JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rich, C. B.
Right arrow Articles by Foster, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rich, C. B.
Right arrow Articles by Foster, J. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 47, 33433-33439, November 19, 1999


Basic Fibroblast Growth Factor Decreases Elastin Gene Transcription through an AP1/cAMP-response Element Hybrid Site in the Distal Promoter*

Celeste B. Rich, Marta R. Fontanilla, Matthew Nugent, and Judith Ann FosterDagger

From the Department of Biochemistry, Boston University School of Medicine, Boston, Massachusetts 02118

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Previous studies demonstrated that basic fibroblast growth factor (bFGF) decreases elastin gene transcription in pulmonary fibroblasts. In this study we pursue the identification of the element and the trans-acting factors responsible. Gel shift analyses show that bFGF increases protein binding to a sequence located at -564 to -558 base pairs (bp), which possesses homology to both AP1 and cAMP-response consensus elements yet displays a unique affinity for heterodimer binding. Site-directed mutation of the -564- to -558-bp sequence results in an increase in promoter activity and abrogates the effect of bFGF. Western blot analysis shows that bFGF induces a sustained increase in the steady-state levels of Fra 1, and co-transfection of a Fra 1 expression vector with an elastin promoter reporter construct results in an inhibition of elastin promoter activity. Overall the results suggest that bFGF represses elastin gene transcription by increasing the amount of the Fra 1 that subsequently binds to the -564- to -558-bp as a heterodimer with c-Jun to form an inhibitory complex. We propose that the identified bFGF response element can serve to down-regulate elastin transcription in elastogenic cells and, conversely, can serve to up-regulate elastogenesis in cells where endogenous bFGF signaling is attenuated or altered.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Elastin is an essential component of mammalian lungs because of its ability to impart elasticity to alveolar walls. Lung elastin gene expression has been studied in developmental and pathogenic models using both in vivo and in vitro approaches (1-9). These studies have shown that elastin expression can be regulated at both the transcriptional (5, 8, 10) and post-transcriptional (5, 11) levels and have further provided insight into a number of potential modulators regulating these changes (8, 11-13). Our laboratory has focused on the transcriptional regulation of the elastin gene in avian lung embryogenesis (1) and on a cell model mimicking elastase injury to mammalian lungs (4, 10). This latter model, consisting of primary cultures of rat pulmonary fibroblasts, showed that brief exposure to elastase results in the release of bFGF1 bound within the extracellular matrix. The model further demonstrated that exogenous bFGF down-regulates elastin transcription in these cell cultures (10). Furthermore, the addition of bFGF blocking antibody to cell medium resulted in increased elastin promoter activity suggesting that this matrix-sequestered growth factor is an endogenous inhibitor of elastin transcription. This latter possibility is supported by the studies of Weinstein et al. (14) that implicated the FGFR-3 and FGFR-4 receptors in regulating elastin deposition in postnatal mouse lung.

A number of studies have focused on the ability of bFGF to up-regulate gene transcription via cis-acting elements that bind various members of the basic leucine zipper family of transcription factors including AP1, CRE, and ETS cognates (15-17). On the other hand, the ability of bFGF to down-regulate transcription has not been that well documented. The overall goal of the present study was to determine the specific cis-acting element and trans-acting factor(s) responsible for bFGF repression of elastin gene transcription. We find that bFGF down-regulates elastin transcription by promoting increased protein binding to an AP1/CRE-like sequence located at -564 to -558 bp of the elastin promoter. We further present evidence that the increased binding is due to the formation of a Fra 1/c-Jun heterodimer that forms because of sustained induction of Fra 1 by bFGF. Furthermore, our results suggest that the bFGF element of the elastin promoter regulates elastin transcription via the availability and integrity of the bFGF signaling pathway.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents-- Human recombinant bFGF (18 kDa) was obtained from Scios-Nova (Mountain View, CA). Mouse monoclonal anti-bovine bFGF, type I IgG (Upstate Biotechnology Inc.), was used to neutralize bFGF activity. Fra 1 (SC-183X), c-Jun (SC-45X), SP1 (SC-59X), and AP2 (SC-184X) rabbit polyclonal antibodies and horseradish peroxidase-conjugated anti-rabbit IgG (SC-2004) and anti-mouse IgG (SC-2005) were purchased from Santa Cruz Biotechnology. The proliferating cell nuclear antigen (PCNA) antibody was purchased from Oncogene Research Products. Human recombinant c-JUN was purchased from Promega. Complementary, single strand oligodeoxynucleotides representing the AP1 consensus sequence (18), 5' CGCTTGATGACTCAGCCGGAA 3', the AP2 consensus sequence (19), 5' GATCGAACTGACCGCCCGCGGCCCGT 3', the CRE consensus sequence (20), 5' AGAGATTGCCTGACGTCAGAGAGCTAG 3', the elastin promoter sequences from the -573- to -546-bp region, 5' GGCAGAACCTGTCTCTAGCCAGACCTG 3', and a mutated version of this sequence, 5' GGCAGAACCTCGCAAAAGCCAGACCTG 3' (mutation underlined), were synthesized by the DNA-protein core facility at Boston University Medical Center. Duplex oligomers were prepared as described previously (21).

Isolation and Treatment of Cell Cultures-- Neonatal rat pulmonary fibroblast cells were isolated from lungs of 3-day-old Harlan Sprague-Dawley rats and seeded in first passage as described previously (10). Medium was changed twice weekly. For preparation of nuclear extract and isolation of RNA, cells plated at 2 × 104 cells/cm2 in 75-cm2 flasks were maintained for 2 weeks. Prior to the addition of bFGF (10 ng/ml) the medium was changed to 0.5% serum for 24 h and then incubated with bFGF for various times as indicated. For transfection experiments, cells were seeded 3 × 104 cells/cm2 in 100-mm plates and grown overnight in complete Dulbecco's modified Eagle's media containing 5% FBS, and the medium was changed and the calcium phosphate/DNA precipitate added. After 20-22 h, the cells were glycerol-shocked and the medium changed to 0.5% FBS as described previously (10). After 24 h in 0.5% FBS, bFGF (10 ng/ml) was added for an additional 24 h.

Isolation and Analysis of RNA-- Total RNA was isolated and analyzed by Northern blotting as described previously by Wolfe et al. (22). After electrophoretic transfer of the gel, hybridization with rat tropoelastin cDNA was performed as described previously (23).

Preparation of Nuclear Extracts-- Nuclei from untreated and bFGF-treated cell cultures were isolated by the procedures previously reported (10). Total protein for each sample was determined by the BCA protein assay (Pierce). The extracts were stored at -80 °C in extraction buffer consisting of 20 mM HEPES (pH 7.9), 0.35 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 1.0 µM diisopropyl fluorophosphate, 0.5 µg/ml leupeptin, 2.0 µg/ml aprotinin, and 0.7 µg/ml pepstatin, 0.2 mM sodium vanadate, and 100 µM sodium fluoride.

Gel Mobility Shift Assay-- Two large restriction fragments spanning the entire -900- to -472-bp region of the elastin promoter were generated. The -900 to +2 elastin promoter construct (22) was restricted with PpuMI, the resultant fragments labeled with Klenow and then restricted with SalI to generate the -900- to -721-bp fragment. Restricting the Klenow-labeled PpuMI fragment with ApaI generated a -721- to -472-bp fragment. Restriction fragments were separated by gel electrophoresis and isolated from the agarose with the QIAEX II Gel Extraction Kit (Qiagen). The duplex oligomers described above were labeled with T4 polynucleotide kinase and separated from free [32P]ATP by a Sephadex G-50 column procedure (24). The 32P-labeled DNA fragments (0.1-2.5 ng, 40-200 fmol, 20,000-100,000 cpm), nuclear extract (10 µg of protein), or recombinant c-Jun (as specified) and 5 µg of poly(dI-dC) were brought to a volume of 17.5 µl with 3.5 µl of 5× binding buffer (50 mM HEPES (pH 7.9), 5 mM dithiothreitol, 0.5% Triton, and 2.5% glycerol), 3.5 µl of extraction buffer (including the volume of nuclear extract), and the appropriate volume of H2O. Reactions were incubated at 25 °C for 30 min, and the products were resolved by electrophoresis through a 4% native polyacrylamide gel in 90 mM Tris borate, 2.0 mM EDTA buffer (pH 8.3). Electrophoresis and resultant autoradiography was performed as described previously (21). For competition experiments, 20-100-fold molar excesses of unlabeled, competitor DNA was preincubated with nuclear extracts for 30 min at 25 °C before the addition of 32P-labeled DNA. For supershift experiments, 2 µl of antibody was incubated with the 10 µg of nuclear extract overnight at 4 °C prior to the addition of radiolabeled probe. Reactions were allowed to incubate an additional 30 min at 25 °C before running the gel.

Ultraviolet Cross-link Analysis-- To perform this analysis, a gel shift was run as described above, and complex II was cut from the gel and cross-linked with UV (254 nm) in the gel slice for 30 min. The gel slice was then incubated in 2× Laemmli sample buffer for 30 min and placed into the sample well of a 10% SDS gel that had been prepared using a 3.0-mm comb and spacers. The samples were sealed with 1% agarose, and the cross-linked complexes were resolved by electrophoresis. The complexes were electrophoretically transferred to a nitrocellulose membrane and visualized by autoradiography.

Western Blot Analysis-- Nuclear extracts (40 µg) were fractionated on a 10% SDS-polyacrylamide and electrophoretically transferred to nitrocellulose as we have described (10). After transfer the nitrocellulose membrane was cut such that a duplicate set of samples were stained with Amido Black for detection of protein loading. The other was probed with Fra 1 (1:1000), c-Jun (1:1000), or PCNA (2.5:1000) antibody. The secondary antibody was anti-rabbit IgG-conjugated to horseradish peroxidase (1:2000) for the Fra 1 and c-Jun antibodies and anti-mouse IgG-conjugated to horseradish peroxidase for PCNA. Immunodetection of proteins was visualized by the ECL method according to manufacturer's instructions (Amersham Pharmacia Biotech).

Gel shift and Western blot analyses were coupled to identify c-Jun as a component of the heterodimer binding to the elastin sequence. Gel shift analyses were performed using the AP1 consensus oligomer incubated with recombinant c-Jun and the elastin promoter -573- to -546-oligomer incubated with nuclear extract isolated from bFGF-treated fibroblasts. The gel was exposed to x-ray film at room temperature overnight to establish the position of complex formation. By using the film as a guide, the complexes formed between the AP1 consensus oligomer and c-Jun (see Fig. 4B) and complex II formed between the elastin oligomer and the nuclear extract (see Fig. 2) were cut out of the gel and incubated for 30 min in 2× Laemmli sample buffer. As a control the same area as complex II was cut out of gel shift reaction lane that contained all the reaction components except DNA. The equivalent of four excised gel slices for each complex was loaded into the well of a 3-mm preparative 10% SDS gel and electrophoresed as usual. The gel was transferred to nitrocellulose and treated as described above.

Transient DNA Transfections and CAT Assays-- Pulmonary fibroblasts were transfected with plasmid DNA (30 µg) as we have previously reported (10). Transfection efficiencies were assessed by co-transfection with 5 µg of pCMV beta -galactosidase (CLONTECH). Three to five separate sets of pulmonary fibroblasts and two different preparations of plasmid DNAs were used for these analyses. Determinations of CAT and beta -galactosidase activities were performed as described previously (10). Quantitative analyses were performed with a Molecular Dynamics PhosphorImager or Densitometer.

Elastin promoter reporter CAT constructs used include the -900 to +2 bp (22) and a mutated form that involves changes of the 5 bp between -564 to -558 bp. This mutation was engineered by first using PCR to amplify the -750- to -527-bp region with an antisense primer (5' CCAGACTCCCCAACACCCCCAGGTCTGGCTTTTGCGAGCTTCTGCCC 3') containing the mutation (underlined) and a unique HinfI restriction site downstream of the mutated site and a sense primer (5' GGCCCCTGCAGAATGCAGCCCT 3') representing a region of the elastin promoter upstream of a unique PpuMI restriction site located at -719 bp. The PCR-amplified fragment was purified with a Wizard PCR preps DNA purification system (Promega). Once isolated, the PCR fragment was double-digested with PpuMI and HinfI and purified by gel electrophoresis. Separately an aliquot of -900 to +2 construct was double-digested with HindIII and SalI to release the -900- to +2-bp elastin sequence from the CAT reporter vector. This HindIII and SalI restriction fragment was further digested with HinfI and SfiI and purified by gel electrophoresis. The PpuMI and HinfI PCR fragment and the HinfI and SfiI wild type fragment were ligated together. This piece was then ligated into -900- to +2-construct that had been double-digested with PpuMI and SfiI. Competent cells (Life Technologies, Inc.) were transformed, subclones isolated, and plasmid mini-preps were performed. The sequence of the mutated plasmid was confirmed by automated DNA sequencing at the DNA-protein core facility at Boston University Medical Center.

Expression vectors for Fra 1 and 2 were generously supplied by Dr. P. R. Dobner (University of Massachusetts Medical Center, Woscester). Dr. M. Karin (Department of Pharmacology, University of California, San Diego) generously supplied the c-Jun expression vector. The elastin promoter deletion construct -900- to +2-bp construct (30 µg) was co-transfected with the expression vectors (0-20 µg) and 5 µg of pRSV beta -galactosidase (a gift of Dr. N. Rosenthal, Harvard University). The amount of DNA in each reaction was adjusted to 55 µg with Bluescript vector DNA (Stratagene).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Localization of the bFGF Response Element to -564 to -558 bp of the Elastin Promoter-- Deletion analysis of the elastin gene promoter showed that the major bFGF response element resides between -900 to -500 bp (10). In order to identify the specific sequence conveying bFGF responsiveness, two large restriction fragments were generated that span the entire -900- to -500-bp region, and these were incubated with nuclear extracts prepared from untreated and bFGF-treated pulmonary fibroblasts. Only the fragment comprising -721 to -472 bp exhibited a change in complex formation upon bFGF treatment, and the change seen is an increase in protein binding (Fig. 1). Since the -721- to -472-bp region contains several putative AP2 and an AP1 elements (25), gel shift analyses were performed with these consensus sequences (Fig. 1). The results show that only the AP1 oligomer displays differential complex formation upon bFGF treatment, and this difference involves an increase in complex formation similar to that observed with the elastin -721- to -472-bp fragment. To examine the response of the actual AP1-like sequence within the elastin promoter to bFGF treatment, gel shift analyses were performed with an oligomer including this sequence (-573 to -546 bp). Complex formation induced by bFGF treatment was then competed with the unlabeled, wild type oligomer (wt) and the unlabeled, mutated form of this sequence (mut.) (Fig. 2). The mutation introduced was designed to cause total disruption of protein binding as opposed to defining the role of specific bases. Consequently, five out of the seven bases that form the core of the AP1-like binding site as defined by Ryseck and Bravo (26) were changed (see Fig. 2 legend). The results demonstrate that the wt elastin sequence exhibits an increase in complex formation with bFGF treatment, and this increase is competed by the wt oligomer and only partially by the mut. oligomer. The major band remaining after competition with the mut. oligomer is a component of Complex II referred to as Complex IIb. It is interesting to point out that the pattern of complex formation displayed by the -573- to -546-bp elastin oligomer differs from that of the consensus AP1 oligomer in two respects. First, the elastin promoter sequence exhibits greater binding to a faster migrating complex (referred to as Complex II in Fig. 2), and second, the bFGF-induced increase in protein binding involves this latter complex rather than a slower migrating complex exhibited by the AP1 oligomer (see Fig. 1). This latter observation suggests that the elastin promoter AP1-like sequence possesses a protein affinity that differs from classical AP1 sites.


View larger version (85K):
[in this window]
[in a new window]
  		Fig. 1.   Gel shift analyses of elastin promoter restriction fragment and AP1 and AP2 consensus sequences with nuclear extract from control and bFGF-treated pulmonary fibroblast cultures. Ten micrograms of nuclear proteins isolated from untreated and bFGF-treated pulmonary fibroblasts and 5.0 µg of poly(dI-dC) were incubated with 32P-labeled -721- to -472-bp restriction fragment or with 32P-labeled double-stranded AP1 or AP2 consensus oligodeoxynucleotides as described under "Materials and Methods." The resulting complexes were resolved by electrophoresis through a 4% native polyacrylamide gel, and the DNA-protein complexes were visualized by autoradiography. Also shown in the 1st lane is the 32P-labeled -721- to -472-bp restriction fragment run without the addition of any nuclear extract as a control.


View larger version (66K):
[in this window]
[in a new window]
  		Fig. 2.   Competition gel shift analyses of wild type and mutated elastin oligonucleotides. A competition gel shift using 100-fold molar excess of unlabeled oligonucleotide and 10 µg of nuclear proteins isolated from bFGF-treated and untreated cultures and 32P-labeled wild type elastin promoter -573- to -546-bp probe is shown. The various lanes are designated in the figure. The arrows designate Complexes I, IIa, and IIb. The following are the oligodeoxynucleotide sequences representing the elastin promoter region containing the AP1 site: wild type (wt); 5' GGCAGAACCTGTCTCTAGCCAGACCTG 3' and mutated (mut.); 5' GGCAGAACCTCGCAAAAGCCAGACCTG 3'. The underlined nucleotides indicate the AP1 site in the wild type and the mutated oligomers.

Mutation of the -564- to -558-bp Sequence Increases Elastin Promoter Activity and Abrogates the Effect of bFGF-- Before proceeding to any further characterization of DNA-protein interactions we tested the functionality of the targeted elastin promoter sequence within the environment of the pulmonary fibroblast cells. A mutation was introduced into the -564- to -558-bp sequence of -900- to +2-bp elastin reporter construct (see "Materials and Methods"). This mutation consisted of the same 5-bp change used in the mut. elastin oligomer described above (Fig. 2). Transient transfections of rat pulmonary fibroblasts were performed using the wild type and the mutated elastin promoter constructs (Fig. 3). The results show that the activity driven by the mut. elastin promoter construct is not down-regulated by bFGF suggesting that the targeted sequence is the major bFGF response element within the elastin promoter. Further evidence for the functional role of the -564- to -558-bp sequence derives from the fact that the mutated elastin promoter drives a higher level of reporter activity than the wild type sequence, suggesting that this sequence serves to repress elastin gene transcription. We have previously suggested that endogenous bFGF acts as a repressor of elastin gene transcription (10). This hypothesis was based on the observation that the addition of bFGF blocking antibody to pulmonary fibroblasts results in an up-regulation of elastin mRNA levels. The effect of the mutation introduced into the elastin gene promoter on reporter activity parallels the effect of bFGF blocking antibody on mRNA thereby linking bFGF down-regulation to a specific site in the elastin promoter. Furthermore, the increase exhibited by the mutated elastin gene promoter is comparable to the activity driven by the -500- to +2-bp elastin reporter construct in these same cells (10) suggesting that the -564- to -558-bp sequence is the major repressor sequence in the -900- to -500-bp region of the elastin gene.


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 3.   The effect of bFGF on wild type and mutated elastin promoter constructs in pulmonary fibroblast cultures. A, a representative CAT assay is shown. Transient transfections were performed using pCAT under the control of the wild type or mutated -900- to +2-bp elastin promoter fragment in untreated and treated cells. For the CAT assay, samples of cell extract containing equal amounts of beta -galactosidase activity were subjected to thin layer chromatography. The thin layer plates were analyzed on a PhosphorImager. B, the quantitation of the transient transfections was obtained from five separate sets of pulmonary fibroblast cultures using two different preparations of plasmid DNA. Relative CAT activity was expressed as percent of the wt -900 to +2 elastin promoter construct transfected in untreated cells. The error bars indicate the standard deviation of the results.

Formation of a Fra 1/c-Jun Heterodimer Appears to Dictate the Down-regulation of Elastin Gene Transcription-- Since the results obtained by transient transfections demonstrate that the -564- to -558-bp sequence confers bFGF responsiveness, we directed our attention to identifying the proteins binding to this element. This sequence was previously categorized as a putative AP1 site (25, 27). A recent computer homology search of this sequence reveals that it also exhibits homology to a consensus CRE. As a first step in identifying the protein(s) binding to the elastin sequence, we performed a competition gel shift analysis using the radiolabeled elastin promoter oligomer spanning -573 to -546 bp incubated with nuclear extract isolated from bFGF-treated fibroblasts. Complex formation was competed with the unlabeled elastin promoter oligomer and AP1 and CRE consensus oligomers (Fig. 4A). The results show that neither consensus oligomer competes for specific protein binding even at a 100-fold excess. To explore further the differences between the protein binding affinity of the elastin promoter sequence and the CRE and AP1 consensus sequences, gel shift analysis was performed using radiolabeled oligomers that were incubated with recombinant c-Jun. The rationale for this experiment was predicated on the report of Kovary and Bravo (28) who have shown that c-Jun can bind to AP1 and CRE sequences as a homodimer, although the affinity differs between the sequences. Fig. 4B provides a gel shift analysis showing that the CRE and AP1 oligomers bind c-Jun as a homodimer, whereas the elastin promoter oligomer does not exhibit any binding, even after a long exposure of the film.


View larger version (39K):
[in this window]
[in a new window]
  		Fig. 4.   Competition gel shift analyses of the elastin promoter -573- to -546-bp oligonucleotide with unlabeled oligomer and the AP1 and CRE consensus oligonucleotides. Gel shift analysis of c-Jun recombinant protein binding to elastin oligomer and the AP1 and CRE consensus oligodeoxynucleotides. A, the elastin promoter oligomer spanning -573 to -546 bp was radiolabeled, incubated with nuclear extract from bFGF-treated cells, and complex formation competed with unlabeled elastin oligomer and AP1 and CRE consensus oligomer at the amounts designated. For these experiments, unlabeled oligonucleotides were preincubated with bFGF-treated nuclear extracts for 30 min at room temperature before the addition of the labeled elastin oligomer. The resulting complexes were resolved by gel electrophoresis and visualized by autoradiography. B, gel shift analysis of recombinant c-Jun (5 footprinting units) using the radiolabeled elastin promoter oligomer and the AP1 and CRE consensus oligodeoxynucleotides were performed. Conditions are described in Fig. 1 legend. Bovine serum albumin (5 µg) was added as a protein carrier.

The possibility that the elastin promoter site might dictate heterodimer binding was explored. Gel shift analyses were performed where the radiolabeled elastin promoter oligomer was incubated with a fixed, sub-saturating amount of fibroblast nuclear extract isolated from bFGF-treated cultures (0.1 µg) and increasing amounts of c-Jun recombinant protein (Fig. 5A). As a control to test whether complex formation with c-Jun is a result of specific protein-DNA interaction rather than a nonspecific result of protein concentration (21), samples containing bovine serum albumin (0.1 µg) and the same amounts of recombinant c-Jun protein were included (Fig. 5B). The results show that addition of increasing amounts of recombinant c-Jun to the nuclear extract results in a dose-dependent formation of complexes, one of which possesses a similar mobility to that exhibited by the bFGF-sensitive complex II. These data suggest that the binding affinity of the elastin bFGF response element is directed toward heterodimer complexes and further suggests that c-Jun and another protein within the nuclear extract are interacting to form the bFGF-induced complex.


View larger version (59K):
[in this window]
[in a new window]
  		Fig. 5.   Gel shift analysis of the elastin promoter -573- to -546-bp oligomer with increasing amounts of c-Jun together with a constant, sub-saturating amount of nuclear extract isolated from bFGF-treated cells. Increasing concentrations of c-Jun recombinant protein were added to a fixed subsaturating amount (0.1 µg) of nuclear extract (NE) (A) or bovine serum albumin (BSA) (0.1 µg) (B). After 30 min at 25 °C, the samples were incubated with 32P-labeled elastin oligomer and poly(dI-dC) as described in Fig. 1 legend. The resulting complexes were resolved by electrophoresis, and the protein-DNA complexes were visualized by autoradiography.

In order to identify the specific proteins binding to the elastin bFGF response element, several approaches were used. A two-dimensional cross-link analysis was performed to determine the molecular mass of proteins binding to Complex II (see Fig. 6A). The resultant autoradiogram reveals the presence of three protein-DNA complexes possessing apparent molecular masses of 61, 42, and 35 kDa. Assuming that these cross-linked complexes represent monomers of the dimer UV cross-linked to the DNA (29), the data suggest the possibility that Fra 1 (35-kDa complex), c-Jun, Jun B, Jun D, or Fra 2 (42-kDa complex) and c-Fos (61-kDa complex) proteins may be components of Complex II. It is also possible that the 61-kDa complex may represent a heterodimer of the 42- and 35-kDa proteins, although such a conclusion cannot be drawn from this analysis. To determine if c-Jun was a member of Complex II, a two-dimensional gel shift and Western blot analysis was performed (see "Materials and Methods"). The results shown in Fig. 6B demonstrate that c-Jun is present in the bFGF-sensitive complex. We next attempted to identify c-Jun and Fra 1 as components of Complex II by supershift analyses. The results of numerous experiments to supershift a component of Complex II were unsuccessful. However, we were able to detect a specific diminution of binding to Complex II with both antibody preparations to c-Jun and Fra 1 (Fig. 6C). This is not an uncommon finding since others (30, 31) have also reported that these antibodies abrogate rather than supershift these proteins. We next compared the levels of these leucine zipper family members by Western blot analysis as a function of bFGF treatment in the pulmonary fibroblasts. Fig. 6D provides a Western blot analysis of the protein levels of c-Jun and Fra 1 as a function of time after bFGF treatment. The protein level of PCNA, an indicator of cell entry into S phase, was used as a control since we have previously shown that bFGF is not a mitogen to confluent, contact-inhibited pulmonary fibroblast cells (10). The results, after adjustment to PCNA levels, show that very low levels of Fra 1 protein are seen at the start of the time course (0 h) and 24 h in untreated cells and are significantly elevated at 4 h, and this level remains for the 24-h period examined. On the other hand, c-Jun levels remain elevated and unaffected by bFGF treatment. Although not shown, levels of other Jun/Fos (Jun B and Jun D, Fra 2) family members and ATF/CREB (CREB-1 and 2, ATF-1 and 2) family members were either not detected or showed very low, constant levels within the same experimental samples. These data, coupled with the molecular weight of proteins determined by two-dimensional analysis, suggest that the increase of Fra 1 by bFGF results in heterodimer formation with c-Jun that subsequently binds to the elastin bFGF response element causing transcriptional down-regulation of elastin gene transcription. The fact that low levels of Fra 1 are present within the nuclear extract of untreated cell cultures is consistent with our suggestion that bFGF is an endogenous repressor of elastin gene transcription for these fibroblast cultures.


View larger version (48K):
[in this window]
[in a new window]
  		Fig. 6.   Western and gel shift analyses of proteins binding to the elastin oligomer and/or induced by bFGF. A, a gel slice containing Complex II was isolated from gel shift electrophoresis and the protein-DNA complexes cross-linked by UV for 30 min. The gel slice was incubated in loading buffer and then placed into the sample well of a 10% SDS-polyacrylamide gel. The complexes were electrophoresed and transferred to a nitrocellulose membrane and visualized by autoradiography. Calculation of the approximate molecular masses was based on the migration of standards. B, Western blot analysis of the homodimer of recombinant c-Jun/AP1 consensus complex (lane I) and Complex II (lane II) isolated from gel shift electrophoresis and run on a 10% SDS-polyacrylamide gel as described under "Materials and Methods." As a control gel slices in the area equivalent to Complex II migration were isolated from gel shift lanes without DNA and run on another 10% SDS-polyacrylamide gel (lane III) with recombinant c-Jun (lane IV) as a marker. The membranes were incubated with c-Jun antibody. C, 10 µg of nuclear proteins were incubated with the indicated antibody prior to the addition of 32P-labeled elastin promoter oligomer (-573 to -546 bp) and analyzed on a gel shift as described under "Materials and Methods." The arrows designate Complexes I, IIa, and IIb. D, protein extracts of nuclei isolated at various indicated times after addition of bFGF were quantitated by BCA protein assay, and 40 µg of each was loaded on a 10% SDS-polyacrylamide gel and electrophoresed. The proteins were transferred to nitrocellulose and probed with the indicated antibodies.

Since these approaches were suggestive, we decided to functionally test the putative involvement of Fra 1 in the bFGF response by negating the ability of bFGF to bind its receptor with a bFGF antibody and then examining the effect of this inhibition on Fra 1 protein levels (Fig. 7A) and Complex II formation in a gel shift analysis (Fig. 7B) and endogenous elastin mRNA levels (Fig. 7C). These data show that the addition of bFGF and bFGF blocking antibody results in up-regulation of elastin mRNA with no change in either Fra 1 levels or binding to Complex II of the elastin promoter oligomer spanning -573 to -546 bp.


View larger version (38K):
[in this window]
[in a new window]
  		Fig. 7.   Analysis of Fra 1 protein, nuclear proteins, and elastin mRNA after treatment with bFGF and bFGF blocking antibody. RNA and nuclear protein extracts were isolated from untreated and bFGF-treated cells as well as bFGF-treated cells that also had the addition bFGF-blocking antibody. A, 40 µg of nuclear protein was fractionated on a 10% SDS-polyacrylamide gel, transferred to nitrocellulose, and probed with antibody to Fra 1. B, 10 µg of nuclear proteins were incubated with 32P-labeled elastin promoter oligomer (-573 to -546 bp) and analyzed on a gel shift as described in Fig. 1 legend. C, 10 µg of total RNA was fractionated on a Northern gel, transferred to Nytran, and probed with radiolabeled rat elastin cDNA.

To functionally test the ability of Fra 1 to decrease elastin promoter activity, pulmonary fibroblasts were co-transfected with the -900- to +2-bp elastin promoter construct and Fra 1, Fra 2, and c-Jun expression vectors. The data provided in Fig. 8 show that the co-transfection of increasing amounts of Fra 1 expression vector results in a dose-dependent decrease in CAT activity. Conversely, co-transfection with Fra 2 and c-Jun expression vectors had no effect on CAT activity. To test further the role of the identified binding site, the response of the mutated -900- to +2-bp elastin reporter construct (see Fig. 3) was examined. Fra 1 expression did not have any significant effect on the increased promoter activity imparted by the mutation introduced (Fig. 8).


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 8.   Co-transfection of rat pulmonary fibroblasts with the elastin promoter -900 to +2 construct or -900 to +2 mutated construct and expression vectors for Fra 1, c-Jun, and Fra 2. A, a representative CAT assay is shown. All transfections were done with constant total DNA by supplementing with Bluescript vector DNA. For the CAT assay, samples of cell extract containing equal amounts of beta -galactosidase activity were subjected to thin layer chromatography. B, quantitation of the CAT activity driven by the elastin promoter construct was obtained from three separate sets of pulmonary fibroblast cultures using two different preparations of plasmid DNA. Relative CAT activity was expressed as percent of the activity displayed by elastin promoter -900 to +2 construct. Error bars indicate the standard deviation of the results. The * indicates that these data are an average of two analyses displaying a deviation of ±5%.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Previously we have shown that bFGF down-regulates elastin gene transcription in rat pulmonary fibroblasts, and we have suggested that this ability may have important biological significance in situations of pulmonary injury/repair (10). In the present study we have focused on defining the cis- and trans-acting factors involved in bFGF repression of elastin gene transcription. Three different bFGF response elements have been identified in the promoters of the proenkephalin (15), osteocalcin (16), and interstitial collagenase (17) genes. All of these bFGF response elements serve as activators and possess homology to AP1 and CRE sequences and yet differ in their affinity for trans-acting factors and their requirements for synergistic interactions.

The elastin promoter bFGF response element serves as a repressor element that, similar to the other bFGF elements, exhibits homology to AP1 and CRE sequences yet displays a different protein binding affinity and appears to function as a single element in response to bFGF. The elastin response element sequence is an imperfect palindrome that may specify a unique DNA structure that could contribute to a heterodimeric preference (32). It is interesting to point out that there are two AP1-like sites in the elastin promoter. The upstream site is the sequence we have targeted in this study, i.e. -564 to -558 bp, the downstream site is located at -229 to -223 bp (25). Within the seven bases constituting the putative AP1-binding site the two sequences differ by only two bases. Kahari et al. (27) have shown that TNF-alpha down-regulates elastin gene expression in rat aortic SMC and human skin fibroblasts and have provided evidence that the downstream AP1 site conveys this response. Also, these authors showed that TNF-alpha treatment results in a transient induction of c-Fos and c-Jun and further demonstrated that co-transfection of c-Fos and c-Jun expression vectors results in down-regulation of elastin promoter activity. Although not shown, we have found that the -229- to -223-bp sequence does not compete effectively with protein complexes formed by the upstream -564- to -558-bp sequence suggesting that the binding affinity is different between the two sequences. Thus, the elastin promoter appears poised to respond to two down-regulators, i.e. bFGF and TNF-alpha , via similar cis-elements that bind different leucine zipper family members.

The results of this study are important to our understanding of how elastin gene expression is affected in a situation mimicking events accompanying elastase digestion of lung tissue. Previously we have shown that elastase digestion of pulmonary fibroblast cell cultures results in the release of bFGF. The release of bFGF results in opposing effects depending upon whether cells are exposed to elastase treatment (4). Cells not treated with elastase show a decrease in elastin mRNA, and elastase-treated cells show an increase in elastin mRNA. Our hypothesis has been that bFGF acts as an endogenous inhibitor of elastin gene transcription in situations reflecting a lack of elastase proteolysis. Excessive elastase activity, a hallmark of pulmonary emphysema (33-35), might render cells within the immediate environment of proteolytic digestion either unresponsive to bFGF or may dictate an alternate bFGF signaling pathway. A recent report by one of our group (36) showed that elastase treatment of pulmonary fibroblast cell cultures results in a significant loss of heparan sulfate proteoglycans without any appreciable loss in the FGF receptor. The loss of heparan sulfate resulted in a decreased capacity of the elastase-treated cells to bind bFGF suggesting that the response to bFGF would be attenuated or altered. These data are consistent with the reported specificity of elastases (37) and further provide support for the hypothesis that bFGF signaling is different within cells that are adjacent or remote from elastase activity.

Weinstein et al. (14) reported that the process of lung alveogenesis is blocked in mice doubly homozygous for targeted mutations in two FGF receptor genes, i.e. FGFR-3 and FGFR-4. Histochemical analysis of lungs obtained from these mice showed an abnormally high deposition of elastin when compared with lungs from sibling controls. Based on these results the authors suggest that FGF signaling through the FGFR-3 and FGFR-4 receptors serves to down-regulate elastin synthesis at a critical stage during secondary septation. These data are consistent with our finding that elastin transcription in pulmonary fibroblast cells is normally regulated by endogenous bFGF. The control of elastin transcription is most likely exerted at a point determined by the accumulation of bFGF in the matrix or the maturation of the bFGF signaling network, e.g. a critical concentration of heparan sulfate proteoglycans or FGF-receptor type. A comparable situation can be envisaged within mammalian lung alveolarization where elastogenesis may be both temporally and spatially regulated by the availability and/or signaling of bFGF. This developmental paradigm of bFGF regulation of elastin transcription could also underlie the response of the elastin gene to proteolytic injury where an attenuation or alteration of bFGF signaling results in an up-regulation of elastin transcription to initiate a repair mechanism spatially restricted to the region of elastase damage.

Although we have focused on elastin gene transcription in pulmonary tissue, this model of response to an injury situation, conveyed by matrix digestion, is likely to be applicable to other important matrix genes and to other tissues. The mechanism proposed provides a means for communication between extracellular matrix events to the genes encoding matrix proteins based on the availability/activity of a ubiquitous, extracellular matrix-associated growth factor. We are currently pursuing the bFGF signaling pathway and how this pathway ultimately results in Fra 1 induction in pulmonary fibroblast cells and how this pathway differs in cells exposed to elastase.

    ACKNOWLEDGEMENTS

We acknowledge the superb technical assistance of Valerie Verbitzki and Daniel Pine for isolating and maintaining pulmonary fibroblasts and for plasmid DNA preparation.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant HL 46902.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should addressed: Dept. of Biochemistry, Boston University School of Medicine, 80 E. Concord St., Boston, MA. 02118. Tel.: 617-638-4361; Fax 617-638-5339; E-mail: jfoster@med- biochem.bu.edu.

    ABBREVIATIONS

The abbreviations used are: bFGF, basic fibroblast growth factor; FGFR, fibroblast growth factor receptor; mut., mutant; bp, base pair; CAT, chloramphenicol acetyltransferase; FBS, fetal bovine serum; PCNA, proliferating cell nuclear antigen; PCR, polymerase chain reaction; TNF-alpha , tumor necrosis factor-alpha ; CRE, cAMP-response element; wt, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. James, M. F., Rich, C. B., Trinkhaus-Randall, V., Rosenbloom, J., and Foster, J. A. (1998) Dev. Dyn. 213, 170-181[CrossRef][Medline] [Order article via Infotrieve]
2. Noguchi, A., and Samaha, H. (1991) Am. J. Respir. Cell Mol. Biol. 5, 571-578
3. Bruce, M. C. (1991) Am. J. Respir. Cell Mol. Biol. 5, 344-350
4. Foster, J. A., Rich, C. B., and Miller, M. F. (1990) J. Biol. Chem. 265, 15544-15551[Abstract/Free Full Text]
5. Swee, M. H., Parks, W. C., and Pierce, R. A. (1995) J. Biol. Chem. 270, 14899-14906[Abstract/Free Full Text]
6. Shibahara, S. U., Davidson, J. M., Smith, K., and Crystal, R. G. (1981) Biochemistry 20, 6577-6584[CrossRef][Medline] [Order article via Infotrieve]
7. Pierce, R. A., Mariencheck, W. I., Sandefur, S., Crouch, E. C., and Parks, W. C. (1995) Am. J. Physiol. 268, L491-L500[Abstract/Free Full Text]
8. Brettell, L. M., and McGowan, S. E. (1994) Am. J. Respir. Cell Mol. Biol. 10, 306-315[Abstract]
9. Berk, J. L., Franzblau, C., and Goldstein, R. H. (1991) J. Biol. Chem. 266, 3192-3197[Abstract/Free Full Text]
10. Rich, C. B., Nugent, M. A., Stone, P., and Foster, J. A. (1996) J. Biol. Chem. 271, 23043-23048[Abstract/Free Full Text]
11. McGowan, S. E., Jackson, S. K., Olson, P. J., Parekh, T., and Gold, L. I. (1997) Am. J. Respir. Cell Mol. Biol. 17, 25-35[Abstract/Free Full Text]
12. Noguchi, A., Firsching, K., Kursar, J. D., and Reddy, R. (1990) Pediatr. Res. 28, 379-382[Medline] [Order article via Infotrieve]
13. McGowan, S. E., Liu, R., and Harvey, C. S. (1993) Am. J. Respir. Cell Mol. Biol. 3, 369-376
14. Weinstein, M., Xu, X., Ohyama, K., and Deng, C. (1998) Development 125, 3615-3623[Abstract]
15. Tan, Y., Low, K. G., Boccia, C., Grossman, J., and Comb, M. J. (1994) Mol. Cell. Biol. 14, 7546-7556[Abstract/Free Full Text]
16. Boudreaux, J. M., and Towler, D. A. (1996) J. Biol. Chem. 271, 7508-7515[Abstract/Free Full Text]
17. Newberry, E. P., Willis, D., Latifi, T., Boudreaux, J. M., and Towler, D. A. (1997) Mol. Endocrinol. 11, 1129-1144[Abstract/Free Full Text]
18. Natarajan, K., Singh, S., Burke, T. R., Jr., Grunberger, D., and Aggarwal, B. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9090-9095[Abstract/Free Full Text]
19. Kilbourne, E. J., Widom, R., Harnish, D. C., Malik, S., and Karathanasis, S. (1995) J. Biol. Chem. 270, 7004-7010[Abstract/Free Full Text]
20. Cvekl, A., Sax, C. M., Bresnick, E. H., and Piatigorsky, J. (1994) Mol. Cell. Biol. 14, 7363-7376[Abstract/Free Full Text]
21. Jensen, D. E., Rich, C. B., Terpestra, A., Farmer, S. R., and Foster, J. A. (1995) J. Biol. Chem. 270, 6555-6563[Abstract/Free Full Text]
22. Wolfe, L. B., Rich, C. B., Goud, H. D., Terpstra, A. J., Bashir, M., Rosenbloom, J., Sonenshein, G. E., and Foster, J. A. (1993) J. Biol. Chem. 268, 12418-12426[Abstract/Free Full Text]
23. Foster, J. A., Rich, C. B., Horrigan, S., Miller, M., Dadd, C., Baule, B., and Keene, D. R. (1988) Lab. Invest. 58, 667-673[Medline] [Order article via Infotrieve]
24. Sambrook, J., Fritsche, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , pp. 1.42-1.43, Cold Springs Harbor Laboratory, Cold Springs Habor, NY
25. Kahari, V.-M., Fazio, M. J., Chen, Y. Q., Bashir, M. M., Rosenbloom, J.., and Uitto, J. (1990) J. Biol. Chem. 265, 9485-9490[Abstract/Free Full Text]
26. Ryseck, R. P., and Bravo, R. (1991) Oncogene 6, 533-542[Medline] [Order article via Infotrieve]
27. Kahari, V.-M., Chen, Y. Q., Bashir, M. M., Rosenbloom, J., and Uitto, J. (1992) J. Biol. Chem. 267, 26134-2614128[Abstract/Free Full Text]
28. Kovary, K., and Bravo, R. (1991) Mol. Cell. Biol. 11, 2451-59[Abstract/Free Full Text]
29. Genersch, E., Eckerskorn, C., Lottspeich, F., Herzog, C., Kuhn, K., and Poschl, E. (1995) EMBO J. 14, 791-800[Medline] [Order article via Infotrieve]
30. Griffiths, N. R., Black, E. J., Culbert, A. A., Dickens, M., Shaw, P. E., Gillespie, D. A. F., and Tavare, J. M. (1998) Biochem. J. 335, 19-25
31. Lallemand, D., Spyrou, G., Yaniv, M., and Pfarr, C. M. (1997) Oncogene 14, 819-830[CrossRef][Medline] [Order article via Infotrieve]
32. Leonard, D. A., and Kerppola, T. K. (1998) Nat. Struct. Biol. 5, 877-881[CrossRef][Medline] [Order article via Infotrieve]
33. Albin, R. J., Senior, R. M., Welgus, H. G., Connolly, N. L., and Campbell, E. J. (1987) in Pulmonary Emphysema and Proteolysis: 1986 Part V (Taylor, J. C. , and Mittman, C., eds) , pp. 283-288, Academic Press, Inc., Orlando, FL
34. Sandhaus, R. A. (1987) in Pulmonary Emphysema and Proteolysis: 1986 Part IV (Taylor, J. C. , and Mittman, C., eds) , pp. 227-233, Academic Press, Inc., Orlando, FL
35. Snider, G. L., Ciccolella, D. E., Morris, S. M., Stone, P. J., and Lucey, E. C. (1991) Ann. N. Y. Acad. Sci. 624, 45-59[Medline] [Order article via Infotrieve]
36. Buczek-Thomas, J., and Nugent, M. A. (1999) J. Biol. Chem. 274, 25167-25172[Abstract/Free Full Text]
37. Van de Lest, C. H. A., Versteeg, E. M. M., VeerKamp, J. H., and Van Kuppevelt, T. H. (1995) Eur. Respir. J. 8, 238-245[Abstract]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J.-C. Jean, C. B. Rich, and M. Joyce-Brady
Hypoxia results in an HIF-1-dependent induction of brain-specific aldolase C in lung epithelial cells
Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L950 - L956.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. A. Pierce, C. H. Moore, and M. C. Arikan
Positive transcriptional regulatory element located within exon 1 of elastin gene.
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L391 - L399.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. A. Mitchell and S. J. Lye
Differential Activation of the Connexin 43 Promoter by Dimers of Activator Protein-1 Transcription Factors in Myometrial Cells
Endocrinology, April 1, 2005; 146(4): 2048 - 2054.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. S. Hofmann, X. Wang, C. P. Sullivan, P. Toselli, P. J. Stone, S. E. McLean, R. P. Mecham, B. M. Schreiber, and G. E. Sonenshein
B-Myb Represses Elastin Gene Expression in Aortic Smooth Muscle Cells
J. Biol. Chem., March 4, 2005; 280(9): 7694 - 7701.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
J. A. Mitchell, O. Shynlova, B. L. Langille, and S. J. Lye
Mechanical stretch and progesterone differentially regulate activator protein-1 transcription factors in primary rat myometrial smooth muscle cells
Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E439 - E445.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Liu, C. B. Rich, J. A. Buczek-Thomas, M. A. Nugent, M. P. Panchenko, and J. A. Foster
Heparin-binding EGF-like growth factor regulates elastin and FGF-2 expression in pulmonary fibroblasts
Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1106 - L1115.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. B. Rich, I. Carreras, E. C. Lucey, J. A. Jaworski, J. A. Buczek-Thomas, M. A. Nugent, P. Stone, and J. A. Foster
Transcriptional regulation of pulmonary elast