH2-terminal
truncated -, -, or -rENaC individually with wt partners
completely eliminated INa (Fig. 4). These observations are
consistent with the conclusion that deletion of the NH2
terminus of -, -, and -rENaC produced a dominant negative
mutant. In addition, the observation that an excess of wt- -rENaC
decreased INa whereas an excess of wt- -rENaC increased
INa suggests that the level of expression of the - and
-subunit regulates INa.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Overexpression of
wt- -rENaC decreases and overexpression of
wt- -rENaC increases INa. By
contrast, overexpression of the NH2-terminal truncated
mutant of each subunit in oocytes also expressing wt- , , -rENaC
eliminated INa. The number of oocytes per group was 5-8.
Asterisks indicate that INa is significantly
different from the data immediately above (p < 0.01).
The number 1 indicates that we injected 2.5 ng/cRNA/oocyte
of that subunit and 10 indicates that we injected 25 ng/cRNA/oocyte of that subunit.
|
|
The NH2 Terminus of -rENaC Contains Two Domains That
Regulate INa--
To begin to identify the key amino acids
in the NH2 terminus of -rENaC that are important for
channel function, we made a series of NH2-terminal,
truncated -rENaC cDNAs and co-expressed truncated -rENaCs
with wild type - and -rENaC. Deletion of amino acids 2-41 and
2-46 had no effect on INa (Fig.
5). However, deletion of amino acids
2-51 increased INa by almost 4-fold (Fig. 5). Thus,
deletion of amino acids 47 through 50 had a dramatic and positive
effect on INa. Deletion of amino acids 2-55, 2-58, and
2-67 had no additional effect on INa compared with
deletion of amino acids 2-51. However, truncation of additional amino
acids ( 2-79, 2-89, 2-100, and 2-109) reduced
INa to 0. Thus, amino acids 68-109 of -rENaC are
required for channel activity. Taken together, these results indicate
that there are two domains in the NH2 terminus of -rENaC
that play key roles in channel activity. One domain between amino acids
47 and 50, that, when deleted increases INa. The second
domain, located downstream of amino acid 67 is absolutely required for
rENaC activity as assayed in the Xenopus oocyte expression
system.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
Progressive NH2-terminal
deletions of -rENaC. Oocytes were
co-injected with wt or mutant -rENaC and wt- and wt- -rENaC
(2.5 ng/cRNA/oocyte). Data are expressed as the ratio of
INa mutant/INa wt (i.e.
wt- , , -rENaC). The number of oocytes per group was 5-8.
Asterisks indicate significantly different from
wt- , , -rENaC (p < 0.001).
|
|
Deletion of Amino Acids 2-67 in -rENaC Enhances INa
by Increasing the Number of Channels in the Plasma Membrane: Single
Channel Analysis--
Deletion of amino acids 2-67 in -rENaC may
enhance INa by increasing: the number of channels in the
plasma membrane (N), the single channel open probability
(Po), and/or the single channel conductance
( ). To discriminate among these possibilities we conducted
patch-clamp analysis on cell-attached membrane patches in oocytes
expressing either wt- , , -rENaC or 2-67- , , -rENaC. Representative current records are depicted in Fig.
6. Deletion of amino acids 2-67 had no
effect on which, when measured using lithium as the permeant
cation, was 7.6 ± 0.3 pS for , , -rENaC (n = 6) and 7.2 ± 0.1 pS (n = 8: p > 0.2) for 2-67- , , -rENaC. The single channel conductance
using Na+ as the primary cation was also not affected by
truncation of the amino terminus of (5.4 ± 0.2 pS for
, , -rENaC and 5.1 ± 0.1 pS for
2-67- , , -rENaC). Truncation of the NH2 terminus of -rENaC also had no effect on the cation permeability of the channel. The PNa/PK was
82.0 ± 3.7 for , , -rENaC and 97.1 ± 8.7 for
2-67- , , -rENaC (n = 4: p > 0.1).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Representative single channel current records
of
wt- , , -rENaC
and
2-67- , , -rENaC
in cell-attached patches of oocytes. The pipette potential was
60 mV. There were 4 channels in the membrane patch expressing
wt- , , -rENaC and 9 channels in the membrane patch in oocytes
expressing 2-67- , , -rENaC. Dashed line indicates
the 0 current level (i.e. channels closed).
|
|
Deletion of amino acids 2-67 in -rENaC produced a striking and
significant increase in the number of active channels in the membrane
(N) but had no effect on Po. N was 6.3 ± 1.2 for , , -rENaC (n = 8) and 11.3 ± 1.2 for 2-67- , , -rENaC (n = 7:
p < 0.01). Furthermore, the Po
was similar in both groups of oocytes (0.32 ± 0.06 (n = 8) for , , -rENaC and 0.43 ± 0.03 for
2-67- , , -rENaC (n = 7: p > 0.1)). Thus, truncation of amino acids 2-67 in -rENaC enhanced
INa primarily by increasing the number of channels in the
plasma membrane.
Deletion of Amino Acids 2-67 in -rENaC Enhances INa
by Increasing the Number of Channels in the Plasma Membrane: Laser
Scanning Confocal Microscopy--
To provide independent support for
the patch-clamp studies, presented above, demonstrating that deletion
of amino acids 2-67 in -rENaC increased the number of channels in
the plasma membrane we examined plasma membrane expression of wt and
mutant rENaC by laser scanning confocal microscopy of GFP-tagged rENaC.
We co-expressed GFP- -rENaC and GFP- -rENaC with either
wt- -rENaC or 2-67- -rENaC. In a previous study we demonstrated
that the GFP tag on - and -rENaC does not have a positive or
negative effect on INa when co-expressed with
-rENaC.2 Moreover,
INa was also significantly higher in oocytes expressing 2-67- , GFP- , and GFP- -rENaC compared with oocytes
expressing wt- , GFP- , and GFP- -rENaC (5.23 ± 0.84 µA
versus 1.67 ± 0.35 µA: n = 6, p < 0.005). Thus, GFP had no effect on
INa.
As illustrated in Fig. 7, oocytes
expressing 2-67 , GFP- , and GFP- -rENaC had dramatically
more rENaC in the plasma membrane than oocytes expressing wt- ,
GFP- , and GFP- -rENaC. This observation confirms our patch-clamp
studies demonstrating that deletion of amino acids 2-67 in -rENaC
increased the number of channels in the plasma membrane.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7.
Representative images of oocytes injected
with water (Row 1) or oocytes expressing GFP-tagged
rENaC (Rows 2-4). Row 2: wt- ,
GFP- , GFP- -rENaC. Row 3: 2-67 , GFP- ,
GFP- -rENaC. Row 4: 2-109 , GFP- , GFP- -rENaC.
Proteins in the plasma membrane were labeled with biotin which was
detected with strepavidin conjugated to Texas Red (images in column
labeled a). The location of GFP-labeled rENaC is depicted in
green in panel b. Panel c is an overlay of
panels a and b. Co-localization of rENaC and the
plasma membrane are indicted in yellow. There was no visible
green fluorescence in water-injected oocytes. There was significantly
more wt- , GFP- , GFP- -rENaC in the membrane than 2-109 ,
GFP- , and GFP- -rENaC. However, there was more 2-67 ,
GFP- , and GFP- -rENaC in the membrane than wt- , GFP- ,
GFP -rENaC.
|
|
We have also begun to address the question why does deletion of amino
acids 2-109 in -rENaC eliminate INa? We considered two
possibilities. First, 2-109- , , -rENaC may not traffic to the plasma membrane. Second 2-109- , , -rENaC may traffic to the plasma membrane but does not form functional channels. To discriminate between these possibilities we co-expressed
2-109- -rENaC with GFP-tagged - and -rENaC subunits in
oocytes and examined the cellular distribution by laser scanning
confocal microscopy. 2-109- , GFP- -rENaC, and GFP- -rENaC
was expressed in the plasma membrane; however, the level of expression
was less than wt- , GFP- , and GFP- -rENaC (Fig. 7). Because we
could not detect INa in oocytes expressing
2-109- , , -rENaC this observation suggests that
2-10- , , -rENaC does not form functional channels in the membrane, as assayed in the Xenopus expression system, or
that expression is too low to detect by the two-electrode voltage clamp technique.
Deletion of Amino Acids 2-67 in -rENaC Increases the Half-life
of the Channel in the Plasma Membrane--
To determine if the
increased expression of 2-67- , , -rENaC channels in the
plasma membrane is due to an increase in the rate of delivery of
channels to the membrane and/or to a decrease in the rate of endocytic
retrieval of channels from the membrane we inhibited delivery of
channels to the plasma membrane with brefeldin A (BFA). BFA is a fungal
metabolite that inhibits the anterograde transport of newly synthesized
proteins from the endoplasmic reticulum to the Golgi apparatus (18,
30-32). Although BFA has many effects on vesicle transport it does not
affect clathrin-mediated endocytosis in Xenopus oocytes.
Moreover, BFA has no direct effect on rENaC channel activity and it is
fully reversible in oocytes (30). Addition of BFA reduced
INa in oocytes expressing , , -rENaC and
2-67- , , -rENaC (Fig. 8). We
determined the half-life of the channel in the membrane by measuring
the rate of decay of INa as a function of time after
addition of BFA to the incubation media. This half-life reflects the
rate of endocytic retrieval of rENaC from the
membrane.3 The half-life of
INa was 1.1 ± 0.2 h for oocytes expressing
, , -rENaC (n = 7) and 3.5 ± 1.3 h
for oocytes expressing 2-67- , , -rENaC (n = 7, p < 001). These data are most consistent with the
conclusion that deletion of amino acids 2-67 in -rENaC increased
the number of rENaC channels in the membrane by reducing endocytic
retrieval of channels from the plasma membrane.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 8.
The effect of brefeldin A (BFA) on
INa in oocytes injected with
wt- , , -rENaC
or
2-67- , , -rENaC.
cRNA for
wt- , , -rENaC
or
2-67- , , -rENaC
was injected into oocytes. Two days later, BFA (10 µg/ml) was
added to the bath solution at time 0 and INa was measured
at the time points indicated. The mean INa for
wt- , , -rENaC and 2-67- , , -rENaC were significantly
different at each time point (p < 0.01). Standard
error bars for some means are smaller than the symbol. The
half-life of INa was calculated using PRISM software
(Graphpad Software). The data were best fit to a single exponential. In
the absence of BFA, INa was constant for 8 h in
oocytes expressing both wt- , , -rENaC and
2-67- , , -rENaC.
|
|
 |
DISCUSSION |
The major new finding in this report is that the cytoplasmic,
NH2 termini of -, -, and -rENaC are required for
rENaC activity. Our data also demonstrate that the NH2
terminus of -rENaC contains two key domains. One domain, amino acids
47 to 50, regulates the endocytic retrieval of the channel from the
plasma membrane. The second domain, located downstream of amino acid
67, is required for channel function. Our data also reveal that
overexpression (10-fold) of -rENaC inhibits INa in
oocytes expressing wild-type -, -, and -channel subunits,
whereas overexpression (10-fold) of -rENaC enhances INa
in oocytes expressing wild-type -, -, and -channel subunits.
Lastly, we demonstrate that deletion of the cytoplasmic,
NH2 terminus of , , and produces a dominant negative mutant.
The Cytoplasmic, NH2 Terminus of -, -, and
-rENaC Is Required for Maximum Channel Activity--
The current
view on ENaC channel assembly and function is that all three subunits
are required for maximal channel activity and that the three subunits
assemble in the endoplasmic reticulum, are post-translationally
modified in the Golgi network, and traffic to the plasma membrane.
Consistent with this view we demonstrated that maximum INa
was observed when all three wild-type rENaC subunits were co-expressed
in oocytes. However, we also showed that substitution of any wt-rENaC
subunit with a N-truncated subunit reduced INa dramatically. Thus, we conclude that the cytoplasmic, NH2
terminus of -, -, and -rENaC is required for maximum channel
activity. Our data confirm and extend observations reporting the
importance of the cytoplasmic, NH2 terminus in rENaC
function. For example, Grunder et al. (17) demonstrated that
point substitutions of a highly conserved glycine residue with a serine
in the NH2 termini of -rENaC (G95S), -rENaC (G37S),
or -rENaC (G40S) dramatically reduced INa. Adams
et al. (16) reported that N -hENaC interacted with
-hENaC but failed to stimulate INa when coexpressed with -hENaC. In fact, co-expression of N -hENaC with -hENaC
decreased INa slightly, and reduced protein levels of
-hENaC (16) suggesting that interaction of N -hENaC with
-hENaC facilitated its degradation. It is interesting to note that
Adams et al. (16) also reported that at least two domains of
-hENaC interact with -hENaC: a domain located within amino acids
3-53 and another, unidentified domain. Accordingly, the ability of
-hENaC to contribute maximally to rENaC function may require that
-hENaC interacts with at least two domains in and perhaps with
domains in -hENaC. Abrogation of either interaction may be
sufficient to reduce channel activity. Finally, in a previous study we
demonstrated that deletion of amino acids 2-109 in -rENaC had no
effect on or Po when the truncated subunit
was studied in lipid bilayers (33). However, deletion of the
NH2 terminus changed the kinetic properties of the channel
(33). Given these observations it was somewhat surprising that we could
not measure an amiloride-sensitive current in oocytes expressing
2-109- , , -rENaC (Fig. 2) even though the channel was
expressed in the plasma membrane, although the expression was less than
wt- , GFP- , and GFP- -rENaC (Fig. 7). The most parsimonious
explanation for these observations is that 2-109 assembles with
- and -rENaC and traffics to the plasma membrane but the current
produced by the mutant channel is too low to detect by the
two-electrode voltage clamp technique.
The failure of N-rENaC subunits to support maximum channel activity
could be related to their inability to interact with wild-type subunits
and/or to traffic to the plasma membrane. Alternatively, or in
addition, it is possible that N-rENaC subunits interact with
wild-type subunits and traffic to the membrane: however, the
NH2 terminus of each subunit may be essential for channel activity. For example, the NH2 terminus is important in the
assembly of other multimeric ion channels, including the acetylcholine receptor and voltage-gated K+ channels (27, 28, 34, 35).
Moreover, the NH2 terminus of some channels, including
-rENaC, is involved in channel gating (33, 36, 37). Additional
studies, beyond the scope of the present report, are required to
elucidate the mechanism whereby deletion of the NH2 termini
reduces INa.
Overexpression of wt- and -rENaC Affects
INa--
Overexpression of -rENaC in oocytes expressing
-, -, and -rENaC inhibited INa whereas
overexpression of -rENaC in oocytes expressing -, -, and
-rENaC enhanced INa. Assuming that the amount of cRNA
injected into oocytes correlates with the amount of protein expressed,
these observations are consistent with the view that the relative
levels of expression of , , -rENaC regulates INa.
Thus, our data suggest that overexpression of -rENaC disrupts the
optimal stochiometry of , , -rENaC subunits whereas
overexpression of -rENaC enhances the optimal stochiometry of
, , -rENaC subunits. The view that varying the ratio of -,
-, and -rENaC subunit expression affects INa is
supported by two recent publications (22, 38). For example, inspection
of individual data points in Fig. 1 in Firsov et al. (38)
suggests that overexpression of -rENaC reduces INa in
oocytes expressing , , -rENaC. In addition, in oocytes
expressing - and -rENaC or - and -rENaC, variations in the
ratio of cRNA injection from 1:1 significantly decreased INa (22).
Deletion of the NH2 Terminus of -, -, and
-rENaC Produces a Dominant Negative Mutant--
When co-expressed
with wild-type -, -, and -rENaC subunits,
NH2-terminal mutants of each rENaC subunit dramatically
reduced INa. Thus, NH2-truncated-rENaC subunits
appear to be dominant negative mutants that displace wt subunits from
the multimeric ion channel complex. Overexpression of the cytoplasmic
NH2 termini of degenerins, which are closely related to
rENaC, also inhibits degenerin channel activity. Thus, the
NH2 terminus of the superfamily of ion channels that
includes the FMRFamide-gated Na+ channel, Na+
channels in brain (BNC1 and BNC2), and the degenerins of C. elegans that encode mechanosensitive channels (e.g.
DEG-1, MEC-4, and MEC-10) plays an important role in channel function
(4, 7).
A Domain between Amino Acids 47 and 50 (KGDK) in -rENaC
Regulates rENaC Endocytosis--
Our data suggest that amino acids
47-50 (KGDK) in -rENaC may be an endocytic motif that regulates the
number of channels in the plasma membrane. We report that deletion of
amino acids 2-41 or 2-46 in -rENaC had no effect on
INa; however, deletion of four additional amino acids
(i.e. KGDK 47-50) increased INa by ~4-fold
(Fig. 5). Additional deletions, including 2-55, 2-59, and
2-67 failed to increase INa further. Thus, deletion of
amino acids 47-50 (KGDK), a region which is conserved across species (11), increased INa. Several lines of evidence in this
report suggest that deletion of amino acids 47-50 enhances
INa by increasing the number of channels in the plasma
membrane and that the increase in the number of channels results from a
decline in the endocytic retrieval of rENaC from the plasma membrane.
Single channel patch-clamp studies demonstrated that the increase in
INa with 2-67- , , -rENaC compared with
, , -rENaC-rENaC was referable to an increase in the number of
channels in the membrane and not due to an increase in or
Po. We confirmed the electrophysiological data
by laser scanning confocal microscopy of GFP-tagged - and -rENaC
subunits. We observed a dramatic increase in the amount of 2-67 ,
GFP- , and GFP- -rENaC in the plasma membrane compared with wt- ,
GFP- , and GFP- -rENaC. Finally, inhibition of channel insertion
into the membrane with BFA revealed that deletion of amino acids 2-67 in -rENaC decreased the rate of decline of INa compared
with wt-rENaC, an observation consistent with the view that the amino terminus of -rENaC, in particular KGDK, is involved in the endocytic retrieval of channels from the plasma membrane. Truncation of a similar
motif (i.e. RGER) in furin, a mammalian endopeptidase, impairs its endocytosis (39). RGER is isoelectrically identical to
KGDK, consistent with the view that these amino acids may be an
endocytic motif which is important for rENaC internalization from the
plasma membrane.
One splice variant of human -ENaC subunit ( -hENaC2), extends the
length of the NH2 terminus by 59 amino acids, which
includes a second copy of the KGDK motif (29, 40). Thus, it can be predicted that -hENaC2 may have a different half-life than
-hENaC. The KGDK motif is present in rat, human (KDNK), bovine, and
mouse -ENaC, but is absence in chicken and frog -ENaC (11, 40). -hENaC has two translated products, one corresponding to the longest
open reading frame and another that uses an alternative translation
start codon that results in a protein missing the first 20 amino acids
in the NH2 terminus (40). Our data predict that -hENaC
missing the first 20 amino acids is functionally normal.
Ubiquitination of lysine residues (Lys) is important for rENaC
internalization, endocytosis, and channel degradation (32); thus, it is
possible that deletion of Lys47 and Lys50 in
-rENaC (i.e. KGDK) may increase INa by
reducing the endocytic retrieval of ubiquitinated rENaC from the plasma
membrane (32). However, in a previous study of -rENaC, point
substitutions of Lys47 and Lys50 to arginine
(i.e. RGDR which conserves charge but eliminates potential
sites for ubiquitination) did not increase INa or the amount of rENaC in the plasma membrane (32). Thus, it is unlikely that
deletion of Lys47 and Lys50 in -rENaC
increases INa by reducing the endocytic retrieval ubiquitinated of rENaC from the plasma membrane.
Summary and Conclusions--
The major new findings in this report
are that the cytoplasmic, NH2 termini of -, -, and
-rENaC are required for rENaC activity. Our data also demonstrate
that the NH2 terminus of -rENaC contains two key
domains. One domain, KGDK, that regulates the endocytic retrieval of
the channel from the plasma membrane. The second domain, located
downstream of amino acid 67 is required for channel function. Our data
also reveal that overexpression (10-fold) of -rENaC inhibits
INa measured in oocytes expressing wild-type -, -,
and -channel subunits, whereas overexpression (10-fold) of -rENaC
enhances INa measured in oocytes expressing wild-type -,
-, and -channel subunits. Lastly, we demonstrate that deletion of
the cytoplasmic, NH2 terminus of , , and produces
a dominant negative mutant. Additional studies are required to
elucidate fully the role of the NH2 terminus in each
subunit and to support the conclusion that KGDK is an endocytic motif.
 |
ACKNOWLEDGEMENT |
We thank Olivia Weale for valuable technical assistance.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants DK-34533, DK-51067, and DK-07301 (to B. A. S.) and
DK37206 (to D. J. B.) and a grant from the National Kidney
Foundation (to M. L. C).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of
Physiology, Dartmouth Medical School, 615 Remsen Bldg., Hanover, NH
03755-3836. Tel.: 603-650-1775; Fax: 603-650-1130; E-mail: Bruce
A.Stanton{at}Dartmouth.edu.
2
A. L. Langloh, B. Berdiev, H. Ji, K. Keyser, B. A. Stanton, and D. J. Benos, unpublished data.
3
This half-life does not strictly represent the
rate of endocytosis since recycling of endosomes containing rENaC back
to the membrane would result in an underestimate in the rate of endocytosis.
 |
ABBREVIATIONS |
The abbreviations used are:
ENaC, epithelial
sodium channel;
PCR, polymerase chain reaction;
bp, base pair(s);
EGFP, enhanced green fluorescent protein;
INa, amiloride-sensitive sodium current;
wt, wild-type;
BFA, brefeldin
A.
 |
REFERENCES |
| 1.
|
Garty, H.,
and Palmer, L. G.
(1997)
Physiol. Rev.
77,
359-396[Abstract/Free Full Text]
|
| 2.
|
Benos, D. J.,
Awayda, M. S.,
Berdiev, B. K.,
Bradford, A. L.,
Fuller, C. M.,
Senyk, O.,
and Ismailov, I. I.
(1996)
Kidney Int.
49,
1632-1637[Medline]
[Order article via Infotrieve]
|
| 3.
|
Voilley, N.,
Galibert, A.,
Bassilana, F.,
Renard, S.,
Lingueglia, E.,
Coscoy, S.,
Champigny, G.,
Hofman, P.,
Lazdunski, M.,
and Barbry, P.
(1997)
Comp. Biochem. Physiol. A
118,
193-200[CrossRef]
|
| 4.
|
Horisberger, J. D.
(1998)
Curr. Opin. Cell Biol.
10,
443-449[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Canessa, C. M.,
Schild, L.,
Buell, G.,
Thorens, B.,
Gautschi, I.,
Horisberger, J.-D.,
and Rossier, B. C.
(1994)
Nature
367,
463-467[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Lingueglia, E.,
Voilley, N.,
Waldmann, R.,
Lazdunski, M.,
and Barbry, P.
(1993)
FEBS Lett.
318,
95-99[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Fyfe, G. K.,
Quinn, A.,
and Canessa, C. M.
(1998)
Semin. Nephrol.
18,
138-151[Medline]
[Order article via Infotrieve]
|
| 8.
|
Canessa, C. M.
(1996)
News Physiol. Sci.
11,
195-201[Abstract/Free Full Text]
|
| 9.
|
Schild, L.,
Schneeberger, E.,
Gautschi, I.,
and Firsov, D.
(1997)
J. Gen. Physiol.
109,
15-26[Abstract/Free Full Text]
|
| 10.
|
Ismailov, I. I.,
Kieber-Emmons, T.,
Lin, C.,
Berdiev, B. K.,
Shlyonsky, V. G.,
Patton, H. K.,
Fuller, C. M.,
Worrell, R.,
Zuckerman, J. B.,
Sun, W.,
Eaton, D. C.,
Benos, D. J.,
and Kleyman, T. R.
(1997)
J. Biol. Chem.
272,
21075-21083[Abstract/Free Full Text]
|
| 11.
| Benos, D. J., and Stanton, B. A. (1999) J. Physiol., in press
|
| 12.
|
Schild, L.,
Lu, Y.,
Gautschi, I.,
Schneeberger, E.,
Lifton, R. P.,
and Rossier, B. C.
(1996)
EMBO J.
15,
2381-2387[Medline]
[Order article via Infotrieve]
|
| 13.
|
Tamura, H.,
Schild, L.,
Enomoto, N.,
Matsui, N.,
Marumo, F.,
and Rossier, B. C.
(1996)
J. Clin. Invest.
97,
1780-1784[Medline]
[Order article via Infotrieve]
|
| 14.
|
Shimkets, R. A.,
Warnock, D. G.,
Bositis, C. M.,
Nelson-Williams, C.,
Hansson, J. H.,
Schambelan, M.,
Gill, J. R., Jr.,
Ulick, S.,
Milora, R. V.,
Findling, J. W.,
Canessa, C. M.,
Rossier, B. C.,
and Lifton, R. P.
(1994)
Cell
79,
407-414[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Firsov, D.,
Schild, L.,
Gautschi, I.,
Mérillat, A. M.,
Schneeberger, E.,
and Rossier, B. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
15370-15375[Abstract/Free Full Text]
|
| 16.
|
Adams, C. M.,
Snyder, P. M.,
and Welsh, M. J.
(1997)
J. Biol. Chem.
272,
27295-27300[Abstract/Free Full Text]
|
| 17.
|
Grunder, S.,
Firsov, D.,
Chang, S. S.,
Fowler Jager, N.,
Gautschi, I.,
Schild, L.,
Lifton, R. P.,
and Rossier, B. C.
(1997)
EMBO J.
16,
899-907[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Prince, L. S.,
and Welsh, M. J.
(1998)
Biochem. J.
336,
705-710
|
| 19.
|
Canessa, C. M.,
Horisberger, J.,
and Rossier, B. D.
(1993)
Nature
361,
467-470[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Dascal, N.
(1987)
CRC Crit. Rev. Biochem. Mol. Biol.
22,
317-387[CrossRef]
|
| 21.
|
Chalfant, M. L.,
Denton, J. S.,
Berdiev, B. K.,
Ismailov, I. I.,
Benos, D. J.,
and Stanton, B. A.
(1999)
Am. J. Physiol. Cell Physiol.
276,
C477-C486[Abstract/Free Full Text]
|
| 22.
|
McNicholas, C. M.,
and Canessa, C. M.
(1997)
J. Gen. Physiol.
109,
681-692[Abstract/Free Full Text]
|
| 23.
|
Methfessel, C.,
Witzemann, V.,
Takahashi, T.,
Mishina, M.,
Numa, S.,
and Sakmann, B.
(1986)
Pflugers Arch.
407,
577-588[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Light, D. B.,
McCann, F. V.,
Keller, T. M.,
and Stanton, B. A.
(1988)
Am. J. Physiol.
255,
F278-F286[Abstract/Free Full Text]
|
| 25.
|
Awayda, M. S.,
Tousson, A.,
and Benos, D. J.
(1997)
Am. J. Physiol. Cell Physiol.
273,
C1889-C1899[Abstract/Free Full Text]
|
| 26.
|
Tucker, S. J.,
Bond, C. T.,
Herson, P.,
Pessia, M.,
and Adelman, J. P.
(1996)
J. Biol. Chem.
271,
5866-5870[Abstract/Free Full Text]
|
| 27.
|
Li, M.,
Jan, Y. N.,
and Jan, L. Y.
(1992)
Science
257,
1225-1230[Abstract/Free Full Text]
|
| 28.
|
Shen, N. V.,
Chen, X.,
Boyer, M. M.,
and Pfaffinger, P. J.
(1993)
Neuron
11,
67-76[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Voilley, N.,
Lingueglia, E.,
Champigny, G.,
Mattéi, M.-G.,
Waldmann, R.,
Lazdunski, M.,
and Barbry, P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
247-251[Abstract/Free Full Text]
|
| 30.
|
Shimkets, R. A.,
Lifton, R. P.,
and Canessa, C. M.
(1997)
J. Biol. Chem.
272,
25537-25541[Abstract/Free Full Text]
|
| 31.
|
Geering, K.,
Beggah, A.,
Good, P.,
Girardet, S.,
Roy, S.,
Schaer, D.,
and Jaunin, P.
(1996)
J. Cell Biol.
133,
1193-1204[Abstract/Free Full Text]
|
| 32.
|
Staub, O.,
Gautschi, I.,
Ishikawa, T.,
Breitschopf, K.,
Ciechanover, A.,
Schild, L.,
and Rotin, D.
(1997)
EMBO J.
16,
6325-6336[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Berdiev, B. K.,
Karlson, K. H.,
Jovov, B.,
Ripoll, P. J.,
Morris, R.,
Loffing-Cueni, D.,
Halpin, P.,
Stanton, B. A.,
Kleyman, T. R.,
and Ismailov, I. I.
(1998)
Biophys. J.
75,
2292-2301[Medline]
[Order article via Infotrieve]
|
| 34.
|
Verrall, S.,
and Hall, Z. W.
(1992)
Cell
68,
23-31[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Shen, N. V.,
and Pfaffinger, P. J.
(1995)
Neuron
14,
625-633[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Hoshi, T.,
Zagotta, W. N.,
and Aldrich, R. W.
(1990)
Science
250,
533-538[Abstract/Free Full Text]
|
| 37.
|
Zagotta, W. N.,
Hoshi, T.,
and Aldrich, R. W.
(1990)
Science
250,
568-571[Abstract/Free Full Text]
|
| 38.
|
Firsov, D.,
Gautschi, I.,
Merillat, A. M.,
Rossier, B. C.,
and Schild, L.
(1998)
EMBO J.
17,
344-352[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Voorhees, P.,
Deignan, E.,
van Donselaar, E.,
Humphrey, J.,
Marks, M. S.,
Peters, P. J.,
and Bonifacino, J. S.
(1995)
EMBO J.
14,
4961-4975[Medline]
[Order article via Infotrieve]
|
| 40.
|
Thomas, C. P.,
Auerbach, S.,
Stokes, J. B.,
and Volk, K. A.
(1998)
Am. J. Physiol.
274,
C1312-C1323
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
O. J. Mace, A. M. Woollhead, and D. L. Baines
AICAR activates AMPK and alters PIP2 association with the epithelial sodium channel ENaC to inhibit Na+ transport in H441 lung epithelial cells
J. Physiol.,
September 15, 2008;
586(18):
4541 - 4557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Mason, B. E. Jacobs, and P. A. Welling
AP-2-dependent Internalization of Potassium Channel Kir2.3 Is Driven by a Novel Di-hydrophobic Signal
J. Biol. Chem.,
March 7, 2008;
283(10):
5973 - 5984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. N. Helms, L. Liu, Y.-Y. Liang, O. Al-Khalili, A. Vandewalle, S. Saxena, D. C. Eaton, and H.-P. Ma
Phosphatidylinositol 3,4,5-Trisphosphate Mediates Aldosterone Stimulation of Epithelial Sodium Channel (ENaC) and Interacts with {gamma}-ENaC
J. Biol. Chem.,
December 9, 2005;
280(49):
40885 - 40891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Snyder
Minireview: Regulation of Epithelial Na+ Channel Trafficking
Endocrinology,
December 1, 2005;
146(12):
5079 - 5085.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-P. Ma and D. C. Eaton
Acute Regulation of Epithelial Sodium Channel by Anionic Phospholipids
J. Am. Soc. Nephrol.,
November 1, 2005;
16(11):
3182 - 3187.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Bachhuber, J. Konig, T. Voelcker, B. Murle, R. Schreiber, and K. Kunzelmann
Cl- Interference with the Epithelial Na+ Channel ENaC
J. Biol. Chem.,
September 9, 2005;
280(36):
31587 - 31594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. A. Itani, J. R. Campbell, J. Herrero, P. M. Snyder, and C. P. Thomas
Alternate promoters and variable splicing lead to hNedd4-2 isoforms with a C2 domain and varying number of WW domains
Am J Physiol Renal Physiol,
November 1, 2003;
285(5):
F916 - F929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Booth, Q. Tong, J. Medina, P. M. Snyder, P. Patel, and J. D. Stockand
A Region Directly Following the Second Transmembrane Domain in {gamma}ENaC Is Required for Normal Channel Gating
J. Biol. Chem.,
October 17, 2003;
278(42):
41367 - 41379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Bruns, B. Hu, Y. J. Ahn, S. Sheng, R. P. Hughey, and T. R. Kleyman
Multiple epithelial Na+ channel domains participate in subunit assembly
Am J Physiol Renal Physiol,
October 1, 2003;
285(4):
F600 - F609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-A. Konstas and C. Korbmacher
The gamma -subunit of ENaC is more important for channel surface expression than the beta -subunit
Am J Physiol Cell Physiol,
February 1, 2003;
284(2):
C447 - C456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Hendron, P. Patel, M. Hausenfluke, N. Gamper, M. S. Shapiro, R. E. Booth, and J. D. Stockand
Identification of Cytoplasmic Domains within the Epithelial Na+ Channel Reactive at the Plasma Membrane
J. Biol. Chem.,
September 6, 2002;
277(37):
34480 - 34488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Bonny and B. C. Rossier
Disturbances of Na/K Balance: Pseudohypoaldosteronism Revisited
J. Am. Soc. Nephrol.,
September 1, 2002;
13(9):
2399 - 2414.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kellenberger and L. Schild
Epithelial Sodium Channel/Degenerin Family of Ion Channels: A Variety of Functions for a Shared Structure
Physiol Rev,
July 1, 2002;
82(3):
735 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Snyder
The Epithelial Na+ Channel: Cell Surface Insertion and Retrieval in Na+ Homeostasis and Hypertension
Endocr. Rev.,
April 1, 2002;
23(2):
258 - 275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Giovannardi, G. Forlani, M. Balestrini, E. Bossi, R. Tonini, E. Sturani, A. Peres, and R. Zippel
Modulation of the Inward Rectifier Potassium Channel IRK1 by the Ras Signaling Pathway
J. Biol. Chem.,
March 29, 2002;
277(14):
12158 - 12163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-P. Ma, S. Saxena, and D. G. Warnock
Anionic Phospholipids Regulate Native and Expressed Epithelial Sodium Channel (ENaC)
J. Biol. Chem.,
March 1, 2002;
277(10):
7641 - 7644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Jovov, B. K. Berdiev, C. M. Fuller, H.-L. Ji, and D. J. Benos
The Serine Protease Trypsin Cleaves C Termini of beta - and gamma -Subunits of Epithelial Na+ Channels
J. Biol. Chem.,
February 1, 2002;
277(6):
4134 - 4140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Volk, P. M. Snyder, and J. B. Stokes
Regulation of Epithelial Sodium Channel Activity through a Region of the Carboxyl Terminus of the alpha -Subunit. EVIDENCE FOR INTRACELLULAR KINASE-MEDIATED REACTIONS
J. Biol. Chem.,
November 16, 2001;
276(47):
43887 - 43893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Rotin, V. Kanelis, and L. Schild
Trafficking and cell surface stability of ENaC
Am J Physiol Renal Physiol,
September 1, 2001;
281(3):
F391 - F399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Butterworth, S. I. Helman, and W. J. Els
cAMP-sensitive endocytic trafficking in A6 epithelia
Am J Physiol Cell Physiol,
April 1, 2001;
280(4):
C752 - C762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-L. Ji, M. L. Chalfant, B. Jovov, J. P. Lockhart, S. B. Parker, C. M. Fuller, B. A. Stanton, and D. J. Benos
The Cytosolic Termini of the beta - and gamma -ENaC Subunits Are Involved in the Functional Interactions between Cystic Fibrosis Transmembrane Conductance Regulator and Epithelial Sodium Channel
J. Biol. Chem.,
September 1, 2000;
275(36):
27947 - 27956.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. P. Thomas, R. W. Loftus, K. Z. Liu, and O. A. Itani
Genomic organization of the 5' end of human beta -ENaC and preliminary characterization of its promoter
Am J Physiol Renal Physiol,
May 1, 2002;
282(5):
F898 - F909.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|