|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 47, 33747-33756, November 19, 1999
From the Derald H. Ruttenberg Cancer Center, Mount Sinai School of
Medicine, New York, New York 10029
Key to the function of the tumor suppressor p53
is its ability to activate the transcription of its target genes,
including those that encode the cyclin-dependent kinase
inhibitor p21 and the proapoptotic Bax protein. In contrast to Saos-2
cells in which p53 activated both the p21 and
bax promoters, in MDA-MB-453 cells p53 activated the
p21 promoter, but failed to activate the bax promoter. Neither phosphorylation of p53 on serines 315 or 392 nor an
intact C terminus was required for p53-dependent activation of the bax promoter, demonstrating that this differential
regulation of bax could not be explained solely by
modifications of these residues. Further, this effect was not due to
either p73 or other identified cellular factors competing with p53 for
binding to its response element in the bax promoter. p53
expressed in MDA-MB-453 cells also failed to activate transcription
through the p53 response element of the bax promoter in
isolation, demonstrating that the defect is at the level of the
interaction between p53 and its response element. In contrast to other
p53 target genes, like p21, in which
p53-dependent transcriptional activation is mediated by a
response element containing two consensus p53 half-sites, activation by
p53 of the bax element was mediated by a cooperative interaction of three adjacent half-sites. In addition, the interaction of p53 with its response element from the bax promoter, as
compared with its interaction with its element from the p21
promoter, involves a conformationally distinct form of the protein.
Together, these data suggest a potential mechanism for the differential
regulation of p53-dependent transactivation of the
bax and p21 genes.
The tumor suppressor protein p53 is an important regulator of
cellular growth. The p53 gene is mutated in the majority of human cancers (1, 2), suggesting that loss of p53 may play an important
causative role in oncogenesis. The p53 protein has been implicated in
several diverse growth-related pathways, including apoptosis, cell
cycle arrest, and senescence (3-5). The ability of p53 to function as
a sequence-specific DNA-binding protein appears to be central to the
function of p53 as a tumor suppressor (6, 7). At its N terminus, the
p53 protein contains a potent transcriptional activation domain (8)
that is linked to a central core domain that mediates sequence-specific
DNA binding (9-11). Both of these domains have been shown to be
important for p53-mediated growth suppression (12). The importance of
the DNA binding domain is further highlighted by the fact that the
major mutational hot spots from human cancers are found in this domain
(13), and several of these mutations have been shown to abolish the
ability of p53 to function as a transcriptional activator (14-16).
A DNA consensus sequence through which p53 binds and activates
transcription has been identified. This sequence consists of two
palindromic decamers of 5'-RRRCWWGYYY-3' (where R is a purine, Y is a
pyrimidine, and W is an adenine or thymine) separated by 0-13
bp,1 forming four repeats of
the pentamer 5'-RRRCW-3' alternating between the top and bottom strands
of the DNA duplex (17-19). This arrangement is consistent with the
notion that p53 binds DNA as a homotetramer (20-23). Through sequences
similar to this consensus, p53 has been shown to activate the
transcription of many genes, including bax, p21,
mdm2, gadd45, IGF-BP3, and
cyclin G (24-31). Data are consistent with a model in which
DNA damage leads to the phosphorylation of p53 as well as the
subsequent stabilization of p53 and activation of its DNA binding
capability (32-35). Consequently, p53-mediated transcription of its
target genes increases. When compared with alternate p53 targets, such
as the cyclin-dependent kinase inhibitor p21,
evidence suggests that the bax gene is differentially regulated by p53. Several tumor-derived p53 mutants have been identified that are capable of activating transcription through the
promoter of the p21 gene but not through the bax
promoter (36-39). This has been correlated with an inability of the
mutants both to bind the p53 response element of the bax
promoter and to trigger apoptosis (36, 38, 39). Such studies with these tumor-derived p53 mutants suggest that a failure in the ability of p53
to activate the bax gene may play an important role in tumor
formation and progression. As such, a complete understanding of the
transcriptional regulation of the bax promoter by p53 may yield important information relevant to our understanding of tumorigenesis.
Previous studies have demonstrated that the bax promoter is
differentially regulated by wild-type p53 in a cell type-specific manner (40). Here the osteosarcoma Saos-2 and the breast carcinoma MDA-MB-453 cell lines were used as a model system to explore the potential mechanisms for this differential regulation. In the Saos-2
cell line, transfected wild-type p53 effectively activated transcription through both the p21 and bax
promoters. In contrast, p53 expressed in the MDA-MB-453 cell line was
capable of activating transcription through the p21 promoter
as well as the p53 response elements of the p21,
cyclin G and cdc25C promoters but failed to do so
through either the bax promoter or the isolated p53 response element derived from the bax promoter. Neither p53
phosphorylation at serine 315 or serine 392 nor an intact C terminus
was required for activation of the bax promoter,
demonstrating that the observed defect in MDA-MB-453 cells could not be
explained solely by modifications of these residues. In addition,
neither the p53 homolog p73 nor other cellular factors that are capable
of binding the p53 response element of the bax promoter
explained the differential regulation of the bax promoter.
Detailed analysis of the interaction of p53 with the bax
promoter, however, demonstrated that unlike other well characterized
p53 response elements, like that of the p21 gene, in which
p53-dependent transcriptional activation is mediated by a
response element containing two consensus p53 half-sites, the response
element of the bax promoter consists of three adjacent half-sites that cooperate to bring about complete activation by p53. In
addition, it appears that p53 exists in a distinct conformation when
bound to its response element from the bax promoter as
compared with when it is bound to the 5'-response element of the
p21 promoter. Together, these data suggest a potential
mechanism for the cell type-specific differential regulation of
bax by p53.
Oligonucleotides--
For use in electrophoretic mobility shift
assays and for subsequent cloning into luciferase reporter plasmids,
complementary single-stranded oligonucleotides were annealed to produce
double-stranded oligonucleotides with the indicated sequences: Bax,
AATTCGGCTACCTCACAAGTTAGAGACAAGCCTGGGCGTGGGCTATATTGTAGCGAATT; OligoA, AATTCGGTACCTCACAAGTTAGAGACAAGCCTGCTAGCGAATT; OligoB,
AATTCGGTACCAGACAAGCCTGGGCGTGGGCGCTAGCGAATT; OligoC,
AATTCGGTACCAGACAAGCCTTTTACGGGGCTATATTGCTAGCGAATT; OligoAB, AATTCGGTACCTCACAAGTTAGAGACAAGCCTGGGCGTGGGCGCTAGCGAATT; OligoAC, AATTCGGTACCTCACAAGTTAGAGACAAGCCTTTTACGGGGCTATATTGCTAGCGAATT; OligoBC, AATTCGGTACCAGACAAGCCTGGGCGTGGGCTATATTGCTAGCGAATT;
p21-5'-AATTCGGTACCGAACATGTCCCAACATGTTGGCTAGCGAATT; p21-3'(2x),
AATTCGGTACCGAAGAAGACTGGGCATGTCTGAAGAAGACTGGGCATGTCTGCTAGCGAATT; Cyclin
G-AATTCGAGCTCCAAGGCTTGCCCGGGCAGGTCTGGGTACCGAATT; Cdc25C(2x), AATTCGGTACCGGGCAAGTCTTACCATTTCCAGAGCAAGCACGCTAGCAGGCCTGTGCTTGCTCTGGAAATGGTAAGACTTGCCCAGATCTAATATTG; and Sens-1, TCGAAGAAGACGTGCAGGGACCCTCGA.
Plasmids--
The expression plasmids pCMV-p53wt,
pCMV-p53V143A, and pCMV-p53S392A, originally
referred to as pC53-SN3 (41), pC53-SCX3 (14), and pCMVhup53ala392 (42),
respectively, encode the indicated human p53 protein under the control
of the cytomegalovirus promoter. The expression plasmid
pCMV-p53 Cell Lines--
The osteosarcoma Saos-2 cell line and the breast
carcinoma MDA-MB-453 cell line were maintained in a humidified tissue
culture incubator at 37 °C with 5% CO2. Saos-2 cells
were grown in Dulbecco's modified Eagle's medium, containing 10%
heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. MDA-MB-453 cells were grown in RPMI medium,
containing 10% heat-inactivated fetal bovine serum, 100 units/ml
penicillin, 100 µg/ml streptomycin, and 5 µg/ml insulin.
Transfections--
Unless otherwise indicated, 1 × 105 cells were seeded into 35-mm plates. Cells were
transfected 24 h later using the DOTAP liposomal transfection
reagent (Roche Molecular Biochemicals) according to the manufacturer's
instructions. Cellular lysates were prepared 48 h
post-transfection, total protein concentration was determined by
protein assay (Bio-Rad), and luciferase assays were quantitated using a
commercially available kit (Promega) and a TD-20e Luminometer (Turner).
Nuclear Extracts--
All procedures were conducted at 4 °C.
For each 100-mm dish, cells were washed three times with 5 ml of
phosphate-buffered saline. Cells then were scraped into 500 µl of
lysis buffer (20 mM HEPES, pH 7.5, 20% glycerol, 10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 1 mM
dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 50 µM leupeptin, and 50 µg/ml aprotinin) and centrifuged at 500 × g for 5 min. Pellets were resuspended in 200 µl of nuclear extraction buffer (lysis buffer containing 500 mM NaCl) and incubated end-over-end for 60 min. Samples
were centrifuged at 18,000 × g for 10 min. Nuclear
extracts were aliquoted, quick-frozen in liquid nitrogen, and stored at
Electrophoretic Mobility Shift Assays--
Purification of human
p53 protein and electrophoretic mobility shift assays using this
purified p53 were conducted as described previously (46). In brief,
Sf9 cells that were infected with recombinant baculovirus
expressing His-tagged p53 were lysed in 20 mM HEPES, pH
7.4, containing 20% glycerol, 10 mM NaCl, 0.2 mM EDTA, 0.1% Triton X-100, 1 mM
dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 50 µM leupeptin, and 50 µg/ml aprotinin (Buffer L). Nuclei
were pelleted by centrifugation at 2300 rpm and then resuspended in
Buffer L containing 500 mM NaCl. Extracts were diluted to
100 mM NaCl with Buffer L, applied to a 0.5-ml nickel
nitriloacetic acid agarose column (Qiagen) that was equilibrated with
20 mM HEPES containing 100 mM NaCl and eluted
with 200 mM imidazole containing 10 mM HEPES,
pH 7.4, and 5 mM NaCl. Fractions of 0.5 ml were collected,
dialyzed against 10 mM HEPES, pH 7.4, 5 mM NaCl, 0.1 mM EDTA, 20% glycerol, and 1 mM
dithiothreitol, aliquoted, and stored at
Purified p53 protein or nuclear extract was incubated with 3 ng of
radiolabeled double-stranded oligonucleotide and hybridoma supernatant
where appropriate in a total volume of 30 µl of DNA binding buffer,
containing 20 mM MgCl2, 2 mM
spermidine, 0.7 mM dithiothreitol, 1 mg/ml bovine serum
albumin, and 25 µg/ml poly[d(I-C)] for 30 min at room temperature.
Samples were loaded on a native 4% acrylamide gel and electrophoresed
in 0.5× TBE at 225 V for 2 h at 4 °C. Gels were dried and
exposed to Kodak XAR-5 film using an intensifying screen at SDS-Polyacrylamide Gel Electrophoresis and Western
Blot--
Cells were lysed in 150 mM NaCl, 50 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1% Nonidet
P-40, 1 mM phenylmethylsulfonyl fluoride, 50 µM leupeptin, and 10 µg/ml aprotinin. The protein
concentration of each sample was determined using the Bio-Rad Protein
Assay. Samples containing equal amounts of protein were electrophoresed in a 10% polyacrylamide gel. Following electrophoresis, protein was
transferred to nitrocellulose and probed with a 1:1 mixture of the
anti-p53 mouse monoclonal antibodies 1801 and 421. The secondary
antibody was a horseradish peroxidase-conjugated goat anti-mouse IgG,
and the signal was detected by the enhanced chemiluminescence method
(Amersham Pharmacia Biotech).
Wild-type p53 Fails to Activate Transcription through the p53
Response Element of the bax Promoter in the Breast Carcinoma MDA-MB-453
Cell Line--
Wild-type p53 expressed in the breast carcinoma
MDA-MB-453 cell line is unable to activate transcription through the
bax promoter or through the isolated p53 response element of
the bax promoter (Figs.
1A and
2A). Luciferase reporter
plasmids containing either the p21 promoter or the
bax promoter were transfected into the p53-negative Saos-2
or MDA-MB-453 cell line with pCMV vector, increasing amounts of a
plasmid expressing wild-type p53, or a plasmid expressing the mutant
p53V143A. In the Saos-2 cell line, wild-type p53
effectively activated transcription of reporter constructs containing
either the p21 or bax promoters. In contrast,
wild-type p53 expressed in the MDA-MB-453 cell line, although still
capable of activating transcription of a reporter containing the
p21 promoter, failed to activate transcription through a
construct containing the bax promoter (Fig. 1A).
Western blots demonstrated that p53 was expressed to equivalent levels
in the two cell lines (Fig. 1B, compare lane 9 with lane 10 and lane 11 with lane
12), if not slightly higher in MDA-MB-453 (Fig. 1B,
lanes 10 and 12), suggesting that the failure of
p53 to activate transcription through the bax promoter is
not due to decreased levels of p53 protein expression.
To determine whether the isolated p53 response element of the
bax promoter was sufficient for this differential effect,
synthetic oligonucleotides corresponding to the p53 response elements
of the p21 and bax promoters were cloned into the
pGL3-E1bTATA luciferase reporter vector, upstream from the minimal
adenovirus E1b promoter. Each reporter construct again was
transfected into either the Saos-2 or MDA-MB-453 cell line with pCMV
vector, increasing amounts of the wild-type p53 expression plasmid, or
the mutant p53V143A expression plasmid. In the Saos-2 cell
line, wild-type p53 effectively activated transcription of constructs
containing either the 5' or the 3' p53 response elements from the
p21 promoter (Fig. 2A), as well as a construct
containing the p53 response element of the bax promoter
(Fig. 2A, inset). As observed with the promoter constructs, wild-type p53 expressed in the MDA-MB-453 cell line failed
to activate transcription via an E1b reporter plasmid
containing the p53 response element of the bax promoter
(Fig. 2A, inset), whereas activating reporters
containing either the 5' or the 3' element of the p21
promoter (Fig. 2A). Expression of wild-type p53 in
MDA-MB-453 cells also activated transcription of reporters containing
the p53 response elements of the cyclin G and
cdc25C genes (Fig. 2B). Thus, the defect in
p53-dependent transcriptional activation of the
bax promoter appears to be at the level of the interaction
of p53 with its response element.
The p53 Response Element of the bax Promoter Consists of
Overlapping Binding Sites for p53--
The data presented in Figs. 1
and 2 demonstrate that in MDA-MB-453 cells there is a defect in
wild-type p53-dependent activation via the 37-bp p53
response element of the bax promoter, as compared with the
5' p53 response element of the p21 promoter. To understand the molecular mechanism mediating this differential regulation of the
p53 response elements, the interaction between p53 and its response
element from the bax promoter was examined in detail by
electrophoretic mobility shift assays. Previous studies localized the
p53 response element of the bax promoter to a 37-bp region at
To identify which of these putative binding sites are responsible for
the interaction between p53 and the bax promoter, synthetic double-stranded oligonucleotides were constructed to model each site
(Table I). The Bax oligonucleotide
contained the complete 37-bp p53 response element from the
bax promoter. Oligo A contained the 21 bp corresponding to
Site A, whereas Oligo B contained the 20 bp corresponding to Site B. Oligo C consisted of the 26 bp corresponding to Site C; however,
because of the sequence overlap between Sites B and C the 6 bp
separating the two half-sites in Site C were scrambled to abolish any
potential contribution from Site B. Each oligonucleotide contained
identical flanking sequences that allowed for its subsequent cloning
into a luciferase reporter plasmid. The relative affinities of these
oligonucleotides for p53 were assessed by electrophoretic mobility
shift assay. Purified p53 bound the labeled Bax oligonucleotide
containing the entire 37-bp p53 response element (Fig.
4A, lane 1), and
this binding was effectively competed by an excess of the same,
unlabeled oligonucleotide (Fig. 4A, lanes 2-4).
Unlabeled Oligo A, Oligo B, and Oligo C also successfully competed for
p53 binding (Fig. 4A, lanes 5-7, 8-10, and 11-13). For comparison, an unrelated
control oligonucleotide, Sens-1, was unable to compete for p53 binding
(Fig. 4,A, lanes 14-16, and B),
demonstrating that the binding of p53 to Oligos A, B, and C is
specific. In each case, however, the binding of p53 to the isolated
sites was weaker than that observed with the entire 37-bp response
element (Fig. 4B). These data suggest the possibility that
in the context of the entire p53 response element of the bax
promoter there is a cooperative interaction between the overlapping p53
binding sites that allows for enhanced p53 binding.
The ability of purified p53 to directly bind to these oligonucleotides
in electrophoretic mobility shift assays was then examined. A labeled
oligonucleotide corresponding to the 5' p53 response element of the
p21 promoter was used as a positive control for p53 binding
(Fig. 5, lanes 1-3). The
p21-5' oligonucleotide was bound by p53 and was effectively
supershifted by mAb 1801, a p53 N-terminal-specific monoclonal antibody
(Fig. 5, lane 2). In addition, the labeled Bax
oligonucleotide, corresponding to the entire p53 response element of
bax, as well as those corresponding to Site A, Site B, and
Site C were also bound by purified p53 (Fig. 5, lanes 4,
7, 10, and 13) and were supershifted
by mAb 1801 (Fig. 5, lanes 5, 8, 11,
and 14). This binding, however, was weaker than that
observed with the p21-5' site, requiring approximately 10-fold more p53 to generate a detectable band shift.
Previously our laboratory reported two distinct classes of p53 binding
sites based on their responses to the C-terminal-specific mAb 421 (46).
p53 binding to one class of sites, which includes the p21-5'
site, is enhanced in the presence of mAb 421, whereas binding to the
second class of sites is inhibited by mAb 421. Confirming our original
observation, p53 binding to the p21-5' site was enhanced in
the presence of mAb 421 (Fig. 5, lane 3). Binding of p53 to
the Bax oligonucleotide as well as to Oligo C, however, was inhibited
in the presence of mAb 421 (Fig. 5, lanes 6 and
15). The binding of p53 to Oligos A and B displayed an
intermediate phenotype, in which mAb 421 failed to effectively supershift the p53-oligonucleotide complexes and failed to enhance p53
binding to the oligonucleotides (Fig. 5, lanes 9 and
12). In either case, the data are consistent with the notion
that binding to each of the bax sites as compared with the
p21-5' site may require a conformationally distinct form of p53.
Overlapping, Low Affinity p53 Binding Sites Synergize for Complete
p53-dependent Transactivation through the p53 Response
Element of the bax Promoter--
The Bax oligonucleotide as well as
Oligo A, Oligo B, and Oligo C were cloned into the pGL3-E1bTATA
luciferase reporter vector upstream from the adenovirus minimal
E1b promoter. Each reporter construct was transfected with
the pCMV empty vector, a plasmid expressing wild-type p53, or a plasmid
expressing the temperature-sensitive p53V143A mutant into
the p53-negative Saos-2 cell line (Fig.
6). At 37 °C the p53V143A
mutant fails to activate transcription through p53-responsive promoters. At 32 °C, however, this mutant adopts a wild-type
conformation and has been shown to activate some p53-responsive
promoters (such as p21) but not others (such as
bax) (36, 38). At 37 °C, wild-type p53 activated
transcription through the complete 37-bp response element of the
bax promoter (Fig. 6A). In addition, wild-type p53 activated transcription through Oligo B; however, this activation was significantly lower than that observed with the complete response element (21-fold compared with 67-fold). Although Oligos A and C both
showed sequence-specific binding to p53 in an electrophoretic mobility
shift assay (Fig. 4), p53 failed to activate transcription, to any
significant degree, through either sequence (Fig. 6A, 2- and
1-fold, respectively). The same pattern of activation was observed with
wild-type p53 at 32 °C (Fig. 6B). Similar to observations made with the bax promoter (36, 38), the
temperature-sensitive p53V143A mutant at 32 °C failed to
activate transcription through any of the isolated p53 binding sites of
the bax promoter (Fig. 6B, gray bars).
The p53V143A mutant, however, did successfully activate
transcription through the p21-5' response element inserted
into the same pGL3-E1bTATA reporter vector (Fig. 6B,
inset).
The transfection data demonstrate that Site B can mediate
p53-dependent activation but that the level of activation
conferred by this sequences is one-third of that observed with the
complete 37-bp response element. To analyze which additional sequences in the 37-bp element are necessary for full activation, another set of
synthetic double-stranded oligonucleotides was constructed (Table I).
Oligo AB contained the 31 bp that correspond to the overlapping Sites A
and B. Oligo AC consisted of the 37-bp response element; however, the 6 bp separating the two half-sites in Site C were scrambled to abolish
any potential contribution from Site B. Oligo BC contained the 30 bp
corresponding to the overlapping Sites B and C. Again, each
oligonucleotide contained identical flanking sequences that allowed for
its subsequent cloning into a luciferase reporter plasmid. These
oligonucleotides were analyzed by electrophoretic mobility shift assay.
Purified p53 bound the labeled Bax oligonucleotide containing the
entire 37-bp p53 response element of the bax promoter (Fig.
7A, lane 1), and
this binding was effectively competed by an excess of the same,
unlabeled oligonucleotide (Fig. 7A, lanes 2-4).
Oligo BC, as well as Oligo AC failed to compete for p53 binding to any
greater degree than Oligo B (Fig. 7A, compare lanes
11-13 and 14-16 with lanes 5-7). Oligo
AB, however, effectively competed for p53 binding (Fig. 7A,
lanes 8-10). This competition was in the same range as that
observed with the complete Bax oligonucleotide (Fig. 7B),
suggesting that the two oligonucleotides share a similar affinity for
the purified p53.
Each double-stranded oligonucleotide was inserted into the pGL3-E1bTATA
reporter vector upstream of the adenovirus minimal E1b
promoter and transfected into Saos-2 cells with either empty vector or
the wild-type p53 expression vector (Fig.
8). Wild-type p53 effectively activated
transcription through the 37-bp p53 response element of the
bax promoter (60-fold) and to a lesser extent through Oligo
B (13-fold). In contrast, p53 failed to significantly activate
transcription through either Oligo A (2-fold) or Oligo C (1-fold).
Consistent with the results of the electrophoretic mobility shift
assays, p53 activated transcription through Oligo AB to a greater
extent than through Oligo B (61-fold compared with 13-fold). This
activation was in the same range as that observed with the complete p53
response element (61-fold compared with 60-fold). Both Oligos BC and AC
failed to mediate any significant p53-dependent
transactivation (4-fold and 1-fold respectively). These data confirm
that in contrast to other p53 response elements, like the
p21-5' site, in which two adjacent p53 half-sites mediate transcriptional activation, the p53 response element of the
bax promoter consists of three half-sites that cooperate to
bring about full activation.
Two Nuclear Factors Selectively Interact with the p53 Response
Element of the bax Promoter but Are Not Responsible for Its
Differential Regulation in MDA-MB-453 Cells--
Given that the defect
in the ability of p53 to activate transcription of bax is at
the level of the interaction between p53 and its response element in
the bax promoter, one potential mechanism to explain the
failure of p53 to activate transcription of bax in
MDA-MB-453 cells might be that cellular factors exist in this cell line
that can selectively compete p53 for binding to the bax
promoter. To investigate this possibility, the labeled Bax oligonucleotide was used as a probe with MDA-MB-453 cell nuclear extract in an electrophoretic mobility shift assay. Four distinct nuclear factors bound this oligonucleotide (Fig. 8A,
lane 1). Three of these factors, labeled BoB1 and
BoB2 (binder of
bax 1 and 2),
and n.s., were effectively competed by an excess of this
same unlabeled oligonucleotide (Fig. 8A, lanes
2-4). The band labeled n.s. also was competed
effectively by Oligos A, B, and C, as well as by the p21-5'
oligonucleotide (Fig. 8A, lanes 2-16),
suggesting that this factor is a nonspecific (n.s.)
DNA-binding protein. In contrast, the bands labeled BoB1 and
BoB2 were effectively competed by an excess of unlabeled
Oligo B but were not competed by Oligo A, Oligo C, or the
p21-5' oligonucleotide, demonstrating sequence specificity
for Oligo B (Fig. 8A, compare lanes 8-10 with
lanes 5-7 and 11-16). The band shifts produced
with nuclear extract of MDA-MB-453 cells were unaffected by the
presence of anti-p53 antibodies (data not shown). In addition, BoB1 and
BoB2 failed to bind the p21-5' oligonucleotide, as well as
oligonucleotides corresponding to the p53 response element of the
gadd45 gene and the 3' element of the mdm-2 gene
(Fig. 8A, lanes 14-16, and data not shown).
These results demonstrate the identification of two novel nuclear
factors that display sequence specificity for the same region of the
bax promoter that we have shown to be essential for
p53-dependent transcriptional activation.
The identification of nuclear factors that showed sequence specificity
for the p53 response element of the bax promoter suggests a
potential mechanism for the differential activation of a reporter construct containing the bax promoter in MDA-MB-453 cells.
To explore this possibility, the levels of BoB1 and BoB2 in Saos-2 (Fig. 8B, lanes 1-5) and MDA-MB-453 (Fig.
8B, lanes 7-11) nuclear extracts were compared
by electrophoretic mobility shift assay, using the Bax oligonucleotide
as radiolabeled probe. No significant difference in BoB1 or BoB2 levels
was observed between nuclear extracts from these two cell lines (Fig.
8B, compare lanes 1-5 with lanes
7-11) that had been normalized by total protein. These results
suggest that BoB1 and BoB2 levels, as assessed by electrophoretic mobility shift assay, cannot explain the differential effects observed
with wild-type p53 on its response element from the bax promoter in MDA-MB-453 cells as compared with Saos-2 cells.
The p53 Homolog p73 Does Not Selectively Inhibit the Ability of p53
to Activate Transcription through the bax Promoter--
In addition to
BoB1 and BoB2, the p53 homolog p73 was examined as a potential
explanation for the inability of wild-type p53 to activate
transcription through the bax promoter in MDA-MB-453 cells.
Saos-2 cells were transfected with a wild-type p53 expression vector,
increasing amounts of an expression vector for p73 An Intact C Terminus Is Not Required for p53-dependent
Transcriptional Activation of the bax Promoter--
Previous studies
have demonstrated that C-terminal phosphorylation on serines 315 (47-49) and 392 (50) as well as acetylation of the C terminus (51)
functionally alter the DNA binding characteristics of p53. Further, the
ability of the C-terminal-specific mAb 421 to enhance the DNA binding
activity of p53 has been proposed to be functionally similar to
deletion of the last 30 amino acids of p53. In both cases, the binding
of p53 to certain response elements is enhanced (50). As mAb 421 inhibits binding of p53 to the bax element, the effect of
deletion of the terminal 30 amino acids was also examined. Saos-2 cells
were transfected with either the p21P or pBax luciferase reporter
plasmid and increasing amounts of pCMV-p53wt, pB-
p53S315A, pB- p53S315D,
pCMV-p53S392A, or pCMV-p53 The data presented in this report demonstrate that wild-type p53
expressed in the osteosarcoma Saos-2 cell line successfully activated
transcription through the promoters of both the
cyclin-dependent kinase inhibitor p21 and the
proapoptotic bax. In contrast, p53 expressed in the breast
carcinoma MDA-MB-453 cell line was capable of activating transcription
through the p21 promoter but failed to do so through the
bax promoter (Fig. 1A). A luciferase reporter construct containing the 37-bp p53 response element from the
bax promoter displayed the same differential response to p53
as the reporter containing the complete promoter (Fig. 2). This
suggests that the 37-bp p53 response element alone is sufficient to
mediate this differential regulation and argues in favor of the notion that the differential effect depends on an inherent difference in the
interaction of p53 with its response elements in the bax and
p21 promoters. In this regard, the data demonstrate three distinct differences between the p53 response elements from these two
promoters. First, unlike the p21-5' element, which consists of two consensus p53 half-sites that form a high-affinity p53 response
element, the response element of the bax promoter consists of three half-sites that cooperate in mediating
p53-dependent transactivation (Fig. 7). Second, the studies
with the C-terminal-specific mAb 421 suggest that the binding of p53 to
its response element in the bax promoter, as compared with
its binding to other response elements, involves a conformationally
distinct form of p53 (Fig. 5). Finally, two novel nuclear factors,
termed BoB1 and BoB2, were identified that demonstrated
sequence-specific binding to the same region of the bax
promoter that was essential for p53-dependent transactivation and failed to bind to the 5' element of the
p21 promoter (Fig. 8).
The fact that the binding of p53 to the bax element, unlike
that to the p21-5' element, failed to be enhanced by the
addition of mAb 421 (Fig. 5) indicates that the binding of p53 to these two sequences may require conformationally distinct forms of p53. Thus,
the inability of p53 to activate transcription through the bax promoter in certain cell lines, like MDA-MB-453, may be
due to an altered post-translational modification that prevents p53 from acquiring the correct conformation for binding. Alternatively, binding to the bax element may induce a distinct
conformational change in p53, as compared with when it is bound to the
p21-5' element, that subsequently allows it to interact with
a distinct set of additional regulatory factors, and the cell
type-specific regulation is at the level of these additional
regulators. This latter scenario has been observed with the
transcription coactivator OCA-B. OCA-B is a B-cell-specific coactivator
that markedly enhances transcription mediated by Oct-1 or Oct-2 through
the octamer sequence of immunoglobulin promoters but fails to activate
transcription mediated by the same Oct-1 or Oct-2 activators through
octamer sequences in the histone H2B gene (52). Consistent with the notion that mAb 421 is revealing a conformational distinction significant to the observed differential regulation of bax,
the ability of wild-type p53 to activate transcription through the p21-3' response element, to which the binding of p53 also is
inhibited by mAb 421 (46), was significantly decreased in MDA-MB-453
cells as compared with Saos-2 (Fig. 2).
Within the C terminus, phosphorylation of serines 315 (47-49) and 392 (50, 53-55) as well as acetylation of lysines 370, 372, and 373 (51)
have been shown to enhance the DNA binding (47-51), transcriptional
activation (53, 54), and growth suppressor (55) functions of p53. In
fact, Scheidtmann and co-workers (49, 54) have suggested that
phosphorylation of serines 315 and 392 alters the ability of p53 to
both bind to and activate transcription through the p53 response
element of the bax promoter, in particular. Given these
results and the observation that the C-terminal-specific mAb 421 inhibits the binding of p53 to the bax element (Fig. 5), we
investigated whether or not these particular post-translational modifications could explain the observed defect in the ability of
wild-type p53 to activate transcription through the bax
promoter in the MDA-MB-453 cell line. The results in Fig. 10
demonstrate that although mutation of either serine 315 or serine 392 to alanine slightly decreases the ability of p53 to activate
transcription through the bax promoter, as compared with the
p21 promoter neither phosphorylation of 315 or 392 nor an
intact C terminus is required for p53 to effectively activate
transcription through either the bax or p21
promoters. Because the data presented here address each modification
independently of the others, the possibility still exists that some
combination of these modifications, or other C-terminal modifications
not addressed here, may have a more significant impact on the ability
of p53 to activate transcription through the bax promoter.
The identification of two novel nuclear factors, BoB1 and BoB2, that
showed sequence specificity for the same region of the bax
promoter that was essential for p53-dependent
transactivation (Figs. 6 and 8) suggested an alternate explanation for
the observed defect in MDA-MB-453 cells. Preliminary results indicated
that the binding of p53 and BoB1 or BoB2 to the p53 response element of
the bax promoter were mutually exclusive, suggesting that
these factors may compete with p53 for binding (data not shown). These factors demonstrated a strong affinity for the bax element
and poor affinity for the p21-5' element. In addition, BoB1
and BoB2 were found to display a moderate affinity for the
p21-3' element (data not shown). Correspondingly, the level
of p53-dependent activation of the reporter construct
containing this 3' element was reduced in MDA-MB-453 cells when
compared with its level of activation in Saos-2 cells (Fig. 2). These
results suggested an inverse relationship between the affinity of these
binding factors for a particular sequence and the ability of that
sequence to mediate p53-dependent transcriptional
activation in MDA-MB-453. When the levels of these factors in
MDA-MB-453 and Saos-2 cells were compared, however, there was no
discernable difference observed (Fig. 8B), suggesting that
although these factors still may have some significance to the
p53-dependent transactivation of bax, they do
not explain the observed defect in the MDA-MB-453 cell line. One could
hypothesize that the p53 homolog p73 might function in a manner
analogous to that originally proposed for the BoB1 and BoB2 binding
factors. Given the sequence homology between the DNA-binding domains of
p53 and p73, it is reasonable to speculate that p73 can bind DNA at p53
response elements and, therefore, may compete with p53 for binding. The
results presented here, however, do not support such a hypothesis.
Expression of p73 The identification of tumor-derived p53 mutants that selectively fail
to activate transcription through the bax promoter and subsequently fail to undergo apoptosis (36-39) suggests that the ability of p53 to activate transcription through the bax
promoter is important to the tumor suppressor function of p53. The Bax protein, in fact, has been shown to play an important role both in
inhibiting tumor progression and in promoting the apoptosis of tumor
cells in response to DNA-damaging agents like those used in the
treatment of cancer (56-62). Studies have shown that decreased Bax
levels are significantly associated with tumor cell resistance to
chemotherapy (56, 58) and that increased expression of Bax is
sufficient to sensitize at least certain tumor cell types to apoptotic
stimuli (57, 60, 61, 63). In addition, the p53-dependent
transcriptional activation of the bax gene has been shown to
be important both in inhibiting tumor formation and progression (59,
62, 64) and in promoting apoptosis in response to radio and
chemotherapy (59, 63). As such, understanding the mechanism of
p53-dependent regulation of the bax gene will
provide new insights into the processes of tumor formation and
progression, as well as the development of tumor resistance to
treatment. The data presented here identify several characteristics
that differentiate the p53 response element of the bax
promoter from other p53 response elements, such as the
p21-5' element. These characteristics suggest a potential
mechanism for the cell type-specific regulation of the bax
promoter by p53, as seen with the MDA-MB-453 and Saos-2 cell lines. The
data demonstrate that in this model system the defect in the ability of
wild-type p53 to activate transcription through the bax
promoter is at the level of the interaction between p53 and its
response element and that this interaction appears to involve a
conformationally distinct form of p53 interacting with a unique
arrangement of three half-sites. It is reasonable to speculate that the
mechanism responsible for the failure of wild-type p53 to activate
transcription through the bax promoter in MDA-MB-453 cells
may also be relevant to the inhibition of bax induction
observed both in tumor formation and progression and in tumors that are
resistant to apoptosis-inducing treatments.
We thank Bert Vogelstein (Johns Hopkins
University) for the wild-type and V143A mutant p53 expression plasmids,
Karen Vousden (National Cancer Institute, Frederick, MD) for the
*
This work was supported by National Cancer Institute Grant
CA69161) and Breast Cancer Program of the U.S. Army Medical Research and Materiel Command Grants DAMD-17-97-1-7336 and DAMD-17-97-1-7337.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
bp, base pair(s);
mAb, monoclonal antibody.
One Mechanism for Cell Type-specific Regulation of the
bax Promoter by the Tumor Suppressor p53 Is Dictated by the
p53 Response Element*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
370-393, originally referred to as
pCB6+p53
370 (43), encodes p53, under the control of the
cytomegalovirus promoter, with a point mutation introducing a stop
codon at amino acid 370. The expression plasmids
pB-p53S315A and pB-p53S315D, originally
referred to as Bhup53ala315 (42) and Bhup53asp315 (42), respectively,
encode the indicated human p53 protein under the control of the human
B-actin promoter. The expression vector pCMV-p73
encodes wild-type
p73 under the control of the cytomegalovirus promoter (44). The
luciferase reporter plasmid p21P contains the 2.4-kilobase pair
HindIII fragment from the p21 promoter cloned into the pGL2-Basic vector (45). The luciferase reporter plasmid pBax
contains the 370-bp SmaI/SacI fragment from the
bax promoter cloned into the pGL3-Basic vector (29). The
following synthetic double-stranded oligonucleotides were digested with
KpnI and NheI and cloned into pGL3-E1bTATA (46),
which also had been double-digested with KpnI and
NheI to produce pTATA vectors with corresponding names: Bax,
OligoA, OligoB, OligoC, OligoAB, OligoBC, OligoAC, p21-5', p21-3'
(x2), Cyclin G, and Cdc25C (x2) (46).
70 °C.
70 °C.
70 °C.
Bands were scanned and quantitated using the Molecular Analyst Imaging
Densitometer (Bio-Rad).
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (43K):
[in a new window]
Fig. 1.
Expression of wild-type p53 in MDA-MB-453
cells fails to activate transcription through the bax
promoter. A, Saos-2 and MDA-MB-453 cells were
transfected as described under "Materials and Methods" with 2 µg
of the indicated reporter constructs in the presence of 0, 5, 50, 100, or 200 ng of pCMV-p53wt or 50 ng of
pCMV-p53V143A. 48 h post transfection cells were lysed
and assayed for total protein and luciferase activity as described
under "Materials and Methods." Appropriate amounts of the vector
pCMV were added to each transfection mixture to maintain a constant
level of total plasmid DNA of 2.2 µg/sample. The indicated values are
the average of three independent experiments each performed in
duplicate. The numbers above each bar indicate
the fold activation for each reporter construct observed with
pCMV-p53wt or pCMV-p53V143A as compared with
pCMV. B, 1 × 106 cells of either Saos-2
(lanes 7, 9, and 11) or MDA-MB-453
(lanes 8, 10, and 12) were seeded in
100-mm plates and subsequently transfected with 10 µg of either empty
pCMV (lanes 7 and 8) or pCMV-p53wt
(lanes 9-12). 48 h post transfection cells were lysed
and assayed for p53 expression levels by Western blot (lanes
7-12) as described under "Materials and Methods." Following
immunodetection the blot was stained with Ponceau S to confirm that
equal amounts of protein were loaded in each lane (lanes
1-6). Each lane contains 60 µg of total protein, and each lane
represents an independent transfection.
View larger version (33K):
[in a new window]
Fig. 2.
Expression of wild-type p53 in MDA-MB-453
cells fails to activate transcription through a 37-bp element of the
bax promoter. Saos-2 (A) and
MDA-MB-453 (A and B) cells were transfected as
described under "Materials and Methods" with 2 µg of the
indicated reporter constructs in the presence of 0, 5, 50, 100, or 200 ng of pCMV-p53wt or 50 ng of pCMV-p53V143A.
48 h post transfection cells were lysed and assayed for total
protein and luciferase activity as described under "Materials and
Methods." Appropriate amounts of the vector pCMV were added to each
transfection mixture to maintain a constant level of plasmid DNA of 2.2 µg/sample. The Bax (1x) data are enlarged for clarity (inset
A). The plots shown in the insets have the same scale.
The indicated values are the average of three independent experiments
each performed in duplicate. The numbers above each
bar indicate the fold activation for each pTATA construct
observed with pCMV-p53wt or pCMV-p53V143A as
compared with pCMV.
113 to 77 from the start site of transcription (29). An examination of the nucleotide sequence of this 37-bp element revealed three potential p53 binding sites, termed Site A, Site B, and Site C
(Fig. 3), that correspond to the
consensus site for p53 binding (17-19). Site A consists of the first
21 bp of the 37-bp response element, with two potential p53 half-sites
separated by a 1-bp insert. The first half-site contains three bases
that vary from the consensus (two purine-to-pyrimidine changes in the first quarter-site and one in the second quarter-site). The second half-site of Site A matches the consensus sequence in all 10 bases. Site B consists of 20 bp including this same "consensus" half-site and a second half-site downstream, separated by no intervening sequences. Site B diverges from the consensus at three bases (the A/T
is a G in the last position of the third quarter-site, and there are
two purine-to-pyrimidine changes in the fourth quarter-site). Site C
consists of 26 bp and includes the same half-site noted in Sites A and
B, separated from a second half-site by a 6-bp insert. Site C contains
two variations from the consensus sequence (a C to A change and a
purine-to-pyrimidine change both in the fourth quarter site). Of note
is the spatial relationship of these three potential p53 binding sites.
The three sites overlap one another with the consensus half-site (102
to 93) common to each. Because of this shared half-site, the binding
of p53 to one site excludes its simultaneous binding to either of the
other sites. Therefore, if one assumes that p53 binds as a tetramer
(20-22), then only one site can be occupied at any given time.
View larger version (63K):
[in a new window]
Fig. 3.
Schematic of the p53 response element of the
human bax promoter. The previously identified p53
response element of the bax promoter is located at 113 to
77 from the transcriptional start site. Based on the p53 consensus
binding site, there exists, within this 37-bp sequence, three
potential, overlapping p53 binding sites. These putative binding sites
are labeled Site A (113 to 93), Site B (102 to 83), and Site C
(102 to 77). The arrows indicate the four quarter sites
that constitute each proposed p53 binding site. The p53 consensus
sequence is indicated above each arrow with r
representing purine and w representing either an adenine or
thymine base. Bases in the bax sequence that vary from this
consensus are indicated by asterisks. The perfect half-site
shared by each potential binding site is highlighted by the gray
box. The position of the TATA box for the bax promoter
(22 to 26) also is indicated.
Synthetic oligonucleotides used in electrophoretic mobility shift
assays and transfection assays
View larger version (48K):
[in a new window]
Fig. 4.
The p53 response element of the
bax promoter contains three overlapping p53 binding
sites. A, an electrophoretic mobility shift assay was
performed using the Bax oligonucleotide as radiolabeled probe. 50 ng of
purified p53 was incubated with 3 ng of the probe alone (lane
1) or in the presence of a 500- (lanes 2, 5,
8, 11, and 14), 1000- (lanes
3, 6, 9, 12, and 15),
or 1500-fold (lanes 4, 7, 10,
13, and 16) molar excess of the indicated
unlabeled competitors. The Sens-1 oligonucleotide (lanes
14-16) was used as a nonspecific control. The arrow
indicates the position of the p53-DNA complexes. Bands were quantitated
by densitometry and expressed as a percentage of the no competition
signal (lane 1) (B). The 1000x point of the Oligo
C competition (lane 12) was not included because of an
artifactual streak in the lane that interfered with quantitation.
View larger version (54K):
[in a new window]
Fig. 5.
Monoclonal antibody 421 enhances the binding
of p53 to the p21 site but inhibits the binding of p53
to the bax sites. An electrophoretic mobility
shift assay was performed, incubating either 5 ng (lanes
1-3) or 50 ng (lanes 4-15) of purified p53 with 3 ng
of the indicated radiolabeled probes in the absence (lanes
1, 4, 7, 10, and 13)
or presence of monoclonal antibodies 1801 (lanes 2,
5, 8, 11, and 14) or 421 (lanes 3, 6, 9, 12, and
15). The arrows indicate the positions of the
p53-DNA complexes, and the brackets indicate the positions
of the supershifted antibody-p53-DNA complexes.
View larger version (17K):
[in a new window]
Fig. 6.
Site B is sufficient to confer
p53-dependent transactivation, but the level of
transactivation is lower than that observed with the complete 37-bp
response element. Saos-2 cells were transfected as described under
"Materials and Methods" with 2 µg of the indicated reporter
constructs and 50 ng of either empty pCMV (white bars), the
wild-type p53 expression vector pCMV-p53wt (black
bars), or the temperature-sensitive p53 expression vector
pCMV-p53V143A (gray bars). Cells were maintained
either at 37 °C (A) or shifted to 32 °C 24 h
prior to lysis (B). Luciferase activity and total protein
levels were assayed as described under "Materials and Methods." The
pTATA-p21-5' reporter construct (B inset) was used as a
positive control for the pCMV-p53V143A expression vector.
The indicated values are the averages of three independent experiments
each performed in duplicate. The numbers above each
bar indicate the fold activation for each pTATA construct
observed with pCMV-p53wt or pCMV-p53V143A as
compared with pCMV.
View larger version (25K):
[in a new window]
Fig. 7.
Overlapping binding sites synergize in p53
binding and in p53-dependent transactivation.
A, an electrophoretic mobility shift assay was performed
using the Bax oligonucleotide as radiolabeled probe. 50 ng of purified
p53 was incubated with 3 ng of the probe alone (lane 1) or
in the presence of a 500- (lanes 2, 5, 8, 11, 14), 1000- (lanes
3, 6, 9, 12, and 15),
or 1500-fold (lanes 4, 7, 10,
13, and 16) molar excess of the indicated
unlabeled competitors. The arrow indicates the position of
the p53-DNA complexes. B, bands were quantitated by
densitometry and expressed as a percentage of the no competition signal
(lane 1). C, Saos-2 cells were transfected as
described under "Materials and Methods" with 2 µg of the
indicated reporter constructs and 50 ng of either pCMV (white
bars) or the wild-type p53 expression vector
pCMV-p53wt (black bars). 48 h post
transfection luciferase activity and total protein levels were assayed
as described under "Materials and Methods." The indicated values
are the averages of three independent experiments each performed in
duplicate. The numbers above each black bar
indicate the fold activation for each pTATA construct observed with
pCMV-p53wt as compared with pCMV.
View larger version (76K):
[in a new window]
Fig. 8.
Nuclear extracts from MDA-MB-453 cells
contain two factors that bind in a sequence-specific manner to the
37-bp p53 response element of the bax promoter.
A, an electrophoretic mobility shift assay was performed
using the Bax oligonucleotide as radiolabeled probe. 2 µl (9 µg of
total protein) of MDA-MB-453 nuclear extract was incubated with 3 ng of
the probe alone (lane 1) or in the presence of a 10- (lanes 2, 5, 8, 11, and
14), 50- (lanes 3, 6, 9,
12, and 15), or 100-fold (lanes 4,
7, 10, 13, and 16) molar
excess of the indicated unlabeled competitors. BoB1 and
BoB2 indicate the positions of the two sequence-specific
DNA-binding factors, and n.s. indicates the position of a
nonspecific band. BoB1 and BoB2 levels are equivalent in MDA-MB-453 and
Saos-2 nuclear extracts. B, an electrophoretic mobility
shift assay was performed using the Bax oligonucleotide as radiolabeled
probe. 0 (lane 6), 4 (lanes 1 and 7),
8 (lanes 2 and 8), 12 (lanes 3 and
9), 16 (lanes 4 and 10), and 20 µg
(lanes 5 and 11) of either Saos-2 (lanes
1-5) or MDA-MB-453 (lanes 7-11) nuclear extract was
incubated with 3 ng of the probe. BoB1 and BoB2
indicate the positions of the two sequence-specific binding
factors.
and either the p21P or pBax luciferase reporter constructs (Fig.
9). In the absence of p73, p53 activated
transcription through both the p21 (12-fold) and
bax (48-fold) promoters. The addition of increasing amounts
of p73 failed to inhibit the ability of p53 to activate transcription
through either the p21 or bax promoters, suggesting that p73 is not responsible for the differential activation observed with these two promoters in the MDA-MB-453 cell line.
View larger version (23K):
[in a new window]
Fig. 9.
The p53 homolog p73 does not selectively
inhibit the ability of p53 to activate transcription through the
bax promoter. Saos-2 cells were transfected as
described under "Materials and Methods" with 2 µg of either the
p21P or pBax luciferase reporter plasmids, 0 ng ( ) or 50 ng (+) of
pCMV-p53wt, and 0 (), 50, or 100 ng of pCMV-p73.
48 h post transfection cells were lysed and assayed for total
protein and luciferase activity as described under "Materials and
Methods." Appropriate amounts of the vector pCMV were added to each
transfection mixture to maintain a constant level of plasmid DNA of 2.1 µg/sample. The indicated values are the average of three independent
experiments each performed in duplicate. The numbers above
each bar indicate the fold activation for each reporter
construct observed with pCMV-p53wt and/or pCMV-p73 as
compared with pCMV.
370-393
expression vector (Fig. 10). In each
case p53 effectively activated transcription through both the
p21 and the bax promoters, suggesting that
neither phosphorylation of serine 315 or serine 392 nor an intact C
terminus is required for the p53-dependent transactivation of the bax promoter. As compared with wild-type p53, each
phosphorylation mutant activated transcription through the
p21 promoter to an equal or greater extent. Although these
mutants, S315A, S315D, and S392A, also clearly activated transcription
through the bax promoter (up to 18-, 16-, and 24-fold,
respectively), this level of activation was consistently lower than
that observed with the wild-type p53 (up to 72-fold), suggesting that
although loss of phosphorylation on either of these residues alone does
not completely inhibit the ability of p53 to activate transcription
through the bax promoter they may contribute in a partial
manner.
View larger version (23K):
[in a new window]
Fig. 10.
An intact C terminus is not required for
p53-dependent transcriptional activation of the
bax promoter. Saos-2 cells were transfected as
described under "Materials and Methods" with 2 µg of either the
p21P or pBax luciferase reporter plasmids and 0, 50, 100, or 200 ng of
pCMV-p53wt (WT), pB-p53S315A
(S315A), pB-p53S315D (S315D),
pCMV-p53S392A (S392A), or
pCMV-p53 370-393 (370-393). 48 h
post transfection cells were lysed and assayed for total protein and
luciferase activity as described under "Materials and Methods."
Appropriate amounts of the vector pCMV were added to each transfection
mixture to maintain a constant level of total plasmid DNA of 2.2 µg/sample. The indicated values are the average of three independent
experiments each performed in duplicate. The numbers above
each bar indicate the fold activation for each reporter
construct observed with each p53 expression vector as compared with
pCMV.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
was unable to inhibit the ability of p53 to
activate transcription through either the bax or
p21 promoters (Fig. 9). In fact, p73 was found to be a
potent activator of transcription through the bax promoter
(Fig. 9, up to 30-fold).
ACKNOWLEDGEMENTS
370-393 mutant p53 expression plasmid, Sam Benchimol (Ontario
Cancer Institute), and John Jenkins (Marie Curie Institute) for the
S315A, S315D, and S392A mutant p53 expression plasmids, William Kaelin
(Dana-Farber Cancer Institute) for the p73 expression plasmid,
Michael Datto and Xiao-Fan Wang (Duke University) for the p21 promoter
reporter construct, John Reed (Burnham Institute) for the
bax promoter construct, and Ze'ev Ronai (Mount Sinai) for
the recombinant baculovirus expressing His-tagged human p53. Ron
Magnusson is thanked for help with the recombinant baculovirus
infections. Lois Resnick-Silverman, Selvon St. Clair, Kathy Zhao, and
Amy Ream of the Manfredi laboratory are thanked for their help and support.
FOOTNOTES
To whom correspondence should be addressed: Derald H. Ruttenberg
Cancer Center, Box 1130, Mount Sinai School of Medicine, New York, NY
10029. Tel.: 212-659-5495; Fax: 212-849-2446; E-mail: jmanfredi@smtplink.mssm.edu.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Greenblatt, M. S.,
Bennett, W. P.,
Hollstein, M.,
and Harris, C. C.
(1994)
Cancer Res.
54,
4855-4578 2.
Hollstein, M.,
Rice, K.,
Greenblatt, M. S.,
Soussi, T.,
Fuchs, R.,
Sorlie, T.,
Hovig, E.,
Smith-Sorensen, B.,
Montesano, R.,
and Harris, C. C.
(1994)
Nucleic Acids Res.
22,
3551-3555
3.
Ko, L. J.,
and Prives, C.
(1996)
Genes Dev.
10,
1054-1072 4.
Levine, A. J.
(1997)
Cell
88,
323-331[CrossRef][Medline]
[Order article via Infotrieve]
5.
Sugrue, M. M.,
Shin, D. Y.,
Lee, S. W.,
and Aaronson, S. A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
9648-9653 6.
Bargonetti, J.,
Friedman, P. N.,
Kern, S. E.,
Vogelstein, B.,
and Prives, C.
(1991)
Cell
65,
1083-1091[CrossRef][Medline]
[Order article via Infotrieve]
7.
Kern, S. E.,
Kinzler, K. W.,
Bruskin, A.,
Jarosz, D.,
Friedman, P.,
Prives, C.,
and Vogelstein, B.
(1991)
Science
252,
1708-1711 8.
Fields, S.,
and Jang, S. K.
(1990)
Science
249,
1046-1049 9.
Bargonetti, J.,
Manfredi, J. J.,
Chen, X.,
Marshak, D. R.,
and Prives, C.
(1993)
Genes Dev.
7,
2565-2574 10.
Pavletich, N. P.,
Chambers, K. A.,
and Pabo, C. O.
(1993)
Genes Dev.
7,
2556-2564 11.
Wang, Y.,
Reed, M.,
Wang, P.,
Stenger, J. E.,
Mayr, G.,
Anderson, M. E.,
Schwedes, J. F.,
and Tegtmeyer, P.
(1993)
Genes Dev.
7,
2575-2586 12.
Pietenpol, J. A.,
Tokino, T.,
Thiagalingam, S.,
el-Deiry, W. S.,
Kinzler, K. W.,
and Vogelstein, B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
1998-2002 13.
Prives, C.
(1994)
Cell
78,
543-546[CrossRef][Medline]
[Order article via Infotrieve]
14.
Kern, S. E.,
Pietenpol, J. A.,
Thiagalingam, S.,
Seymour, A.,
Kinzler, K. W.,
and Vogelstein, B.
(1992)
Science
256,
827-830 15.
Raycroft, L.,
Wu, H. Y.,
and Lozano, G.
(1990)
Science
249,
1049-1051 16.
Unger, T.,
Nau, M. M.,
Segal, S.,
and Minna, J. D.
(1992)
EMBO J.
11,
1383-1390[Medline]
[Order article via Infotrieve]
17.
el-Deiry, W. S.,
Kern, S. E.,
Pietenpol, J. A.,
Kinzler, K. W.,
and Vogelstein, B.
(1992)
Nat. Genet.
1,
45-49[CrossRef][Medline]
[Order article via Infotrieve]
18.
Funk, W. D.,
Pak, D. T.,
Karas, R. H.,
Wright, W. E.,
and Shay, J. W.
(1992)
Mol. Cell. Biol.
12,
2866-2871 19.
Halazonetis, T. D.,
Davis, L. J.,
and Kandil, A. N.
(1993)
EMBO J.
12,
1021-1028[Medline]
[Order article via Infotrieve]
20.
Friedman, P. N.,
Chen, X.,
Bargonetti, J.,
and Prives, C.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
3319-3323 21.
McLure, K. G.,
and Lee, P. W.
(1998)
EMBO J.
17,
3342-3350[CrossRef][Medline]
[Order article via Infotrieve]
22.
Stenger, J. E.,
Mayr, G. A.,
Mann, K.,
and Tegtmeyer, P.
(1992)
Mol. Carcinog.
5,
102-106[Medline]
[Order article via Infotrieve]
23.
Waterman, J. L.,
Shenk, J. L.,
and Halazonetis, T. D.
(1995)
EMBO J.
14,
512-519[Medline]
[Order article via Infotrieve]
24.
Buckbinder, L.,
Talbott, R.,
Velasco-Miguel, S.,
Takenaka, I.,
Faha, B.,
Seizinger, B. R.,
and Kley, N.
(1995)
Nature
377,
646-649[CrossRef][Medline]
[Order article via Infotrieve]
25.
el-Deiry, W. S.,
Tokino, T.,
Velculescu, V. E.,
Levy, D. B.,
Parsons, R.,
Trent, J. M.,
Lin, D.,
Mercer, W. E.,
Kinzler, K. W.,
and Vogelstein, B.
(1993)
Cell
75,
817-825[CrossRef][Medline]
[Order article via Infotrieve]
26.
el-Deiry, W. S.,
Tokino, T.,
Waldman, T.,
Oliner, J. D.,
Velculescu, V. E.,
Burrell, M.,
Hill, D. E.,
Healy, E.,
Rees, J. L.,
Hamilton, S. R.,
Kinzler, K. W.,
and Vogelstein, B.
(1995)
Cancer Res.
55,
2910-2919 27.
Hollander, M. C.,
Alamo, I.,
Jackman, J.,
Wang, M. G.,
McBride, O. W.,
and Fornace, A. J., Jr.
(1993)
J. Biol. Chem.
268,
24385-24393 28.
Macleod, K. F.,
Sherry, N.,
Hannon, G.,
Beach, D.,
Tokino, T.,
Kinzler, K.,
Vogelstein, B.,
and Jacks, T.
(1995)
Genes Dev.
9,
935-944 29.
Miyashita, T.,
and Reed, J. C.
(1995)
Cell
80,
293-299[CrossRef][Medline]
[Order article via Infotrieve]
30.
Perry, M. E.,
Piette, J.,
Zawadzki, J. A.,
Harvey, D.,
and Levine, A. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
11623-11627 31.
Zauberman, A.,
Lupo, A.,
and Oren, M.
(1995)
Oncogene
10,
2361-2366[Medline]
[Order article via Infotrieve]
32.
Haupt, Y.,
Maya, R.,
Kazaz, A.,
and Oren, M.
(1997)
Nature
387,
296-299[CrossRef][Medline]
[Order article via Infotrieve]
33.
Kubbutat, M. H.,
Jones, S. N.,
and Vousden, K. H.
(1997)
Nature
387,
299-303[CrossRef][Medline]
[Order article via Infotrieve]
34.
Shieh, S. Y.,
Ikeda, M.,
Taya, Y.,
and Prives, C.
(1997)
Cell
91,
325-334[CrossRef][Medline]
[Order article via Infotrieve]
35.
Tishler, R. B.,
Calderwood, S. K.,
Coleman, C. N.,
and Price, B. D.
(1993)
Cancer Res.
53 (suppl.),
2212-2216 36.
Di Como, C. J.,
and Prives, C.
(1998)
Oncogene
16,
2527-2539[CrossRef][Medline]
[Order article via Infotrieve]
37.
Flaman, J. M.,
Robert, V.,
Lenglet, S.,
Moreau, V.,
Iggo, R.,
and Frebourg, T.
(1998)
Oncogene
16,
1369-1372[CrossRef][Medline]
[Order article via Infotrieve]
38.
Friedlander, P.,
Haupt, Y.,
Prives, C.,
and Oren, M.
(1996)
Mol. Cell. Biol.
16,
4961-4971[Abstract]
39.
Ludwig, R. L.,
Bates, S.,
and Vousden, K. H.
(1996)
Mol. Cell. Biol.
16,
4952-4960[Abstract]
40.
Zhan, Q.,
Fan, S.,
Bae, I.,
Guillouf, C.,
Liebermann, D. A.,
O'Connor, P. M.,
and Fornace, A. J., Jr.
(1994)
Oncogene
9,
3743-3751[Medline]
[Order article via Infotrieve]
41.
Baker, S. J.,
Markowitz, S.,
Fearon, E. R.,
Willson, J. K.,
and Vogelstein, B.
(1990)
Science
249,
912-915 42.
Slingerland, J. M.,
Jenkins, J. R.,
and Benchimol, S.
(1993)
EMBO J.
12,
1029-1037[Medline]
[Order article via Infotrieve]
43.
Marston, N. J.,
Jenkins, J. R.,
and Vousden, K. H.
(1995)
Oncogene
10,
1709-1715[Medline]
[Order article via Infotrieve]
44.
Jost, C. A.,
Marin, M. C.,
and Kaelin, W. G., Jr.
(1997)
Nature
389,
191-194[CrossRef][Medline]
[Order article via Infotrieve]
45.
Datto, M. B., Yu, Y.,
and Wang, X. F.
(1995)
J. Biol. Chem.
270,
28623-28628 46.
Resnick-Silverman, L.,
St Clair, S.,
Maurer, M.,
Zhao, K.,
and Manfredi, J. J.
(1998)
Genes Dev.
12,
2102-2107 47.
Wang, Y.,
and Prives, C.
(1995)
Nature
376,
88-91[CrossRef][Medline]
[Order article via Infotrieve]
48.
Fuchs, B.,
Hecker, D.,
and Scheidtmann, K. H.
(1995)
Eur. J. Biochem.
228,
625-639[Medline]
[Order article via Infotrieve]
49.
Hecker, D.,
Page, G.,
Lohrum, M.,
Weiland, S.,
and Scheidtmann, K. H.
(1996)
Oncogene
12,
953-961[Medline]
[Order article via Infotrieve]
50.
Hupp, T. R.,
Meek, D. W.,
Midgley, C. A.,
and Lane, D. P.
(1992)
Cell
71,
875-886[CrossRef][Medline]
[Order article via Infotrieve]
51.
Gu, W.,
and Roeder, R. G.
(1997)
Cell
90,
595-606[CrossRef][Medline]
[Order article via Infotrieve]
52.
Luo, Y.,
Fujii, H.,
Gerster, T.,
and Roeder, R. G.
(1992)
Cell
71,
231-241[CrossRef][Medline]
[Order article via Infotrieve]
53.
Hao, M.,
Lowy, A. M.,
Kapoor, M.,
Deffie, A.,
Liu, G.,
and Lozano, G.
(1996)
J. Biol. Chem.
271,
29380-29385 54.
Lohrum, M.,
and Scheidtmann, K. H.
(1996)
Oncogene
13,
2527-2539[Medline]
[Order article via Infotrieve]
55.
Milne, D. M.,
Palmer, R. H.,
and Meek, D. W.
(1992)
Nucleic Acids Res.
20,
5565-5570 56.
Bargou, R. C.,
Daniel, P. T.,
Mapara, M. Y.,
Bommert, K.,
Wagener, C.,
Kallinich, B.,
Royer, H. D.,
and Dorken, B.
(1995)
Int. J. Cancer
60,
854-859[Medline]
[Order article via Infotrieve]
57.
Bargou, R. C.,
Wagener, C.,
Bommert, K.,
Mapara, M. Y.,
Daniel, P. T.,
Arnold, W.,
Dietel, M.,
Guski, H.,
Feller, A.,
Royer, H. D.,
and Dorken, B.
(1996)
J. Clin. Invest.
97,
2651-2659[Medline]
[Order article via Infotrieve]
58.
Krajewski, S.,
Blomqvist, C.,
Franssila, K.,
Krajewska, M.,
Wasenius, V. M.,
Niskanen, E.,
Nordling, S.,
and Reed, J. C.
(1995)
Cancer Res.
55,
4471-4478 59.
McCurrach, M. E.,
Connor, T. M.,
Knudson, C. M.,
Korsmeyer, S. J.,
and Lowe, S. W.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2345-2349 60.
Sakakura, C.,
Sweeney, E. A.,
Shirahama, T.,
Igarashi, Y.,
Hakomori, S.,
Nakatani, H.,
Tsujimoto, H.,
Imanishi, T.,
Ohgaki, M.,
Ohyama, T.,
Yamazaki, J.,
Hagiwara, A.,
Yamaguchi, T.,
Sawai, K.,
and Takahashi, T.
(1996)
Int. J. Cancer
67,
101-105[CrossRef][Medline]
[Order article via Infotrieve]
61.
Wagener, C.,
Bargou, R. C.,
Daniel, P. T.,
Bommert, K.,
Mapara, M. Y.,
Royer, H. D.,
and Dorken, B.
(1996)
Int J Cancer
67,
138-141[CrossRef][Medline]
[Order article via Infotrieve]
62.
Yin, X. M.,
Oltvai, Z. N.,
and Korsmeyer, S. J.
(1994)
Nature
369,
321-323[CrossRef][Medline]
[Order article via Infotrieve]
63.
Shu, H. K. G.,
Kim, M. M.,
Chen, P.,
Furman, F.,
Julin, C. M.,
and Israel, M. A.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
14453-14458 64.
Symonds, H.,
Krall, L.,
Remington, L.,
Saenz-Robles, M.,
Lowe, S.,
Jacks, T.,
and Van Dyke, T.
(1994)
Cell
78,
703-711[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  F. Zhang, W. Wang, Y. Tsuji, S. V. Torti, and F. M. Torti Post-transcriptional Modulation of Iron Homeostasis during p53-dependent Growth Arrest J. Biol. Chem., December 5, 2008; 283(49): 33911 - 33918. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wei, D. Liu, Y. Ge, F. Zhou, J. Xu, H. Chen, J. Gu, and J. Jiang Identification of E1AF as a Target Gene of E2F1-induced Apoptosis in Response to DNA Damage J. Biochem., October 1, 2008; 144(4): 539 - 546. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lokshin, Y. Li, C. Gaiddon, and C. Prives p53 and p73 display common and distinct requirements for sequence specific binding to DNA Nucleic Acids Res., January 12, 2007; 35(1): 340 - 352. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Van Bodegom, Z. Saifudeen, S. Dipp, S. Puri, B. S. Magenheimer, J. P. Calvet, and S. S. El-Dahr The Polycystic Kidney Disease-1 Gene Is a Target for p53-mediated Transcriptional Repression J. Biol. Chem., October 20, 2006; 281(42): 31234 - 31244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Lucas, J. Domenico, and E. W. Gelfand Cyclin-Dependent Kinase 6 Inhibits Proliferation of Human Mammary Epithelial Cells Mol. Cancer Res., February 1, 2004; 2(2): 105 - 114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Inga, F. Storici, T. A. Darden, and M. A. Resnick Differential Transactivation by the p53 Transcription Factor Is Highly Dependent on p53 Level and Promoter Target Sequence Mol. Cell. Biol., December 15, 2002; 22(24): 8612 - 8625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Perez-Sanchez, V. S. Budhram-Mahadeo, and D. S. Latchman Distinct promoter elements mediate the co-operative effect of Brn-3a and p53 on the p21 promoter and their antagonism on the Bax promoter Nucleic Acids Res., November 15, 2002; 30(22): 4872 - 4880. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Buzek, L. Latonen, S. Kurki, K. Peltonen, and M. Laiho Redox state of tumor suppressor p53 regulates its sequence-specific DNA binding in DNA-damaged cells by cysteine 277 Nucleic Acids Res., June 1, 2002; 30(11): 2340 - 2348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. CROCHEMORE, T. M. MICHAELIDIS, D. FISCHER, J.-P. LOEFFLER, and O. F. X. ALMEIDA Enhancement of p53 activity and inhibition of neural cell proliferation by glucocorticoid receptor activation FASEB J, June 1, 2002; 16(8): 761 - 770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Nicholls, K. G. McLure, M. A. Shields, and P. W. K. Lee Biogenesis of p53 Involves Cotranslational Dimerization of Monomers and Posttranslational Dimerization of Dimers. IMPLICATIONS ON THE DOMINANT NEGATIVE EFFECT J. Biol. Chem., April 5, 2002; 277(15): 12937 - 12945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Stros, T. Ozaki, A. Bacikova, H. Kageyama, and A. Nakagawara HMGB1 and HMGB2 Cell-specifically Down-regulate the p53- and p73-dependent Sequence-specific Transactivation from the Human Bax Gene Promoter J. Biol. Chem., February 22, 2002; 277(9): 7157 - 7164. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. D. Jeffy, R. B. Chirnomas, E. J. Chen, J. M. Gudas, and D. F. Romagnolo Activation of the Aromatic Hydrocarbon Receptor Pathway Is Not Sufficient for Transcriptional Repression of BRCA-1: Requirements for Metabolism of Benzo[a]pyrene to 7r,8t-Dihydroxy-9t,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene Cancer Res., January 1, 2002; 62(1): 113 - 121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Ogden, K. C. Lee, K. Wernke-Dollries, S. A. Stratton, B. Aronow, and M. C. Barton p53 Targets Chromatin Structure Alteration to Repress alpha -Fetoprotein Gene Expression J. Biol. Chem., November 2, 2001; 276(45): 42057 - 42062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. I. Pestina, J. L. Cleveland, C. Yang, G. P. Zambetti, and C. W. Jackson Mpl ligand prevents lethal myelosuppression by inhibiting p53-dependent apoptosis Blood, October 1, 2001; 98(7): 2084 - 2090. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. V. Blagosklonny, P. Giannakakou, L. Y. Romanova, K. M. Ryan, K. H. Vousden, and T. Fojo Inhibition of HIF-1- and wild-type p53-stimulated transcription by codon Arg175 p53 mutants with selective loss of functions Carcinogenesis, June 1, 2001; 22(6): 861 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. V. BLAGOSKLONNY p53 from complexity to simplicity: mutant p53 stabilization, gain-of-function, and dominant-negative effect FASEB J, October 1, 2000; 14(13): 1901 - 1907. [Abstract] [Full Text]
|
|
|
|
|
|
S. K. Ogden, K. C. Lee, and M. C. Barton Hepatitis B Viral Transactivator HBx Alleviates p53-mediated Repression of alpha -Fetoprotein Gene Expression J. Biol. Chem., September 1, 2000; 275(36): 27806 - 27814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Thornborrow and J. J. Manfredi The Tumor Suppressor Protein p53 Requires a Cofactor to Activate Transcriptionally the Human BAX Promoter J. Biol. Chem., May 4, 2001; 276(19): 15598 - 15608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kimura, Y. Mizukami, T. Miura, K. Fujimoto, S. Kobayashi, and M. Matsuzaki Orphan G Protein-coupled Receptor, GPR41, Induces Apoptosis via a p53/Bax Pathway during Ischemic Hypoxia and Reoxygenation J. Biol. Chem., July 6, 2001; 276(28): 26453 - 26460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. T. Warnick, B. Dabbas, C. D. Ford, and K. A. Strait Identification of a p53 Response Element in the Promoter Region of the hMSH2 Gene Required for Expression in A2780 Ovarian Cancer Cells J. Biol. Chem., July 13, 2001; 276(29): 27363 - 27370. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |