|
J Biol Chem, Vol. 274, Issue 46, 33011-33019, November 12, 1999
Recombinant Human DNA (Cytosine-5) Methyltransferase
II. STEADY-STATE KINETICS REVEAL ALLOSTERIC ACTIVATION BY
METHYLATED DNA*
Albino
Bacolla ,
Sriharsa
Pradhan§,
Richard J.
Roberts§, and
Robert D.
Wells
From the Center for Genome Research, Institute of Biosciences and
Technology, Texas A & M University, Texas Medical Center,
Houston, Texas 77030-3303 and § New England Biolabs,
Beverly, Massachusetts 01915
 |
ABSTRACT |
Initial velocity determinations were conducted
with human DNA (cytosine-5) methyltransferase (DNMT1) on unmethylated
and hemimethylated DNA templates in order to assess the mechanism of
the reaction. Initial velocity data with DNA and
S-adenosylmethionine (AdoMet) as variable substrates and
product inhibition studies with methylated DNA and
S-adenosylhomocysteine (AdoHcy) were obtained and
evaluated as double-reciprocal plots. These relationships were
linear for plasmid DNA, exon-1 from the imprinted small
nuclear ribonucleoprotein-associated polypeptide N,
(CGG·CCG)12, (m5CGG·CCG)12, and
(CGG·CCG)73 but were not linear for
(CGG·Cm5CG)12. Inhibition by AdoHcy was
apparently competitive versus AdoMet and
uncompetitive/noncompetitive versus DNA at 20
µM AdoMet. Addition of the product (methylated DNA) to
unmethylated plasmid DNA increased Vmax(app)
resulting in mixed stimulation and inhibition. Velocity equations
indicated a two-step mechanism as follows: first, activation of DNMT1
by methylated DNA that bound to an allosteric site, and second, the
addition of AdoMet and DNA to the catalytic site. The preference of
DNMT1 for hemimethylated DNA may be the result of positive
cooperativity of AdoMet binding mediated by allosteric activation by
the methylated CG steps. We propose that this activation plays a role
in vivo in the regulation of maintenance methylation.
 |
INTRODUCTION |
The genome of most organisms contains modified nucleotides
including N6-methyladenine,
N4-methylcytosine, and
C5-methylcytosine
(m5C)1 (1-3).
However, both the biological significance and the types of DNA
methylation differ greatly between prokaryotes and eukaryotes. In
prokaryotes, most modified bases participate in
restriction-modification, a defense mechanism that protects the host
from heterologous phage infection (4). In addition,
N6-methyladenine plays a role in the initiation
of DNA replication (5) and in post-replicative methyl-directed mismatch
repair (6).
In higher eukaryotes, DNA methylation is confined to m5C
and is implicated in the regulation of development, genomic imprinting (7, 8), X chromosome inactivation, gene expression (9), and
retrotransposon inactivation (10-12). In mammals, the patterns of
methylation are inherited from both parental genomes but are erased and
reconstructed (de novo methylation) in somatic cells following implantation (13, 14). Such patterns are then copied and
maintained by hemimethylation of the daughter strands during semiconservative DNA synthesis in S phase (maintenance methylation) (15, 16). However, the mechanisms by which both de novo and maintenance methylation occur remain to be elucidated.
Several DNA methyltransferases have been isolated from human and mouse
(17-20), but it is not clear whether the de novo and maintenance methylations are carried out by separate proteins in
vivo or whether both activities are shared by one or more enzymes (21-26). Nevertheless, a role for in vivo methylation has
been established for isoforms of the human DNMT1 gene (27,
28) whose product, DNMT1, methylates C at a CG dinucleotide step, both
in single-stranded and double-stranded, unmethylated or hemimethylated, templates (29-34). Hemimethylated templates are the most effective for
the reaction, and methylation rates increase in the neighborhood of
pre-existing m5C residues (35-38). However, little is
known about the mechanisms responsible for this preference.
DNMT1 has a bipartite structure with the C-terminal 570 amino acids
containing the catalytic domain. This region shares sequence homologies
with all prokaryotic type II cytosine-5 methyltransferases (39, 40),
including a PC dipeptide motif that is part of the catalytic center in
the crystal structures of M.HhaI (41) and M.HaeIII (42), and the binding site for
S-adenosylmethionine (AdoMet), the methyl donor for
methyltransferases (43, 44). The remaining ~1000 N-terminal amino
acids, which are not present in the prokaryotic enzymes, contain a
nuclear localization signal, a replication foci targeting sequence
(15), and are important in the discrimination between unmethylated and
hemimethylated substrates (33).
Herein, we report kinetic analyses with the human full-length,
recombinant, DNMT1 on a variety of DNA substrates with the aim of
learning about the mechanism of the methyl transfer reaction and the
role of DNA in regulating the enzyme activity. The results confirm the
preference of DNMT1 for pre-methylated DNA; however, the kinetics
reveal a complex behavior with DNA substrates that are bound more
tightly. The reaction follows a sequential mechanism whereby both
substrates (DNA and AdoMet) must bind to the enzyme before any product
(methylated DNA and AdoHcy) is released and is consistent with a
two-step process. First, DNMT1 binds DNA at an allosteric site
(probably in the N-terminal domain) and activates the catalytic center,
and second, AdoMet and the DNA (which may either be the same molecule
bound to the regulatory site or a new DNA molecule) occupy the
catalytic site. Allosteric binding of pre-methylated CG is proposed to
increase the accessibility of AdoMet to the catalytic center, which
then results in an acceleration of the reaction rate.
 |
EXPERIMENTAL PROCEDURES |
Enzyme Assay for Initial Velocities in the Absence of
Products--
Recombinant DNMT1 was expressed and purified as
described (45). Unmethylated or hemimethylated DNA was incubated with
40 nM DNMT1 and
S-(5'-adenosyl)-L-[methyl-3H]methionine
(AdoMet) for 30 min at 37 °C in a total volume of 25 µl in buffer
A (100 mM Tris·HCl, pH 7.8, at 25 °C, 1 mM
Na2EDTA, 1 mM dithiothreitol, 7 µg/ml
phenylmethylsulfonyl fluoride, 5% glycerol, and 100 µg/ml bovine
serum albumin). Fig. 1 shows that reactions were linear under these conditions. On the other hand, enzyme
concentrations greater than 50 nM (inset to Fig.
1B) or reaction times longer than 1 h (not shown) did
not give linear responses. Concentrations of DNA are given in
micromolars of single-stranded CG steps; the range of CG and AdoMet
concentrations used in the reactions varied according to the DNA
template as follows: for pRW3602, 3.42-25.0 µM CG and
2.13-50.0 µM AdoMet; for the oligonucleotide corresponding to exon-1 of the small nuclear
ribonucleoprotein-associated polypeptide N (SNRPN) (45),
0.5-5.0 µM CG and 4.0-15.1 µM AdoMet; for
(CGG·CCG)12, 0.5-5.0 µM CG and 4.08-50.0
µM AdoMet; for (CGG·Cm5CG)12
and (m5CGG·CCG)12, 0.1-1.0 µM
unmethylated CG and 1.02-10.0 µM AdoMet; for
(CGG·CCG)73, 0.12-1.0 µM CG and 2.11-20.0
µM AdoMet. For d(I-C·I-C)~7000, only 1 nM DNMT1 was used since the reactions were much faster. In
this case, the concentration range of the substrates was 0.1-1.0 µM for CI and 1.02-20 µM for AdoMet. At
the end of the reaction, samples were quenched in a dry ice/ethanol
bath, spotted on DE81 ion exchange chromatography filters (Whatman),
placed on a 12-well manifold apparatus (Millipore), washed, dried, and
counted (45). The efficiency of scintillation counting was calculated
for every round of washing from the counts/min obtained in two filters
that were loaded with an internal control (IC filter). This control consisted of 25 µl of plasmid DNA extensively pre-methylated with AdoMet and bacterial SssI methylase (New England Biolabs);
unincorporated AdoMet was removed by Sephadex G-50 fine (Amersham
Pharmacia Biotech) column chromatography. The eluate was reconstituted
in buffer A to a concentration of ~6000 cpm/25 µl (IC solution).
The nanomolar [3H]CH3 (N) present
in the DNA at the end of the reaction was calculated as
n = (C B)/RF,
where C was the counts/min of a sample, B the blank (cpm in the absence of DNMT1), R the ratio of IC
filter/IC solution, and F the cpm/nM free
AdoMet. The initial velocity (v) was obtained as
1/v = ET/N, where E was the
concentration of DNMT1 and T the reaction time. The lower
levels of incorporations (which were associated with the data points at
the lowest concentrations of unmethylated (CGG·CCG)n) were
approximately twice their blank values. Data points were collected in
duplicate, graphed on Lineweaver-Burk double-reciprocal plots, and fit
to weighted (weight was v2) linear regressions.
These plots contain two independent variables, namely the reciprocal of
the apparent Vmax
(Vmax(app)), given by the intercepts, and the
ratio of the Michaelis constant (Km) (plus the
dissociation constant) for the variable substrate to Vmax(app), given by the slopes. By re-plotting
these intercepts and slopes derived from various combinations of
substrates, new linear plots were obtained, which yield the true
Vmax, Km, and the
dissociation constant for the substrates. Non-linear fits were not
weighted. When appropriate, the coordinates of the intersection for the
family of reciprocal plots were calculated from the kinetic constants
obtained from the replots of slope and intercept and applied as a
constraint during curve fitting.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
Conditions for linearity of the methyl
transfer reaction with DNMT1 and supercoiled pRW3602.
A, 40 nM DNMT1 was incubated at 37 °C with 25 µM CG steps and 10 µM AdoMet in a 300-µl
reaction volume in buffer A. At 30 s and subsequently at 5-min
intervals, 25 µl were withdrawn and processed, and the results were
analyzed as described under "Experimental Procedures." The means
and standard deviations for the data points were derived from two
independent experiments. B, a concentration range of 2-60
nM DNMT1 was used in reactions containing 10 µM CG steps and 10 µM AdoMet at 37 °C
for 30 min. The means and standard deviations for the data points were
derived from two independent experiments. The value at 60 nM DNMT1 was excluded from the interpolation.
Inset, the concentration ranged from 2 to 200 nM
DNMT1.
|
|
Enzyme Assay for Initial Velocities in the Presence of
Products--
Addition of known concentrations of the products to an
enzymatic reaction (product inhibition) is a powerful strategy for deciphering an enzyme mechanism, i.e. whether the substrates
bind (and the products dissociate) in an ordered or random fashion. Methylation reactions on supercoiled pRW3602 were performed in the
presence of added S-(5'-adenosyl)-L-homocysteine
(AdoHcy) or methylated DNA as product inhibitors. Assays were performed as described but, in addition, they contained fixed amounts of either
of the inhibitors. In the experiments with AdoHcy, the concentration
range of the reactants was 4.0-25.0 µM CG, 2.0-40.0 µM AdoMet, and 2.5-25.0 µM AdoHcy. Two
methylated DNAs were used as products. The first was a 40-bp duplex
oligonucleotide [(MeCG)20]) containing
canonical Watson-Crick pairs but with 5-methylcytosines substituting
for all cytosines. The second was a 36-bp duplex oligonucleotide with
the sequence
CGG(F5CGG)11·(Cm5CG)12,
named (F/MeCG)12, where F5C
designates 5-fluorocytosine. The rationale for using this fluorinated oligonucleotide was that, contrary to
[(MeCG)20],
(F/MeCG)12 may form an irreversible complex
with DNMT1, thus blocking the enzymatic turnover. In the experiments
with methylated DNA, the concentration range of the reactants was
4.0-25.0 µM CG for pRW3602, 2.5-60 µM CG
for (MeCG)20 or 11 nM to 40.0 µM CG for (F/MeCG)12, and 6.67 and 30.0 µM AdoMet.
Chemicals and DNA--
AdoMet at the specific activities of 15.0 Ci/mmol (1 Ci = 37 GBq), 500 mCi/mmol, and 60-85 Ci/mmol was
obtained from Amersham Pharmacia Biotech. AdoHcy (Sigma) was prepared
by dissolving 100 mg into 5 ml of 1 N HCl to give a 52 mM solution. Dilutions were made fresh in distilled water.
Plasmid pRW3602 was a derivative of pUC9 that contained a 40-bp insert
(TTAAGCAGCAGTATCCTCTTGGGGGCGCCTTCCCCACACT) from the human -globin
promoters in its HincII site (46). The plasmid was 2705 bp
in length with a total of 338 CG steps (on average, 1 every 8 bp).
(CGG·CCG)73 was an XbaI-BamHI
restriction fragment from plasmid pRW3691 and contained a total of 156 CG steps (including 10 from the triplet repeat flanking sequences)
(47). d(I-C·I-C)~7000 (48) was from Amersham Pharmacia
Biotech. (CGG·CCG)12,
(CGG·Cm5CG)12,
(m5CGG·CCG)12, SNRPN
oligonucleotide, and (F/MeCG)12 were
synthesized by solid phase chemistry. Their preparation is detailed in
Ref. 45. (MeCG)20 was also synthesized
chemically and contained 5-methylcytosine at each of the 20 CG
steps. The top strand sequence was
GAAm5CGTAm5CGTTAm5CGATm5CGm5CGTm5CGAm5CGATm5 CGAAm5CGTm5CGTAC.
The complementary strands were annealed to give a stock solution of 500 µM CG steps. Oligonucleotide concentrations were obtained
by optical absorption on a Beckman DU 640 spectrophotometer using the
extinction coefficients calculated from the known coefficients of the
component nucleotides. Since this synthetic 40-mer contains only
m5C at all CG steps and contains no CNG sequences, it does
serve as a substrate for DNMT1 and was studied as a product inhibitor. A list of all the substrates and inhibitors used and their relevant properties is given in Table I.
Velocity Equations, Initial Forward Velocity in the Absence of
Products--
Fig. 2 shows the basic
scheme for the reaction of DNMT1 with DNA and AdoMet as obtained from
the initial velocity data and product inhibition studies. Knowledge of
the reaction sequence is essential for the derivation of all the
kinetic constants, since the meaning of slopes and intercepts of the
double-reciprocal plots (as well as their replots) is based on the
velocity equation derived from the mechanism itself. Fig. 2A
shows that the first step involves the binding of DNA (D) to a
regulatory site in DNMT1 (E), distinct from the catalytic site, to
give a DNA-DNMT1 initial complex. The second step consists in the
binding of a CG·CG (or CG·m5CG or
m5CG·CG) and AdoMet (Am) to the catalytic site to give
the ternary complex competent for catalysis.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2.
Scheme of an ordered Bi Bi mechanism with
allosteric activation for the methyltransferase reaction by DNMT1.
A, free DNMT1 (E) binds the activator DNA
(D) at a regulatory site and subsequently AdoMet
(Am) and a second molecule of DNA to the catalytic site. The
sequence of addition of AdoMet and the DNA to the catalytic site is
arbitrary. The kinetic data do not distinguish whether AdoMet, or the
DNA, or both are the first to bind to this site. B,
E, and DE are grouped together since their
interconversion is at equilibrium relative to the other enzyme species.
This assumption is made in order to develop a velocity equation that
yields linear responses; f1 is
DE/(E + DE); M and
Ah signify the products of the reaction, methylated DNA and
AdoHcy, respectively.
|
|
Based on the initial velocity patterns that were obtained, the reaction
is treated at steady state (the turnover rate of the enzyme is not
limited by how fast the chemical reaction takes place) except for the
interconversion between free DNMT1 and DNA-DNMT1, which must occur at
equilibrium within the steady state. Addition of the substrates is
shown to be ordered, with AdoMet preceding the DNA; however, this
sequence of addition is not proven by the present data, as discussed
later. Indeed, the reaction may be ordered with DNA binding before
AdoMet or random, where either substrate can bind first. The velocity
equations for an ordered or random sequential bireactant system (such
as this) are identical, and both Vmax and the
Michaelis constant for the substrates
(KmCG and
KmAdoMet) can be derived, even
though the mechanism is unknown. However, the dissociation constant
Kia for the first substrate that adds to the
reaction cannot be assigned unless it is identified. Our derivation of
the following velocity Equation 1 was based on the formulations by
King-Altman and Cha, which are described in detail by Segel (49). The
method requires that the section of the reaction at equilibrium be
grouped into a single corner of the scheme, as illustrated in Fig.
2B. The rate k3[AdoMet] is then
corrected for f1, the ratio of DNA-DNMT1 to
DNA-DNMT1 plus free DNMT1. In the following equations, [CG] is given
the same meaning as [D] (DNA) in Fig. 2.
The velocity Equation 1, in the absence of products, is as follows.
|
(Eq. 1)
|
where Kia(app) = Kia(1 + KCG/[CG]),
Kia = k4/k3,
Km(app)AdoMet = KmAdoMet(1 + KCG/[CG]), and
KCG = k2/k1.
When [AdoMet] is the variable substrate (see Equation 2)
|
(Eq. 2)
|
for small values of KCG/[CG] and
KCG
KmAdoMet.
Plots obtained at changing fixed concentrations of [CG] intersect at
1/[AdoMet] = 1/Kia and 1/v = (1 KmAdoMet/Kia)/Vmax.
When [CG] is the varied substrate (see Equation 3), for small values
of KCG/[CG], the velocity is as follows:
|
(Eq. 3)
|
and the family of double-reciprocal plots intersects at 1/[CG] = KmAdoMet/KmCG
Kia and 1/v = (1 KmAdoMet/Kia)/Vmax.
 |
RESULTS |
Initial velocity experiments enable the evaluation of kinetic
constants and provide insights into the mechanism of a reaction. A
comprehension of the mechanism of this key enzyme, human DNMT1, is
critical for understanding its role in developmental processes and in
the etiology of fragile X syndrome and other diseases (7-10, 50). A
variety of DNA templates (Table I) were methylated to less than 5-8%
of the total CG steps by purified, recombinant DNMT1 with the aim of
assessing the effect of sequences flanking the substrate CG on the
kinetic constants, the role of negative supercoiling, and the mechanism
of the reaction. Experimental data were analyzed by graphing the extent
of methylation as a function of concentration of DNA or AdoMet, as
variable substrates, on double-reciprocal Lineweaver-Burk plots. This
report is the second of a series of three papers describing the
purification and characterization of DNMT1 (45) and focuses on the
mechanism of the methyltransferase reaction. The third
paper2 will describe the
effect of DNA topology on the reaction rates at CG sites in random as
well as CGG·CCG repeat tracts and compare the kinetic properties of
DNMT1 with the bacterial M.SssI.
Linear Velocity Responses--
For bireactant enzymes (such as
DNMT1), double-reciprocal plots generally give linear responses where
1/v is graphed as a function of 1/substrate. For most of the
DNAs used, which included supercoiled pRW3602 as purified from
Escherichia coli ( = 0.045), relaxed
circular ( = 0), or linear, as well as the
SNRPN oligonucleotide (unmethylated or hemimethylated),
(CGG·CCG)12, (m5CGG·CCG)12, and
(CGG·CCG)73, the velocity curves were linear with respect
to the variable substrate, whether this was the DNA or AdoMet. Fig.
3 shows the data with supercoiled
pRW3602. Fig. 3A shows the concentration of
[3H]CH3 groups incorporated when the DNA was
the variable substrate (on the x axis) and AdoMet the fixed
substrate. Conversely, Fig. 3B shows the results with AdoMet
as the variable substrate and DNA as the fixed substrate. For all of
the DNA templates listed above, the velocity patterns were as in Fig.
3, i.e. they converged to the left of the y axis
and above or below the x axis for both substrates. Fig.
4 shows the double-reciprocal plots for
the triplet repeat sequences (CGG·CCG)12 (Fig. 4,
A and B),
(m5CGG·CCG)12 (Fig. 4, C and
D), and (CGG·CCG)73 (Fig. 4, E and
F). These patterns contrast with those obtained with
M.HhaI (51) and M.SssI2
methylases, where the families of lines converge on the y
axis when AdoMet is the variable substrate. This result shows that AdoMet and DNA do not bind by an ordered and rapid equilibrium mechanism to DNMT1, as in the case with M.HhaI and
M.SssI.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
Initial forward velocities for the
methylation of supercoiled pRW3602. The figure shows
Lineweaver-Burk double-reciprocal plots. On the y axis is
the reciprocal of nM [3H]CH3
contained in the DNA following transfer from AdoMet by 1 nM
DNMT1 in 1 min, and on the x axis is the reciprocal
concentration of the variable substrate. DNMT1 concentration was 40 nM. A, [3H]CH3
concentration as a function of variable DNA at changing-fixed AdoMet;
AdoMet concentrations were as follows: filled circles, 50.0 µM; open circles, 12.5 µM,
filled squares, 6.67 µM; open
squares, 4.42 µM; filled diamonds, 3.33 µM; open diamonds, 2.13 µM.
B, [3H]CH3 incorporated as a
function of variable AdoMet at changing-fixed CG concentrations:
filled circles, 25.0 µM; open
circles, 12.2 µM; filled squares, 8.06 µM; open squares, 4.81 µM;
filled diamonds, 3.42 µM. Other plots were
omitted for clarity. Lines drawn through the experimental
data points are from fitting of the data to Equation 3 for A
and Equation 2 for B.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
Initial forward velocities for the
methylation of CGG·CCG triplet repeats. The Lineweaver-Burk
double-reciprocal plots present 1/v (y axis)
expressed as the reciprocal of nM
[3H]CH3 contained in the DNA following the
transfer from AdoMet by 1 nM DNMT1 in 1 min
versus the reciprocal concentration of the variable
substrate (x axis). The DNMT1 concentration was 40 nM. The concentrations of reactants for each are in the
following order: filled circles, open circles,
filled squares, open squares, filled diamonds, and
open diamonds. A,
[3H]CH3 concentration as a function of
variable DNA at changing-fixed AdoMet for (CGG·CCG)12;
AdoMet concentrations were 50.0, 15.9, 9.26, 5.02, 4.50, and 4.08 µM. B, [3H]CH3
concentration as a function of variable AdoMet at changing-fixed DNA
for (CGG·CCG)12; CG concentrations were 5.00, 2.50, 1.25, 0.83, 0.62, and 0.50 µM. C,
[3H]CH3 concentration as a function of
variable DNA at changing-fixed AdoMet for
(m5CGG·CCG)12; AdoMet concentrations were
10.0, 5.02, 3.38, 1.73, 1.23, and 1.02 µM. D,
[3H]CH3 concentration as a function of
variable AdoMet at changing-fixed DNA for
(m5CGG·CCG)12; CG concentrations were 1.00, 0.50, 0.25, 0.17, 0.12, and 0.10 µM. E,
[3H]CH3 concentration as a function of
variable DNA at changing-fixed AdoMet for (CGG·CCG)73;
AdoMet concentrations were 20.0, 9.00, 5.88, 4.00, 2.50, and 2.11 µM. F, [3H]CH3
concentration as a function of variable AdoMet at changing-fixed DNA
for (CGG·CCG)73; CG concentrations were 1.00, 0.40, 0.25, 0.18, 0.14, and 0.12 µM.
|
|
Fig. 5 shows the replots of the
slope and y axis intercept
(1/Vmax(app)) for each of the lines in
Fig. 3 that were used to derive the kinetic constants. As shown in
Equations 2 and 3, four replots are possible that give the following
constants: (a) 1/Vmax on the
y axis intercept (Fig. 5A) and
1/KmAdoMet on the
x-axis intercept by replotting the intercepts of Fig. 3A as a function of 1/AdoMet (Equation 3); (b)
KmCG/Vmax
on the y axis intercept (Fig. 5A) and
1/Kia on the x axis intercept by
replotting the slopes of Fig. 3A as a function of 1/AdoMet;
(c) 1/Vmax on the y axis
intercept (Fig. 5B) and
1/KmCG on the x axis
intercept by replotting the intercepts from Fig. 3B as a
function of 1/CG (Equation 2); and (d)
KmAdoMet/Vmax
on the y axis intercept (Fig. 5B) and
KmAdoMet/KiaKmCG
on the x axis intercept by replotting the slopes from Fig.
3B as a function of 1/CG. Therefore, these four replots
yield the maximum velocity and the Michaelis constants for AdoMet (at
DNA = ) and DNA (at AdoMet = ). As pointed out
previously, the dissociation constant Kia cannot be
assigned to the DNA or AdoMet because the method does not distinguish
the order of addition. The experimental values for the constants are
reported in the companion papers2 (45).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Replots of intercepts and slopes of initial
velocities for the methylation of supercoiled pRW3602.
A, replot of slopes and y axis intercepts of the
1/v versus 1/CG data shown in Fig. 3A. B, replot
of slopes and y axis intercepts from the 1/v
versus 1/AdoMet data shown in Fig. 3B. Error
bars are the standard error associated with the double-reciprocal
plots before constraint to the convergence point was applied.
Lines drawn through the experimental data points are from
fitting of the data to the slopes and intercepts of Equation 3 for
A and Equation 2 for B.
|
|
Curved Velocity Responses--
Unexpectedly, two template DNAs
(d(I-C·I-C)~7000 and
(CGG·Cm5CG)12) gave non-linear initial
velocity curves. The results for d(I-C·I-C)~7000 are
described in the accompanying paper (45), whereas the double-reciprocal
plots for (CGG·Cm5CG)12 are reported in Fig.
6. Fig. 6A shows that the
methylation rate was linear when DNA was the variable substrate. The
data also indicate that, contrary to Figs. 3 and 4, velocities were maximal at 1.74 µM AdoMet, such that further increases
(up to 10.0 µM) did not result in a decrease in slope or
intercept. Fig. 6B shows that plots were not linear when
AdoMet was the variable substrate. Velocities were unchanged, and plots
were parallel to the x axis when AdoMet concentrations rose
above ~2 µM. The responses were still dependent on DNA
concentration, since 1/Vmax(app) (y
axis intercepts) decreased with increasing CG content. A replot of
1/Vmax(app) versus 1/CG was linear
(Fig. 7A), whereas both intercept and slope replots from the data at fixed AdoMet were curved
(Fig. 7B).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6.
Double-reciprocal plots for the methylation
of (CGG·Cm5CG)12. A,
[3H]CH3 concentration as a function of DNA at
fixed AdoMet concentrations were as follows: open triangles,
1.02 µM; filled triangles, 1.23 µM; open diamonds, 1.43 µM;
filled diamonds, 1.74 µM; open
squares, 2.56 µM; filled squares, 4.17 µM; open circles, 5.02 µM; and
filled circles, 10.0 µM. B,
nM [3H]CH3 incorporated as a
function of AdoMet at fixed DNA. CG concentrations were as follows:
open diamonds, 0.10 µM; filled
diamonds, 0.12 µM; open squares, 0.16 µM; filled squares, 0.25 µM;
open circles, 0.50 µM; filled
circles, 1.00 µM. DNMT1 concentration was 40 nM.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7.
Replots of slopes and intercepts for initial
velocities with (CGG·Cm5CG)12.
A, replot of y axis intercepts from the 1/v
versus 1/AdoMet data shown in Fig. 6B. B, replot of
y axis intercepts and slopes from the 1/v versus
1/CG shown in Fig. 6A.
|
|
This result indicates that when this particular DNA was bound to
DNMT1, the velocity of the reaction was already maximal at a very low
(~2 µM) AdoMet concentration, contrary to the
expectation that maximum velocity requires infinite amounts of AdoMet.
The plots in Figs. 6 and 7 still enable the calculation of
1/Vmax, 1/KmCG, and
1/KmAdoMet; however,
Kia cannot be derived.
The most significant conclusion that can be drawn from these results is
that the kinetic behavior of DNMT1 may be dramatically altered by both
sequence of the DNA template and its pre-methylation status. Obviously,
the scheme in Fig. 2 and its velocity equations are not adequate to
describe the results with (CGG·Cm5CG)12 which
implies that DNMT1 is capable of complex kinetics. Overall, this
combination of linear plus non-linear responses indicates a
steady-state mechanism, where the DNA can act simultaneously both as a
substrate and as an activator for the reaction. The activation is
proposed to occur through binding of a DNA molecule at a site distinct
from the catalytic center, i.e. an allosteric, or
regulatory, site. The precise sequence of the chemical steps that lead
to such non-linear responses, however, is unknown. Nevertheless, it
seems clear that the role of the DNA bound to the allosteric site is to
increase the affinity of the DNA-DNMT1 complex for AdoMet since low
levels of AdoMet are sufficient to maximally drive the reaction.
It is noteworthy that the complex enzymatic behavior is associated with
a DNA sequence, the (CGG·CCG)n triplet repeat, whose
expansion in the chromosomal FRAX locus leads to aberrant methylation and to disease in humans.
In summary, these studies indicate that the methylation reaction by
DNMT1 may follow complex mechanisms, and both the sequence composition
as well as the methylation status of the DNA substrate contribute to
this complexity.
Product Inhibition with AdoHcy--
Product inhibition studies of
bireactant enzymes provide a means to distinguish random from ordered
sequential Bi Bi mechanisms. Ordered systems give competitive patterns
with the first substrate that binds to the enzyme versus the
last product that leaves the enzyme (the plots converge on the
y axis) and non-competitive patterns with the other
combinations (the lines converge to the left of the y axis).
On the contrary, random mechanisms give competitive inhibition between
like substrates and products (with similar chemical structures) and
non-competitive patterns between unlike reactants. In our case,
determining whether the reaction is ordered or random would enable the
assignment of the dissociation constant Kia to the
DNA, to AdoMet, or to both in the case of a random system.
In the first set of experiments (AdoHcy versus CG with fixed
AdoMet) (unlike product and substrate), 2.5 to 25.0 µM
AdoHcy were added to reactions where the concentration of CG with
supercoiled pRW3602 was varied and AdoMet kept constant. In separate
studies, the fixed concentration of AdoMet ranged from 2.0 to 40.0 µM. The pattern of inhibition was non-competitive from
2.0 to 10.0 µM AdoMet, rather uncompetitive at 15.0 and
20.0 µM AdoMet, and non-competitive again from 26.0 to
40.0 µM AdoMet (not shown).
In double-reciprocal plots where AdoMet was the variable substrate,
AdoHcy the changing-fixed inhibitor (like substrate and product), and
CG the fixed co-substrate (4.0 to 25.0 µM), velocities increased, as expected, up to 20.0 µM AdoMet; however,
higher concentrations caused strong inhibition by AdoHcy, a result that was not anticipated. In fact, the expectation was that AdoMet would
progressively overcome the inhibition by AdoHcy, linearly increasing
the reaction rates as its concentration rose. The slopes obtained from
the 1/v versus 1/CG plots (which were linear) at various
AdoHcy concentrations were graphed as a function of AdoMet. Increasing
AdoMet up to 50 µM progressively reduced the slopes (higher velocities) to plateau levels in the absence of AdoHcy, as
expected. AdoHcy increased all of the slopes as a result of inhibition,
and increasing AdoMet progressively reduced such an inhibition.
However, at concentrations of AdoMet >20 µM, there was a
new, strong non-competitive inhibition by AdoHcy that was then reduced
by higher levels of AdoMet. This pattern found at greater than 20.0 µM AdoMet is anomalous; the reason for this behavior is
uncertain. When these unusual data at >20.0 µM AdoMet were excluded, the pattern of inhibition versus AdoHcy (like
substrate and product) was competitive (Fig.
8A).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 8.
Product inhibition by AdoHcy.
A, nM [3H]CH3
incorporated in supercoiled pRW3602 (6.02 µM CG) at
varying AdoMet concentrations and changing-fixed AdoHcy as the
inhibitor; AdoHcy concentrations were 2.5 µM
(filled circles), 5.0 µM (open
circles), 10.0 µM (filled squares), 15.0 µM (open squares), 20.0 µM (filled triangles), and 25.0 µM (open triangles). B, Dixon plot
for AdoHcy inhibition; the slopes (Slope1/CG) of
1/v versus 1/CG (µM CG in
supercoiled pRW3602: 4.00, 4.81, 6.02, 8.06, 12.19, and 25.0) obtained
at fixed AdoMet (2.0, 4.0, 6.67, 10.0, 15.0, and 20.0 µM)
and changing-fixed AdoHcy (0, 2.5, 5.0, 10.0, 15.0, 20.0, and 25.0 µM) concentrations were calculated; these results then
were replotted as Slope1/CG versus 1/AdoMet for
each concentration of AdoHcy (all regressions were linear). The slopes
of these last regressions are shown as a function of AdoHcy
concentrations.
|
|
To test whether there was evidence for more than one binding site for
AdoMet in DNMT1, a Dixon plot (49) was constructed. Slopes1/CG were replotted as a function of 1/AdoMet for
AdoMet 20.0 µM, at each fixed value of AdoHcy. The
replots were linear, and their slopes (SlopeCG/AdoMet) were
finally graphed as a function of AdoHcy (Fig. 8B). The result was a linear, rather than a parabolic, curve indicating that
only one AdoMet-binding site per DNMT1 molecule was detected. The
x axis intercept gives the Ki for AdoHcy,
which is ~14 µM.
Product Inhibition with Methylated and Fluorinated DNA--
The
second part of the inhibition studies consisted of the use of the other
product, fully methylated DNA. In conjunction with the data with
AdoHcy, fully methylated DNA was expected to give non-competitive
inhibition patterns versus both substrates for an ordered
steady-state mechanism or competitive inhibition versus DNA
for a random mechanism. A concentration range of 2.5 to 60.0 µM of m5CG steps containing 5-methylcytosine
in a 40-bp duplex synthetic oligonucleotide
(MeCG)20 was added to 4.00 to 25.0 µM CG from supercoiled pRW3602 (like substrate and
product) and 6.67 or 30.0 µM AdoMet. Fig. 9A shows the replot of
intercepts from double-reciprocal plots where pRW3602 was the variable
substrate and (MeCG)20 the changing-fixed
inhibitor, with AdoMet fixed at 6.67 µM. Intercepts were
expected not to change for a competitive system or increase with
increasing m5CG for a non-competitive mechanism. On the
contrary, whereas some scatter was observed,
1/Vmax(app) decreased as more inhibitor was
added, indicating enzyme activation rather than inhibition. Slope
effects were more complex but not substantial. At 30.0 µM AdoMet, velocities with 2.5, 5.0, and 10.0 µM
(MeCG)20 were indistinguishable from those in
the absence of inhibitor, whereas 20, 30, and 40 µM
(MeCG)20 caused inhibition. These latter three
concentrations gave parabolic curves, whereas, in all cases, intercepts
were unchanged (Fig. 9B). Overall, these data indicate that
fully methylated DNA acted in two ways as follows: first, it inhibited
the reaction by competing with unmethylated DNA for the catalytic
center, and second, it accelerated the turnover number of the enzyme by
binding to an allosteric site.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 9.
Product inhibition by fully methylated
(MeCG)20 duplex DNA. A, replot
of y axis intercepts from double-reciprocal plots of initial
velocities obtained with supercoiled pRW3602 as the variable substrate
(4.00, 4.81, 6.02, 8.06, 12.19, and 25.0 µM CG) in the
presence of changing-fixed concentrations of
(MeCG)20 oligonucleotide, ranging from 0 to
60.0 µM methylated (m5CG) CG. The
concentration of AdoMet was 6.67 µM. B,
double-reciprocal plot of initial velocities obtained with supercoiled
pRW3602 as the variable substrate and (MeCG)20
as the changing-fixed inhibitor. AdoMet was held at 30.0 µM. The concentrations of m5CG were as
follows: 0 µM (inverted triangles),
2.5 µM (open triangles), 5.0 µM
(filled triangles), 10.0 µM (open
squares), 20.0 µM (filled squares), 40.0 µM (open circles), and 60.0 µM
(filled circles). Experimental data points were fit to a
second degree polynomial, and no constraints were applied.
|
|
To verify this dual role of methylated DNA further, experiments
were carried out with an oligonucleotide
(CGG(F5CGG)11·(Cm5CG)12)
that contained m5CG on one strand and F5CG
(5-fluorocytosine) steps on the complementary strand
[(F/MeCG)12].
(F/MeCG)12 has two characteristics as follows:
on the one hand, it acts as a dead-end inhibitor since F5CG
binds to DNMT1 in the presence of AdoMet and traps the enzyme into a
stable DNMT1-AdoMet-DNA complex that does not proceed through catalysis
(52-54). As a result, this causes inhibition. On the other hand, the
DNA sequence and methylation status of
(F/MeCG)12 is identical to that of
(CGG·Cm5CG)12, the substrate that produced
the complex enzymatic patterns in Figs. 6 and 7. Thus, it was of
interest to determine if (F/MeCG)12 acted as an
inhibitor, an activator, or both. Eleven nM to 40.0 µM of modified CG steps from
(F/MeCG)12 was added to 4.00 to 25.0 µM CG from supercoiled pRW3602 and 6.67 or 30.0 µM AdoMet. Fig. 10,
A and B, shows the intercept and slope replots
from double-reciprocal plots where pRW3602 was the variable substrate
and (F/MeCG)12 the fixed inhibitor (like
substrate and inhibitor). The Lineweaver-Burk plots were linear.
(F/MeCG)12 caused a decrease in both intercepts
and slopes at 6.67 µM AdoMet (filled circles)
and had no effect at 30.0 µM AdoMet (open
circles). Interestingly, the decreases in intercepts occurred at
nanomolar concentrations of the added oligonucleotide, suggesting that
(F/MeCG)12 was far more potent as an activator
than as an inhibitor.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 10.
Product inhibition by
fluorinated/methylated (F/MeCG)12 duplex
DNA. Replots of the y axis intercepts (A)
and slopes (B) from double-reciprocal plots of initial
velocities obtained with supercoiled pRW3602 as a variable substrate
(4.00, 4.81, 6.02, 8.06, 12.19, and 25.0 µM CG) in the
presence of changing-fixed concentrations of fluorinated/methylated
(F/MeCG)12 oligonucleotide ranging from 0 to
40.0 µM CG steps. Concentrations of AdoMet were 6.67 µM (filled circles) and 30.0 µM
(open circles).
|
|
To verify this conclusion, control reactions were performed in the
presence of (F/MeCG)12 alone since
DNMT1-AdoMet-DNA complexes, which are retained on DE81 filters during
the sample processing, would lead to erroneously high values of labeled
methyl groups for pRW3602. These controls confirmed that the
oligonucleotide acted as an activator rather than an inhibitor.
In summary, these product inhibition studies support the finding
obtained with (CGG·Cm5CG)12 that methylated
DNA is an activator of the methyl transfer reaction. On the other hand,
since this behavior complicated the inhibition patterns, it could not
be used in conjunction with the AdoHcy experiments to distinguish
whether the reaction proceeds through a random or an ordered mechanism.
Therefore, the dissociation constant Kia cannot be
assigned to either the DNA or AdoMet.
 |
DISCUSSION |
Mammalian DNMT1 was reported to methylate hemimethylated DNA to a
greater extent (2-5-fold) than unmethylated DNA (32-34, 38), an
observation confirmed here with a new recombinant enzyme that displays
an ~30-fold higher activity than previously obtained (34). It was
also observed that methylation rates increase when duplex, or
single-stranded, DNA contains randomly pre-methylated m5CG·CG, m5CG·m5CG, or
m5CG steps (a phenomenon known as methylation spreading)
and that such a stimulation extends in trans to unmethylated
molecules (Refs. 36 and 37 and references therein and Refs. 55 and 56).
Furthermore, allosteric transitions in DNMT1-methylated DNA complexes
have been proposed, based on non-Michaelis-Menten patterns of
methylation with hemimethylated templates (57).
Our studies indicate that the presence of m5CG (either in
hemimethylated of fully methylated templates) stimulates the reaction. The effect is likely mediated by DNA binding to an allosteric site,
since neither (MeCG)20 nor the
(F/MeCG)12 duplexes served as alternative
substrates in control experiments.
This effect could be achieved in two ways as follows: (a)
m5CG "exposes" the enzyme active site, which is
otherwise less accessible and/or, (b) m5CG
binding modifies the active site conformation, improving its fit for
AdoMet and/or the DNA. The data with
(CGG·Cm5CG)12, which showed saturation at 2 µM AdoMet, suggest an active role for m5CG in
shaping the AdoMet binding pocket. Furthermore, the results reveal a
role for the DNA primary sequence in modulating substrate binding
specificity and, ultimately, the catalytic rates (45, 58).
The turnover number for the enzyme varied considerably among the DNA
templates, from ~1 to 50 h 1, but was lower than for
d(I-C·I-C)~7000, 184 h 1 (45). These
results seem to exclude the methyl transfer as the rate-limiting step
in the reaction. On the other hand, it was found that methylation rates
increase with negative supercoiling2 suggesting that,
instead, substrate binding and/or product release limit the turnover
rate (59).
Overall, the initial velocity data are consistent with a steady-state
sequential Bi Bi mechanism (either ordered or random). The linear
double-reciprocal plots are adequately described by the reaction scheme
in Fig. 2 and velocity equations (Equations 1-3) developed according
to steady-state assumptions that require the addition of both
substrates before any product is released. However, the scheme is not
sufficient to explain the curved responses obtained with
(CGG·Cm5CG)12 and
d(I-C·I-C)~7000, suggesting that the reaction may take
alternative pathways.
It was reported that DNMT1 is processive, based on the observations
that methylation rates increase with the length of the DNA, that NaCl
inhibits the reaction in a concentration-dependent manner
(57, 60), and that DNA-protein associations are rather stable (61, 62).
The linear velocity patterns obtained here with the various DNA
templates, including the closely spaced CG steps in
(CGG·CCG)n, were accounted for by a reaction scheme whereby
the enzyme dissociates from the DNA after each reaction cycle. Thus,
additional terms associated with processivity were not necessary in the
final velocity equation. The higher Vmax
observed for longer, rather than shorter, polymers such as (CGG·CCG)73 versus (CGG·CCG)12
(45)2 does not require a processive mechanism. The
one-dimensional limited diffusion (63-66) and/or intersegment transfer
(67-70) processes, characteristic of DNA-binding enzymes, account for
this result. The theory underlying such mechanisms states that
macromolecular collision in solution is not elastic, so that when
a protein collides with a DNA molecule, it stays along the contour
length of the DNA through repetitive microcollisions (which entail
dissociations and re-associations), rather than drifting away.
Consequently, the time spent by a protein on one DNA molecule of length
n would be greater than the time spent by the same protein
on combined m DNA molecules of length n/m.
Therefore, we cannot conclude that DNMT1 acted processively.
These kinetic determinations have implications for the in
vivo reactions of maintenance methylation. For example, the
pre-methylated parental strand during DNA replication may act as an
allosteric activator to direct reactions on the unmethylated daughter
strand. Also, the ability of the enzyme to bind AdoMet in equilibrium may be exploited to accelerate reaction rates. It is possible that
turnover rates are higher in vivo, where DNMT1 may
associate with multienzyme complexes, such as the replication or the
mismatch repair systems, that afford high processivity rates that can
compensate for the limitations imposed in vitro with DNMT1
alone. In summary, the human DNMT1 is a complex enzyme from the
standpoint of protein structure, the ability of substrates to conduct
regulatory functions, and kinetic behavior on different types of substrates.
 |
ACKNOWLEDGEMENTS |
We thank Drs. W. Wallace Cleland and Thomas
Meek for critical reviews of the manuscript and Drs. Daniel Santi and
Sanjay Kumar for providing helpful suggestions.
 |
FOOTNOTES |
*
This work was supported by Grants GM46127 (to R. J. R.),
GM52982, and NS37554 (to R. D. W.) from the National Institutes of Health and by the Robert A. Welch Foundation (to R. D. W.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Center for Genome
Research, Inst. of Biosciences and Technology, Texas A & M
University, Texas Medical Center, 2121 Holcombe Blvd., Houston, TX
77030-3303. Tel.: 713-677-7660; Fax: 713-677-7689; E-mail:
abacolla@ibt.tamu.edu.
2
A. Bacolla, S. Pradhan, J. E. Larson,
R. J. Roberts, and R. D. Wells, manuscript in preparation.
 |
ABBREVIATIONS |
The abbreviations used are:
m5C, C5-methylcytosine;
bp, base pair(s);
DNMT1, DNA
(cytosine-5) methyltransferase;
AdoMet, S-adenosyl-L-methionine;
AdoHcy, S-adenosyl-L-homocysteine;
SNRPN, duplex oligonucleotide (75 bp) corresponding to exon-1 of the small
nuclear ribonucleoprotein-associated polypeptide N, which is part of an
imprinting center on human chromosome 15q11-13;
F5C, 5-fluorocytosine;
(MeCG)20, double-stranded
40-mer of random sequence containing methylated cytosine
(m5C) at all CG dinucleotide steps;
(F/MeCG)12, duplex oligonucleotide of
composition
CGG(F5CGG)11·(Cm5CG)12,
containing the CGG triplet repeat sequence whose expansion is associated with the fragile-X mental retardation syndrome (the duplex
oligonucleotide contains non-methylatable CG steps, F5C on
the top strand and m5C on the bottom strand).
 |
REFERENCES |
| 1.
|
Landry, D.,
Barsomian, J. M.,
Feeherey, G. R.,
and Wilson, G. G.
(1992)
Methods Enzymol.
216,
244-259[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Wilson, G. G.
(1992)
Methods Enzymol.
216,
259-279[Medline]
[Order article via Infotrieve]
|
| 3.
|
Cheng, X.
(1995)
Annu. Rev. Biophys. Biomol. Struct.
24,
293-318[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Roberts, R. J.,
and Halford, S. S.
(1993)
in
Nucleases
(Linn, S. M.
, Lloyd, R. S.
, and Roberts, R. J., eds)
, pp. 35-88, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 5.
|
Noyer-Weidener, M.,
and Trautner, T. A.
(1993)
in
DNA Methylation: Molecular Biology and Significance
(Jost, J. P.
, and Saluz, H. P., eds)
, pp. 39-108, Birkhauser Verlag, Basel
|
| 6.
|
Modrich, P.,
and Lahue, R.
(1996)
Annu. Rev. Biochem.
65,
101-133[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Li, E.,
Beard, C.,
Forster, A. C.,
Bestor, T. H.,
and Jaenisch, R.
(1993)
Cold Spring Harbor Symp. Quant. Biol.
58,
297-305[Abstract/Free Full Text]
|
| 8.
|
Li, E.,
Beard, C.,
and Jaenisch, R.
(1993)
Nature
366,
362-365[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Jost, J. P.,
and Saluz, H. P
(1993)
DNA Methylation: Molecular Biology and Significance
, Birkhauser Verlag, Basel
|
| 10.
|
Doerfler, W.
(1991)
Biol. Chem. Hoppe-Seyler
372,
557-564[Medline]
[Order article via Infotrieve]
|
| 11.
|
Woodcock, D. M.,
Lawler, C. B.,
Linsenmeyer, M. E.,
Doherty, J. P.,
and Warren, W. D.
(1997)
J. Biol. Chem.
272,
7810-7816[Abstract/Free Full Text]
|
| 12.
|
Bestor, T. H.
(1990)
Philos. Trans. R. Soc. Lond-Biol. Sci.
326,
179-187[Abstract/Free Full Text]
|
| 13.
|
Razin, A.,
and Shemer, R.
(1995)
Hum. Mol. Genet.
4,
1751-1755[Abstract]
|
| 14.
|
Trasler, J. M.,
Hake, L. E.,
Johnson, P. A.,
Alcivar, A. A.,
Millette, C. F.,
and Hecht, N. B.
(1990)
Mol. Cell. Biol.
10,
1828-1834[Abstract/Free Full Text]
|
| 15.
|
Leonhardt, H.,
Page, A. W.,
Weier, H.-U.,
and Bestor, T. H.
(1992)
Cell
71,
865-873[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Araujo, F. D.,
Knox, J. D.,
Szyf, M.,
Price, G. B.,
and Zannis-Hadjopoulos, A.
(1998)
Mol. Cell. Biol.
18,
3475-3482[Abstract/Free Full Text]
|
| 17.
|
Okano, M.,
Xie, S.,
and Li, E.
(1998)
Nat. Genet.
19,
219-220[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Van den Wyngaert, I.,
Sprengel, J.,
Kass, S. U.,
and Luyten, W. H. M. L.
(1998)
FEBS Lett.
426,
283-289[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Yoder, J. A.,
and Bestor, T. H.
(1998)
Hum. Mol. Genet.
7,
279-284[Abstract/Free Full Text]
|
| 20.
|
Xu, G.,
Flynn, J.,
Glickman, J. F.,
and Reich, N. O.
(1995)
Biochem. Biophys. Res. Commun.
207,
544-551[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Li, E.,
Bestor, T. H.,
and Jaenisch, R.
(1992)
Cell
69,
915-926[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Trasler, J. M.,
Alcivar, A. A.,
Hake, L. E.,
Bestor, T.,
and Hecht, N. B.
(1992)
Nucleic Acids Res.
20,
2541-2545[Abstract/Free Full Text]
|
| 23.
|
Yoder, J. A.,
Yen, R.-W. C.,
Vertino, P. M.,
Bestor, T. H.,
and Baylin, S. B.
(1996)
J. Biol. Chem.
271,
31092-31097[Abstract/Free Full Text]
|
| 24.
|
Tucker, K. L.,
Talbot, D.,
Lee, M. A.,
Leonhardt, H.,
and Jaenisch, R.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
12920-12925[Abstract/Free Full Text]
|
| 25.
|
Lei, H.,
Oh, S. P.,
Okano, M.,
Jüttermann, R.,
Goss, K. A.,
Jaenisch, R.,
and Li, E.
(1996)
Development
122,
3195-3205[Abstract]
|
| 26.
|
Okano, M.,
Xie, S.,
and Li, E.
(1998)
Nucleic Acids Res.
26,
2536-2540[Abstract/Free Full Text]
|
| 27.
|
Deng, J.,
and Szyf, M.
(1998)
J. Biol. Chem.
273,
22869-22872[Abstract/Free Full Text]
|
| 28.
|
Gaudet, F.,
Talbot, D.,
Leonhardt, H.,
and Jaenisch, R.
(1998)
J. Biol. Chem.
273,
32725-32729[Abstract/Free Full Text]
|
| 29.
|
Wang, R. Y.-H.,
Huang, L.-H.,
and Ehrlich, M.
(1984)
Nucleic Acids Res.
12,
3473-3490[Abstract/Free Full Text]
|
| 30.
|
Hitt, M. M.,
Wu, T.-L.,
Cohen, G.,
and Linn, S.
(1987)
J. Biol. Chem.
263,
4392-4399[Abstract/Free Full Text]
|
| 31.
|
Reale, A.,
Lindsay, H.,
Saluz, H. P.,
Pradhan, S.,
Adams, R. L. P.,
Jost, J.-P.,
and Strom, R.
(1995)
Biochem. J.
312,
855-861
|
| 32.
|
Tollefsbol, T. O.,
and Hutchison, C. A., III
(1995)
J. Biol. Chem.
270,
18543-18550[Abstract/Free Full Text]
|
| 33.
|
Flynn, J.,
Glickman, J. F.,
and Reich, N. O.
(1996)
Biochemistry
35,
7308-7315[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Pradhan, S.,
Talbot, D.,
Sha, M.,
Benner, J.,
Hornstra, L.,
Li, E.,
Jaenisch, R.,
and Roberts, R. J.
(1997)
Nucleic Acids Res.
25,
4666-4673[Abstract/Free Full Text]
|
| 35.
|
Christman, J. K.,
Sheikhnejad, G.,
Marasco, C. J.,
and Sufrin, J. R.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
7347-7351[Abstract/Free Full Text]
|
| 36.
|
Lindsay, H.,
and Adams, R. L. P.
(1996)
Biochem. J.
320,
473-478
|
| 37.
|
Tollefsbol, T. O.,
and Hutchison, C. A., III
(1997)
J. Mol. Biol.
269,
494-504[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Carotti, D.,
Funiciello, S.,
Palitti, F.,
and Strom, R.
(1998)
Biochemistry
37,
1101-1108[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Bestor, T.
(1988)
Biochem. Soc. Trans.
16,
944-947[Medline]
[Order article via Infotrieve]
|
| 40.
|
Bestor, T.,
Laudano, A.,
Mattaliano, R.,
and Ingram, V.
(1988)
J. Mol. Biol.
203,
971-983[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Klimasauskas, S.,
Kumar, S.,
Roberts, R. J.,
and Cheng, X.
(1994)
Cell
76,
357-369[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Reinisch, K. M.,
Chen, L.,
Verdine, G. I.,
and Lipscomb, W. N.
(1995)
Cell
82,
143-153[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Ramchandani, S.,
Bigey, P.,
and Szyf, M.
(1998)
Biol. Chem. Hoppe-Seyler
379,
535-540
|
| 44.
|
Bestor, T. H.
(1992)
EMBO J.
11,
2611-2617[Medline]
[Order article via Infotrieve]
|
| 45.
|
Pradhan, S.,
Bacolla, A.,
Wells, R. D.,
and Roberts, R. J.
(1999)
J. Biol. Chem.
274,
33002-33010[Abstract/Free Full Text]
|
| 46.
|
Bacolla, A.,
Ulrich, M. J.,
Larson, J. E.,
Ley, T. J.,
and Wells, R. D.
(1995)
J. Biol. Chem.
270,
24556-24563[Abstract/Free Full Text]
|
| 47.
|
Bacolla, A.,
Gellibolian, R.,
Shimizu, M.,
Amirhaeri, S.,
Kang, S.,
Ohshima, K.,
Larson, J. E.,
Harvey, S. C.,
Stollar, B. D.,
and Wells, R. D.
(1997)
J. Biol. Chem.
272,
16783-16792[Abstract/Free Full Text]
|
| 48.
|
Grant, R. C.,
Harwood, S. J.,
and Wells, R. D.
(1968)
J. Am. Chem. Soc.
90,
4474-4476[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Segel, I. H.
(1975)
Enzyme Kinetics; Behavior and Analysis of Rapid Equilibrium and Steady-state Enzyme Systems
, pp. 505-845, John Wiley & Sons, Inc., New York
|
| 50.
|
Imbert, I.,
Feng, Y.,
Nelson, D. L.,
Warren, S. T.,
and Mandel, J.-L.
(1998)
in
Genetic Instabilities and Hereditary Neurological Diseases
(Wells, R. D.
, and Warren, S. T., eds)
, pp. 27-53, Academic Press, San Diego, CA
|
| 51.
|
Wu, J. C.,
and Santi, D. V.
(1987)
J. Biol. Chem.
262,
4778-4786[Abstract/Free Full Text]
|
| 52.
|
Smith, S. S.,
Kaplan, B. E.,
Sowers, L. C.,
and Newman, E. M.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4744-4748[Abstract/Free Full Text]
|
| 53.
|
Baker, D. J.,
Laayoun, A.,
and Smith, S. S.
(1993)
Biochem. Biophys. Res. Commun.
196,
864-871[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Yoder, J. A.,
Soman, N. S.,
Verdine, G. L.,
and Bestor, T. H.
(1997)
J. Mol. Biol.
270,
385-395[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Orend, J.,
Kuhlman, I.,
and Doerfler, W.
(1991)
J. Virol.
65,
4301-4308[Abstract/Free Full Text]
|
| 56.
|
Carotti, D.,
Funiciello, S.,
Palitti, F.,
and Strom, R.
(1998)
Biochemistry
37,
1101-1108
|
| 57.
|
Ruchirawat, M.,
Noshari, J.,
and Lapeyre, J.-N.
(1987)
Mol. Cell. Biochem.
76,
45-54[Medline]
[Order article via Infotrieve]
|
| 58.
|
Flynn, J.,
Azzam, R.,
and Reich, N.
(1998)
J. Mol. Biol.
279,
101-116[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Jeltsch, A.,
Friedrich, T.,
and Roth, M.
(1998)
J. Mol. Biol.
275,
747-758[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Bestor, T. H.,
and Ingram, V. M.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
5559-5563[Abstract/Free Full Text]
|
| 61.
|
Grünwald, S.,
and Drahovsky, D.
(1984)
Int. J. Biochem.
16,
883-888[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Pfeifer, G. P.,
Spiess, E.,
Grunwald, S.,
Boehm, L.,
and Drahovsky, D.
(1985)
EMBO J.
4,
2879-2884[Medline]
[Order article via Infotrieve]
|
| 63.
|
Berg, O. G.,
and Blomberg, C.
(1976)
Biophys. Chem.
4,
367-381[CrossRef][Medline]
[Order article via Infotrieve]
|
| 64.
|
Berg, O. G.,
and Blomberg, C.
(1977)
Biophys. Chem.
7,
33-39[CrossRef][Medline]
[Order article via Infotrieve]
|
| 65.
|
Berg, O. G.,
and Blomberg, C.
(1978)
Biophys. Chem.
8,
271-280[CrossRef][Medline]
[Order article via Infotrieve]
|
| 66.
|
Berg, O. G.,
Winter, R. B.,
and von Hippel, P. H.
(1981)
Biochemistry
20,
6926-6948
|
| 67.
|
Winter, R. B.,
Berg, O. G.,
and von Hippel, P. H.
(1981)
Biochemistry
20,
6961-6977[CrossRef][Medline]
[Order article via Infotrieve]
|
| 68.
|
Berg, O. G.,
and Ehrenberg, M.
(1982)
Biophys. Chem.
15,
41-51[CrossRef][Medline]
[Order article via Infotrieve]
|
| 69.
|
Berg, O. G.
(1984)
Biopolymers
23,
1869-1889[CrossRef][Medline]
[Order article via Infotrieve]
|
| 70.
|
Berg, O. G.
(1986)
Biopolymers
25,
811-821[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
V. V. Lao, J. L. Herring, C. H. Kim, A. Darwanto, U. Soto, and L. C. Sowers
Incorporation of 5-chlorocytosine into mammalian DNA results in heritable gene silencing and altered cytosine methylation patterns
Carcinogenesis,
May 1, 2009;
30(5):
886 - 893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-i. Takebayashi, T. Tamura, C. Matsuoka, and M. Okano
Major and Essential Role for the DNA Methylation Mark in Mouse Embryogenesis and Stable Association of DNMT1 with Newly Replicated Regions
Mol. Cell. Biol.,
December 1, 2007;
27(23):
8243 - 8258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Valinluck and L. C. Sowers
Endogenous Cytosine Damage Products Alter the Site Selectivity of Human DNA Maintenance Methyltransferase DNMT1
Cancer Res.,
February 1, 2007;
67(3):
946 - 950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Mull, M. L. Ebbs, and J. Bender
A Histone Methylation-Dependent DNA Methylation Pathway Is Uniquely Impaired by Deficiency in Arabidopsis S-Adenosylhomocysteine Hydrolase
Genetics,
November 1, 2006;
174(3):
1161 - 1171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mashhoon, C. Pruss, M. Carroll, P. H. Johnson, and N. O. Reich
Selective Inhibitors of Bacterial DNA Adenine Methyltransferases
J Biomol Screen,
August 1, 2006;
11(5):
497 - 510.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
W. D. Rees, F. A. Wilson, and C. A. Maloney
Sulfur Amino Acid Metabolism in Pregnancy: The Impact of Methionine in the Maternal Diet
J. Nutr.,
June 1, 2006;
136(6):
1701S - 1705S.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Goyal, R. Reinhardt, and A. Jeltsch
Accuracy of DNA methylation pattern preservation by the Dnmt1 methyltransferase
Nucleic Acids Res.,
February 25, 2006;
34(4):
1182 - 1188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Lee and B. T. Zhu
Inhibition of DNA methylation by caffeic acid and chlorogenic acid, two common catechol-containing coffee polyphenols
Carcinogenesis,
February 1, 2006;
27(2):
269 - 277.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-W. Jair, K. E. Bachman, H. Suzuki, A. H. Ting, I. Rhee, R.-W. C. Yen, S. B. Baylin, and K. E. Schuebel
De novo CpG Island Methylation in Human Cancer Cells
Cancer Res.,
January 15, 2006;
66(2):
682 - 692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. H. Lee, S. Yegnasubramanian, X. Lin, and W. G. Nelson
Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1
J. Biol. Chem.,
December 9, 2005;
280(49):
40749 - 40756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Patnaik, H. G. Chin, P.-O. Esteve, J. Benner, S. E. Jacobsen, and S. Pradhan
Substrate Specificity and Kinetic Mechanism of Mammalian G9a Histone H3 Methyltransferase
J. Biol. Chem.,
December 17, 2004;
279(51):
53248 - 53258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Okuwaki and A. Verreault
Maintenance DNA Methylation of Nucleosome Core Particles
J. Biol. Chem.,
January 23, 2004;
279(4):
2904 - 2912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. G. Malygin, V. V. Zinoviev, A. A. Evdokimov, W. M. Lindstrom Jr., Norbert. O. Reich, and S. Hattman
DNA (Cytosine-N4-)- and -(Adenine-N6-)-methyltransferases Have Different Kinetic Mechanisms but the Same Reaction Route. A COMPARISON OF M.BamHI AND T4 Dam
J. Biol. Chem.,
April 25, 2003;
278(18):
15713 - 15719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bheemanaik, S. Chandrashekaran, V. Nagaraja, and D. N. Rao
Kinetic and Catalytic Properties of Dimeric KpnI DNA Methyltransferase
J. Biol. Chem.,
February 28, 2003;
278(10):
7863 - 7874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Flynn, J.-Y. Fang, J. A. Mikovits, and N. O. Reich
A Potent Cell-active Allosteric Inhibitor of Murine DNA Cytosine C5 Methyltransferase
J. Biol. Chem.,
February 28, 2003;
278(10):
8238 - 8243.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yokochi and K. D. Robertson
Preferential Methylation of Unmethylated DNA by Mammalian de Novo DNA Methyltransferase Dnmt3a
J. Biol. Chem.,
March 29, 2002;
277(14):
11735 - 11745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pradhan, A. Bacolla, R. D. Wells, and R. J. Roberts
Recombinant Human DNA (Cytosine-5) Methyltransferase. I. EXPRESSION, PURIFICATION, AND COMPARISON OF DE NOVO AND MAINTENANCE METHYLATION
J. Biol. Chem.,
November 12, 1999;
274(46):
33002 - 33010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bacolla, S. Pradhan, J. E. Larson, R. J. Roberts, and R. D. Wells
Recombinant Human DNA (Cytosine-5) Methyltransferase. III. ALLOSTERIC CONTROL, REACTION ORDER, AND INFLUENCE OF PLASMID TOPOLOGY AND TRIPLET REPEAT LENGTH ON METHYLATION OF THE FRAGILE X CGG{middle dot}CCG SEQUENCE
J. Biol. Chem.,
May 18, 2001;
276(21):
18605 - 18613.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Evdokimov, V. V. Zinoviev, E. G. Malygin, S. L. Schlagman, and S. Hattman
Bacteriophage T4 Dam DNA-[N6-adenine]Methyltransferase. KINETIC EVIDENCE FOR A CATALYTICALLY ESSENTIAL CONFORMATIONAL CHANGE IN THE TERNARY COMPLEX
J. Biol. Chem.,
January 4, 2002;
277(1):
279 - 286.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|