|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 48, 34327-34336, November 26, 1999
From the Department of Pediatrics, University of Pittsburgh School
of Medicine, Children's Hospital of Pittsburgh, Pittsburgh,
Pennsylvania 15213
The growth hormone (GH) receptor is essential for
the actions of growth hormone on postnatal growth and metabolism. GH
receptor transcripts are characterized by the presence of disparate
5'-untranslated exons. Factors regulating the expression of the GC rich
L2 transcript of the murine GH receptor gene have hitherto remained
unidentified. To characterize the mechanisms regulating expression of
the L2 transcript, primer extension and ribonuclease protection assays were used to identify transcription start sites in RNA from liver of
adult mice. Transient transfection experiments revealed that 2.0 kilobase pairs of the L2 5'-flanking sequence exhibited promoter activity in BNL CL.2 (mouse liver) cells, CV-1 (monkey kidney) cells,
and HRP.1 trophoblasts. Deletional analysis localized a major
regulatory region to within 75 base pairs of the 5' transcription start
site. Sequence analysis revealed that the region contained consensus
binding sites for the Sp family of transcription factors. Standard gel
shift and supershift analysis using liver nuclear extracts established
that Sp1 and Sp3 bound this regulatory element. Transfection of wild
type but not mutant decoy oligonucleotides into BNL CL.2 cells
decreased the activity of the L2 promoter. Overexpression of Sp1 and
Sp3 protein in Drosophila Schneider cells established that
Sp3 is more potent than Sp1 in transactivating the L2 promoter.
Co-transfection experiments further established that Sp1 antagonizes
the activity of Sp3 to transactivate the L2 promoter. Western blot
analysis of liver nuclear extracts revealed that the levels of Sp3
increase significantly after birth, suggesting a role for the Sp family
of transcription factors in controlling the fetal to postnatal increase
in GH receptor gene expression.
Pituitary GH1 is
essential for postnatal growth and regulation of metabolism of fat,
carbohydrate, and protein in animals. At the tissue level these
pleiotropic actions of GH result from the interaction of GH with the GH
receptor. Hence, regulating the expression of and modulating the
function of the GH receptor is critical for the action of GH in the
intact animal. The promoter-regulatory regions of the murine (1-4),
ovine (5, 6), bovine (7), and human (8) GH receptor genes have been
partially characterized. A feature that is common to the GH receptor
transcripts from these different species is the heterogeneity in the
5'-untranslated region (9). This heterogeneity in the 5'-UTR results
from splicing of the various exon 1 fragments to a common splice site
located 11 bp upstream of the initiating ATG. Whereas the number of
5'-untranslated exons varies among species, in all examples the
location of the splice site from the initiating ATG is constant. In the
human liver there are at least eight distinct 5'-UTRs (V1-V8), with the most common GH receptor variant being termed V1 (9). The identity
and distribution of the 5'-untranslated exons in other tissues of the
body, in which significant expression of GH receptor occurs and which
are targets of GH action, such as kidney and heart, are as yet unknown.
In the rat five distinct 5'-UTRs (GHR1-5) have been
identified (10, 11). The class of RNA containing the GHR1
5'-UTR variant is expressed only in liver, is far more abundant in
females than in males, and is specifically increased during pregnancy
(11). In the sheep two 5'-UTRs have been described (5, 6). Exon 1A is a
liver-specific transcript and is homologous to the human V1 transcript.
Another UTR termed exon 1B displays a striking GC content of 79%
and is homologous to the human V2, rat GHR2, and mouse L2. In the cow
three 5'-UTRs, termed 1A, 1B, and 1C, have been identified (7).
In the mouse two 5'-UTRs, termed L1 and L2, have been characterized
(4). Expression of the L1 and L2 transcripts is regulated in a tissue-
and development stage-specific manner. The L1-GH receptor transcript is
expressed in liver only during pregnancy (3, 12). Late pregnant mouse
liver and placenta both express GHR mRNAs containing L1 and L2
sequences (12). In the placenta L2-GHR UTRs are more abundant than
L1-GHR UTRs. Information regarding the specific factors regulating
expression of the different UTRs is at present limited to that for the
mouse L1 UTR. All identified proximal and distal regulatory elements
contain a core CCAAT sequence (4). An enhancer element located
approximately 3 kb upstream from the transcription start site of the L1
transcript interacts with the transcription factor CTF/NF-1 in COS-7
cells (2). The most distal cis-element identified to date in
the mouse promoter is located 3.6 kb 5' to the transcription start
site, and two CCAAT box-binding proteins, MSY-1 and NF-Y, regulate the
activity of the L1 promoter via interaction with this
cis-element (3). Furthermore, the intracellular distribution
of the MSY-1 protein in the liver suggests a role for this factor in
the pregnancy-specific expression of the GHR (3). In contrast to the L1
transcript, there is a paucity of information regarding the
cis-elements and trans-acting factors regulating
expression of the L2 transcript of the murine GH receptor gene.
The current report describes the identification and partial
characterization of the promoter-regulatory region of the L2 transcript of the murine GH receptor gene. In this report we present data that
define the location of the transcription start site, demonstrate promoter activity in the 5'-flanking region of the L2 transcript of the
murine GH receptor gene, establish that the Sp family of proteins
regulate expression of the L2 transcript, and provide evidence to
indicate that alterations in the levels of the Sp proteins play a role
in ontogenic profile of GH receptor gene expression in the liver.
Oligonucleotides--
The following synthetic
oligonucleotides were used in these experiments (residues altered
in the mutant oligonucleotide are indicated in lowercase type): L2-A,
TTTCACCCCGCCCCCTTCCTC; L2-A-m, CCCTTCCCAGTTTCACCaataaCCCTTCCTCCTCCCCAAGCC; L2-REV,
GTTTCGCCTCGGGAGACAGAA; L2F4, CTCCCTTCCCAGTTTCA; L2F5,
CTCCCCAAGCCTGACAA; Sp1, ATTCGATCGGGGCGGGGCGAGC; Sp1-m,
ATTCGATCGGttCGGGGCGAGC; GL5, CGCCGGGCCTTTCTTTATGTTTTTGGCGTCTTCCA; random, CCCATGTTAGAATCCCAGCTTATACCCGCAGGCACAACATT. Where
necessary double-stranded oligonucleotides were generated by
annealing of synthetic oligonucleotides with the respective
complimentary sequences.
Primer Extension Reaction--
Extension reaction was carried
out with 50 µg of adult mouse total RNA with synthetic
oligonucleotide complimentary to a portion of the L2 transcript of the
GH receptor mRNA. The 21-base oligonucleotide designated L2-REV
(see Fig. 2) is defined by complimentarity of its 5'-end beginning 36 nucleotides upstream from the translational start site of the GH
receptor mRNA (13). The primer was 32P end-labeled
using T4 polynucleotide kinase and hybridized with RNA in 10 mM PIPES (pH 7.4), 200 mM NaCl (pH 6.4), 1 mM dithiothreitol, and 1 mM dNTPs. The
extension reaction was initiated by the addition of 400 units of
Moloney murine leukemia virus reverse transcriptase (Superscript II,
Life Technologies, Inc.) and allowed to proceed for 120 min at
37 °C. After termination of the reaction, the reaction products were
size fractionated by denaturing gel electrophoresis. The sizes of the
extension products were determined both by including radiolabeled
HinfI digested Ribonuclease Protection Assay--
A 517-bp
XbaI-SmaI fragment containing the upstream region
of the L2 transcript was subcloned into the plasmid pBluescript II
SK+ (Stratagene) to create plasmid pSK/66b/0.6. Using
experimentally established sequence information from this clone,
polymerase chain reaction, and routine cloning strategies, the plasmid
pNoTA/T7/L2-mGHR14 was created that contained 115 bp of exon 2 fused to
605 bp of the genomic DNA upstream of the putative transcription start
site for the L2 UTR. Ribonuclease protection assay was carried out with
50 µg of total RNA and an antisense RNA probe generated by transcription of the EcoRI linearized plasmid
pNoTA/T7/L2-mGHR14 with T7 RNA polymerase in the presence of
[32P]UTP. The probe protects a 314-bp fragment that
corresponds to the L2 transcript and a 117-bp fragment corresponding to
a part of exon 2 of the GH receptor mRNA and is thus common to both
the L1 and L2 transcripts. Hybridization at 42 °C and RNase
digestion with RNase A/T1 mixture were performed according to the
manufacturer's instructions (Ambion). Following digestion with RNase,
the RNase-resistant products were size-fractionated on a denaturing
7.5% polyacrylamide gel and visualized by autoradiography and analyzed
using a PhosphorImager (Molecular Dynamics). For quantitation of
individual transcripts, the radioactivity of the individual band was
equalized for the number of uracil nucleotides in the transcript.
Electrophoretic Mobility Shift Assay--
Nuclear extracts from
mouse liver were prepared as described previously (14). Protease
inhibitors (leupeptin 2 µg/ml, pepstatin 1 µg/ml, and aprotinin
1%) were included in the buffers used to prepare the nuclear extracts.
Double-stranded DNA fragments used as probes were obtained by annealing
complementary custom synthesized single-stranded oligonucleotides. The
DNA was end-labeled with [ DNA Sequencing--
Sequencing was carried out by the
dideoxynucleotide chain termination method of Sanger et al.
(15) using either the Sequenase 2.0 kit (U. S. Biochemical Corp.) or
the Fmol sequencing kit (Promega). Sequencing primers either were
complementary to the canonical T3, T7, or SP6 sites flanking the
multiple cloning site of the vector or were complementary to
experimentally established sequences. The sequence data were managed
using the sequence analysis program MacVector5.0 (Oxford
Molecular Group, Inc.).
Reporter Gene Constructs--
Luciferase reporter gene
constructs were engineered to contain various portions of the GH
receptor 5'-flanking region. Construction of the reporter gene-GH
receptor 5'-flanking region hybrids were as follows: an approximately
2.0-kb sized SmaI fragment from the 66B lambda clone
(courtesy of Dr. Frank Talamantes, University of California at Santa
Cruz) containing the 5'-flanking region and extending 110 bp into the
L2 UTR was subcloned into the corresponding site in the polylinker of
pGL3-Basic (Promega) to create pGL3B-L2[ Transient Expression of Reporter Gene--
The culture media
used for tissue culture experiments were obtained from Life
Technologies, Inc. unless otherwise stated. BNL CL.2 cells (ATCC) were
maintained in Eagle's minimum essential medium (with nonessential
amino acids, sodium pyruvate, and Earle's balanced salt solution),
10% fetal calf serum, with penicillin G (100 units/ml) and
streptomycin (100 µg/ml). 0.25 × 106 cells were
plated on 35-mm plates 24 h prior to transfection. 3 µg of
plasmid DNA was transfected per plate using the LipofectAMINE method
(Life Technologies, Inc.). For the experiments involving decoy
oligonucleotides, 0.9 or 1.8 µg of relevant double-stranded oligonucleotides containing wild type or mutagenized Sp1-binding site
sequence were co-transfected with 1.0 µg of pGL3-L2[
Schneider Drosophila Line 2 (SL2) cells were grown in 10-cm
dishes in Schneider's medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum. The cells were allowed to grow to a confluency of 50-60% prior to commencement of transient transfection experiments. 31 µg of plasmid DNA was transfected per plate using the
calcium phosphate transfection method (Life Technologies, Inc.). To
investigate the role of Sp1 and Sp3 in regulating the activity of the
GH receptor promoter, 12 µg of the reporter plasmids containing the
GH receptor promoter fragments were co-transfected with varying amounts
(0.25-16 µg) of Sp1 (pAct-Sp1) and/or Sp3 (pPacUSp3) expression
plasmids. 3 µg of a plasmid RSV/ Western Blot Analysis--
15-µg aliquots of nuclear protein
from mouse liver were heated for 3 min at 90 °C in 62.5 mM Tris HCl, 10% (v/v) glycerol, 5% (v/v)
2-mercaptoethanol, 1.05% SDS, and 0.004% bromphenol blue. The protein
samples were then electrophoresed through a 4% stacking, 10%
resolving, discontinuous SDS-polyacrylamide gel in 25 mM
Tris HCl, 192 mM glycine, and 0.1% SDS buffer. High and
low molecular weight markers (Bio-Rad Laboratories) were also
concurrently electrophoresed. Following electrophoresis, the proteins
were transferred to nitrocellulose by electroblotting (Bio-Rad) in
transfer buffer (10 mM CAPS, 3 mM
dithiothreitol, 15% methanol, pH 10.5) for 1 h. The
nitrocellulose filters were then soaked overnight at 4 °C in 5%
nonfat dry milk, 1× PBS, and 0.1% Tween-20 and subsequently probed
with antibody against the specified protein using the ECL enhanced
chemiluminscence system (Amersham Pharmacia Biotech) according to the
manufacturer's instructions. Where indicated, blots were sequentially
probed for different proteins following removal of primary and
secondary antibodies from the membranes by incubation with 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl
(pH 6.7) for 30 min at 50 °C. The primary antibodies used were
anti-Sp3 (sc-644x, Santa Cruz Biotech) or anti-YY1 (sc-1703x, Santa
Cruz Biotech).
Identification of L2 Transcription Start Sites--
Primer
extension was performed using reverse transcriptase after end-labeled
antisense oligonucleotide (L2-REV) was hybridized to total cellular RNA
from nonpregnant mouse liver. The extension of L2-REV consistently
resulted in three specific bands: one major band measuring 195 nucleotides and two minor bands of 140 and 117 nucleotides in lengths
(Fig. 1A). To precisely
localize the transcription start sites in the 5'-untranslated region,
ribonuclease protection assays were performed. 32P-Labeled
antisense RNA, transcribed from the appropriate strand of
pNoTA/T7/L2-mGHR14, was hybridized to total cellular RNA from nonpregnant mouse liver and digested with RNase A and T1. The major
protected bands were approximately 118 and 311 nucleotides in length
(Fig. 1B). The shorter band corresponds to exon 2, and the
longer band corresponds to the major transcription start site mapped by
the primer extension experiment at 210 bp upstream of the initiating
ATG. Quantitation of the radioactivity in the bands revealed that in
the liver RNA from nonpregnant mouse (Fig. 1B, lane
C), the longer band representing L2 UTR containing GH receptor mRNA accounted for 56% of the total GH receptor RNA; the remaining 44% of the mRNA was in the shorter band representing non-L2 UTR containing GH receptor mRNA. In contrast in liver RNA from pregnant mouse approximately 98% of the mRNA was in the non-L2 band while 2% was in the L2 band.
Analysis of Promoter Activity of the 5'-Flanking Region of the L2
Transcript of the Murine GH Receptor Gene--
The sequence upstream
of the transcription start site is GC-rich (69% up to
The functional role of the 5'-flanking region in the regulation of
transcription of the GH receptor gene was assessed by its ability to
direct expression of the luciferase gene in a transient transfection
assay. A 2.0-kb fragment of the 5'-flanking region of the GH receptor
gene, containing 110 bp of exon 1, was inserted upstream of the
luciferase reporter gene contained in the promoterless expression
vector (pGL3-basic). This fusion construct (pGL3B-L2[
To localize putative cis-acting elements regulating
transcription of the GH receptor gene, we engineered progressively
shorter fragments of GH receptor 5'-DNA (Fig. 3A), and the
expression of these deletion mutants was examined in BNL CL.2 cells by
transient transfection assays. Whereas deletion of approximately 1925 bp did not result in a significant alteration in the expression of the
reporter gene, deletion of the next 32 bp resulted in complete abrogation of promoter activity. These results indicate that the sequence between
To examine potential cell type specificity of the GH receptor for the
L2 transcript, the activities of the various reporter gene constructs
were assayed in CV-1 (monkey kidney) (Fig. 3B) and HRP.1
(trophoblast) (data not shown). The expression profile of these various
constructs was similar to that observed in BNL CL.2 cells with the Protein Binding Activity of the Putative Basal Regulatory
Element--
The loss of expression consequent on deletion of the
32-bp region located between
The Sp1 gene family includes at least four distinct but closely related
transcription factors, Sp1-Sp4. To establish the precise identity of
the protein(s) binding to L2-A, we performed supershift assays with
antibodies specific for different Sp proteins. The addition of
antibodies specific for Sp3 in an EMSA reaction with 32P-labeled L2-A and mouse liver nuclear extracts retarded
the mobility of C1 and C2 complexes (Fig.
7). In parallel experiments addition of
antibody specific for Sp1 also resulted in supershift of C1 and C2
complexes, although the amount of the protein-DNA complex supershifted
was significantly less than with the Sp3 antibody (Fig. 7,
inset). In contrast, antibodies against Sp2 and Sp4 did not
alter the mobility of C1 and C2 protein-DNA complexes, and none of the
Sp antibodies altered the mobility of the C3 complex. These results
indicate the presence of Sp3, and to a lesser extent Sp1, in the C1 and
C2 protein-DNA complexes formed with mouse liver nuclear proteins and
the L2-A sequence.
Sp1 and Sp3 Regulate Activity of the L2 Promoter--
Having
established that Sp1 and Sp3 bind the L2-A element, we next determined
the role of these proteins in regulating the activity of the L2
promoter. Mutation of the Sp1-binding site within the L2-A element
resulted in loss of activity in transient transfection assays (Fig. 3),
indicating the functional significance of the binding of the Sp factors
to the L2-A element. The high levels of endogenous Sp1 expression in
most cell types generally invalidates the conventional strategy of
overexpressing proteins to test their role in regulating the activity
of a particular promoter element. Hence, we adopted the alternate
strategy of using Drosophila Schneider cells (SL2) that have
been previously demonstrated to be devoid of Sp1 and Sp3 proteins. In
the native SL2 cells, pGL3B-L2[
Although the high levels of endogenous Sp1 protein did not allow us to
test the effect of overexpression of Sp proteins on the activity of the
L2-A promoter, we performed experiments designed to decrease the levels
of endogenous Sp proteins in BNL CL.2 cells and studied the effect of
this manipulation on the activity of the L2 promoter. We achieved this
goal by employing the decoy nucleotide strategy. In this approach high
concentrations of a double-stranded oligonucleotide encoding the
recognition motif for the transcription factor of interest is
cotransfected into the cell with the reporter constructs. This decoy
oligonucleotide will compete with the DNA-binding site in the promoter
element being tested and could thus result in a decrease in the protein available to bind to the promoter element. This approach of decreasing the functional levels of an endogenous protein has been previously used
to study the functional role of Sp1 (17) and other transcription factors such as c-myc and cdc2 (18). As shown in
Fig. 9, cotransfection of double-stranded
oligonucleotides with the wild type L2-A sequence or a consensus
Sp1-binding site resulted in a decrease in the activity of the
pGL3B-L2[ Functional Interaction between Sp1 and Sp3--
Previous reports
have documented that Sp1 and Sp3 can interact with each other to either
synergize or antagonize each other's activity at any given DNA-binding
site (19-22). Upon demonstrating that both Sp1 and Sp3 bind to and
alter the activity of the L2-A element in the 5'-flanking region of the
murine GH receptor gene, we next determined whether there is a
functional interaction between Sp1 and Sp3 at the L2-A site. For this
purpose varying amounts of Sp1 and a fixed amount of Sp3 were
cotransfected into SL2 cells, and the activity of the pGL3B-L2[ Levels of Sp3 Increase in the Liver Postnatally--
The
expression of the L2 transcript of the murine GH receptor gene
increases significantly after birth. To investigate whether changes in
the levels of Sp3 play a role in this ontogenic profile of GH receptor
expression, we compared the levels of Sp3 expression in livers of fetal
and adult mice by Western blot and EMSA. As shown in Fig.
11, Western blot analysis of liver
nuclear extracts from adult mouse revealed three specific bands that
correspond to the previously described isoforms of Sp3 (23). In
contrast to the adult liver nuclear extracts, the levels of Sp3 protein were distinctly less in the fetal liver nuclear extracts. The decrease
in levels of Sp3 in the fetal liver was specific and not an artifact of
the nuclear extract preparation, because in the same fetal nuclear
extract preparation the concentration of the ubiquitously expressed
nuclear protein YY1 was not similarly altered. These results were also
confirmed by supershift EMSA with labeled L2-A probe in which the
binding of Sp1 but not that of Sp3 could be detected in fetal liver
nuclear extracts. It should be noted, however, that the Sp1 antibody
failed to alter the electrophoretic mobility of a significant portion
of the protein-DNA complex. This result could represent the binding of
other GC box-binding factors and the role(s) of these yet to be
identified protein(s) is unclear at the present time. Nonetheless, this
profile of binding of Sp factors to the L2-A element is in contrast to
those obtained with adult liver nuclear extracts wherein binding of Sp3
to the L2-A element was much more abundant than the binding of Sp1
protein. We conclude from these results that the levels of Sp3 increase in the liver after birth.
Heterogeneity in the 5'-untranslated regions of the GH receptor
transcripts is a feature common to the GH receptor gene from different
species (9). In the mouse two transcripts termed L1 and L2 have been
identified. We have previously reported on the factors regulating
expression of the L1 transcript of the GH receptor gene (1-3, 14). The
current study was undertaken to identify and characterize
cis-elements and cognate trans-acting factors
that regulate expression of the L2 transcript of the murine GH receptor
gene. In this report we define the location of the transcription start
site, demonstrate that the 5'-flanking region of the L2 transcript of
the murine GH receptor gene exhibits promoter activity, identify the
minimal promoter, establish that the Sp family of proteins regulate
expression of the L2 transcript, and provide evidence to indicate that
alterations in the levels of the Sp proteins play a role in ontogenic
profile of GH receptor gene expression in the liver.
Our results using ribonuclease protection assay with a probe specific
for the L2 UTR indicate that approximately 50% of the GH receptor
mRNA in the mouse liver contains L2. The remaining 50% contains
non-L2 mRNA and in conjunction with the prior observation that L1
is not expressed in nonpregnant liver (3) predicts the presence of
hitherto unidentified UTRs. These results are in agreement with
5'-rapid amplification of cDNA ends analysis of liver cDNA,
wherein sequencing of 31 clones indicated that 24/31 (77%) of the
clones contained the L2 transcript (data not shown). The rest of the
clones contained other UTRs that have yet to be characterized. The
identification of putative novel UTRs for the murine GH receptor gene
has also been previously described in a preliminary report (24).
In contrast to the L1 transcript that is not GC-rich and has a TATA box
(14), the L2 transcript is GC-rich and is devoid of a TATA box. In
general, GC-rich promoters are usually considered to be a target for
regulation by zinc finger transcription factors. Thus TATA-less
promoters have been shown to be particularly sensitive to regulation by
the Sp family of proteins. Sp1, originally identified as a cellular
transcription factor necessary for SV40 gene expression, is an
ubiquitous nuclear protein that activates the transcription of a wide
variety of viral and cellular genes (25). Further work has expanded our
understanding of this protein by revealing the existence of a family of
zinc-finger (His2-Cys2) transcription factors
which includes Sp1, Sp2, Sp3, Sp4, and two distantly related proteins
termed BTEB and BTEB2 (25). Analysis of the DNA binding activities
indicate that Sp3, Sp4, BTEB, and BTEB2 proteins recognize DNA motifs
with specificity and affinity that are very similar to those of Sp1. In
contrast, Sp2 binds GC boxes with significantly lower affinity than the
other members of the Sp family do. It is postulated that the property
of Sp1 to make strong contacts with individual components of the basal
transcriptional machinery and the apparent independence of Sp1 from
requiring the classic TATA-binding protein TBP to activate
transcription make it uniquely suited to activate the TATA-less
promoters by bypassing selective steps in assembly of the core
transcription machinery. This predilection of Sp family of
transcription factors to regulate GC-rich promoters is also evident in
the case of the L2 transcript of the GH receptor gene. Hence results of
the deletional analysis indicated that the sequence between In EMSA, three specific protein-DNA complexes were formed with L2-A
probe and liver nuclear extracts. Whereas we were able to determine
that Sp3 and Sp1 proteins were present in the two slower migrating
complexes, the identity of the proteins in the protein-DNA complex with
the fastest electrophoretic mobility (C3) remains unknown. The results
of the competition experiments with Sp consensus sequence
oligonucleotides suggests that the DNA binding specificity of this
protein(s) is similar to that of the Sp family of proteins. BTEB
(basic transcription
element-binding) protein is a protein of
smaller size than Sp1 with DNA binding specificity similar to that of
Sp1. Thus, BTEB or a related protein could represent the protein
forming the C3 complex with the L2-A element. The precise role of the
proteins involved in the formation of this protein complex will have to
await the identification of this protein(s).
In general, Sp1 and Sp4 function as transcriptional activators. In
contrast, Sp3 is a bifunctional protein with independent domains that
can both activate and repress transcription with the predominant Sp3
function being dependent upon both the promoter and the cellular milieu
(26). The activation potential of Sp3 is distributed over two
glutamine-rich N-terminal regions. Both glutamine-rich domains of Sp3
can stimulate transcription as efficiently as the corresponding Sp1
glutamate domains. Thus both Sp1 and Sp3 proteins have an N terminus
glutamine-rich region that functions as a transferable activation
domain. The Sp3 transactivation repressor domain has been mapped to a
small amino acid region adjacent to the zinc finger domain (26, 27). In
addition it has been demonstrated that the Sp3 gene encodes at least
three proteins by different transcription initiations. Studies have
revealed that the three variants of molecular sizes 115, 80, and 78 kDa
are abundantly expressed in a broad range of tissues, and these
variants could also play a role in enabling Sp3 to assume the dual
function of activator/repressor of transcription (23). Our results
indicate that both Sp1 and Sp3 act as transactivators of the L2
promoter of the GH receptor gene. However there is differential
sensitivity of the L2 promoter to these two proteins with Sp3 being a
potent activator and Sp1 a weak activator. Sp1 and Sp3 proteins have been shown previously to directly interact with each other to modify
the transactivational potential of each individual protein with Sp3
antagonizing the transactivation potential of Sp1 (19-22). Our results
indicate that Sp1 antagonizes the ability of Sp3 to transactivate the
L2 promoter. In addition to competition for DNA binding, steric
hindrance, squelching, quenching, and direct repression are putative
mechanisms that could explain the negative effect of transcription
factors on gene expression. Because Sp1 is an activator, albeit a weak
activator, of L2 promoter expression in SL2 cells, direct repression is
an unlikely mechanism to explain the effect of Sp1 on Sp3 activation of
the L2 promoter. We propose that consistent with prior reports of
effects of Sp1 and Sp3 on the ornithine decarboxylase (21), uteroglobin
(20), HIV-1 (28), and c-myc (29) promoters, the Sp1
repression of Sp3 activation of the L2 promoter is mediated by
competition for DNA binding at the L2-A site of the L2 minimal
promoter. However, our data do not exclude the possibility of
squelching or steric hindrance playing a role in this interaction
between Sp1 and Sp3 proteins. The Sp proteins are subject to
post-translational protein modifications including phosphorylation and
glycosylation (25). The role of post-translational modifications in
regulating the actions of Sp proteins on the GH receptor L2 promoter is
not clear. Phosphorylation is unlikely to play a major role in
modifying the ability of Sp factors to bind to the L2-A element because inhibition of phosphatase activity by okadaic acid did not alter the
DNA binding activity of the L2-A element (data not shown).
GH receptor gene expression displays a distinct ontogenic pattern with
expression being minimal in the fetus and increasing significantly
after birth (4). The paucity of GH receptor during fetal life
correlates with the observation in humans that intrauterine growth is,
for the most part, GH-independent (30). The molecular mechanisms
controlling this development-specific expression of the GH receptor
remain obscure. A previous report from our laboratory had identified a
developmentally regulated enhancer element in the promoter-regulatory
region of the L1 transcript of the murine GH receptor gene (14).
However, because it is now known that the predominant expression of L1
occurs only during pregnancy (3, 12), it is unlikely that this enhancer
element and its cognate trans-acting factors (3) plays a
significant role in the fetal to postnatal transition of expression of
the GH receptor gene. Our data from the ribonuclease protection assays
indicate that approximately 60% of the transcripts in the adult mouse
liver contain the L2 UTR. This observation argues for factors
regulating the expression of the L2 transcript to be playing a
significant role in the regulating the post-natal increase in
expression of the GH receptor gene. Our results indicate that the L2
promoter of the GH receptor gene is activated by Sp3 and that levels of Sp3 in the liver increase significantly after birth. Hence these results would be compatible with a model wherein Sp3 regulates the
fetal-postnatal increase of expression of the GH receptor gene (Fig.
12). Additionally, our studies suggest
an indirect role for Sp1 in facilitating the fetal to postnatal
transition of GH receptor gene expression. It is known that levels of
Sp1 are elevated in fetal liver compared with the adult liver (31).
Whereas by itself Sp1 is a weak activator of the L2 promoter, our
results indicate that Sp1 interacts with Sp3 to antagonize the
transactivational potential of Sp3 on the L2 promoter. Hence the
pattern of increasing Sp3 and declining Sp1 concentrations during the
transition from fetal to postnatal life supports a role for these
proteins in conjointly regulating the fetal to postnatal increase in GH
receptor gene expression (Fig. 12).
In summary, this report identifies and partially characterizes the
promoter-regulatory region controlling expression of the L2 transcript
of the murine GH receptor gene. Our studies establish that the
5'-flanking region of the L2 transcript of the murine GH receptor gene
exhibits promoter activity and delineate the extent of the minimal
promoter necessary for transcription of the L2 UTR containing GH
receptor transcripts. We identify and characterize a regulatory element
in the minimal L2 promoter that interacts with the Sp family of
proteins. A role for the Sp family of proteins in the ontogenic profile
of GH receptor gene expression in the liver is suggested by the
interaction of Sp1 and Sp3 proteins at the L2 promoter and the profile
of expression of Sp1 and Sp3 proteins in fetal and adult liver.
We gratefully acknowledge the support and
encouragement provided by Dr. Mark A. Sperling. The generosity of Drs.
F. Talamantes (lambda clone 66B), E. Seto (pAct-Sp1), and G. Suske
(pPacUSp3) in providing the respective reagents is gratefully acknowledged.
*
This work was supported by National Institutes of Health
Grants R29-DK49845 and 5T32DK07729 and by funds from the Genentech Foundation for Growth and Development, Children's Hospital of Pittsburgh, and the Vira I. Heinz Endowment.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Div. of Endocrinology,
Dept. of Pediatrics, Children's Hospital of Pittsburgh, 3705 Fifth
Ave., Pittsburgh, PA 15213. Tel.: 412-692-5806; Fax: 412-692-6449;
E-mail: menonr@chplink.chp.edu.
The abbreviations used are:
GH, growth hormone;
GHR, GH receptor;
kb, kilobase pair(s);
bp, base pair(s);
CAPS, 3-(cyclohexylamino)propanesulfonic acid;
EMSA, electrophoretic mobility
shift assay;
PIPES, 1,4, piperazine-diethanesulfonic acid;
UTR, untranslated region;
RSV, Rous sarcoma virus.
Role of the Sp Family of Transcription Factors in the Ontogeny of
Growth Hormone Receptor Gene Expression*
,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
X174 DNA on the gel and by concurrently electrophoresing a sequencing reaction. To confirm the transcription start site of the reporter constructs, primer extension experiments were carried out with total RNA isolated from transfected cells and a
primer (GL5) complimentary to the sequence of the pGL3-Basic vector (Promega).
-32P]ATP and T4
polynucleotide kinase. Approximately 30 fmol of DNA was added to 1 µg
of nuclear extract or 1 footprint unit of recombinant Sp1 protein
(Santa Cruz Biotech) in a final volume of 20 µl containing 1 µg of
poly(dI-dC), 20 mM Tris-HCl (pH 8.0), 50 mM
NaCl, bovine serum albumin (50 µg/ml), 1% Nonidet P-40, 1 mM EDTA, 10% glycerol, and 1 mM
dithiothreitol. Following incubation at room temperature for 30 min,
DNA-protein complexes were resolved by electrophoresis at room
temperature through an 8% nondenaturing polyacrylamide gel
(acrylamide/bisacrylamide 80:1) with 90 mM Tris borate (pH 8.5), 2 mM EDTA buffer. The gels were dried and subjected
to autoradiography with intensifying screens (NEN Life Science
Products) at 
80 °C. Competition experiments included the addition
of excess unlabeled DNA fragments to the reaction mix. In some
experiments nuclear extracts were incubated with the indicated amounts
of polyclonal antibodies against Sp1 (sc-59x), Sp2 (sc-643x), Sp3
(sc-644x), or Sp4 (sc-645x) (Santa Cruz Biotech), for 30 min at room
temperature before addition to the binding reactions.
2.0]. Digestion of
pGL3B-L2[2.0] with SacI or NheI followed by
religation resulted in the creation of pGL3B-L2[0.7] and
pGL3B-L2[210], respectively. pGL3B-L2[75] and pGL3B-L2[43]
were engineered by using polymerase chain reaction; the 5'-ends of
these constructs were defined by the oligonucleotides L2F4 and L2F5,
respectively. pGL3B-L2[75 m] was created by incorporating the
mutation defined in the oligonucleotide L2-A-m into pGL2B-L2[75]
using QuikChange (Stratagene). All constructs were sequenced through
the vector-insert junctions to ensure nucleotide fidelity and verify directionality.
75]. After
6 h of incubation, the cells were washed with phosphate-buffered saline and then supplemented with medium for 40 h prior to harvest for luciferase assay. For estimation of luciferase activity the plates
were rinsed twice with phosphate-buffered saline, and the cells were
harvested by the addition of 200 µl of lysis buffer (Dual Luciferase
Assay System; Promega). Following a brief freeze-thaw cycle the
insoluble debris was removed by centrifugation at 4 °C for 2-3 min
at 12,000 × g. 20-µl aliquots of the supernatant were then immediately processed for sequential quantitation of both
firefly and Renilla luciferase activity (Dual Luciferase Assay System; Promega) using a Monolight 2010 Luminometer (Analytical Luminescence). All transfections were performed in duplicate. Transfection efficiency was monitored by co-transfection of 0.2 µg of
either the plasmid pRL-TK (Promega) expressing the Renilla luciferase (deletional analysis) or plasmid RSV/
-gal in which -galactosidase expression is directed by the Rous sarcoma viral promoter (decoy experiments). The results of the luciferase assay are
expressed in relative light units equalized for transfection efficiency. Protein concentration of the supernatant was determined using the Bradford protein assay (Bio-Rad). Statistical differences between groups were determined by analysis of variance. p
values equal to or less than 0.05 were considered significant.
-gal was included in each
transfection mixture to enable monitoring of transfection efficiency.
The cells were exposed to the DNA precipitate for 48 h prior to
being harvested and processed for chemiluminescent assays for
measurement of luciferase (Promega) and -galactosidase activity
(CLONTECH).
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (21K):
[in a new window]
Fig. 1.
Identification of transcription initiation
start sites of the L2 transcript of the GH receptor gene utilized in
liver. A, primer extension. Autoradiograph of the
size-fractionated products of a primer extension reaction carried out
with 50 µg of total adult mouse liver RNA (lane A) or tRNA
(lane B) as described under "Experimental Procedures."
The sizes of the major specific product (indicated by arrow)
and the minor specific products (indicated by asterisks)
were determined by concurrently electrophoresed 32P-labeled
X174 HinfI DNA markers (lane M) and sequencing
reactions (not shown). B, ribonuclease nuclease protection
assay. Autoradiograph of the RNase-resistant products from analysis of
50 µg of mouse liver total RNA from nonpregnant (lane C)
and pregnant mouse (lane D) is as described under
"Experimental Procedures." As a control the native antisense probe
was hybridized to 40 µg of yeast tRNA and electrophoresed after
digestion without (lane A) or with (lane B) RNase
treatment. The sizes of the specific products were determined by
concurrently electrophoresed 32P- labeled X174 HinfI DNA markers (lane M).
The antisense RNA probe used in the ribonuclease protection assay was
transcribed using T7 polymerase (position and direction of
transcription indicated by arrow). The extent of the RNA
probe protected by the L2 UTR and a portion of exon 2 of the GH
receptor mRNA is shown.
213 bp from
transcription start site). Comparison with the transcription factor
data base TRANSFAC (16) failed to reveal consensus sequences for either
a TATA or CCAAT box in the immediate upstream region from the
transcription start sites (Fig.
2).
View larger version (35K):
[in a new window]
Fig. 2.
Nucleotide sequence in the vicinity of the
transcription start sites for the L2 transcript of the murine GH
receptor gene. Numbering was arbitrarily established with the
major transcription start site designated as +1 and indicated by a
box; minor transcription start sites are indicated by
stars. Primers used for primer extension (L2-REV), EMSA
(L2-A) and polymerase chain reaction cloning (L2F4 and L2F5)
experiments are indicated. Putative binding site for Sp family of
transcription factors is demarcated. Intron sequences are in
lowercase letters.
2.0]) exhibited significant luciferase activity when transiently transfected into BNL CL.2 mouse liver cells (Fig.
3A). In multiple transfection experiments, the relative expression of luciferase using
pGL3B-L2[2.0] was consistently about 6-9-fold greater than the
background measured with the promoterless vector and approximately
equal to that observed with the positive control that contains the
cytomegalovirus promoter. Primer extension experiments with RNA
isolated from the transfected cells indicated that the transcription
start site utilized by the L2 promoter plasmids corresponded to the
major start site identified in RNA extracted from whole liver tissue
(Fig. 4). Hence, we conclude that the
5'-flanking region of the L2 transcript of the murine GH receptor gene
has promoter activity and that expression of the reporter gene was
initiated at a site identical to that used by the GH receptor gene in
liver tissue.
View larger version (32K):
[in a new window]
Fig. 3.
Transient expression analyses of the
promoter-regulatory region of L2 transcript of the murine GH receptor
gene. Luciferase expression plasmids were generated by inserting
the GH receptor transcription start sites and various portions of the
5'-flanking sequence of the L2 transcript of the GH receptor gene in to
the promoterless luciferase plasmid pGL3-Basic. These expression
plasmids were transfected into BNL CL.2 (mouse liver) cells
(A) or CV-1 (African green monkey kidney) cells
(B) as described under "Experimental Procedures."
Luciferase-specific activity in cell homogenates, equalized for
transfection efficiency monitored by co-transfection of a plasmid
expressing Renilla luciferase (pRL-TK; Promega), is
expressed as relative to that of the pGL3-Basic. To compare the
activity of the GH receptor promoter-luciferase constructs with that of
a canonical promoter-regulatory element, the activity of a control
plasmid (pGL2-Control; Promega) that contains a SV40 promoter and
enhancer sequences was also measured in these cells. Results represent
the means ± S.E. of 3-4 independent transfections performed in
duplicate. Arrows indicate orientation of the GH receptor
DNA relative to direction of GH receptor gene transcription. Using
analysis of variance, 
, p < 0.05 compared with
pGL3-Basic; #, p < 0.05 compared with
pGL3B-L2[0.7].
View larger version (37K):
[in a new window]
Fig. 4.
Determination of transcription initiation
site usage in luciferase expression plasmids. Autoradiograph of
the size-fractionated products of a primer extension reaction carried
out with primer (GL5) complimentary to the sequence of the pGL3-Basic
vector (Promega) and 40 µg of total RNA from BNL CL.2 cells
transfected with either pGL3-Basic (lane A) or
pGL3B-L2[ 75] (lane B) as described under "Experimental
Procedures." The size of the specific product (indicated by
arrow) was determined by concurrently electrophoresed
32P-labeled X174 HinfI DNA markers and
sequencing reactions (not shown).
75 bp and 43 bp upstream of the transcription start site is essential for basal activity of the GH receptor gene.
75
to 43-bp region being necessary for basal activity. However, in CV-1
cells there was also a significant increase in activity from 0.7 kb to
210 bp, indicating the presence of a putative inhibitory regulatory
element in this region. These results indicate that the basal promoter
regulating expression of the L2 transcript of the GH receptor is active
in a wide variety of tissues, a finding consistent with the widespread
expression of the L2 transcript in mouse tissues (12). Furthermore, the results with the CV-1 cells suggest that distal promoter elements present upstream in the 5'-flanking region of the L2 UTR may play a
role in the tissue-specific regulation of expression of the L2 GH
receptor transcript.
75 and 43 bp upstream of the
transcription start site suggested the presence of basal regulatory
element(s) within this region. Computer analysis of the sequence of
this 32-bp region indicated the presence of a canonical Sp1-binding site within this region (Fig. 2). An oligonucleotide (L2-A) was designed that encompassed the putative Sp1-binding site, and its protein binding activity was tested by EMSA. Addition of nuclear extract from female mouse liver to an aliquot of
32P-labeled L2-A resulted in the formation of three
protein-DNA complexes we termed C1, C2, and C3 (Fig.
5). To determine the sequence specificity
of these protein-DNA complexes, competition experiments were performed.
Whereas a 50-fold molar excess of unlabeled L2-A eliminated the
formation of all three DNA-protein complexes, an oligonucleotide with
random sequence did not affect the binding even at a 100-fold molar
excess. Thus, these results demonstrate that these protein-DNA
complexes are sequence-specific. To determine the identity of the
proteins(s) binding to this putative regulatory element, we performed
competition experiments with an oligonucleotide (Sp1, Santa Cruz
Biotech) containing a consensus binding site for the Sp family of
proteins. Although the addition of molar excess of an oligonucleotide
with consensus binding site for Sp1 abrogated the formation of all
three protein-DNA complexes, addition of an oligonucleotide with point
mutations in the Sp1-binding site (Sp1-m, Santa Cruz Biotech) failed to
abrogate the formation of the three protein-DNA complexes (Fig.
6). We next tested the ability of the
L2-A sequence to bind recombinant Sp1 protein. EMSA experiments wherein
32P-labeled L2-A was incubated with recombinant Sp1 prior
to electrophoresis revealed that the L2-A sequence was able to bind Sp1
protein (Fig. 6, lane 5). In cross-competition experiments,
unlabeled L2-A was able to abrogate the binding of recombinant Sp1
protein to both 32P-labeled L2-A and to the
32P-labeled oligonucleotide containing the consensus Sp1
binding sequence (data not shown). These results indicate that the
protein(s) binding to L2A has DNA binding characteristics similar to
those of the Sp1 family of proteins.
View larger version (52K):
[in a new window]
Fig. 5.
Nuclear proteins from mouse liver bind to a
putative Sp-binding site in the promoter of the L2 transcript of the
murine GH receptor gene. 32P-Labeled L2-A was
incubated with nuclear extracts prepared from liver of adult female
mice, electrophoresed, and subjected to autoradiography as described
under "Experimental Procedures." Competition between
32P-labeled L2-A and unlabeled specific (L2-A, lanes
2-4), Sp1 consensus (lanes 5-7), or random sequence
(lanes 8 and 9) oligonucleotides at molar excess
of 10 (lanes 2 and 5), 50 (lanes 3,
6, and 8), or 100 (lanes 4,
7, and 9) is shown. The bands
representing specific DNA-protein complexes (C1,
C2, and C3) and the unbound
32P-labeled L2-A (Free Probe) are
indicated.
View larger version (49K):
[in a new window]
Fig. 6.
Binding of purified Sp1 protein to the
putative Sp-binding site in the promoter of the L2 transcript of the
murine GH receptor gene. 32P-Labeled Sp1 consensus
oligonucleotide (lanes 1-3) or L2-A oligonucleotide
(lanes 4-10) were incubated in the absence of (lanes
1 and 4) or presence of purified Sp1 protein
(lanes 2 and 5) or adult mouse liver nuclear
extracts (lanes 3 and 6-10), electrophoresed,
and subjected to autoradiography as described under "Experimental
Procedures." Competition between 32P-labeled L2-A and
unlabeled Sp1 consensus (lanes 7 and 8) or
Sp1-mutant (lanes 9 and 10) oligonucleotides at
molar excess of 50 (lanes 7 and 9) or 100 (lanes 8 and 10) is shown. The bands
representing specific DNA-protein complexes (C1,
C2, and C3) and the unbound
32P-labeled probe (Free Probe) are indicated.
Inset, underexposed autoradiograph of lanes 2-5
showing formation of DNA-protein complex (×) between purified Sp1
protein and 32P-labeled Sp1 consensus (lane 2)
or 32P-labeled L2-A (lane 5)
oligonucleotide.
View larger version (39K):
[in a new window]
Fig. 7.
Sp3 and Sp1 bind to L2-A.
32P-Labeled L2-A was incubated with nuclear extracts from
adult mouse liver in the presence (lanes 2-5) or absence
(lane 1) of antibodies against the Sp family of
transcription factors, electrophoresed, and subjected to
autoradiography as described under "Experimental Procedures." The
antibodies included in the incubation mix were anti- Sp1 (lane
2), anti-Sp2 (lane 3), anti-Sp3 (lane 4), or
anti-Sp4 (lane 5). The bands representing
specific DNA-protein complexes (C1, C2, and
C3) and the supershifted complex (SS) are
indicated. Inset, overexposed autoradiograph of lanes
1-3 demonstrating supershift of protein-DNA complex with
inclusion of anti-Sp1 antibody in the incubation mix.
75] did not exhibit significant
activity when compared with the pGL3/basic vector alone. However
overexpression of Sp3 in these cells resulted in significant increase
in the activity of pGL3B-L2[75] (Fig.
8A). This increase in activity was proportional to the amount of Sp3 transfected into the SL2 cells
with the maximal 26-30-fold induction being achieved with 1 µg of
Sp3 expression plasmid. In contrast the pGL3B-L2[43] construct
failed to exhibit Sp3-dependent induction of activity in
these cells (data not shown). These results indicate that Sp3 can
regulate the activity of the L2 UTR of the GH receptor gene and that
this effect is dependent on the region between 75 and 43 bp
upstream of the transcription start site. We next tested the effect of
overexpression of Sp1 protein on the activity of the GH receptor
promoter in the SL2 cells. In comparison with the results with Sp3
overexpression, induction by Sp1 was significantly less, with the
maximal induction of 2-3-fold achieved with 16 µg of Sp1 plasmid DNA
(Fig. 8B). These results indicate that although Sp1 is able
to regulate the activity of the GH receptor promoter it is much less
potent that Sp3 in its ability to activate this promoter.
View larger version (25K):
[in a new window]
Fig. 8.
Overexpression of Sp1 and Sp3 transactivate
GH receptor L2 promoter-luciferase reporter construct in
Drosophila Schneider cells. 12 µg of
pGL3B-L2[ 75] and the indicated amounts of either pPacUSp3
(A) or pAct-Sp1 (B) were cotransfected in to
Drosophila Schneider cells, and luciferase activity was
measured as described under "Experimental Procedures."
Luciferase-specific activity in cell homogenates, equalized for
transfection efficiency monitored by co-transfection of a plasmid
expressing -galactosidase (RSV/-gal, 3 µg), is expressed as
relative to that of pGL3-L2[75] in the absence of either pPacUSp3
(A) or pAct-Sp1 (B). Results represent the
means ± S.E. of 3-4 independent transfections.
75] construct. This effect was proportional to the amount
of the oligonucleotide transfected with a 25 and 30-50% decrease in
activity with 0.9 and 1.8 µg, respectively. In contrast,
oligonucleotides that did not contain an Sp1 consensus binding site
(random sequence) or with mutations in the Sp1-binding site of either
the L2-A sequence (L2-A-m) or the consensus Sp1 oligonucleotide (Sp1-m)
failed to significantly alter the activity of the pGL3B-L2[75]
construct. We conclude from these experiments that Sp1 and Sp3 regulate
the activity of the L2-A promoter, and this regulation is dependent on
the presence of the L2-A element.
View larger version (27K):
[in a new window]
Fig. 9.
Decoy oligonucleotides with Sp binding
sequence inhibit the activity of L2 promoter-luciferase construct in
BNL CL.2 cells. 1µg of pGL3B-L2[ 75] and 0.9 (open
bars) or 1.8 (shaded bars) µg of the indicated
double-stranded oligonucleotides were co-transfected into BNL CL.2
cells as described under "Experimental Procedures."
Luciferase-specific activity in cell homogenates, equalized for
transfection efficiency monitored by co-transfection of a plasmid
expressing -galactosidase (RSV/-gal), is expressed as relative to
that of pGL3B-L2[75] in the absence of co-transfected
double-stranded oligonucleotides. Results represent the means ± S.E. of 3-4 independent transfections.
75]
construct was monitored. As illustrated in Fig.
10A, these results indicate
that Sp1 inhibited the stimulatory activity of Sp3 in a
dose-dependent manner. The inhibition of the
transactivation potential of Sp3 by Sp1 was maximum at 8 µg of Sp1
and resulted in a decrease in the activation potential of Sp3 to
10-15% of that observed with Sp3 alone. It is noteworthy that this
decrease in the transactivation potential of Sp3 was not due to
decreased expression of Sp3 consequent to co-expression of Sp1 (Fig.
10B). We conclude from these results that Sp1 antagonizes
the ability of Sp3 to transactivate the GH receptor L2 promoter.
View larger version (21K):
[in a new window]
Fig. 10.
Sp1 antagonizes ability of Sp3 to
transactivate GH receptor L2 promoter-luciferase reporter construct in
Drosophila Schneider cells. A, 12 µg
of pGL3B-L2[ 75], 0.5 µg of pPacUSp3, and the indicated amounts of
pAct-Sp1 were cotransfected in to Drosophila Schneider
cells, and luciferase activity was measured as described under
"Experimental Procedures." Luciferase-specific activity in cell
homogenates, equalized for transfection efficiency monitored by
co-transfection of a plasmid expressing -galactosidase (RSV/-gal,
3 µg), is expressed as relative to that of pGL3-L2[75] in the
presence of 0.5 µg pPacUSp3 but in the absence of pAct-Sp1. Results
represent the means ± S.E. of 3-4 independent transfections.
B, Western blot analysis of Sp3 expression in
Drosophila Schneider cells co-transfected with fixed (0.5 µg) pPacUSp3 and increasing amounts of pAct-Sp1 (0, 2, 4, and 8 µg). 10-µg aliquots of nuclear extracts were electrophoresed,
transferred on to nitrocellulose membrane, and probed with antibodies
specific for Sp3 protein, and the specific proteins were detected using
the chemiluminescence system as described under "Experimental
Procedures."
View larger version (15K):
[in a new window]
Fig. 11.
Expression of Sp3 protein in fetal mouse
liver. A and B, Western blot analysis of Sp3
expression in nuclear extracts from fetal and adult mouse liver.
20-µg aliquots of nuclear extracts from adult (lane 1) or
fetal (lane 2) nuclear extracts were electrophoresed,
transferred on to nitrocellulose membrane, and sequentially probed with
antibodies specific for Sp3 protein (A) or YY-1
(B). The specific proteins were detected using the
chemiluminescence system as described under "Experimental
Procedures." Lane 3 represents an overexposure of
lane 2. C, 32P-labeled L2-A was
incubated with nuclear extracts prepared from livers of fetal (days 19 and 20 of gestation) in the presence of antibodies against Sp3 or Sp1
as indicated. The band representing the supershifted complex
(SS) is indicated.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
73 and
45 bp is essential for activity of the L2 promoter and represents the
minimal promoter. Computer analysis of the intervening sequence
revealed the presence of a canonical hexanucleotide (CCGCCC) binding
site for the Sp family of proteins. EMSA experiments established that
the Sp consensus element, which we termed L2-A, bound recombinant Sp1
protein and nuclear proteins from adult mouse liver. Using antibodies
against the various Sp proteins in supershift EMSA experiments, our
results indicate that the L2-A element preferentially binds Sp3 and to a lesser extent Sp1 protein; the L2-A element did not bind Sp2 or Sp4
protein. Whereas both Sp1 and Sp3 are ubiquitously expressed in various
tissues, Sp4 expression appears to be restricted to certain cell types
of the brain. To determine whether the apparent lack of Sp4 binding to
the L2-A element was the result of the absence of Sp4 protein in liver
nuclear extracts, we assayed for binding to the L2-A element with brain
nuclear extracts. In results similar to that obtained with liver
nuclear extracts, only binding of Sp1 and Sp3 and not that of Sp4 could
be demonstrated with brain nuclear extracts (data not shown),
suggesting that the observed Sp protein binding profile of the L2-A
element was not solely determined by the composition of the nuclear
extracts being assayed.
View larger version (51K):
[in a new window]
Fig. 12.
Proposed model for role of Sp proteins in
ontogeny of GH receptor gene expression. Sp3 and Sp1 bind to and
regulate activity of the L2 promoter of the murine GH receptor gene.
Individually, Sp3 is a strong activator and Sp1 is a weak activator of
the GH receptor L2 promoter. In combination, Sp1 antagonizes the
transactivation potential of Sp3 on the GH receptor L2 promoter. In
fetal liver, Sp1 levels are high and Sp3 levels are low resulting in
weak activation of the L2 promoter. In contrast in the adult liver, Sp3
levels are elevated with relative decrease in Sp1 levels, facilitating
enhanced activity of the L2 promoter and increased expression of the GH
receptor gene.
ACKNOWLEDGEMENTS
FOOTNOTES
Supported by a scholarship from the Korean Ui-Hang Foundation.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Menon, R. K.,
Cheng, H.,
and Singh, M.
(1997)
Mol. Endocrinol.
11,
1291-1304 2.
Zou, L.,
and Menon, R. K.
(1995)
Endocrinology
136,
5236-5239[Abstract]
3.
Schwartzbauer, G., Yu, J. H.,
Cheng, H.,
and Menon, R. K.
(1998)
J. Biol. Chem.
273,
24760-24769 4.
Schwartzbauer, G.,
and Menon, R. K.
(1998)
Mol. Genet. Metab.
63,
243-253[CrossRef][Medline]
[Order article via Infotrieve]
5.
O'Mahoney, J. V.,
Brandon, M. R.,
and Adams, T. E.
(1994)
Mol. Cell. Endocrinol.
101,
129-139[CrossRef][Medline]
[Order article via Infotrieve]
6.
Adams, T. E.,
Baker, L.,
Fiddes, R. J.,
and Brandon, M. R.
(1990)
Mol. Cell. Endocrinol.
73,
135-145[CrossRef][Medline]
[Order article via Infotrieve]
7.
Jiang, H.,
Okamura, C. S.,
and Lucy, M. C.
(1999)
J. Biol. Chem.
274,
7893-7900 8.
Zou, L.,
Burmeister, L.,
and Sperling, M. A.
(1997)
Endocrinology
138,
1771-1774 9.
Edens, A.,
and Talamantes, F.
(1998)
Endocr. Rev.
19,
559-582 10.
Domene, H. M.,
Cassorla, F.,
Werner, H.,
Roberts, C. T., Jr.,
and LeRoith, D.
(1995)
DNA Cell Biol.
14,
195-204[Medline]
[Order article via Infotrieve]
11.
Baumbach, W. R.,
and Bingham, B.
(1995)
Endocrinology
136,
749-760[Abstract]
12.
Southard, J. N.,
Barrett, B. A.,
Bikbulatova, L.,
Ilkbahar, Y.,
Wu, K.,
and Talamantes, F.
(1995)
Endocrinology
136,
2913-2921[Abstract]
13.
Smith, W. C.,
Kuniyoshi, J.,
and Talamantes, F.
(1989)
Mol. Endocrinol.
3,
984-990 14.
Menon, R. K.,
Stephan, D. A.,
Singh, M.,
Morris, S. M., Jr.,
and Zou, L.
(1995)
J. Biol. Chem.
270,
8851-8859 15.
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467 16.
Heinemeyer, T.,
Wingender, E.,
Reuter, T.,
Hermjakob, H.,
Kel, A.,
Kel, O.,
Ignatieva, E.,
Ananko, E. A.,
Podkolodnaya, N. L.,
Kolpakov, F. A.,
Podkolodny, N. L.,
and Kolchanov, N. A.
(1998)
Nucleic Acids Res.
26,
364-370
17.
Liang, F.,
Schaufele, F.,
and Gardner, D. G.
(1999)
Endocrinology
140,
1695-1701 18.
Morishita, R.,
Gibbons, G. H.,
Ellison, K. E.,
Nakajima, M.,
Zhang, L.,
Kaneda, Y.,
Ogihara, T.,
and Dzau, V.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5855-5859 19.
Bigger, C. B.,
Melnikova, I. N.,
and Gardner, P. D.
(1997)
J. Biol. Chem.
272,
25976-25982 20.
Hagen, G.,
Muller, S.,
Beato, M.,
and Suske, G.
(1994)
EMBO J.
13,
3843-3851[Medline]
[Order article via Infotrieve]
21.
Kumar, A. P.,
and Butler, A. P.
(1997)
Nucleic Acid Res.
25,
2012-2019 22.
Kwon, H. S.,
Kim, M. S.,
Edenberg, J. H.,
and Hur, M. W.
(1999)
J. Biol. Chem.
274,
20-28 23.
Kennet, S. B.,
Udvadia, A. I.,
and Horowitz, J. M.
(1997)
Nucleic Acids Res.
25,
3110-3117 24.
Moffat, J. G.,
Edens, A.,
and Talamantes, F.
(1998)
80th Annual Meeting of the Endocrine Society, New Orleans, June 24-27, 1998
, Endocrine Society, New Orleans, Louisiana
25.
Lania, L.,
Majello, B.,
and De Luca, P.
(1997)
Int. J. Biochem. Cell Biol.
29,
1313-1323[CrossRef][Medline]
[Order article via Infotrieve]
26.
Majello, B.,
De Luca, P.,
and Lania, L.
(1997)
J. Biol. Chem.
272,
4021-4026 27.
Dennig, J.,
Beato, M.,
and Suske, G.
(1996)
EMBO J.
15,
5659-5667[Medline]
[Order article via Infotrieve]
28.
Majello, B.,
De Luca, P.,
Hagan, G.,
Suske, G.,
and Lania, L.
(1994)
Nucleic Acids Res.
22,
4914-4921 29.
Majello, B.,
De Luca, P.,
Suske, G.,
and Lania, L.
(1995)
Oncogene
10,
1841-1848[Medline]
[Order article via Infotrieve]
30.
Gluckman, P. D.
(1986)
in
Reviews in Reproductive Biology
(Clarke, J. R., ed)
, pp. 1-60, Oxford University Press, Oxford
31.
Saffer, J. D.,
Jackson, S. P.,
and Annarella, M. B.
(1991)
Mol. Cell Biol.
11,
2189-2199
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer Structure and Activity of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter Mol. Endocrinol., March 1, 2009; 23(3): 360 - 372. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bonnefont, L. Daulhac, M. Etienne, E. Chapuy, C. Mallet, L. Ouchchane, C. Deval, J.-P. Courade, M. Ferrara, A. Eschalier, et al. Acetaminophen Recruits Spinal p42/p44 MAPKs and GH/IGF-1 Receptors to Produce Analgesia via the Serotonergic System Mol. Pharmacol., February 1, 2007; 71(2): 407 - 415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Lu, W. H. Walker, J. Sun, O. A. Weisz, R. B. Gibbs, S. F. Witchel, M. A. Sperling, and R. K. Menon Insulin-Like Peptide 6: Characterization of Secretory Status and Posttranslational Modifications Endocrinology, December 1, 2006; 147(12): 5611 - 5623. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Thimmarayappa, J. Sun, L. E. Schultz, P. Dejkhamron, C. Lu, A. Giallongo, J. L. Merchant, and R. K. Menon Inhibition of Growth Hormone Receptor Gene Expression by Saturated Fatty Acids: Role of Kruppel-Like Zinc Finger Factor, ZBP-89 Mol. Endocrinol., November 1, 2006; 20(11): 2747 - 2760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-C. Leung, G. Johannsson, G. M. Leong, and K. K. Y. Ho Estrogen Regulation of Growth Hormone Action Endocr. Rev., October 1, 2004; 25(5): 693 - 721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Borgatti, I. Lampronti, A. Romanelli, C. Pedone, M. Saviano, N. Bianchi, C. Mischiati, and R. Gambari Transcription Factor Decoy Molecules Based on a Peptide Nucleic Acid (PNA)-DNA Chimera Mimicking Sp1 Binding Sites J. Biol. Chem., February 21, 2003; 278(9): 7500 - 7509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. M. Gowri, J. H. Yu, A. Shaufl, M. A. Sperling, and R. K. Menon Recruitment of a Repressosome Complex at the Growth Hormone Receptor Promoter and Its Potential Role in Diabetic Nephropathy Mol. Cell. Biol., February 1, 2003; 23(3): 815 - 825. [Abstract] [Full Text]
|
|
|
|
 |
|
 X. Zhang, Y. Li, C. Dai, J. Yang, P. Mundel, and Y. Liu Sp1 and Sp3 transcription factors synergistically regulate HGF receptor gene expression in kidney Am J Physiol Renal Physiol, January 1, 2003; 284(1): F82 - F94. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Goodyer, G. Zogopoulos, G. Schwartzbauer, H. Zheng, G. N. Hendy, and R. K. Menon Organization and Evolution of the Human Growth Hormone Receptor Gene 5'-Flanking Region Endocrinology, May 1, 2001; 142(5): 1923 - 1934. [Abstract] [Full Text]
|
|
|
|
 |
|
 H.-L. Hung, E. S. Pollak, R. D. Kudaravalli, V. Arruda, K. Chu, and K. A. High Regulation of human coagulation factor X gene expression by GATA-4 and the Sp family of transcription factors Blood, February 15, 2001; 97(4): 946 - 951. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |