J Biol Chem, Vol. 274, Issue 46, 32936-32942, November 12, 1999
The Membrane Binding Domains of Prostaglandin Endoperoxide H
Synthases 1 and 2
PEPTIDE MAPPING AND MUTATIONAL ANALYSIS*
Andrew G.
Spencer,
Elizabeth
Thuresson,
James C.
Otto,
Inseok
Song
,
Tim
Smith,
David L.
DeWitt,
R. Michael
Garavito, and
William L.
Smith§
From the Department of Biochemistry, Michigan State University,
East Lansing, Michigan 48824 and the
University of Seoul,
Department of Life Science, Seoul 130-743, South Korea
 |
ABSTRACT |
Prostaglandin endoperoxide H synthases 1 and 2 (PGHS-1 and -2) are the major targets of nonsteroidal anti-inflammatory
drugs. Both isozymes are integral membrane proteins but lack
transmembrane domains. X-ray crystallographic studies have led to the
hypothesis that PGHS-1 and -2 associate with only one face of the
membrane bilayer through a novel, monotopic membrane binding domain
(MBD) that is comprised of four short, consecutive, amphipathic
-helices (helices A-D) that include residues 74-122 in ovine
PGHS-1 (oPGHS-1) and residues 59-108 in human PGHS-2 (hPGHS-2).
Previous biochemical studies from our laboratory showed that the MBD of
oPGHS-1 lies somewhere between amino acids 25 and 166. In studies
reported here, membrane-associated forms of oPGHS-1 and hPGHS-2 were
labeled using the hydrophobic, photoactivable reagent
3-trifluoro-3-(m-[125I]iodophenyl)diazirine,
isolated, and cleaved with AspN and/or GluC, and the photolabeled
peptides were sequenced. The results establish that the MBDs of oPGHS-1
and hPGHS-2 reside within residues 74-140 and 59-111, respectively,
and thus provide direct provide biochemical support for the hypothesis
that PGHS-1 and -2 do associate with membranes through a monotopic MBD.
We also prepared HelA, HelB, and HelC mutants of oPGHS-1, in which, for
each helix, three or four hydrophobic residues expected to protrude
into the membrane were replaced with small, neutral residues. When
expressed in COS-1 cells, HelA and HelC mutants exhibited little or no
catalytic activity and were present, at least in part, as misfolded
aggregates. The HelB mutant retained about 20% of the cyclooxygenase
activity of native oPGHS-1 and partitioned in subcellular fractions
like native oPGHS-1; however, the HelB mutant exhibited an extra site of N-glycosylation at Asn104. When this
glycosylation site was eliminated (HelB/N104Q mutation), the mutant
lacked cyclooxygenase activity. Thus, our mutational analyses indicate
that the amphipathic character of each helix is important for the
assembly and folding of oPGHS-1 to a cyclooxygenase active form.
 |
INTRODUCTION |
Prostaglandin endoperoxide H synthases 1 and 2 (PGHS-1 and
-2)1 catalyze the formation
of PGH2 from arachidonic acid, the committed step in the
biosynthesis of prostanoids (1). Specific synthases downstream of PGHSs
form what are considered to be the biologically active prostanoids
including PGE2, PGF2
, PGI2,
PGD2, and thromboxane A2 (1, 2). Prostanoids
coordinate cellular responses important to numerous physiological
functions. PGHS-1 is expressed constitutively in nearly all mammalian
tissues and is the source of prostaglandins central to
"housekeeping" functions such as renal water reabsorption, vascular
homeostasis, and gastric patency (1, 2). PGHS-2 is absent from most
cells but can be rapidly and dramatically induced in many cell types
upon treatment with inflammatory cytokines, growth factors,
v-src, and tumor promoters (3-11). Products formed through
the action of this isoform appear to play a role in cell growth and
differentiation (12).
PGHS isozymes share 60% primary sequence identity (11, 13), and x-ray
crystal structures of the proteins are virtually superimposable
(14-16). Kinetic profiles suggest similar if not identical reaction
mechanisms (1, 17). There are, however, significant differences between
the two isozymes with respect to their pharmacological profiles and
each isozyme plays an independent role in cell physiology (18-21).
PGHS-1 and -2 qualify as integral membrane proteins because they can be
solubilized only by treatment of membranes with detergents and not with
chaotropic salts (22, 23). These isozymes are localized to the luminal
surfaces of the endoplasmic reticulum and the inner and outer membranes
of the nuclear envelope (24-27). x-ray crystallographic studies
demonstrate that both isozymes are homodimers with each monomer
consisting of a small epidermal growth factor domain at the N terminus,
a putative membrane binding domain of about 50 amino acids, and a large
globular catalytic domain (14-16) (Fig. 1). Neither isozyme contains
structural motifs known to confer membrane association to integral
membrane proteins (e.g. transmembrane domains or prenylation
sites). Instead, PGHS-1 and -2 are thought to associate with cellular
membranes through a novel, monotopic membrane binding domain (MBD) that
interdigitates into only one leaflet of the lipid bilayer (14-16)
(Fig. 1). The MBD of PGHSs contain four short, consecutive, amphipathic
-helices (labeled A-D in Fig. 1A).
Hydrophobic and aromatic residues protrude from these helices and away
from the hydrophilic surface of the catalytic domain to create a
hydrophobic patch predicted to facilitate interaction with an
underlying lipid layer. These helices also surround an opening through
which fatty acid substrates are believed to enter the cyclooxygenase
active site.
It is important to our understanding of PGHS biology and the structural
biology of membrane proteins in general to understand how PGHS-1 and -2 interact with cellular membranes. In this report, we describe
experiments designed to identify and characterize biochemically the
regions of PGHS-1 and PGHS-2 that interact with cellular membranes by
using a combination of photoaffinity labeling with
3-trifluoro-3-(m-[125I]iodophenyl)diazirine
([125I]TID) (28) and mutagenic analyses of the
-helices proposed to be involved in membrane binding.
 |
EXPERIMENTAL PROCEDURES |
Materials--
All materials were purchased from Sigma unless
otherwise noted. [125I]TID, DEAE-Sepharose, and Protein
A-Sepharose were purchased from Amersham Pharmacia Biotech. The
nonionic detergent C10E6 was purchased from
Anatrace, Inc. Dulbecco's modified Eagle's medium was from Life
Technologies, Inc. Fetal bovine serum and bovine calf serum were from
Hyclone. CsCl was from Roche Molecular Biochemicals. Arachidonic acid
was purchased from Cayman Chemical Co. Oligonucleotides were from the
Macromolecular Structure Facility at Michigan State University.
Nickel-NTA was purchased from Qiagen. N-Isopropyliodoacetic
acid was from Molecular Probes, Inc. PVDF membranes were from Millipore Corp.
Preparation of Microsomal oPGHS-1 and hPGHS-2--
Microsomes
containing oPGHS-1 were prepared from sheep seminal vesicles
essentially as described previously (29, 30) and assayed for protein
using the Bio-Rad Bradford protein assay reagent. Microsomal hPGHS-2
was prepared from Sf21 insect cells that had been infected with
baculovirus containing the coding region for hPGHS-2 engineered to
contain a hexahistidine tag near the N
terminus.2 Sf21 insect
cells were grown in 500-ml spinner flasks or in a 12-liter bioreactor
in Sigma TC-100 medium containing 10% fetal calf serum. When the cell
density had reached 1.8 × 106 cells/ml, cells were
infected with baculovirus encoding His-tagged hPGHS-2. Infection was
allowed to proceed for 3 days. Approximately 9.0 × 108 Sf21 cells were harvested by centrifugation and
resuspended in 10 ml of 0.1 M Tris-HCl, pH 7.4. Cells were
then disrupted by vigorous sonication using a microtip attachment to a
Misonix sonicator. After low speed (10,000 × g for 10 min) centrifugation to pellet cell debris, microsomal membranes were
collected by centrifugation at 200,000 × g for 60 min
in a Beckman SW50.1 swinging bucket rotor. The microsomal pellet was
resuspended in 2 ml of 0.1 M Tris-HCl, pH 7.4, Dounce-homogenized, and assayed for protein using the Bio-Rad Bradford
protein assay reagent.
[125I]TID Labeling of PGHS-1 and -2--
Steps in
this procedure were carried out at 4 °C unless otherwise noted.
[125I]TID was ordered as soon as possible after its
synthesis and used within 1 week. Microsomal preparations of oPGHS-1 or
hPGHS-2 were prepared as described above and resuspended to a final
protein concentration of 15-20 mg/ml in the appropriate buffer.
Aliquots (400 µl) were preincubated in the presence of 80 µM flurbiprofen to block the ability of
[125I]TID to label the PGHS active site (30). In some
experiments, 200 mM reduced glutathione was included to
scavenge [125I]TID exposed to the aqueous phase. In no
case did glutathione scavenging affect the [125I]TID
labeling pattern (data not shown), indicating that
[125I]TID was only labeling portions of PGHS within the
hydrophobic core of the membrane (28, 30). To each 400-µl aliquot of
microsomal protein, approximately 50 µCi of [125I]TID
was added to a final concentration of 10-12 µM,
depending on the lot. After incubation for 10 min, resuspended
microsomes were transferred to a quartz cuvette (path length = 1 cm) and irradiated for 5 min with a UV illuminator (366 nm) held at a distance of 5 cm. Labeled membrane proteins were solubilized using the
detergent C10E6 at a concentration of 1% (v/v)
for 1 h with gentle shaking. oPGHS-1 or hPGHS-2 was purified from
the solubilized membrane protein fraction using immunoprecipitation or
nickel-agarose, respectively.
Immunoprecipitation of oPGHS-1 from Solubilized
Microsomes--
Following [125I]TID labeling,
solubilized microsomal membrane proteins were transferred to a fresh
tube. A monoclonal antibody directed against oPGHS-1 (50 ml; 0.1 mg/ml)
(31) was added to the solubilized proteins, and the sample was allowed
to incubate with shaking for 30 min at 4 °C. PGHS-1 was precipitated
by the addition of 100 ml of Protein A-Sepharose as described by the manufacturer. The immunocomplex was collected by centrifugation at
500 × g for 10 min on a table top microcentrifuge and
washed three times with 0.1 M Tris-HCl, pH 8.0, containing
0.1% Tween 20. To elute immunoprecipitated oPGHS-1, the immunocomplex
was resuspended in 0.5% recrystallized SDS and boiled for 5 min with periodic vortexing. The Protein A-Sepharose was collected by
centrifugation, the supernatant containing the immunopurified,
[125I]TID-labeled oPGHS-1 was collected, and the
supernatant protein was then denatured, reduced, and alkylated prior to proteolysis.
Purification of His-tagged PGHS-2 by Nickel
Chromatography--
Following labeling with [125I]TID,
solubilized microsomal hPGHS-2 was placed in a 15-ml conical tube and
diluted 3-fold with buffer A (10 mM sodium phosphate, 100 mM NaCl, 20 mM imidazole, pH 7.2). Washed
nickel-NTA (1 ml) was added, and the tube was incubated at 4 °C with
gentle shaking for 1 h. Nickel-NTA was collected by centrifugation
at 1200 rpm for 2 min in a Beckman table top centrifuge, and the resin
was washed three times for 5 min in wash buffer (10 mM
sodium phosphate, 500 mM NaCl, 30 mM imidazole,
0.1% C10E6, pH 7.2). Photoaffinity-labeled
hPGHS-2 was eluted from the nickel-NTA by incubation in elution buffer (10 mM sodium phosphate, 200 mM NaCl, 200 mM imidazole, pH 7.2) for 1 h at 4 °C. hPGHS-2
eluted from nickel-NTA was dialyzed against 10 mM Tris-HCl,
pH 8.5, and further purified by anion exchange chromatography. hPGHS-2
bound to DEAE-Sepharose at pH 8.5 and was eluted with 50 mM
Tris-HCl, pH 6.5. Eluted protein was concentrated using a Millipore
Ultra-Free concentrator to a volume of approximately 400 µl and
dialyzed against 10 mM Tris-HCl, pH 8.2, prior to
denaturation, reduction, and alkylation.
Denaturation, Alkylation, Reduction, and Proteolysis of oPGHS-1
and hPGHS-2--
Prior to denaturation,
[125I]TID-labeled protein samples were concentrated to a
volume of 25 µl. Samples were denatured by incubation in 6 M guanidinium hydrochloride (final concentration) at
55 °C for 3 h. Freshly prepared 1 M dithiothreitol
was then added to a final concentration of 10 mM. After
covering with argon, the sample was incubated at 55 °C for 2 h.
Reduced disulfide bridges were prevented from reforming by the addition
of 7 µl of freshly prepared N-isopropyliodoacetic acid
(2.3 mg/100 µl in 20% methanol) and incubation at room temperature
in the dark for 1 h. After the alkylation step, samples were
dialyzed against 4 liters of either 0.05 M
NH4HCO3, pH 7.9 (for GluC digestion) or 10 mM Tris-HCl, pH 8.5 (for AspN digestion) for 12-15 h in a
Fisher 0.5-ml Slide-A-Lyzer (molecular mass = 10,000 Da). Prior to
proteolysis, samples were concentrated in a SpeedVac to a volume of
approximately 50 µl. Endoproteinase GluC or AspN was added such that
the final ratio of protease to PGHS-1/-2 was approximately 1:50.
Digestions were performed at 37 °C for 20-24 h. Proteolytic
fragments were analyzed by SDS-PAGE as described below.
SDS-PAGE and Analysis of Proteolytic Products--
The following
precautions were employed to prevent the N-terminal blockage of
peptides separated by SDS-PAGE: (a) highly purified, fresh
acrylamide reagents and buffers were used to prepare slab gels;
(b) the gels were allowed to polymerize overnight at room temperature before use; and (c) recrystallized SDS was used
in all buffers and gels. Proteolytic peptides or untreated controls were separated on 16% acrylamide slab gels and transferred to PVDF
membranes for Western analysis or autoradiography. Small molecular
weight peptides generated by AspN treatment were separated using 10%
T, 3% C Tris-Tricine gels exactly as described by Schagger and
von-Jagow (32). Autoradiography was performed by (a)
sandwiching the PVDF membrane between two intensifying screens and
exposing to Amersham Hyperfilm-MP for 4 days at
80 °C or
(b) exposing the PVDF membrane to a phosphor screen
(Molecular Dynamics, Inc.) for 2 days. In the former case, Stratagene
Glogos II fluorescent markers were used to orient the film to the PVDF
membrane prior to excision of [125I]TID-labeled peptides.
Immunoblot visualization of PGHS-1 or -2 and their proteolytic products
was done as described previously (29). Antibodies against hPGHS-2 were
directed against amino acids 20-40 at the N terminus (Santa Cruz
Biotechnology, Inc.). An antibody recognizing the N terminus of oPGHS-1
was directed against amino acids 25-35 (29).
Microsequencing of Radiolabeled Proteolytic Peptides--
Using
the autoradiograph as a template, [125I]TID-labeled
peptides were excised from PVDF membranes and cut into
1-mm2 squares with clean razor blades. Amino-terminal amino
acid sequence analysis was performed in collaboration with Dr. Joseph
Leykam of the Michigan State University Macromolecular Structure
Facility using automated Edman degradation in an Applied Biosystems
477A gas phase amino acid sequencer. Phenylthiohydantoin-derivatives were identified by high pressure liquid chromatography.
Preparation of oPGHS-1 Mutants--
Mutants were prepared
starting with M13mp19-oPGHS-1, which contains a 2.3-kilobase pair
SalI fragment encoding native oPGHS-1, according to the
method of Kunkel et al. (33) using a Bio-Rad kit
essentially as described previously (34). The following mutagenic
oligonucleotides were used in the preparation of mutations in the
membrane binding domain of oPGHS-1: HelA (I74T/W75S/W77S/L78T) 5'-312CCCGGAGACATCGACCTCGACCCGGACGAC341-3';
HelB (F88S/F91S/L92A)
5'-353AGCCCCTCTTCCATCCACTCTGCGCTGACGCACGGG388-3';
HelC (W98S/L99A/F102S)
5'-383CACGGGCGCTCGGCTTGGGATTCTGTCAATGCCACC418-3'.
Phage samples were sequenced using the dideoxy method to identify
mutants (35). A double mutant, HelAB, was constructed by a second round
of mutagenesis using the HelB oligonucleotide primer and M13mp-oPGHS-1
(HelA) as the original template. The 2.3-kilobase pair insert from the
replicative form of M13mp19-oPGHS-1 containing the desired mutations
was isolated and subcloned into pSVT7 (34). Plasmids used for
transfection were purified by CsCl gradient ultracentrifugation. The
additional N104Q mutation in HelB was prepared using the Promega Gene
Editor mutagenesis kit (mutagenic oligonucleotide:
5'-CTTTGGGATTTTGTCCAGGCCACCTTCATCCGG-3'). Mutations were reconfirmed by
double-stranded sequencing of the pSVT7 constructs using Sequenase
(version 2.0, U.S. Biochemical Corp.) and the protocol described by the manufacturer.
Expression and Harvesting of Native and Mutant oPGHS-1 in COS-1
Cells--
COS-1 cell transfections were performed essentially as
described previously (29) except that cells were harvested 18 h
post-transfection. Differential centrifugation was used to prepare
membrane and soluble fractions of the cells. Cells were harvested and
then homogenized by sonication using a Misonix microtip sonicator.
Following sonication, the sample was centrifuged at 10,000 × g for 10 min to collect nuclei and dense cell debris. This
latter pellet was designated 10P. The supernatant was subjected to
ultracentrifugation at 200,000 × g for 60 min. The
resulting pellet and supernatant were designated 200P and 200S,
respectively. The 200P fraction was a microsomal fraction and was used
for (a) all enzymatic activity assays, (b) initial solubility experiments, and (c) 10P, 200P, and 200S
fractionation experiments.
Solubilization of Native and Mutant oPGHS-1 from COS-1 Cell
Membranes--
Microsomal membranes were isolated from COS-1 cells
expressing native or mutant oPGHS-1 as described previously (29).
Preparations were diluted to a final protein concentration of 4 mg/ml.
Tween 20 was added to a final concentration of 1%, and the membranes were incubated on ice for 1 h. Membranes were recollected by
centrifugation at 200,000 × g for 60 min. Supernatants
containing solubilized protein were transferred to a clean tube and
boiled in SDS-PAGE sample buffer. Microsomal and pelleted fractions
were resuspended, homogenized, and boiled in SDS-PAGE sample buffer.
Quantitation of oPGHS-1 in supernatant and pellet fractions observed
following SDS-PAGE was performed using a Bio-Rad GS-505 Molecular
Imaging System and Molecular Analyst software.
Isolation of nuclei in the absence of detergent was performed exactly
as described previously (27). Nuclei were resuspended in Hanks'
balanced saline solution and incubated in the presence or absence of
0.2% saponin, 1.0% saponin, 1.0% Tween 20, or 0.1% Nonidet P-40.
After incubation for 30 min on ice, nuclei were collected by
centrifugation at 1000 × g. The supernatants were collected, transferred to clean tubes, and boiled in the presence of
SDS-PAGE sample buffer. Nuclear pellets were resuspended, sonicated, and boiled in the presence of SDS-PAGE sample buffer. The presence of
immunoreactive oPGHS-1 in each supernatant and pellet was determined by
Western blotting analysis.
Enzymatic Deglycosylation of
oPGHS-1--
N-Deglycosylation of oPGHS-1 was performed
essentially as described (29). Briefly, solubilized microsomes from
COS-1 cells expressing native or mutant oPGHS-1 were incubated in the
presence of 50 milliunits of endoglycosidase H in 50 mM
NaH2PO4, pH 5.7, at 37 °C. After 12-h
digestions, samples were analyzed by Western blotting.
Cyclooxygenase and Peroxidase Assays--
Cyclooxygenase assays
were performed using an oxygen electrode as described with 100 µM arachidonate as substrate (36). Peroxidase assays were
performed spectrophotometrically on a Perkin-Elmer model 552A Double
Beam UV-visible spectrophotometer by measuring the oxidation of
3,3,3',3'- tetramethylenephenylenediamine at 611 nm (13, 37).
 |
RESULTS |
[125I]TID is a hydrophobic molecule that partitions
into membranes and upon photoactivation yields a carbene that, in turn,
reacts nonspecifically with both lipid and protein constituents of the membranes (28). Previous studies using [125I]TID labeling
of oPGHS-1 in ovine seminal vesicle microsomes had established that the
radiolabel was incorporated into a 20.5-kDa peptide that included
residues 25-166 (30). The putative membrane binding domains of oPGHS-1
and hPGHS-2 are predicted to include residues 74-122 and 59-108,
respectively (Fig. 1B).
Accordingly, our experiments were designed to determine if a peptide
containing only these residues could be photolabeled with
[125I]TID.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 1.
Structure of ovine PGHS-1 and sequences of
the membrane binding domains of ovine PGHS-1 and human PGHS-2.
A, each monomer of homodimeric oPGHS-1 contains three
folding domains including a globular catalytic domain, an epidermal
growth factor domain, and a putative membrane binding domain
(arrows) (14). The putative membrane binding domain consists
of four amphipathic -helices (labeled A-D). Hydrophobic
side chains are shown protruding from helices A-C. B, amino
acid sequences of the putative membrane binding domains of oPGHS-1 and
hPGHS-2. Amino acids forming the amphipathic -helices are
underlined. Predicted proteolytic cleavage products for GluC
(8 kDa) and AspN (6.2 kDa) are shown ([dharrow]) along with their
predicted molecular masses.
|
|
Photolabeling of the oPGHS-1 Membrane Binding Domain--
Ovine
seminal vesicle microsomes containing oPGHS-1 were preincubated with
flurbiprofen and photolabeled with [125I]TID, and, as
expected (30), oPGHS-1 was the major [125I]TID-labeled
membrane protein (data not shown). SDS-PAGE of
[125I]TID-labeled oPGHS-1 immunoprecipitated from
solubilized microsomes revealed a single radioactive band (Fig.
2A) that was recognized, upon
Western transfer blotting, by an oPGHS-1-specific antibody (Fig.
2B). Analysis of the primary structure of oPGHS-1 predicts that cleavage of the enzyme with endoproteinase GluC will yield an
8-kDa peptide containing amino acids 74-140 (Fig. 1B).
Accordingly, [125I]TID-labeled, immunoprecipitated
oPGHS-1 was denatured in guanidinium hydrochloride and subjected to
exhaustive proteolysis with endoproteinase GluC. Separation of the GluC
proteolysis products by SDS-PAGE, transfer to PVDF membranes, and
subsequent autoradiography revealed an 8-kDa,
[125I]TID-labeled peptide (Fig. 2A). A small
amount of a radiolabeled 14-kDa peptide was found that was recognized
by an antibody directed against amino acids 25-35 (Fig.
2B); the 14-kDa peptide probably represents incompletely
digested oPGHS-1 containing residues 25-140. We attempted to confirm
the identity of the 8-kDa photoaffinity-labeled peptide from Fig.
2A by N-terminal sequence analysis. Unfortunately, this was
unsuccessful because the sequencing background was unacceptably high,
apparently because of contaminating peptides derived from GluC-digested
IgG molecules used to immunoprecipitate the oPGHS-1.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 2.
[125I]TID labeling of oPGHS-1
and hPGHS-2 and peptides derived from their proteolytic cleavage.
oPGHS-1 and hPGHS-2 were labeled with [125I]TID,
purified, and digested with GluC or AspN as indicated and as detailed
under "Experimental Procedures." Proteolytic products were
separated by SDS-PAGE and analyzed by autoradiography and
immunoblotting. A, autoradiograph of undigested and
GluC-digested [125I]TID-labeled oPGHS-1. B,
immunoblot of the PVDF membrane from A using an antibody
against amino acids 25-35 of oPGHS-1. C, phosphor image
generated by autoradiography of undigested and GluC-digested
[125I]TID-labeled hPGHS-2. D, immunoblot of
the PVDF membrane from C using an antibody directed against
amino acids 20-40 of hPGHS-2. E, autoradiograph of GluC or
AspN products of hPGHS-2 separated with Tricine SDS-PAGE gels. In
B and D, GluC (35 kDa) reacted nonspecifically
with the secondary antibody used to visualize the anti-PGHS antibodies.
The molecular mass markers on the left apply to
A-D; the molecular mass markers on the right
apply to E.
|
|
Photolabeling of the hPGHS-2 Membrane Binding Domain--
hPGHS-2
was engineered to contain a hexa-His tag and expressed in Sf21
insect cells using a baculovirus expression system. The
Km, Vmax, and subcellular
localization of His-tagged hPGHS-2 were indistinguishable from those of
the native enzyme, suggesting that the His-tagged hPGHS-2 is folded and
associated with membranes in a native fashion.2 To
determine which regions of hPGHS-2 were associated with the endoplasmic
reticulum, microsomal membranes from Sf21 cells expressing His-tagged hPGHS-2 were prepared and photoaffinity-labeled with [125I]TID. Analysis of the purified hPGHS-2 by SDS-PAGE
revealed a single [125I]TID-labeled band at the expected
molecular mass, 70-72 kDa (Fig. 2C). This protein band was
reactive with an antibody directed against the N terminus of hPGHS-2
(Fig. 2D).
The primary structure of PGHS-2 predicts that treatment with
endoproteinase GluC will yield proteolytic products that include an
8-kDa fragment containing amino acids 59-126 (Fig. 1B).
This region includes the predicted membrane binding domain with amino acids 59-108. Exhaustive proteolysis of
[125I]TID-labeled hPGHS-2 with endoproteinase GluC
followed by autoradiography revealed a single radioactive peptide of 8 kDa (Fig. 2C). The 8-kDa fragment was not recognized by
antibodies directed against amino acids 20-40 of hPGHS-2 (Fig.
2D). These observations suggested that the membrane binding
domain of hPGHS-2 lies between residues 59 and 126. To confirm this,
the 8-kDa [125I]TID-labeled peptide from Fig.
2C was excised from the PVDF membrane and subjected to 15 rounds of N-terminal sequence analysis. The N-terminal sequence of this
peptide was FLTRIKLFLKPTPNT, which corresponds to amino acids 59-73.
Thus, the 8-kDa radioactive peptide containing the
[125I]TID-labeled portion of hPGHS-2 consists of amino
acids 59-126. This region contains the corresponding four amphipathic
-helices predicted to serve as the membrane binding domain of
hPGHS-2 (16).
Further mapping of the membrane-associated portion of hPGHS-2 was
accomplished by exhaustive digestion of [125I]TID-labeled
hPGHS-2 with endoproteinase AspN (Fig. 1B). AspN treatment
of hPGHS-2 resulted in a single radioactive band of approximately 6.2 kDa (Fig. 2E). This radiolabeled peptide was smaller than
the 8-kDa, radiolabeled GluC product and was of a size similar to that
of the four-helix hPGHS-2 membrane binding domain containing amino
acids 59-109. N-terminal sequence analysis of the radioactive AspN
product identified three peptides, one including residues 59-111 of
hPGHS-2 (6.2 kDa), another corresponding to residues 384-428 of
hPGHS-2 (6.1 kDa), and an unknown trace contaminant. The hPGHS-2
fragment consisting of amino acids 59-111 apparently resulted from
promiscuous cleavage of the protein by AspN at Glu58 and
Asp111; AspN has been reported to cleave proteins at Glu
residues under normal proteolytic conditions (38, 39). Thus, AspN
peptide mapping provided further evidence consistent with an hPGHS-2
membrane binding domain involving amino acids 59-109.
Mutations in the Membrane Binding Domain of oPGHS-1--
To begin
examining the role of hydrophobic amino acids within the membrane
binding domain, three different sets of mutations were introduced into
helices A-C, respectively, of oPGHS-1 (Figs. 1 and
3). Hydrophobic residues oriented away
from the body of the enzyme and expected to interdigitate with the
membrane lipids were replaced by smaller neutral or hydrophilic side
chains. The mutants were designated HelA (I74T/W75S/W77S/L78T), HelB
(F88S/F91S/L92A), and HelC (W98S/L99A/F102S). Helix D was not altered,
because this latter helix is part of the hydrophobic channel involved
in binding arachidonic acid, and mutations in this region were expected
to yield inactive enzyme (36, 40). Each of the mutant proteins was
expressed in COS-1 cells. As summarized in Table
I, enzymatic assays of microsomal
membranes prepared from the cells revealed that the HelB mutant protein
retained approximately 20% of the native cyclooxygenase and peroxidase
activities, and HelC retained very low, but detectable levels of
activity (~1% of native enzyme) measured by radio thin layer
chromatography (not shown), while the HelA mutant was catalytically
inactive. The electrophoretic mobilities of the HelA, HelB, and HelC
mutants were examined by SDS-PAGE (Fig. 3A). Interestingly,
the HelB and HelC mutants exhibited a 74-kDa band in addition to the
native 72-kDa band. Native oPGHS-1 is glycosylated at three of four
consensus N-glycosylation sites (Asn68,
Asn144, and Asn410) and has an observed
molecular mass of 72 kDa (29). The 74-kDa bands seen for HelB and HelC
mutants appear to result from an additional N-glycosylation
at a consensus N-glycosylation site at Asn104
located in helix C of the membrane binding domain that in native oPGHS-1 is not glycosylated. Consistent with this is the finding that
treatment of each of the three mutant proteins with endoglycosidase H
reduced their molecular masses to 66 kDa (Fig. 3A).
Additionally, another HelB mutant was prepared and designated
HelB/N104Q; this mutant exhibited a 72-kDa but not a 74-kDa band on
SDS-PAGE (Fig. 3B). The HelB/N104Q mutant lacked
cyclooxygenase activity but exhibited a low level of peroxidase
activity. In contrast, N104Q oPGHS-1 retains 45-50% of both
peroxidase and cyclooxygenase activities of native oPGHS-1 (29). Our
results suggest that the additional N-glycosylation
occurring In the HelB mutant partially compensates for a complete loss
of cyclooxygenase activity induced by mutations in residues in helix B,
which are expected to protrude into the membrane.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 3.
Western blot analysis of ovine PGHS-1 helix
mutant proteins. A, microsomes prepared from
transfected COS-1 cells expressing native or mutant oPGHSs-1 were
incubated in the presence or absence of endoglycosidase H (Endo
H) as described under "Experimental Procedures." Proteins were
resolved by SDS-PAGE, transferred to nitrocellulose, and visualized
using an antibody against the amino terminus of oPGHS-1. B,
microsomal proteins prepared from COS-1 cells expressing native, HelB,
or HelB/N104Q were separated by SDS-PAGE, transferred to
nitrocellulose, and visualized using a polyclonal antibody raised
against oPGHS-1. C, transfected COS-1 cells were homogenized
and separated into 10P, 200P, and 200S fractions by differential
centrifugation as detailed under "Experimental Procedures."
Proteins in each of the fractions were resolved by SDS-PAGE and
transferred to nitrocellulose membranes for Western transfer blot
analysis using an antibody against the amino terminus of oPGHS-1.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Cyclooxygenase and peroxidase activities of oPGHS-1 membrane binding
domain mutants
Microsomal membranes from COS-1 cells that were sham-transfected or
transfected with plasmids encoding native oPGHS-1 or oPGHS-1 mutants
were assayed for cyclooxygenase and peroxidase activities as described
under "Experimental Procedures" and are displayed as a
percentage ± S.D. of the activities of native oPGHS-1 expressed
in COS-1 cells. These experiments were performed using a minimum of
three transfections and with measurements made in triplicate and
yielded similar results with each transfection.
|
|
Native PGHS-1 is normally associated with the membrane pellets derived
from centrifugation at 10,000 × g and 200,000 × g (10P and 200P). To determine if mutations in the membrane
binding domain of oPGHS-1 were sufficient to disrupt its association
with membranes, COS-1 cells expressing native oPGHS-1 or HelA, HelB, or
HelC mutants were homogenized and subjected to differential
centrifugation (Fig. 3C). All three mutant proteins were
equally distributed between the 10P and 200P fractions. No
immunoreactive reactive material was observed in the 200S supernatant
fraction from native or mutant oPGHS-1. Thus, mutations in the
individual helices A, B, and C are insufficient to solubilize PGHS-1
from cellular membranes. The distribution of cyclooxygenase activity
for the HelB mutant between the 10P, 200P, and 200S fractions (43, 57, and 0%, respectively) following differential centrifugation was
similar to that seen for native oPGHS-1.
The lack of enzymatic activity in the HelA protein and the low activity
of the HelC protein raised the possibility that these mutant proteins
were not retaining native structure and were mostly present as unfolded
aggregates that precipitated with membrane fractions. We examined this
possibility by determining the ability of each mutant protein to be
solubilized by detergents. Treatment of microsomes from COS-1 cells
expressing native PGHS-1, HelA, HelB, or HelC with 1% Tween 20 indicated that greater percentages of native PGHS-1 and HelB (66 and
50%, respectively) were solubilized from membranes as compared with
HelA and HelC (38 and 32%, respectively) (Fig.
4A). To further explore this
apparent difference in the solubility of the mutant proteins, we
expressed HelA, HelB, and a double mutant (HelAB) in COS-1 cells and
incubated nuclei isolated from these cells in the presence or absence
of various detergents (Fig. 4B). Regardless of the detergent
used for solubilization, HelA and HelAB were always more difficult to
solubilize from membranes than HelB, which displayed a solubilization
pattern similar to that of the native enzyme. These observations
suggest that a significant portion of HelA and HelC is present as
unfolded aggregates when overexpressed in COS-1 cells.

View larger version (89K):
[in this window]
[in a new window]
|
Fig. 4.
Detergent solubilization of oPGHS-1 helix
mutants. A, microsomes were prepared from COS-1 cells
expressing native, HelA, HelB, or HelC oPGHS-1, and samples were
incubated in the presence of Tween 20 for 1 h and subjected to
ultracentrifugation as detailed under "Experimental Procedures."
Solubilized and membrane-associated oPGHS-1 was visualized with an
antibody against amino acids 25-35. B, nuclear membranes
were isolated from COS-1 cells expressing native oPGHS-1, HelA, HelB,
or a double mutant, HelAB. Equivalent samples were incubated in the
presence or absence of various detergents as described under
"Experimental Procedures." Following solubilization, proteins were
separated by SDS-PAGE, transferred to nitrocellulose, and visualized
with an antibody against the amino terminus of oPGHS-1. s,
supernatant; p, pellet; st, oPGHS-1 standard;
Sap., saponin, Tween, Tween 20; NP-40,
Nonidet P-40.
|
|
 |
DISCUSSION |
Integral membrane proteins utilize one or more of a variety of
mechanisms to associate with lipid bilayers. G protein-linked receptors
(41) and ion channels (42) as well as single pass membrane proteins
such as cytochrome P450s (43, 44) use hydrophobic
-helices that span
both leaflets of the membrane lipid bilayer, whereas porins traverse
the bilayer using antiparallel
-barrels (45). Other proteins
including monomeric and heteromeric G proteins associate with membranes
via fatty acyl and/or prenyl groups (46). PGHS-1 and PGHS-2 are
integral membrane proteins in that they can only be solubilized with
detergents, but these enzymes lack established structural motifs known
to confer membrane association. In 1994, Picot et al. (14)
observed an amphipathic domain consisting of four short
-helices in
the crystal structure of oPGHS-1 and proposed that this domain anchors
the protein monotopically (47) within one face of the membrane (Fig.
1A). The major aim of this study was to test further this
prediction using direct biochemical analyses.
Biochemical identification of PGHS membrane binding domains was based
on the characterization of radiolabeled peptides derived from oPGHS-1
and hPGHS-2 after treatment of the proteins in their membrane-associated forms with [125I]TID. This latter
reagent partitions primarily into membranes and, under appropriate
conditions, labels only those portions of proteins that reside within
the lipid bilayer (28, 30, 48). Radioactive peptides resulting from
GluC and AspN cleavage of [125I]TID-labeled hPGHS-2 were
unequivocally identified by N-terminal sequence analysis, and the
results establish that a peptide consisting of amino acids 59-111 is
associated with the lipid bilayer. Because the hypothesized membrane
binding domain of hPGHS-2 is composed of residues 59-109, our studies
support the concept that the four amphipathic
-helices present in
this segment of the protein are embedded in the lipid bilayer and thus
compose the membrane binding domain of this isozyme. Parallel
experiments with oPGHS-1 yielded results that also are consistent with
the observations made with hPGHS-2. We were unable to confirm the
identity of the [125I]TID-labeled peptide derived from
oPGHS-1, but taken together with previous work demonstrating selective
[125I]TID labeling of a peptide containing amino acids
25-166 (30), our observation of a single 8-kDa radioactive
GluC-derived peptide indicates that a region of oPGHS-1 consisting of
amino acids 74-140 is membrane-associated.
Our conclusions based on biochemical identification of the
membrane-associated domain of PGHSs are consistent with recent functional studies of the PGHS membrane binding domains (49). When
overexpressed in NIH 3T3 cells, green fluorescent protein fusion
proteins containing the PGHS-1 and -2 membrane binding domains and
epidermal growth factor domains associate with cellular membranes, but
green fluorescent protein-PGHS proteins lacking the membrane binding
domain do not. Again, these studies indicate that the domain containing
the four amphipathic
-helices are necessary to permit the
interactions of PGHSs with membranes. Moreover, PGHS-1 and-2 appear not
to require other proteins in order to interact with membranes, since
purified oPGHS-1 (50) and hPGHS-22 both bind to
phospholipid vesicles.
A series of mutations were made in three of the four
-helices of
oPGHS-1 in order to determine the relative importance of the individual
-helices in membrane binding. In each case, the mutants remained
membrane-associated but were catalytically inactive or nearly
catalytically inactive with respect to both peroxidase and
cyclooxygenase activities. With the HelA and HelC mutants, at least a
portion of the protein molecules appeared to form misfolded aggregates,
which could not be solubilized efficiently. The HelB mutant retained
activity, but this apparently resulted from an unexpected but
compensatory glycosylation of Asp104. When this residue was
replaced with a glutamine, the HelB mutant lost activity, whereas the
corresponding mutant in native oPGHS-1 retains approximately 50% of
its activity (29). Overall, we interpret the results of studies with
the MBD mutants to indicate that appropriate folding of enzyme requires
that each of the membrane binding domain
-helices needs to be
structurally intact. The roles of individual amino acids need to be
investigated further.
The structures of several types of protein domains involved in
reversible Ca2+- and/or lipid-dependent
monotopic association with membranes have been determined (51-53).
However, until recently, PGHS-1 and -2 were the only integral membranes
that appeared to interact with membranes monotopically.
Crystallographic analysis of a bacterial squalene cyclase revealed a
structural motif similar to that observed in PGHSs-1 and -2 and
suggested that this type of domain may be used by integral membrane
biosynthetic enzymes whose substrate is derived directly from the lipid
bilayer (54, 55). Although the three-dimensional fold of PGHS and the
squalene cyclase are similar, there is no sequence similarity between
the proteins. However, both proteins are homodimeric and possess
hydrophobic patches that protrude away from the hydrophilic catalytic
domains. Monotopic membrane binding domains like those of the PGHSs and squalene cyclase appear to be positioned in such a way to allow direct
substrate access to the active site. This would be thermodynamically favorable, since hydrophobic substrates like arachidonate and squalene
are not likely to be released directly into an aqueous environment. The
membrane binding domains of PGHS and squalene cyclase appear to
function as (a) membrane anchors and (b)
continuous hydrophobic tunnels from the site of substrate release to
the active site. There has not yet been biochemical confirmation that the predicted membrane binding domain of the squalene cyclase is
membrane-associated.
The catalytic domains of PGHS-1 and -2 share 70% of their primary
structure, while the membrane binding domains of the enzymes are only
38% identical. An interesting question is whether sequence differences
in the membrane binding domains of PGHS-1 and -2 may promote their
association with distinct phospholipid microdomains within cellular
membranes. Interactions between membrane proteins and polar head groups
of phospholipids have been shown to be of biological importance and
appear to form in vivo (54, 56-58). It is conceivable that
the phospholipid microenvironment immediately surrounding an integral
membrane protein may affect its biological activity by promoting or
restricting access of the protein to various components of the cellular
membrane. In the case of PGHS-1 and -2, the overall charge of the MBD
is 2.75 and 6.0, respectively.3 It is not
known whether these differences in the membrane binding domain confer
differential activities of PGHS-1 or -2.
The depth at which the individual amino acids lie within the PGHS
membrane binding domain is unknown. Although [125I]TID
labels only those parts of a protein associated with the hydrophobic
core of a lipid bilayer, it labels nonspecifically in a manner that
makes depth determinations for individual amino acids difficult. In
making the mutant versions of oPGHS-1 (HelA, HelB, and HelC), we
changed residues that, based on charge and polarity, might be expected
to interact with phospholipid head groups. Only HelB seemed to fold in
a native state, retaining 20% of the native cyclooxygenase and
peroxidase activities. Changing the amphipathic character of helices A
and C resulted in their apparent misfolding. Interestingly, the three
HelB mutations replaced native PGHS-1 residues with side chains similar
in charge and polarity to the corresponding residues in PGHS-2.
In summary, we have provided biochemical evidence that the membrane
binding domains of ovine PGHS-1 and human PGHS-2 are contained within
residues 74-140 and 59-111, respectively. These results are
consistent with crystallographic predictions of a new kind of monotopic
membrane binding domain. Our results support this hypothesis and supply
new information characterizing a novel membrane association strategy
that may be used by other lipid biosynthetic enzymes.
 |
ACKNOWLEDGEMENT |
We thank Dr. Joseph Leykam of the Michigan
State University Macromolecular Structure Facility for assistance with
N-terminal sequence analysis.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant DK22042.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Rm. 513, Biochemistry
Bldg., Dept. of Biochemistry, Michigan State University, East Lansing,
MI 48824. Tel.: 517-353-8680; Fax: 517-353-9334; E-mail:
smithww@pilot.msu.edu.
2
A. C. Spencer, T. Smith, and D. L. DeWitt, unpublished results.
3
L. Kuhn, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
PGHS, prostaglandin
endoperoxide H synthase;
PG, prostaglandin;
hPGHS-2, human PGHS-2;
oPGHS-1, ovine PGHS-1;
MBD, membrane binding domain;
NTA, nitrilotriacetic acid;
PVDF, polyvinylidene difluoride;
PAGE, polyacrylamide gel electrophoresis;
Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.
 |
REFERENCES |
| 1.
|
Smith, W. L.,
Garavito, R. M.,
and DeWitt, D. L.
(1996)
J. Biol. Chem.
271,
33157-33160[Free Full Text]
|
| 2.
|
Smith, W. L.,
and DeWitt, D. L.
(1996)
Adv. Immunol.
62,
167-215[Medline]
[Order article via Infotrieve]
|
| 3.
|
Raz, A.,
Wyche, A.,
Jiyi, F.,
Seibert, K.,
and Needleman, P.
(1990)
Adv. Prostaglandin Thromboxane Leukotriene Res.
20,
22-27[Medline]
[Order article via Infotrieve]
|
| 4.
|
Jones, D. A.,
Carlton, D. P.,
McIntyre, T. M.,
Zimmerman, G. A.,
and Prescott, S. M.
(1993)
J. Biol. Chem.
268,
9049-9054[Abstract/Free Full Text]
|
| 5.
|
Hulkower, K. I.,
Wertheimer, S. J.,
Levin, W.,
Coffey, J. W.,
Anderson, C. M.,
Chen, T.,
DeWitt, D.,
Crowl, M.,
Hope, W. C.,
and Morgan, D. W.
(1994)
Arthritis Rheum.
37,
653-661[Medline]
[Order article via Infotrieve]
|
| 6.
|
Guan, Z.,
Buckman, S. Y.,
Pentland, A. P.,
Templeton, D. J.,
and Morrison, A. R.
(1998)
J. Biol. Chem.
273,
12901-12908[Abstract/Free Full Text]
|
| 7.
|
Foegh, M. L.
(1989)
in
Prostaglandins in Clinical Practice
(Watkins, W. D.
, and David, W., eds)
, pp. 131-140, Raven Press, New York
|
| 8.
|
Evett, G. E.,
Xie, W.,
Chipman, J. G.,
Robertson, D. L.,
and Simmons, D. L.
(1993)
Arch. Biochem. Biophys.
306,
169-177[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Xie, W.,
and Herschman, H. R.
(1996)
J. Biol. Chem.
271,
31742-31748[Abstract/Free Full Text]
|
| 10.
|
Xie, W.,
and Herschman, H. R.
(1995)
J. Biol. Chem.
270,
27622-27628[Abstract/Free Full Text]
|
| 11.
|
Kujubu, D. A.,
Fletcher, B. S.,
Varnum, B. C.,
Lim, R. W.,
and Herschman, H. R.
(1991)
J. Biol. Chem.
266,
12866-12872[Abstract/Free Full Text]
|
| 12.
|
Masferrer, J. L.,
Zweifel, B. S.,
Manning, P. T.,
Hauser, S. D.,
Leahy, K. M.,
Smith, W. G.,
Isakson, P. C.,
and Seibert, K.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
3228-3232[Abstract/Free Full Text]
|
| 13.
|
DeWitt, D. L.,
El-Harith, E. A.,
Kraemer, S. A.,
Andrews, M. J.,
Yao, E. F.,
Armstrong, R. L.,
and Smith, W. L.
(1990)
J. Biol. Chem.
265,
5192-5198[Abstract/Free Full Text]
|
| 14.
|
Picot, D.,
Loll, P. J.,
and Garavito, M.
(1994)
Nature
367,
243-249[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Kurumbail, R. G.,
Stevens, A. M.,
Gierse, J. K.,
McDonald, J. J.,
Stegeman, R. A.,
Pak, J. Y.,
Gildenaus, D.,
Miyashiro, J. M.,
Penning, T. D.,
Seibert, K.,
Isakson, P. C.,
and Stallings, W. C.
(1996)
Nature
384,
644-648[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Luong, C.,
Miller, A.,
Barnett, J.,
Chow, J.,
Ramesha, C.,
and Browner, M. F.
(1996)
Nat. Struct. Biol.
3,
927-933[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Kulmacz, R. J.,
Pendleton, R. B.,
and Lands, W. E.
(1994)
J. Biol. Chem.
269,
5527-5536[Abstract/Free Full Text]
|
| 18.
|
Laneuville, O.,
Breuer, D. K.,
DeWitt, D. L.,
Hla, T.,
Funk, C. D.,
and Smith, W. L.
(1994)
J. Pharmacol. Exp. Ther.
271,
927-934[Abstract/Free Full Text]
|
| 19.
|
Laneuville, O.,
Breuer, D. K.,
Xu, N.,
Huang, Z. H.,
Gage, D. A.,
Watson, J. T.,
Lagarde, M.,
DeWitt, D. L.,
and Smith, W. L.
(1995)
J. Biol. Chem.
270,
19330-19336[Abstract/Free Full Text]
|
| 20.
|
Langenbach, R.,
Morham, S. G.,
Tiano, H. F.,
Loftin, C. D.,
Ghanayem, B. I.,
Chulada, P. C.,
Mahler, J. F.,
Goulding, E. H.,
Kluckman, K. D.,
Kim, H. S.,
and Smithies, O.
(1995)
Cell
83,
483-493[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Morham, S. G.,
Langenbach, R.,
Loftin, C. D.,
Tiano, H. F.,
Vouloumanos, N.,
Jennette, J. C.,
Mahler, J. F.,
Kluckman, K. D.,
Ledford, A.,
Lee, C. A.,
and Smithies, O.
(1995)
Cell
83,
473-482[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Van der Ouderaa, F. J.,
Buytenhek, M.,
Nugteren, D. H.,
and Van-Dorp, D. A.
(1977)
Biochim. Biophys. Acta
487,
315-331[Medline]
[Order article via Infotrieve]
|
| 23.
|
van der Ouderaa, F. J. G.,
and Buytenhek, M.
(1982)
Methods Enzymol.
86,
60-69[Medline]
[Order article via Infotrieve]
|
| 24.
|
Otto, J. C.,
and Smith, W. L.
(1994)
J. Biol. Chem.
269,
19868-19875[Abstract/Free Full Text]
|
| 25.
|
Regier, M. K.,
DeWitt, D. L.,
Schindler, M. S.,
and Smith, W. L.
(1993)
Arch. Biochem. Biophys.
301,
439-444[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Morita, I.,
Schindler, M.,
Regier, M. K.,
Otto, J. C.,
Hori, T.,
DeWitt, D. L.,
and Smith, W. L.
(1995)
J. Biol. Chem.
270,
10902-10908[Abstract/Free Full Text]
|
| 27.
|
Spencer, A. G.,
Woods, J. W.,
Arakawa, T.,
Singer, I. I.,
and Smith, W. L.
(1998)
J. Biol. Chem.
273,
9886-9893[Abstract/Free Full Text]
|
| 28.
|
Brunner, J.,
and Semenza, G.
(1981)
Biochemistry
20,
7174-7182[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Otto, J. C.,
DeWitt, D. L.,
and Smith, W. L.
(1993)
J. Biol. Chem.
268,
18234-18242[Abstract/Free Full Text]
|
| 30.
|
Otto, J. C.,
and Smith, W. L.
(1996)
J. Biol. Chem.
271,
9906-9910[Abstract/Free Full Text]
|
| 31.
|
DeWitt, D. L.,
Rollins, T. E.,
Day, J. S.,
Gauger, J. A.,
and Smith, W. L.
(1981)
J. Biol. Chem.
256,
10375-10382[Free Full Text]
|
| 32.
|
Schagger, H.,
and von-Jagow, G.
(1987)
Anal. Biochem.
166,
368-379[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Kunkel, T. A.,
Roberts, J. D.,
and Zakour, R. A.
(1987)
Methods Enzymol.
154,
367-382[Medline]
[Order article via Infotrieve]
|
| 34.
|
Shimokawa, T.,
and Smith, W. L.
(1991)
J. Biol. Chem.
266,
6168-6173[Abstract/Free Full Text]
|
| 35.
|
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467[Abstract/Free Full Text]
|
| 36.
|
Rieke, C. J.,
Mulichak, A. M.,
Garavito, R. M.,
and Smith, W. L.
(1999)
J. Biol. Chem.
274,
17109-17114[Abstract/Free Full Text]
|
| 37.
|
Kulmacz, R. J.
(1987)
Prostaglandins
34,
225-240[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Ingrosso, D.,
Fowler, A. V.,
Bleibaum, J.,
and Clarke, S.
(1989)
Biochem. Biophys. Res. Commun.
162,
1528-1534[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Tetaz, T.,
Morrison, J. R.,
Andreou, J.,
and Fidge, N. H.
(1990)
Biochem. Int.
22,
561-566[Medline]
[Order article via Infotrieve]
|
| 40.
|
Bhattacharyya, D. K.,
Lecomte, M.,
Rieke, C. J.,
Garavito, R. M.,
and Smith, W. L.
(1996)
J. Biol. Chem.
271,
2179-2184[Abstract/Free Full Text]
|
| 41.
|
Hamm, H. E.
(1998)
J. Biol. Chem.
273,
669-672[Free Full Text]
|
| 42.
|
Unwin, N.
(1993)
J. Mol. Biol.
229,
1101-1124[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Ruan, K.-H.,
Wang, L.-H.,
Wu, K. K.,
and Kulmacz, R. J.
(1993)
J. Biol. Chem.
268,
19483-19490[Abstract/Free Full Text]
|
| 44.
|
Szczesna-Skorupa, E.,
Chen, C. D.,
Rogers, S.,
and Kemper, B.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
14793-14798[Abstract/Free Full Text]
|
| 45.
|
Schulz, G. E.
(1996)
Curr. Opin. Struct. Biol.
6,
485-490[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Booden, M. A.,
Baker, T. L.,
Solski, P. A.,
Der, C. J.,
Punke, S. G.,
and Buss, J. E.
(1999)
J. Biol. Chem.
274,
1423-1431[Abstract/Free Full Text]
|
| 47.
|
Blobel, G.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
1496-1500[Abstract/Free Full Text]
|
| 48.
|
Blanton, M. P.,
and Cohen, J. B.
(1992)
Biochemistry
31,
3738-3750[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Li, Y.,
Smith, T.,
Grabski, S.,
and DeWitt, D. L.
(1998)
J. Biol. Chem.
273,
29830-29837[Abstract/Free Full Text]
|
| 50.
|
Strittmatter, P.,
Machuga, E. T.,
and Roth, G. J.
(1982)
J. Biol. Chem.
257,
11883-11886[Abstract/Free Full Text]
|
| 51.
|
Perisic, O.,
Fong, S.,
Lynch, D. E.,
Bycroft, M.,
and Williams, R. L.
(1998)
J. Biol. Chem.
273,
1596-1604[Abstract/Free Full Text]
|
| 52.
|
Kent, C.
(1997)
Biochim. Biophys. Acta
1348,
79-90[Medline]
[Order article via Infotrieve]
|
| 53.
|
Fushman, D.,
Najmabadi-Haske, T.,
Cahill, S.,
Zheng, J.,
LeVine, H., III,
and Cowburn, D.
(1998)
J. Biol. Chem.
273,
2835-2843[Abstract/Free Full Text]
|
| 54.
|
Wendt, K. U.,
Poralla, K.,
and Schulz, G. E.
(1997)
Science
277,
1811-1815[Abstract/Free Full Text]
|
| 55.
|
Wendt, K. U.,
Lenhart, A.,
and Schulz, G. E.
(1999)
J. Mol. Biol.
286,
175-187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Movileanu, L.,
Popescu, D.,
Victor, G.,
and Turcu, G.
(1997)
Biosystems
40,
263-275[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Paris, S.,
Beraud-Dufour, S.,
Robineau, S.,
Bigay, J.,
Antonny, B.,
Chabre, M.,
and Chardin, P.
(1997)
J. Biol. Chem.
272,
22221-22226[Abstract/Free Full Text]
|
| 58.
|
Haverstick, D. M.,
and Glaser, M.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
4475-4479[Abstract/Free Full Text]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
U. R. Mbonye, C. Yuan, C. E. Harris, R. S. Sidhu, I. Song, T. Arakawa, and W. L. Smith
Two Distinct Pathways for Cyclooxygenase-2 Protein Degradation
J. Biol. Chem.,
March 28, 2008;
283(13):
8611 - 8623.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yamashita, T. Shinohara, S. Tsuji, Q. N. Myrvik, A. Nishiyama, R. A. Henriksen, and Y. Shibata
Catalytically Inactive Cyclooxygenase 2 and Absence of Prostaglandin E2 Biosynthesis in Murine Peritoneal Macrophages following In Vivo Phagocytosis of Heat-Killed Mycobacterium bovis Bacillus Calmette-Guerin
J. Immunol.,
November 15, 2007;
179(10):
7072 - 7078.
[Abstract]
[Full Text]
[PDF]
|
 |
|