Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bacolla, A.
Right arrow Articles by Wells, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bacolla, A.
Right arrow Articles by Wells, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 46, 33011-33019, November 12, 1999


Recombinant Human DNA (Cytosine-5) Methyltransferase
II. STEADY-STATE KINETICS REVEAL ALLOSTERIC ACTIVATION BY METHYLATED DNA*

Albino BacollaDagger , Sriharsa Pradhan§, Richard J. Roberts§, and Robert D. Wells

From the Center for Genome Research, Institute of Biosciences and Technology, Texas A & M University, Texas Medical Center, Houston, Texas 77030-3303 and § New England Biolabs, Beverly, Massachusetts 01915

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Initial velocity determinations were conducted with human DNA (cytosine-5) methyltransferase (DNMT1) on unmethylated and hemimethylated DNA templates in order to assess the mechanism of the reaction. Initial velocity data with DNA and S-adenosylmethionine (AdoMet) as variable substrates and product inhibition studies with methylated DNA and S-adenosylhomocysteine (AdoHcy) were obtained and evaluated as double-reciprocal plots. These relationships were linear for plasmid DNA, exon-1 from the imprinted small nuclear ribonucleoprotein-associated polypeptide N, (CGG·CCG)12, (m5CGG·CCG)12, and (CGG·CCG)73 but were not linear for (CGG·Cm5CG)12. Inhibition by AdoHcy was apparently competitive versus AdoMet and uncompetitive/noncompetitive versus DNA at <= 20 µM AdoMet. Addition of the product (methylated DNA) to unmethylated plasmid DNA increased Vmax(app) resulting in mixed stimulation and inhibition. Velocity equations indicated a two-step mechanism as follows: first, activation of DNMT1 by methylated DNA that bound to an allosteric site, and second, the addition of AdoMet and DNA to the catalytic site. The preference of DNMT1 for hemimethylated DNA may be the result of positive cooperativity of AdoMet binding mediated by allosteric activation by the methylated CG steps. We propose that this activation plays a role in vivo in the regulation of maintenance methylation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The genome of most organisms contains modified nucleotides including N6-methyladenine, N4-methylcytosine, and C5-methylcytosine (m5C)1 (1-3). However, both the biological significance and the types of DNA methylation differ greatly between prokaryotes and eukaryotes. In prokaryotes, most modified bases participate in restriction-modification, a defense mechanism that protects the host from heterologous phage infection (4). In addition, N6-methyladenine plays a role in the initiation of DNA replication (5) and in post-replicative methyl-directed mismatch repair (6).

In higher eukaryotes, DNA methylation is confined to m5C and is implicated in the regulation of development, genomic imprinting (7, 8), X chromosome inactivation, gene expression (9), and retrotransposon inactivation (10-12). In mammals, the patterns of methylation are inherited from both parental genomes but are erased and reconstructed (de novo methylation) in somatic cells following implantation (13, 14). Such patterns are then copied and maintained by hemimethylation of the daughter strands during semiconservative DNA synthesis in S phase (maintenance methylation) (15, 16). However, the mechanisms by which both de novo and maintenance methylation occur remain to be elucidated.

Several DNA methyltransferases have been isolated from human and mouse (17-20), but it is not clear whether the de novo and maintenance methylations are carried out by separate proteins in vivo or whether both activities are shared by one or more enzymes (21-26). Nevertheless, a role for in vivo methylation has been established for isoforms of the human DNMT1 gene (27, 28) whose product, DNMT1, methylates C at a CG dinucleotide step, both in single-stranded and double-stranded, unmethylated or hemimethylated, templates (29-34). Hemimethylated templates are the most effective for the reaction, and methylation rates increase in the neighborhood of pre-existing m5C residues (35-38). However, little is known about the mechanisms responsible for this preference.

DNMT1 has a bipartite structure with the C-terminal 570 amino acids containing the catalytic domain. This region shares sequence homologies with all prokaryotic type II cytosine-5 methyltransferases (39, 40), including a PC dipeptide motif that is part of the catalytic center in the crystal structures of M.HhaI (41) and M.HaeIII (42), and the binding site for S-adenosylmethionine (AdoMet), the methyl donor for methyltransferases (43, 44). The remaining ~1000 N-terminal amino acids, which are not present in the prokaryotic enzymes, contain a nuclear localization signal, a replication foci targeting sequence (15), and are important in the discrimination between unmethylated and hemimethylated substrates (33).

Herein, we report kinetic analyses with the human full-length, recombinant, DNMT1 on a variety of DNA substrates with the aim of learning about the mechanism of the methyl transfer reaction and the role of DNA in regulating the enzyme activity. The results confirm the preference of DNMT1 for pre-methylated DNA; however, the kinetics reveal a complex behavior with DNA substrates that are bound more tightly. The reaction follows a sequential mechanism whereby both substrates (DNA and AdoMet) must bind to the enzyme before any product (methylated DNA and AdoHcy) is released and is consistent with a two-step process. First, DNMT1 binds DNA at an allosteric site (probably in the N-terminal domain) and activates the catalytic center, and second, AdoMet and the DNA (which may either be the same molecule bound to the regulatory site or a new DNA molecule) occupy the catalytic site. Allosteric binding of pre-methylated CG is proposed to increase the accessibility of AdoMet to the catalytic center, which then results in an acceleration of the reaction rate.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Enzyme Assay for Initial Velocities in the Absence of Products-- Recombinant DNMT1 was expressed and purified as described (45). Unmethylated or hemimethylated DNA was incubated with 40 nM DNMT1 and S-(5'-adenosyl)-L-[methyl-3H]methionine (AdoMet) for 30 min at 37 °C in a total volume of 25 µl in buffer A (100 mM Tris·HCl, pH 7.8, at 25 °C, 1 mM Na2EDTA, 1 mM dithiothreitol, 7 µg/ml phenylmethylsulfonyl fluoride, 5% glycerol, and 100 µg/ml bovine serum albumin). Fig. 1 shows that reactions were linear under these conditions. On the other hand, enzyme concentrations greater than 50 nM (inset to Fig. 1B) or reaction times longer than 1 h (not shown) did not give linear responses. Concentrations of DNA are given in micromolars of single-stranded CG steps; the range of CG and AdoMet concentrations used in the reactions varied according to the DNA template as follows: for pRW3602, 3.42-25.0 µM CG and 2.13-50.0 µM AdoMet; for the oligonucleotide corresponding to exon-1 of the small nuclear ribonucleoprotein-associated polypeptide N (SNRPN) (45), 0.5-5.0 µM CG and 4.0-15.1 µM AdoMet; for (CGG·CCG)12, 0.5-5.0 µM CG and 4.08-50.0 µM AdoMet; for (CGG·Cm5CG)12 and (m5CGG·CCG)12, 0.1-1.0 µM unmethylated CG and 1.02-10.0 µM AdoMet; for (CGG·CCG)73, 0.12-1.0 µM CG and 2.11-20.0 µM AdoMet. For d(I-C·I-C)~7000, only 1 nM DNMT1 was used since the reactions were much faster. In this case, the concentration range of the substrates was 0.1-1.0 µM for CI and 1.02-20 µM for AdoMet. At the end of the reaction, samples were quenched in a dry ice/ethanol bath, spotted on DE81 ion exchange chromatography filters (Whatman), placed on a 12-well manifold apparatus (Millipore), washed, dried, and counted (45). The efficiency of scintillation counting was calculated for every round of washing from the counts/min obtained in two filters that were loaded with an internal control (IC filter). This control consisted of 25 µl of plasmid DNA extensively pre-methylated with AdoMet and bacterial SssI methylase (New England Biolabs); unincorporated AdoMet was removed by Sephadex G-50 fine (Amersham Pharmacia Biotech) column chromatography. The eluate was reconstituted in buffer A to a concentration of ~6000 cpm/25 µl (IC solution). The nanomolar [3H]CH3 (N) present in the DNA at the end of the reaction was calculated as n = (C - B)/RF, where C was the counts/min of a sample, B the blank (cpm in the absence of DNMT1), R the ratio of IC filter/IC solution, and F the cpm/nM free AdoMet. The initial velocity (v) was obtained as 1/v = ET/N, where E was the concentration of DNMT1 and T the reaction time. The lower levels of incorporations (which were associated with the data points at the lowest concentrations of unmethylated (CGG·CCG)n) were approximately twice their blank values. Data points were collected in duplicate, graphed on Lineweaver-Burk double-reciprocal plots, and fit to weighted (weight was v2) linear regressions. These plots contain two independent variables, namely the reciprocal of the apparent Vmax (Vmax(app)), given by the intercepts, and the ratio of the Michaelis constant (Km) (plus the dissociation constant) for the variable substrate to Vmax(app), given by the slopes. By re-plotting these intercepts and slopes derived from various combinations of substrates, new linear plots were obtained, which yield the true Vmax, Km, and the dissociation constant for the substrates. Non-linear fits were not weighted. When appropriate, the coordinates of the intersection for the family of reciprocal plots were calculated from the kinetic constants obtained from the replots of slope and intercept and applied as a constraint during curve fitting.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Conditions for linearity of the methyl transfer reaction with DNMT1 and supercoiled pRW3602. A, 40 nM DNMT1 was incubated at 37 °C with 25 µM CG steps and 10 µM AdoMet in a 300-µl reaction volume in buffer A. At 30 s and subsequently at 5-min intervals, 25 µl were withdrawn and processed, and the results were analyzed as described under "Experimental Procedures." The means and standard deviations for the data points were derived from two independent experiments. B, a concentration range of 2-60 nM DNMT1 was used in reactions containing 10 µM CG steps and 10 µM AdoMet at 37 °C for 30 min. The means and standard deviations for the data points were derived from two independent experiments. The value at 60 nM DNMT1 was excluded from the interpolation. Inset, the concentration ranged from 2 to 200 nM DNMT1.

Enzyme Assay for Initial Velocities in the Presence of Products-- Addition of known concentrations of the products to an enzymatic reaction (product inhibition) is a powerful strategy for deciphering an enzyme mechanism, i.e. whether the substrates bind (and the products dissociate) in an ordered or random fashion. Methylation reactions on supercoiled pRW3602 were performed in the presence of added S-(5'-adenosyl)-L-homocysteine (AdoHcy) or methylated DNA as product inhibitors. Assays were performed as described but, in addition, they contained fixed amounts of either of the inhibitors. In the experiments with AdoHcy, the concentration range of the reactants was 4.0-25.0 µM CG, 2.0-40.0 µM AdoMet, and 2.5-25.0 µM AdoHcy. Two methylated DNAs were used as products. The first was a 40-bp duplex oligonucleotide [(MeCG)20]) containing canonical Watson-Crick pairs but with 5-methylcytosines substituting for all cytosines. The second was a 36-bp duplex oligonucleotide with the sequence CGG(F5CGG)11·(Cm5CG)12, named (F/MeCG)12, where F5C designates 5-fluorocytosine. The rationale for using this fluorinated oligonucleotide was that, contrary to [(MeCG)20], (F/MeCG)12 may form an irreversible complex with DNMT1, thus blocking the enzymatic turnover. In the experiments with methylated DNA, the concentration range of the reactants was 4.0-25.0 µM CG for pRW3602, 2.5-60 µM CG for (MeCG)20 or 11 nM to 40.0 µM CG for (F/MeCG)12, and 6.67 and 30.0 µM AdoMet.

Chemicals and DNA-- AdoMet at the specific activities of 15.0 Ci/mmol (1 Ci = 37 GBq), 500 mCi/mmol, and 60-85 Ci/mmol was obtained from Amersham Pharmacia Biotech. AdoHcy (Sigma) was prepared by dissolving 100 mg into 5 ml of 1 N HCl to give a 52 mM solution. Dilutions were made fresh in distilled water.

Plasmid pRW3602 was a derivative of pUC9 that contained a 40-bp insert (TTAAGCAGCAGTATCCTCTTGGGGGCGCCTTCCCCACACT) from the human gamma -globin promoters in its HincII site (46). The plasmid was 2705 bp in length with a total of 338 CG steps (on average, 1 every 8 bp). (CGG·CCG)73 was an XbaI-BamHI restriction fragment from plasmid pRW3691 and contained a total of 156 CG steps (including 10 from the triplet repeat flanking sequences) (47). d(I-C·I-C)~7000 (48) was from Amersham Pharmacia Biotech. (CGG·CCG)12, (CGG·Cm5CG)12, (m5CGG·CCG)12, SNRPN oligonucleotide, and (F/MeCG)12 were synthesized by solid phase chemistry. Their preparation is detailed in Ref. 45. (MeCG)20 was also synthesized chemically and contained 5-methylcytosine at each of the 20 CG steps. The top strand sequence was GAAm5CGTAm5CGTTAm5CGATm5CGm5CGTm5CGAm5CGATm5 CGAAm5CGTm5CGTAC. The complementary strands were annealed to give a stock solution of 500 µM CG steps. Oligonucleotide concentrations were obtained by optical absorption on a Beckman DU 640 spectrophotometer using the extinction coefficients calculated from the known coefficients of the component nucleotides. Since this synthetic 40-mer contains only m5C at all CG steps and contains no CNG sequences, it does serve as a substrate for DNMT1 and was studied as a product inhibitor. A list of all the substrates and inhibitors used and their relevant properties is given in Table I.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Relevant properties of the DNA substrates and inhibitors

Velocity Equations, Initial Forward Velocity in the Absence of Products-- Fig. 2 shows the basic scheme for the reaction of DNMT1 with DNA and AdoMet as obtained from the initial velocity data and product inhibition studies. Knowledge of the reaction sequence is essential for the derivation of all the kinetic constants, since the meaning of slopes and intercepts of the double-reciprocal plots (as well as their replots) is based on the velocity equation derived from the mechanism itself. Fig. 2A shows that the first step involves the binding of DNA (D) to a regulatory site in DNMT1 (E), distinct from the catalytic site, to give a DNA-DNMT1 initial complex. The second step consists in the binding of a CG·CG (or CG·m5CG or m5CG·CG) and AdoMet (Am) to the catalytic site to give the ternary complex competent for catalysis.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Scheme of an ordered Bi Bi mechanism with allosteric activation for the methyltransferase reaction by DNMT1. A, free DNMT1 (E) binds the activator DNA (D) at a regulatory site and subsequently AdoMet (Am) and a second molecule of DNA to the catalytic site. The sequence of addition of AdoMet and the DNA to the catalytic site is arbitrary. The kinetic data do not distinguish whether AdoMet, or the DNA, or both are the first to bind to this site. B, E, and DE are grouped together since their interconversion is at equilibrium relative to the other enzyme species. This assumption is made in order to develop a velocity equation that yields linear responses; f1 is DE/(E + DE); M and Ah signify the products of the reaction, methylated DNA and AdoHcy, respectively.

Based on the initial velocity patterns that were obtained, the reaction is treated at steady state (the turnover rate of the enzyme is not limited by how fast the chemical reaction takes place) except for the interconversion between free DNMT1 and DNA-DNMT1, which must occur at equilibrium within the steady state. Addition of the substrates is shown to be ordered, with AdoMet preceding the DNA; however, this sequence of addition is not proven by the present data, as discussed later. Indeed, the reaction may be ordered with DNA binding before AdoMet or random, where either substrate can bind first. The velocity equations for an ordered or random sequential bireactant system (such as this) are identical, and both Vmax and the Michaelis constant for the substrates (KmCG and KmAdoMet) can be derived, even though the mechanism is unknown. However, the dissociation constant Kia for the first substrate that adds to the reaction cannot be assigned unless it is identified. Our derivation of the following velocity Equation 1 was based on the formulations by King-Altman and Cha, which are described in detail by Segel (49). The method requires that the section of the reaction at equilibrium be grouped into a single corner of the scheme, as illustrated in Fig. 2B. The rate k3[AdoMet] is then corrected for f1, the ratio of DNA-DNMT1 to DNA-DNMT1 plus free DNMT1. In the following equations, [CG] is given the same meaning as [D] (DNA) in Fig. 2.

The velocity Equation 1, in the absence of products, is as follows.
v=<FR><NU>V<SUB><UP>max</UP></SUB>[<UP>AdoMet</UP>][<UP>CG</UP>]</NU><DE>K<SUB>ia(<UP>app</UP>)</SUB>K<SUP><UP>CG</UP></SUP><SUB>m</SUB>+K<SUP><UP>CG</UP></SUP><SUB>m</SUB>[<UP>AdoMet</UP>]+K<SUP><UP>AdoMet</UP></SUP><SUB>m(<UP>app</UP>)</SUB>[<UP>CG</UP>]+[<UP>AdoMet</UP>][<UP>CG</UP>]</DE></FR> (Eq. 1)
where Kia(app) = Kia(1 + KCG/[CG]), Kia = k4/k3, Km(app)AdoMet = KmAdoMet(1 + KCG/[CG]), and KCG = k2/k1.

When [AdoMet] is the variable substrate (see Equation 2)
<FR><NU>1</NU><DE>v</DE></FR>=<FR><NU>1</NU><DE>V<SUB><UP>max</UP></SUB></DE></FR><FENCE>1+<FR><NU>K<SUP><UP>CG</UP></SUP><SUB>m</SUB></NU><DE>[<UP>CG</UP>]</DE></FR></FENCE>+<FR><NU>K<SUP><UP>AdoMet</UP></SUP><SUB>m</SUB></NU><DE>V<SUB><UP>max</UP></SUB></DE></FR><FENCE>1+<FR><NU>K<SUB>ia</SUB>K<SUP><UP>CG</UP></SUP><SUB>m</SUB></NU><DE>K<SUP><UP>AdoMet</UP></SUP><SUB>m</SUB>[<UP>CG</UP>]</DE></FR></FENCE> · <FR><NU>1</NU><DE>[<UP>AdoMet</UP>]</DE></FR> (Eq. 2)
for small values of KCG/[CG] and KCG << KmAdoMet.

Plots obtained at changing fixed concentrations of [CG] intersect at 1/[AdoMet] = -1/Kia and 1/v = (1 - KmAdoMet/Kia)/Vmax.

When [CG] is the varied substrate (see Equation 3), for small values of KCG/[CG], the velocity is as follows:
<FR><NU>1</NU><DE>v</DE></FR>=<FR><NU>1</NU><DE>V<SUB><UP>max</UP></SUB></DE></FR><FENCE>1+<FR><NU>K<SUP><UP>AdoMet</UP></SUP><SUB>m</SUB></NU><DE>[<UP>AdoMet</UP>]</DE></FR></FENCE>+<FR><NU>K<SUP><UP>CG</UP></SUP><SUB>m</SUB></NU><DE>V<SUB><UP>max</UP></SUB></DE></FR><FENCE>1+<FR><NU>K<SUB>ia</SUB></NU><DE>[<UP>AdoMet</UP>]</DE></FR></FENCE> · <FR><NU>1</NU><DE>[<UP>CG</UP>]</DE></FR> (Eq. 3)
and the family of double-reciprocal plots intersects at 1/[CG] = -KmAdoMet/KmCG Kia and 1/v = (1 - KmAdoMet/Kia)/Vmax.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Initial velocity experiments enable the evaluation of kinetic constants and provide insights into the mechanism of a reaction. A comprehension of the mechanism of this key enzyme, human DNMT1, is critical for understanding its role in developmental processes and in the etiology of fragile X syndrome and other diseases (7-10, 50). A variety of DNA templates (Table I) were methylated to less than 5-8% of the total CG steps by purified, recombinant DNMT1 with the aim of assessing the effect of sequences flanking the substrate CG on the kinetic constants, the role of negative supercoiling, and the mechanism of the reaction. Experimental data were analyzed by graphing the extent of methylation as a function of concentration of DNA or AdoMet, as variable substrates, on double-reciprocal Lineweaver-Burk plots. This report is the second of a series of three papers describing the purification and characterization of DNMT1 (45) and focuses on the mechanism of the methyltransferase reaction. The third paper2 will describe the effect of DNA topology on the reaction rates at CG sites in random as well as CGG·CCG repeat tracts and compare the kinetic properties of DNMT1 with the bacterial M.SssI.

Linear Velocity Responses-- For bireactant enzymes (such as DNMT1), double-reciprocal plots generally give linear responses where 1/v is graphed as a function of 1/substrate. For most of the DNAs used, which included supercoiled pRW3602 as purified from Escherichia coli (-<A><AC>&sfgr;</AC><AC>&cjs1171;</AC></A> = 0.045), relaxed circular (-<A><AC>&sfgr;</AC><AC>&cjs1171;</AC></A> = 0), or linear, as well as the SNRPN oligonucleotide (unmethylated or hemimethylated), (CGG·CCG)12, (m5CGG·CCG)12, and (CGG·CCG)73, the velocity curves were linear with respect to the variable substrate, whether this was the DNA or AdoMet. Fig. 3 shows the data with supercoiled pRW3602. Fig. 3A shows the concentration of [3H]CH3 groups incorporated when the DNA was the variable substrate (on the x axis) and AdoMet the fixed substrate. Conversely, Fig. 3B shows the results with AdoMet as the variable substrate and DNA as the fixed substrate. For all of the DNA templates listed above, the velocity patterns were as in Fig. 3, i.e. they converged to the left of the y axis and above or below the x axis for both substrates. Fig. 4 shows the double-reciprocal plots for the triplet repeat sequences (CGG·CCG)12 (Fig. 4, A and B), (m5CGG·CCG)12 (Fig. 4, C and D), and (CGG·CCG)73 (Fig. 4, E and F). These patterns contrast with those obtained with M.HhaI (51) and M.SssI2 methylases, where the families of lines converge on the y axis when AdoMet is the variable substrate. This result shows that AdoMet and DNA do not bind by an ordered and rapid equilibrium mechanism to DNMT1, as in the case with M.HhaI and M.SssI.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Initial forward velocities for the methylation of supercoiled pRW3602. The figure shows Lineweaver-Burk double-reciprocal plots. On the y axis is the reciprocal of nM [3H]CH3 contained in the DNA following transfer from AdoMet by 1 nM DNMT1 in 1 min, and on the x axis is the reciprocal concentration of the variable substrate. DNMT1 concentration was 40 nM. A, [3H]CH3 concentration as a function of variable DNA at changing-fixed AdoMet; AdoMet concentrations were as follows: filled circles, 50.0 µM; open circles, 12.5 µM, filled squares, 6.67 µM; open squares, 4.42 µM; filled diamonds, 3.33 µM; open diamonds, 2.13 µM. B, [3H]CH3 incorporated as a function of variable AdoMet at changing-fixed CG concentrations: filled circles, 25.0 µM; open circles, 12.2 µM; filled squares, 8.06 µM; open squares, 4.81 µM; filled diamonds, 3.42 µM. Other plots were omitted for clarity. Lines drawn through the experimental data points are from fitting of the data to Equation 3 for A and Equation 2 for B.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   Initial forward velocities for the methylation of CGG·CCG triplet repeats. The Lineweaver-Burk double-reciprocal plots present 1/v (y axis) expressed as the reciprocal of nM [3H]CH3 contained in the DNA following the transfer from AdoMet by 1 nM DNMT1 in 1 min versus the reciprocal concentration of the variable substrate (x axis). The DNMT1 concentration was 40 nM. The concentrations of reactants for each are in the following order: filled circles, open circles, filled squares, open squares, filled diamonds, and open diamonds. A, [3H]CH3 concentration as a function of variable DNA at changing-fixed AdoMet for (CGG·CCG)12; AdoMet concentrations were 50.0, 15.9, 9.26, 5.02, 4.50, and 4.08 µM. B, [3H]CH3 concentration as a function of variable AdoMet at changing-fixed DNA for (CGG·CCG)12; CG concentrations were 5.00, 2.50, 1.25, 0.83, 0.62, and 0.50 µM. C, [3H]CH3 concentration as a function of variable DNA at changing-fixed AdoMet for (m5CGG·CCG)12; AdoMet concentrations were 10.0, 5.02, 3.38, 1.73, 1.23, and 1.02 µM. D, [3H]CH3 concentration as a function of variable AdoMet at changing-fixed DNA for (m5CGG·CCG)12; CG concentrations were 1.00, 0.50, 0.25, 0.17, 0.12, and 0.10 µM. E, [3H]CH3 concentration as a function of variable DNA at changing-fixed AdoMet for (CGG·CCG)73; AdoMet concentrations were 20.0, 9.00, 5.88, 4.00, 2.50, and 2.11 µM. F, [3H]CH3 concentration as a function of variable AdoMet at changing-fixed DNA for (CGG·CCG)73; CG concentrations were 1.00, 0.40, 0.25, 0.18, 0.14, and 0.12 µM.

Fig. 5 shows the replots of the slope and y axis intercept (1/Vmax(app)) for each of the lines in Fig. 3 that were used to derive the kinetic constants. As shown in Equations 2 and 3, four replots are possible that give the following constants: (a) 1/Vmax on the y axis intercept (Fig. 5A) and 1/KmAdoMet on the x-axis intercept by replotting the intercepts of Fig. 3A as a function of 1/AdoMet (Equation 3); (b) KmCG/Vmax on the y axis intercept (Fig. 5A) and 1/Kia on the x axis intercept by replotting the slopes of Fig. 3A as a function of 1/AdoMet; (c) 1/Vmax on the y axis intercept (Fig. 5B) and 1/KmCG on the x axis intercept by replotting the intercepts from Fig. 3B as a function of 1/CG (Equation 2); and (d) KmAdoMet/Vmax on the y axis intercept (Fig. 5B) and KmAdoMet/KiaKmCG on the x axis intercept by replotting the slopes from Fig. 3B as a function of 1/CG. Therefore, these four replots yield the maximum velocity and the Michaelis constants for AdoMet (at DNA infinity ) and DNA (at AdoMet = infinity ). As pointed out previously, the dissociation constant Kia cannot be assigned to the DNA or AdoMet because the method does not distinguish the order of addition. The experimental values for the constants are reported in the companion papers2 (45).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Replots of intercepts and slopes of initial velocities for the methylation of supercoiled pRW3602. A, replot of slopes and y axis intercepts of the 1/v versus 1/CG data shown in Fig. 3A. B, replot of slopes and y axis intercepts from the 1/v versus 1/AdoMet data shown in Fig. 3B. Error bars are the standard error associated with the double-reciprocal plots before constraint to the convergence point was applied. Lines drawn through the experimental data points are from fitting of the data to the slopes and intercepts of Equation 3 for A and Equation 2 for B.

Curved Velocity Responses-- Unexpectedly, two template DNAs (d(I-C·I-C)~7000 and (CGG·Cm5CG)12) gave non-linear initial velocity curves. The results for d(I-C·I-C)~7000 are described in the accompanying paper (45), whereas the double-reciprocal plots for (CGG·Cm5CG)12 are reported in Fig. 6. Fig. 6A shows that the methylation rate was linear when DNA was the variable substrate. The data also indicate that, contrary to Figs. 3 and 4, velocities were maximal at 1.74 µM AdoMet, such that further increases (up to 10.0 µM) did not result in a decrease in slope or intercept. Fig. 6B shows that plots were not linear when AdoMet was the variable substrate. Velocities were unchanged, and plots were parallel to the x axis when AdoMet concentrations rose above ~2 µM. The responses were still dependent on DNA concentration, since 1/Vmax(app) (y axis intercepts) decreased with increasing CG content. A replot of 1/Vmax(app) versus 1/CG was linear (Fig. 7A), whereas both intercept and slope replots from the data at fixed AdoMet were curved (Fig. 7B).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   Double-reciprocal plots for the methylation of (CGG·Cm5CG)12. A, [3H]CH3 concentration as a function of DNA at fixed AdoMet concentrations were as follows: open triangles, 1.02 µM; filled triangles, 1.23 µM; open diamonds, 1.43 µM; filled diamonds, 1.74 µM; open squares, 2.56 µM; filled squares, 4.17 µM; open circles, 5.02 µM; and filled circles, 10.0 µM. B, nM [3H]CH3 incorporated as a function of AdoMet at fixed DNA. CG concentrations were as follows: open diamonds, 0.10 µM; filled diamonds, 0.12 µM; open squares, 0.16 µM; filled squares, 0.25 µM; open circles, 0.50 µM; filled circles, 1.00 µM. DNMT1 concentration was 40 nM.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7.   Replots of slopes and intercepts for initial velocities with (CGG·Cm5CG)12. A, replot of y axis intercepts from the 1/v versus 1/AdoMet data shown in Fig. 6B. B, replot of y axis intercepts and slopes from the 1/v versus 1/CG shown in Fig. 6A.

This result indicates that when this particular DNA was bound to DNMT1, the velocity of the reaction was already maximal at a very low (~2 µM) AdoMet concentration, contrary to the expectation that maximum velocity requires infinite amounts of AdoMet. The plots in Figs. 6 and 7 still enable the calculation of 1/Vmax, 1/KmCG, and 1/KmAdoMet; however, Kia cannot be derived.

The most significant conclusion that can be drawn from these results is that the kinetic behavior of DNMT1 may be dramatically altered by both sequence of the DNA template and its pre-methylation status. Obviously, the scheme in Fig. 2 and its velocity equations are not adequate to describe the results with (CGG·Cm5CG)12 which implies that DNMT1 is capable of complex kinetics. Overall, this combination of linear plus non-linear responses indicates a steady-state mechanism, where the DNA can act simultaneously both as a substrate and as an activator for the reaction. The activation is proposed to occur through binding of a DNA molecule at a site distinct from the catalytic center, i.e. an allosteric, or regulatory, site. The precise sequence of the chemical steps that lead to such non-linear responses, however, is unknown. Nevertheless, it seems clear that the role of the DNA bound to the allosteric site is to increase the affinity of the DNA-DNMT1 complex for AdoMet since low levels of AdoMet are sufficient to maximally drive the reaction.

It is noteworthy that the complex enzymatic behavior is associated with a DNA sequence, the (CGG·CCG)n triplet repeat, whose expansion in the chromosomal FRAX locus leads to aberrant methylation and to disease in humans.

In summary, these studies indicate that the methylation reaction by DNMT1 may follow complex mechanisms, and both the sequence composition as well as the methylation status of the DNA substrate contribute to this complexity.

Product Inhibition with AdoHcy-- Product inhibition studies of bireactant enzymes provide a means to distinguish random from ordered sequential Bi Bi mechanisms. Ordered systems give competitive patterns with the first substrate that binds to the enzyme versus the last product that leaves the enzyme (the plots converge on the y axis) and non-competitive patterns with the other combinations (the lines converge to the left of the y axis). On the contrary, random mechanisms give competitive inhibition between like substrates and products (with similar chemical structures) and non-competitive patterns between unlike reactants. In our case, determining whether the reaction is ordered or random would enable the assignment of the dissociation constant Kia to the DNA, to AdoMet, or to both in the case of a random system.

In the first set of experiments (AdoHcy versus CG with fixed AdoMet) (unlike product and substrate), 2.5 to 25.0 µM AdoHcy were added to reactions where the concentration of CG with supercoiled pRW3602 was varied and AdoMet kept constant. In separate studies, the fixed concentration of AdoMet ranged from 2.0 to 40.0 µM. The pattern of inhibition was non-competitive from 2.0 to 10.0 µM AdoMet, rather uncompetitive at 15.0 and 20.0 µM AdoMet, and non-competitive again from 26.0 to 40.0 µM AdoMet (not shown).

In double-reciprocal plots where AdoMet was the variable substrate, AdoHcy the changing-fixed inhibitor (like substrate and product), and CG the fixed co-substrate (4.0 to 25.0 µM), velocities increased, as expected, up to 20.0 µM AdoMet; however, higher concentrations caused strong inhibition by AdoHcy, a result that was not anticipated. In fact, the expectation was that AdoMet would progressively overcome the inhibition by AdoHcy, linearly increasing the reaction rates as its concentration rose. The slopes obtained from the 1/v versus 1/CG plots (which were linear) at various AdoHcy concentrations were graphed as a function of AdoMet. Increasing AdoMet up to 50 µM progressively reduced the slopes (higher velocities) to plateau levels in the absence of AdoHcy, as expected. AdoHcy increased all of the slopes as a result of inhibition, and increasing AdoMet progressively reduced such an inhibition. However, at concentrations of AdoMet >20 µM, there was a new, strong non-competitive inhibition by AdoHcy that was then reduced by higher levels of AdoMet. This pattern found at greater than 20.0 µM AdoMet is anomalous; the reason for this behavior is uncertain. When these unusual data at >20.0 µM AdoMet were excluded, the pattern of inhibition versus AdoHcy (like substrate and product) was competitive (Fig. 8A).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 8.   Product inhibition by AdoHcy. A, nM [3H]CH3 incorporated in supercoiled pRW3602 (6.02 µM CG) at varying AdoMet concentrations and changing-fixed AdoHcy as the inhibitor; AdoHcy concentrations were 2.5 µM (filled circles), 5.0 µM (open circles), 10.0 µM (filled squares), 15.0 µM (open squares), 20.0 µM (filled triangles), and 25.0 µM (open triangles). B, Dixon plot for AdoHcy inhibition; the slopes (Slope1/CG) of 1/v versus 1/CG (µM CG in supercoiled pRW3602: 4.00, 4.81, 6.02, 8.06, 12.19, and 25.0) obtained at fixed AdoMet (2.0, 4.0, 6.67, 10.0, 15.0, and 20.0 µM) and changing-fixed AdoHcy (0, 2.5, 5.0, 10.0, 15.0, 20.0, and 25.0 µM) concentrations were calculated; these results then were replotted as Slope1/CG versus 1/AdoMet for each concentration of AdoHcy (all regressions were linear). The slopes of these last regressions are shown as a function of AdoHcy concentrations.

To test whether there was evidence for more than one binding site for AdoMet in DNMT1, a Dixon plot (49) was constructed. Slopes1/CG were replotted as a function of 1/AdoMet for AdoMet <= 20.0 µM, at each fixed value of AdoHcy. The replots were linear, and their slopes (SlopeCG/AdoMet) were finally graphed as a function of AdoHcy (Fig. 8B). The result was a linear, rather than a parabolic, curve indicating that only one AdoMet-binding site per DNMT1 molecule was detected. The x axis intercept gives the Ki for AdoHcy, which is ~14 µM.

Product Inhibition with Methylated and Fluorinated DNA-- The second part of the inhibition studies consisted of the use of the other product, fully methylated DNA. In conjunction with the data with AdoHcy, fully methylated DNA was expected to give non-competitive inhibition patterns versus both substrates for an ordered steady-state mechanism or competitive inhibition versus DNA for a random mechanism. A concentration range of 2.5 to 60.0 µM of m5CG steps containing 5-methylcytosine in a 40-bp duplex synthetic oligonucleotide (MeCG)20 was added to 4.00 to 25.0 µM CG from supercoiled pRW3602 (like substrate and product) and 6.67 or 30.0 µM AdoMet. Fig. 9A shows the replot of intercepts from double-reciprocal plots where pRW3602 was the variable substrate and (MeCG)20 the changing-fixed inhibitor, with AdoMet fixed at 6.67 µM. Intercepts were expected not to change for a competitive system or increase with increasing m5CG for a non-competitive mechanism. On the contrary, whereas some scatter was observed, 1/Vmax(app) decreased as more inhibitor was added, indicating enzyme activation rather than inhibition. Slope effects were more complex but not substantial. At 30.0 µM AdoMet, velocities with 2.5, 5.0, and 10.0 µM (MeCG)20 were indistinguishable from those in the absence of inhibitor, whereas 20, 30, and 40 µM (MeCG)20 caused inhibition. These latter three concentrations gave parabolic curves, whereas, in all cases, intercepts were unchanged (Fig. 9B). Overall, these data indicate that fully methylated DNA acted in two ways as follows: first, it inhibited the reaction by competing with unmethylated DNA for the catalytic center, and second, it accelerated the turnover number of the enzyme by binding to an allosteric site.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 9.   Product inhibition by fully methylated (MeCG)20 duplex DNA. A, replot of y axis intercepts from double-reciprocal plots of initial velocities obtained with supercoiled pRW3602 as the variable substrate (4.00, 4.81, 6.02, 8.06, 12.19, and 25.0 µM CG) in the presence of changing-fixed concentrations of (MeCG)20 oligonucleotide, ranging from 0 to 60.0 µM methylated (m5CG) CG. The concentration of AdoMet was 6.67 µM. B, double-reciprocal plot of initial velocities obtained with supercoiled pRW3602 as the variable substrate and (MeCG)20 as the changing-fixed inhibitor. AdoMet was held at 30.0 µM. The concentrations of m5CG were as follows: 0 µM (inverted triangles), 2.5 µM (open triangles), 5.0 µM (filled triangles), 10.0 µM (open squares), 20.0 µM (filled squares), 40.0 µM (open circles), and 60.0 µM (filled circles). Experimental data points were fit to a second degree polynomial, and no constraints were applied.

To verify this dual role of methylated DNA further, experiments were carried out with an oligonucleotide (CGG(F5CGG)11·(Cm5CG)12) that contained m5CG on one strand and F5CG (5-fluorocytosine) steps on the complementary strand [(F/MeCG)12]. (F/MeCG)12 has two characteristics as follows: on the one hand, it acts as a dead-end inhibitor since F5CG binds to DNMT1 in the presence of AdoMet and traps the enzyme into a stable DNMT1-AdoMet-DNA complex that does not proceed through catalysis (52-54). As a result, this causes inhibition. On the other hand, the DNA sequence and methylation status of (F/MeCG)12 is identical to that of (CGG·Cm5CG)12, the substrate that produced the complex enzymatic patterns in Figs. 6 and 7. Thus, it was of interest to determine if (F/MeCG)12 acted as an inhibitor, an activator, or both. Eleven nM to 40.0 µM of modified CG steps from (F/MeCG)12 was added to 4.00 to 25.0 µM CG from supercoiled pRW3602 and 6.67 or 30.0 µM AdoMet. Fig. 10, A and B, shows the intercept and slope replots from double-reciprocal plots where pRW3602 was the variable substrate and (F/MeCG)12 the fixed inhibitor (like substrate and inhibitor). The Lineweaver-Burk plots were linear. (F/MeCG)12 caused a decrease in both intercepts and slopes at 6.67 µM AdoMet (filled circles) and had no effect at 30.0 µM AdoMet (open circles). Interestingly, the decreases in intercepts occurred at nanomolar concentrations of the added oligonucleotide, suggesting that (F/MeCG)12 was far more potent as an activator than as an inhibitor.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 10.   Product inhibition by fluorinated/methylated (F/MeCG)12 duplex DNA. Replots of the y axis intercepts (A) and slopes (B) from double-reciprocal plots of initial velocities obtained with supercoiled pRW3602 as a variable substrate (4.00, 4.81, 6.02, 8.06, 12.19, and 25.0 µM CG) in the presence of changing-fixed concentrations of fluorinated/methylated (F/MeCG)12 oligonucleotide ranging from 0 to 40.0 µM CG steps. Concentrations of AdoMet were 6.67 µM (filled circles) and 30.0 µM (open circles).

To verify this conclusion, control reactions were performed in the presence of (F/MeCG)12 alone since DNMT1-AdoMet-DNA complexes, which are retained on DE81 filters during the sample processing, would lead to erroneously high values of labeled methyl groups for pRW3602. These controls confirmed that the oligonucleotide acted as an activator rather than an inhibitor.

In summary, these product inhibition studies support the finding obtained with (CGG·Cm5CG)12 that methylated DNA is an activator of the methyl transfer reaction. On the other hand, since this behavior complicated the inhibition patterns, it could not be used in conjunction with the AdoHcy experiments to distinguish whether the reaction proceeds through a random or an ordered mechanism. Therefore, the dissociation constant Kia cannot be assigned to either the DNA or AdoMet.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mammalian DNMT1 was reported to methylate hemimethylated DNA to a greater extent (2-5-fold) than unmethylated DNA (32-34, 38), an observation confirmed here with a new recombinant enzyme that displays an ~30-fold higher activity than previously obtained (34). It was also observed that methylation rates increase when duplex, or single-stranded, DNA contains randomly pre-methylated m5CG·CG, m5CG·m5CG, or m5CG steps (a phenomenon known as methylation spreading) and that such a stimulation extends in trans to unmethylated molecules (Refs. 36 and 37 and references therein and Refs. 55 and 56). Furthermore, allosteric transitions in DNMT1-methylated DNA complexes have been proposed, based on non-Michaelis-Menten patterns of methylation with hemimethylated templates (57).

Our studies indicate that the presence of m5CG (either in hemimethylated of fully methylated templates) stimulates the reaction. The effect is likely mediated by DNA binding to an allosteric site, since neither (MeCG)20 nor the (F/MeCG)12 duplexes served as alternative substrates in control experiments.

This effect could be achieved in two ways as follows: (a) m5CG "exposes" the enzyme active site, which is otherwise less accessible and/or, (b) m5CG binding modifies the active site conformation, improving its fit for AdoMet and/or the DNA. The data with (CGG·Cm5CG)12, which showed saturation at 2 µM AdoMet, suggest an active role for m5CG in shaping the AdoMet binding pocket. Furthermore, the results reveal a role for the DNA primary sequence in modulating substrate binding specificity and, ultimately, the catalytic rates (45, 58).

The turnover number for the enzyme varied considerably among the DNA templates, from ~1 to 50 h-1, but was lower than for d(I-C·I-C)~7000, 184 h-1 (45). These results seem to exclude the methyl transfer as the rate-limiting step in the reaction. On the other hand, it was found that methylation rates increase with negative supercoiling2 suggesting that, instead, substrate binding and/or product release limit the turnover rate (59).

Overall, the initial velocity data are consistent with a steady-state sequential Bi Bi mechanism (either ordered or random). The linear double-reciprocal plots are adequately described by the reaction scheme in Fig. 2 and velocity equations (Equations 1-3) developed according to steady-state assumptions that require the addition of both substrates before any product is released. However, the scheme is not sufficient to explain the curved responses obtained with (CGG·Cm5CG)12 and d(I-C·I-C)~7000, suggesting that the reaction may take alternative pathways.

It was reported that DNMT1 is processive, based on the observations that methylation rates increase with the length of the DNA, that NaCl inhibits the reaction in a concentration-dependent manner (57, 60), and that DNA-protein associations are rather stable (61, 62). The linear velocity patterns obtained here with the various DNA templates, including the closely spaced CG steps in (CGG·CCG)n, were accounted for by a reaction scheme whereby the enzyme dissociates from the DNA after each reaction cycle. Thus, additional terms associated with processivity were not necessary in the final velocity equation. The higher Vmax observed for longer, rather than shorter, polymers such as (CGG·CCG)73 versus (CGG·CCG)12 (45)2 does not require a processive mechanism. The one-dimensional limited diffusion (63-66) and/or intersegment transfer (67-70) processes, characteristic of DNA-binding enzymes, account for this result. The theory underlying such mechanisms states that macromolecular collision in solution is not elastic, so that when a protein collides with a DNA molecule, it stays along the contour length of the DNA through repetitive microcollisions (which entail dissociations and re-associations), rather than drifting away. Consequently, the time spent by a protein on one DNA molecule of length n would be greater than the time spent by the same protein on combined m DNA molecules of length n/m. Therefore, we cannot conclude that DNMT1 acted processively.

These kinetic determinations have implications for the in vivo reactions of maintenance methylation. For example, the pre-methylated parental strand during DNA replication may act as an allosteric activator to direct reactions on the unmethylated daughter strand. Also, the ability of the enzyme to bind AdoMet in equilibrium may be exploited to accelerate reaction rates. It is possible that turnover rates are higher in vivo, where DNMT1 may associate with multienzyme complexes, such as the replication or the mismatch repair systems, that afford high processivity rates that can compensate for the limitations imposed in vitro with DNMT1 alone. In summary, the human DNMT1 is a complex enzyme from the standpoint of protein structure, the ability of substrates to conduct regulatory functions, and kinetic behavior on different types of substrates.

    ACKNOWLEDGEMENTS

We thank Drs. W. Wallace Cleland and Thomas Meek for critical reviews of the manuscript and Drs. Daniel Santi and Sanjay Kumar for providing helpful suggestions.

    FOOTNOTES

* This work was supported by Grants GM46127 (to R. J. R.), GM52982, and NS37554 (to R. D. W.) from the National Institutes of Health and by the Robert A. Welch Foundation (to R. D. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Center for Genome Research, Inst. of Biosciences and Technology, Texas A & M University, Texas Medical Center, 2121 Holcombe Blvd., Houston, TX 77030-3303. Tel.: 713-677-7660; Fax: 713-677-7689; E-mail: abacolla@ibt.tamu.edu.

2 A. Bacolla, S. Pradhan, J. E. Larson, R. J. Roberts, and R. D. Wells, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: m5C, C5-methylcytosine; bp, base pair(s); DNMT1, DNA (cytosine-5) methyltransferase; AdoMet, S-adenosyl-L-methionine; AdoHcy, S-adenosyl-L-homocysteine; SNRPN, duplex oligonucleotide (75 bp) corresponding to exon-1 of the small nuclear ribonucleoprotein-associated polypeptide N, which is part of an imprinting center on human chromosome 15q11-13; F5C, 5-fluorocytosine; (MeCG)20, double-stranded 40-mer of random sequence containing methylated cytosine (m5C) at all CG dinucleotide steps; (F/MeCG)12, duplex oligonucleotide of composition CGG(F5CGG)11·(Cm5CG)12, containing the CGG triplet repeat sequence whose expansion is associated with the fragile-X mental retardation syndrome (the duplex oligonucleotide contains non-methylatable CG steps, F5C on the top strand and m5C on the bottom strand).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Landry, D., Barsomian, J. M., Feeherey, G. R., and Wilson, G. G. (1992) Methods Enzymol. 216, 244-259[CrossRef][Medline] [Order article via Infotrieve]
2. Wilson, G. G. (1992) Methods Enzymol. 216, 259-279[Medline] [Order article via Infotrieve]
3. Cheng, X. (1995) Annu. Rev. Biophys. Biomol. Struct. 24, 293-318[CrossRef][Medline] [Order article via Infotrieve]
4. Roberts, R. J., and Halford, S. S. (1993) in Nucleases (Linn, S. M. , Lloyd, R. S. , and Roberts, R. J., eds) , pp. 35-88, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
5. Noyer-Weidener, M., and Trautner, T. A. (1993) in DNA Methylation: Molecular Biology and Significance (Jost, J. P. , and Saluz, H. P., eds) , pp. 39-108, Birkhauser Verlag, Basel
6. Modrich, P., and Lahue, R. (1996) Annu. Rev. Biochem. 65, 101-133[CrossRef][Medline] [Order article via Infotrieve]
7. Li, E., Beard, C., Forster, A. C., Bestor, T. H., and Jaenisch, R. (1993) Cold Spring Harbor Symp. Quant. Biol. 58, 297-305[Abstract/Free Full Text]
8. Li, E., Beard, C., and Jaenisch, R. (1993) Nature 366, 362-365[CrossRef][Medline] [Order article via Infotrieve]
9. Jost, J. P., and Saluz, H. P (1993) DNA Methylation: Molecular Biology and Significance , Birkhauser Verlag, Basel
10. Doerfler, W. (1991) Biol. Chem. Hoppe-Seyler 372, 557-564[Medline] [Order article via Infotrieve]
11. Woodcock, D. M., Lawler, C. B., Linsenmeyer, M. E., Doherty, J. P., and Warren, W. D. (1997) J. Biol. Chem. 272, 7810-7816[Abstract/Free Full Text]
12. Bestor, T. H. (1990) Philos. Trans. R. Soc. Lond-Biol. Sci. 326, 179-187[Abstract/Free Full Text]
13. Razin, A., and Shemer, R. (1995) Hum. Mol. Genet. 4, 1751-1755[Abstract]
14. Trasler, J. M., Hake, L. E., Johnson, P. A., Alcivar, A. A., Millette, C. F., and Hecht, N. B. (1990) Mol. Cell. Biol. 10, 1828-1834[Abstract/Free Full Text]
15. Leonhardt, H., Page, A. W., Weier, H.-U., and Bestor, T. H. (1992) Cell 71, 865-873[CrossRef][Medline] [Order article via Infotrieve]
16. Araujo, F. D., Knox, J. D., Szyf, M., Price, G. B., and Zannis-Hadjopoulos, A. (1998) Mol. Cell. Biol. 18, 3475-3482[Abstract/Free Full Text]
17. Okano, M., Xie, S., and Li, E. (1998) Nat. Genet. 19, 219-220[CrossRef][Medline] [Order article via Infotrieve]
18. Van den Wyngaert, I., Sprengel, J., Kass, S. U., and Luyten, W. H. M. L. (1998) FEBS Lett. 426, 283-289[CrossRef][Medline] [Order article via Infotrieve]
19. Yoder, J. A., and Bestor, T. H. (1998) Hum. Mol. Genet. 7, 279-284[Abstract/Free Full Text]
20. Xu, G., Flynn, J., Glickman, J. F., and Reich, N. O. (1995) Biochem. Biophys. Res. Commun. 207, 544-551[CrossRef][Medline] [Order article via Infotrieve]
21. Li, E., Bestor, T. H., and Jaenisch, R. (1992) Cell 69, 915-926[CrossRef][Medline] [Order article via Infotrieve]
22. Trasler, J. M., Alcivar, A. A., Hake, L. E., Bestor, T., and Hecht, N. B. (1992) Nucleic Acids Res. 20, 2541-2545[Abstract/Free Full Text]
23. Yoder, J. A., Yen, R.-W. C., Vertino, P. M., Bestor, T. H., and Baylin, S. B. (1996) J. Biol. Chem. 271, 31092-31097[Abstract/Free Full Text]
24. Tucker, K. L., Talbot, D., Lee, M. A., Leonhardt, H., and Jaenisch, R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12920-12925[Abstract/Free Full Text]
25. Lei, H., Oh, S. P., Okano, M., Jüttermann, R., Goss, K. A., Jaenisch, R., and Li, E. (1996) Development 122, 3195-3205[Abstract]
26. Okano, M., Xie, S., and Li, E. (1998) Nucleic Acids Res. 26, 2536-2540[Abstract/Free Full Text]
27. Deng, J., and Szyf, M. (1998) J. Biol. Chem. 273, 22869-22872[Abstract/Free Full Text]
28. Gaudet, F., Talbot, D., Leonhardt, H., and Jaenisch, R. (1998) J. Biol. Chem. 273, 32725-32729[Abstract/Free Full Text]
29. Wang, R. Y.-H., Huang, L.-H., and Ehrlich, M. (1984) Nucleic Acids Res. 12, 3473-3490[Abstract/Free Full Text]
30. Hitt, M. M., Wu, T.-L., Cohen, G., and Linn, S. (1987) J. Biol. Chem. 263, 4392-4399[Abstract/Free Full Text]
31. Reale, A., Lindsay, H., Saluz, H. P., Pradhan, S., Adams, R. L. P., Jost, J.-P., and Strom, R. (1995) Biochem. J. 312, 855-861
32. Tollefsbol, T. O., and Hutchison, C. A., III (1995) J. Biol. Chem. 270, 18543-18550[Abstract/Free Full Text]
33. Flynn, J., Glickman, J. F., and Reich, N. O. (1996) Biochemistry 35, 7308-7315[CrossRef][Medline] [Order article via Infotrieve]
34. Pradhan, S., Talbot, D., Sha, M., Benner, J., Hornstra, L., Li, E., Jaenisch, R., and Roberts, R. J. (1997) Nucleic Acids Res. 25, 4666-4673[Abstract/Free Full Text]
35. Christman, J. K., Sheikhnejad, G., Marasco, C. J., and Sufrin, J. R. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7347-7351[Abstract/Free Full Text]
36. Lindsay, H., and Adams, R. L. P. (1996) Biochem. J. 320, 473-478
37. Tollefsbol, T. O., and Hutchison, C. A., III (1997) J. Mol. Biol. 269, 494-504[CrossRef][Medline] [Order article via Infotrieve]
38. Carotti, D., Funiciello, S., Palitti, F., and Strom, R. (1998) Biochemistry 37, 1101-1108[CrossRef][Medline] [Order article via Infotrieve]
39. Bestor, T. (1988) Biochem. Soc. Trans. 16, 944-947[Medline] [Order article via Infotrieve]
40. Bestor, T., Laudano, A., Mattaliano, R., and Ingram, V. (1988) J. Mol. Biol. 203, 971-983[CrossRef][Medline] [Order article via Infotrieve]
41. Klimasauskas, S., Kumar, S., Roberts, R. J., and Cheng, X. (1994) Cell 76, 357-369[CrossRef][Medline] [Order article via Infotrieve]
42. Reinisch, K. M., Chen, L., Verdine, G. I., and Lipscomb, W. N. (1995) Cell 82, 143-153[CrossRef][Medline] [Order article via Infotrieve]
43. Ramchandani, S., Bigey, P., and Szyf, M. (1998) Biol. Chem. Hoppe-Seyler 379, 535-540
44. Bestor, T. H. (1992) EMBO J. 11, 2611-2617[Medline] [Order article via Infotrieve]
45. Pradhan, S., Bacolla, A., Wells, R. D., and Roberts, R. J. (1999) J. Biol. Chem. 274, 33002-33010[Abstract/Free Full Text]
46. Bacolla, A., Ulrich, M. J., Larson, J. E., Ley, T. J., and Wells, R. D. (1995) J. Biol. Chem. 270, 24556-24563[Abstract/Free Full Text]
47. Bacolla, A., Gellibolian, R., Shimizu, M., Amirhaeri, S., Kang, S., Ohshima, K., Larson, J. E., Harvey, S. C., Stollar, B. D., and Wells, R. D. (1997) J. Biol. Chem. 272, 16783-16792[Abstract/Free Full Text]
48. Grant, R. C., Harwood, S. J., and Wells, R. D. (1968) J. Am. Chem. Soc. 90, 4474-4476[CrossRef][Medline] [Order article via Infotrieve]
49. Segel, I. H. (1975) Enzyme Kinetics; Behavior and Analysis of Rapid Equilibrium and Steady-state Enzyme Systems , pp. 505-845, John Wiley & Sons, Inc., New York
50. Imbert, I., Feng, Y., Nelson, D. L., Warren, S. T., and Mandel, J.-L. (1998) in Genetic Instabilities and Hereditary Neurological Diseases (Wells, R. D. , and Warren, S. T., eds) , pp. 27-53, Academic Press, San Diego, CA
51. Wu, J. C., and Santi, D. V. (1987) J. Biol. Chem. 262, 4778-4786[Abstract/Free Full Text]
52. Smith, S. S., Kaplan, B. E., Sowers, L. C., and Newman, E. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4744-4748[Abstract/Free Full Text]
53. Baker, D. J., Laayoun, A., and Smith, S. S. (1993) Biochem. Biophys. Res. Commun. 196, 864-871[CrossRef][Medline] [Order article via Infotrieve]
54. Yoder, J. A., Soman, N. S., Verdine, G. L., and Bestor, T. H. (1997) J. Mol. Biol. 270, 385-395[CrossRef][Medline] [Order article via Infotrieve]
55. Orend, J., Kuhlman, I., and Doerfler, W. (1991) J. Virol. 65, 4301-4308[Abstract/Free Full Text]
56. Carotti, D., Funiciello, S., Palitti, F., and Strom, R. (1998) Biochemistry 37, 1101-1108
57. Ruchirawat, M., Noshari, J., and Lapeyre, J.-N. (1987) Mol. Cell. Biochem. 76, 45-54[Medline] [Order article via Infotrieve]
58. Flynn, J., Azzam, R., and Reich, N. (1998) J. Mol. Biol. 279, 101-116[CrossRef][Medline] [Order article via Infotrieve]
59. Jeltsch, A., Friedrich, T., and Roth, M. (1998) J. Mol. Biol. 275, 747-758[CrossRef][Medline] [Order article via Infotrieve]
60. Bestor, T. H., and Ingram, V. M. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 5559-5563[Abstract/Free Full Text]
61. Grünwald, S., and Drahovsky, D. (1984) Int. J. Biochem. 16, 883-888[CrossRef][Medline] [Order article via Infotrieve]
62. Pfeifer, G. P., Spiess, E., Grunwald, S., Boehm, L., and Drahovsky, D. (1985) EMBO J. 4, 2879-2884[Medline] [Order article via Infotrieve]
63. Berg, O. G., and Blomberg, C. (1976) Biophys. Chem. 4, 367-381[CrossRef][Medline] [Order article via Infotrieve]
64. Berg, O. G., and Blomberg, C. (1977) Biophys. Chem. 7, 33-39[CrossRef][Medline] [Order article via Infotrieve]
65. Berg, O. G., and Blomberg, C. (1978) Biophys. Chem. 8, 271-280[CrossRef][Medline] [Order article via Infotrieve]
66. Berg, O. G., Winter, R. B., and von Hippel, P. H. (1981) Biochemistry 20, 6926-6948
67. Winter, R. B., Berg, O. G., and von Hippel, P. H. (1981) Biochemistry 20, 6961-6977[CrossRef][Medline] [Order article via Infotrieve]
68. Berg, O. G., and Ehrenberg, M. (1982) Biophys. Chem. 15, 41-51[CrossRef][Medline] [Order article via Infotrieve]
69. Berg, O. G. (1984) Biopolymers 23, 1869-1889[CrossRef][Medline] [Order article via Infotrieve]
70. Berg, O. G. (1986) Biopolymers 25, 811-821[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
V. V. Lao, J. L. Herring, C. H. Kim, A. Darwanto, U. Soto, and L. C. Sowers
Incorporation of 5-chlorocytosine into mammalian DNA results in heritable gene silencing and altered cytosine methylation patterns
Carcinogenesis, May 1, 2009; 30(5): 886 - 893.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S.-i. Takebayashi, T. Tamura, C. Matsuoka, and M. Okano
Major and Essential Role for the DNA Methylation Mark in Mouse Embryogenesis and Stable Association of DNMT1 with Newly Replicated Regions
Mol. Cell. Biol., December 1, 2007; 27(23): 8243 - 8258.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Valinluck and L. C. Sowers
Endogenous Cytosine Damage Products Alter the Site Selectivity of Human DNA Maintenance Methyltransferase DNMT1
Cancer Res., February 1, 2007; 67(3): 946 - 950.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Mull, M. L. Ebbs, and J. Bender
A Histone Methylation-Dependent DNA Methylation Pathway Is Uniquely Impaired by Deficiency in Arabidopsis S-Adenosylhomocysteine Hydrolase
Genetics, November 1, 2006; 174(3): 1161 - 1171.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
N. Mashhoon, C. Pruss, M. Carroll, P. H. Johnson, and N. O. Reich
Selective Inhibitors of Bacterial DNA Adenine Methyltransferases
J Biomol Screen, August 1, 2006; 11(5): 497 - 510.
[Abstract] [PDF]


Home page
J. Nutr.Home page
W. D. Rees, F. A. Wilson, and C. A. Maloney
Sulfur Amino Acid Metabolism in Pregnancy: The Impact of Methionine in the Maternal Diet
J. Nutr., June 1, 2006; 136(6): 1701S - 1705S.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. Goyal, R. Reinhardt, and A. Jeltsch
Accuracy of DNA methylation pattern preservation by the Dnmt1 methyltransferase
Nucleic Acids Res., February 25, 2006; 34(4): 1182 - 1188.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W. J. Lee and B. T. Zhu
Inhibition of DNA methylation by caffeic acid and chlorogenic acid, two common catechol-containing coffee polyphenols
Carcinogenesis, February 1, 2006; 27(2): 269 - 277.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K.-W. Jair, K. E. Bachman, H. Suzuki, A. H. Ting, I. Rhee, R.-W. C. Yen, S. B. Baylin, and K. E. Schuebel
De novo CpG Island Methylation in Human Cancer Cells
Cancer Res., January 15, 2006; 66(2): 682 - 692.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. H. Lee, S. Yegnasubramanian, X. Lin, and W. G. Nelson
Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1
J. Biol. Chem., December 9, 2005; 280(49): 40749 - 40756.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Patnaik, H. G. Chin, P.-O. Esteve, J. Benner, S. E. Jacobsen, and S. Pradhan
Substrate Specificity and Kinetic Mechanism of Mammalian G9a Histone H3 Methyltransferase
J. Biol. Chem., December 17, 2004; 279(51): 53248 - 53258.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Okuwaki and A. Verreault
Maintenance DNA Methylation of Nucleosome Core Particles
J. Biol. Chem., January 23, 2004; 279(4): 2904 - 2912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. G. Malygin, V. V. Zinoviev, A. A. Evdokimov, W. M. Lindstrom Jr., Norbert. O. Reich, and S. Hattman
DNA (Cytosine-N4-)- and -(Adenine-N6-)-methyltransferases Have Different Kinetic Mechanisms but the Same Reaction Route. A COMPARISON OF M.BamHI AND T4 Dam
J. Biol. Chem., April 25, 2003; 278(18): 15713 - 15719.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Bheemanaik, S. Chandrashekaran, V. Nagaraja, and D. N. Rao
Kinetic and Catalytic Properties of Dimeric KpnI DNA Methyltransferase
J. Biol. Chem., February 28, 2003; 278(10): 7863 - 7874.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Flynn, J.-Y. Fang, J. A. Mikovits, and N. O. Reich
A Potent Cell-active Allosteric Inhibitor of Murine DNA Cytosine C5 Methyltransferase
J. Biol. Chem., February 28, 2003; 278(10): 8238 - 8243.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Yokochi and K. D. Robertson
Preferential Methylation of Unmethylated DNA by Mammalian de Novo DNA Methyltransferase Dnmt3a
J. Biol. Chem., March 29, 2002; 277(14): 11735 - 11745.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Pradhan, A. Bacolla, R. D. Wells, and R. J. Roberts
Recombinant Human DNA (Cytosine-5) Methyltransferase. I. EXPRESSION, PURIFICATION, AND COMPARISON OF DE NOVO AND MAINTENANCE METHYLATION
J. Biol. Chem., November 12, 1999; 274(46): 33002 - 33010.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Bacolla, S. Pradhan, J. E. Larson, R. J. Roberts, and R. D. Wells
Recombinant Human DNA (Cytosine-5) Methyltransferase. III. ALLOSTERIC CONTROL, REACTION ORDER, AND INFLUENCE OF PLASMID TOPOLOGY AND TRIPLET REPEAT LENGTH ON METHYLATION OF THE FRAGILE X CGG{middle dot}CCG SEQUENCE
J. Biol. Chem., May 18, 2001; 276(21): 18605 - 18613.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. A. Evdokimov, V. V. Zinoviev, E. G. Malygin, S. L. Schlagman, and S. Hattman
Bacteriophage T4 Dam DNA-[N6-adenine]Methyltransferase. KINETIC EVIDENCE FOR A CATALYTICALLY ESSENTIAL CONFORMATIONAL CHANGE IN THE TERNARY COMPLEX
J. Biol. Chem., January 4, 2002; 277(1): 279 - 286.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bacolla, A.
Right arrow Articles by Wells, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bacolla, A.
Right arrow Articles by Wells, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement