JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ouellet, M.
Right arrow Articles by Tremblay, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ouellet, M.
Right arrow Articles by Tremblay, M. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 49, 35029-35036, December 3, 1999


p56lck, ZAP-70, SLP-76, and Calcium-regulated Effectors Are Involved in NF-kappa B Activation by Bisperoxovanadium Phosphotyrosyl Phosphatase Inhibitors in Human T Cells*

Michel OuelletDagger , Benoit BarbeauDagger , and Michel J. Tremblay§

From the Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire du Québec, Pavillon CHUL and Département de Biologie Médicale, Faculté de Médecine, Université Laval, Sainte-Foy Québec G1V 4G2, Canada

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

This study investigates the second messengers involved in NF-kappa B activation by the bisperoxovanadium (bpV) phosphotyrosyl phosphatase inhibitors. We first initiated a time course analysis of bpV-mediated activation of the human immunodeficiency virus type-1 long terminal repeat- and NF-kappa B-driven reporter gene. Our results showed a slower and more transient activation of both kappa B-regulated luciferase-encoding vectors by bpV compounds when compared with the action of tumor necrosis factor-alpha (TNF). Time course analyses of NF-kappa B translocation by shift assay experiments further confirmed these results, hence implying distinct pathways of NF-kappa B activation for bpV compounds and TNF. Attempts to characterize the bpV-dependent signaling cascade revealed that the src family protein tyrosine kinase p56lck was critical for NF-kappa B induction by bpV. Furthermore, p56lck interaction with the intracytoplasmic tail of CD4 markedly enhanced such induction. Optimal activation of NF-kappa B following bpV treatment necessitated downstream effectors of p56lck such as the syk family protein tyrosine kinase ZAP-70 and the molecular adaptor SLP-76. Importantly, reduced NF-kappa B activation was observed when capacitative calcium entry was deficient but also upon pharmacological inhibition of calmodulin and calcineurin. Altogether, these results suggest that induction of NF-kappa B by phosphotyrosyl phosphatase bpV inhibitors necessitates both proximal and distal effectors of T cell activation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mechanisms underlying cellular activation involve a complex interplay of many cellular enzymes, adaptors, and receptors, each having a defined role in the fate of the cell. The binding of extracellular cytokines to their physiological cell surface receptors leads to a cascade of biochemical events generally culminating in the activation of specific transcription factors. One of them is the nuclear factor-kappa B (NF-kappa B)1 that is a dimer composed most frequently of subunits p50 and RelA (p65) but occasionally composed of other subunits like p52, c-Rel, and RelB (reviewed in Ref. 1). In most cell types, this transcription factor is retained in the cytoplasm by an inhibitory factor called Ikappa B (2). Activation of protein kinases in the cell ultimately leads to phosphorylation of two critical serines on Ikappa B (3) targeting it for degradation by the proteasome in a ubiquitin-dependent fashion (4, 5). Degradation of Ikappa B exposes the nuclear localization signal of the NF-kappa B dimer (6) allowing it to translocate into the nucleus where it will bind to specific DNA sequences and eventually activate gene transcription.

In T cells, NF-kappa B activation normally occurs either via classical antigenic recognition of a specific peptide/major histocompatibility complex by the T cell receptor (7) or via stimulation by proinflammatory cytokine such as tumor necrosis factor (8) and interleukin-1 (9). Signaling events leading to NF-kappa B activation following TNF and IL-1 stimulation are becoming quite well characterized (reviewed in Ref. 10), whereas those leading to NF-kappa B activation following antigenic recognition remain poorly identified. TCR-derived activation of NF-kappa B is nonetheless assuredly critical for differentiation, activation, proliferation, and protection from apoptosis of T lymphocytes because knockout mice for c-Rel (11), RelB (12, 13), and p65 (14, 15) show profound lymphocyte activation and/or developmental defects.

The state of activation of a T lymphocyte is reflected by the amount of its intracellular tyrosine-phosphorylated proteins. The level of tyrosine phosphorylation is controlled by a direct balance of power between activities of PTKs and PTPs. An increase of tyrosine phosphorylation thus occurs either from induction of PTKs or from inhibition of PTPs. To inhibit specifically PTPs, a novel series of compounds has been synthesized that are derived from the mixture of vanadate and hydrogen peroxide. Unlike pervanadate, these new bisperoxo- vanadium compounds are highly purified by 51V NMR and contain an ancillary ligand in the inner coordination sphere of the vanadium molecule whose function is to increase the stability of the compound as well as to provide a certain degree of specificity (16). Their mode of action is thought to be the same as pervanadate which can enter the active site of the enzyme due to its high similarity with phosphate groups and then oxidize the conserved catalytic cysteine residue located at the bottom of the active site (17). These properties make pervanadate and its purified counterparts, the bpV molecules, competitive, specific, and highly potent inhibitors of PTPs (18).

PTP inhibitors are mainly recognized for their insulinomimetic properties on adipocytes and myocytes (16, 19, 20). However, lymphocytes treated with PTP inhibitors such as pervanadate demonstrate many characteristics proper to activated T cells such as an increase in c-fos gene transcription and IL-2 production as well as expression of activation markers such as CD25 and CD69. Furthermore, several studies have identified a panoply of second messengers that are activated following pervanadate treatment of lymphocytes such as p56lck, p59fyn, ZAP-70, intracellular calcium, and the mitogen-activated protein kinase cascade (21-24). Those effector molecules are thought to permit the shuttling of the activation signal to the nucleus in order to mediate gene transcription by the activation of specific transcription factors. Interestingly, nuclear translocation of NF-kappa B is seen in cells treated with pervanadate, but it was reported by Imbert and co-workers (25) that this activation occurred independently of Ikappa Balpha degradation. These results could not be reproduced regarding NF-kappa B activation by bpV compounds since two following studies using different bpV compounds reported that serine phosphorylation and subsequent degradation of Ikappa Balpha seemed in fact necessary for NF-kappa B-dependent activation of gene transcription (26, 27).

In this study, we have thus characterized signal transducers involved in activation of NF-kappa B following treatment of CD4+ T lymphoid cells with these novel bpV compounds that can markedly increase intracellular phosphotyrosyl levels. We demonstrate the critical role of the src family PTK p56lck as well as the importance of its interaction with the cytoplasmic domain of the glycoprotein CD4 in the activation of NF-kappa B after treatment with bpV. The syk family PTK ZAP-70 and its downstream effector, SLP-76, are also clearly involved in the cascade but seem not to be as essential as p56lck for bpV-induced activation of NF-kappa B. Finally, we demonstrate that capacitative entry of calcium is necessary for efficient NF-kappa B induction upon bpV treatment, and both calmodulin and calcineurin are similarly required.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell Lines-- The lymphoid T cell lines used in this work include Jurkat (clone E6.1), JCAM1.6, 1G5, Jkappa B, P116, P116 cl.39, P116 cl.40, JRT3, J14-V-29, J14-76-11, CJ parental, CJ 5.13, CJ 1.1, A2.01, A2D8, and 3D4D8. Jurkat is considered as a model cell line for the study of T cell signaling machinery (28). JCAM1.6 is a derivative of the Jurkat leukemic T cell line, which is deficient in p56lck expression (29). The 1G5 T cell line is a Jurkat derivative that harbors two stably integrated constructs constituted of the luciferase gene under the control of the HIV-1 SF2 LTR (30). Jkappa B cell line was developed for this study and consists of Jurkat cells electroporated with pNF-kappa B-LUC and pEFneo constructs at a 10:1 ratio. The G418-resistant population harbors an NF-kappa B-responsive promoter driving the luciferase gene. P116 is a ZAP-70-deficient derivative of Jurkat, and the P116 cl.39 and P116 cl.40 are clones reconstituted using a ZAP-70 expression vector (31). The JRT3 cell line is a Jurkat derivative and is deficient for the expression of the TCR·CD3 complex due to a deletion in the beta  chain of the TCR that hinders expression of the whole complex on the cell surface (32). The J14-V-29 cell line is also derived from Jurkat and lacks expression of the T cell-specific adaptor SLP-76 that has been reintroduced using an expression vector, thus creating the J14-76-11 clone (33). The CJ cell lines have been derived from Jurkat using a toxic gene under the control of the NFAT transcription factor (34). The CJ parental cell line retains full calcium capacitative entry, whereas the CJ 5.13 and CJ 1.1 have, respectively, 40% and less than 10% of the wild-type capacitative entry of calcium following stimulation. A2.01 is a CD3- and CD4-negative T lymphoid cell line (35). The A2D8 clone of A2.01 cells is stably transfected with human full-length CD4, whereas the 3D4D8 clone is stably expressing a truncated version of the human CD4 glycoprotein lacking 32 of 38 amino acids located in the cytoplasmic domain (36). All cell lines were grown in RPMI containing 10% fetal calf serum (HyClone Laboratories) added with penicillin and streptomycin except for CJ cell lines, which were grown in 20% fetal calf serum. When necessary, G418 and/or hygromycin B were added to the cell culture medium at a concentration of 1 mg/ml and 300 µg/ml, respectively.

Plasmids-- The expression vector for p56lck, pEFneo LCK-wt, as well as the pEFneo-based empty vector have already been described (37) and were kind gifts from Dr. Clement Couture (Lady Davis Institute). The expression vector encoding luciferase under the control of five consensus binding sites for NF-kappa B (pNF-kappa B-LUC) was obtained from Stratagene.

DEAE-Dextran Transfection-- For each condition, 5 × 106 cells were washed with transfection buffer (25 mM Tris-HCl, 137 mM NaCl, 5 mM KCl, 0.5 mM Na2HPO4, 0.5 mM MgCl2, 0.7 mM CaCl2, pH 7.4), centrifuged at 1,500 × g for 5 min and resuspended in 500 µl of transfection buffer supplemented with 5-30 µg of plasmidic DNA and 500 µg/ml DEAE-dextran (Amersham Pharmacia Biotech). The cell/DNA/DEAE-Dextran mixture was then incubated for 25 min at room temperature after which 5 ml of 100 µM chloroquine (Sigma) in cell culture medium was added. The mixture was then incubated at 37 °C for 45 min before centrifugation at 1,500 × g for 5 min followed by resuspension of the cells in fresh cell culture medium prior to incubation for 16-24 h at 37 °C in a 5% CO2 atmosphere.

Stimulation of Cells-- For studies using pharmacological inhibitors, cells were resuspended in fresh cell culture medium at 1 × 106 cells/ml. Cyclosporin A (CsA) (Fujisawa, Osaka, Japan) and FK506 (Sigma) were added at subcytotoxic concentrations of 50-100 and 5-10 ng/ml, respectively, for 30 min before stimulation. Calmidazolium chloride (Calbiochem) was added 1 h before stimulation at subcytotoxic concentrations of 5-10 µM. Depending on the experiments, transfected or pretreated cells were then stimulated with PMA at 20 ng/ml (Sigma), PHA (Sigma) at 3 µg/ml, ionomycin (Sigma) at 1 µM, and TNF (R & D Systems) at 2 or 8 ng/ml. Bisperoxovanadium compounds harboring different ancillary ligand (bipyridine, bpV[bipy]; 5-hydroxypyridine-2-carboxylic acid anion, bpV[HOpic]; pyridine-2-carboxylic acid anion, bpV[pic]) were always added at a subcytotoxic and subcytostatic concentration of 10 µM.

Luciferase Assay-- Luciferase activity was monitored following a previously described protocol (26) in which 100 µl of cell-free supernatant is drawn from each well and 25 µl of 5× lysis buffer (25 mM Tris phosphate, pH 7.8, 2 mM dithiothreitol, 1% Triton X-100, 10% glycerol) is added. After 30 min of vigorous agitation and one freeze/thaw cycle, 20 µl of cellular extracts were transferred to a luminometer plate, and luciferase activity was monitored on a Dynex MLX microplate luminometer for 20 s/well after a 2-s delay following addition of 100 µl of luciferase buffer (20 mM tricine, 1.07 mM (MgCO3)4 · Mg(OH)2 · 5 H2O, 2.67 mM MgSO4, 0.1 mM EDTA, 220 µM coenzyme A, 4.70 µM D-luciferin potassium salt, 530 µM ATP, 33.3 mM dithiothreitol.

Nuclear Extract Preparations-- Nuclear extracts were prepared according to a previously described protocol (26). Briefly, unstimulated or activated cells (5 × 106) were first washed with phosphate-buffered saline. Cells were then resuspended in 400 µl of hypotonic buffer (Buffer A: 10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride) and kept 15 min on ice before lysis with 25 µl of Nonidet P-40 10%. After brief vortexing and centrifugation, the supernatant was discarded, and the pellet was resuspended with a hypertonic buffer (Buffer B: 20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride) followed by gentle agitation for 15 min. The solution was then centrifuged, and the supernatant was assayed for protein concentration by BCA assay (Pierce) and stored at -85 °C until use.

Probe Labeling-- Radioactive labeling of an oligonucleotide specific for NF-kappa B (5' ATGTGAGGGGACTTTCCCAGGC 3') was performed by mixing 50 ng of one of the DNA strands in a T4 polynucleotide kinase buffer containing 30 µCi of [gamma -32P]ATP and the T4 polynucleotide kinase for 30 min at 37 °C. The reaction was stopped by the addition of 5 µl of 0.2 M EDTA and 25 µl of H2O. A phenol/chloroform extraction of the oligonucleotide was then performed after which the aqueous phase was spun through a G-50 Sephadex column for further purification. The oligonucleotide was then allowed to hybridize with 200 ng of the complementary strand in an annealing buffer (100 mM NaCl, 5 mM Tris, pH 7.5, 10 mM MgCl2, 20 µM EDTA, 1 mM dithiothreitol) after heating at 90 °C for 2 min.

Electrophoretic Mobility Shift Assay-- Nuclear extracts (10 µg) mixed with poly(dI-dC) (1 µg/ml), bovine serum albumin (1 µg/ml), and the labeled oligonucleotide in a binding buffer were first incubated at room temperature and run through a 4% (w/v) polyacrylamide gel for 2 h at 150 V. Competition experiments were performed with 100-fold excess of cold oligonucleotides harboring sequences for NF-kappa B (specific competition) or Oct-2A (nonspecific competition). Gels were dried and exposed on a Kodak Biomax MR film at -85 °C.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Different Kinetics of NF-kappa B Activation by bpV Compounds and TNF-- In order to characterize the NF-kappa B signaling pathway initiated by the bpV PTP inhibitors, kinetic analyses of NF-kappa B activation were carried out using bpV and other well known NF-kappa B-inducing agents. Results showed a strong induction of both HIV-1 long terminal repeat- and NF-kappa B-driven reporter gene expression by bpV molecules and commonly used inducers of NF-kappa B (PMA, PHA, and TNF). In stably transfected 1G5 cells harboring a construct encoding the luciferase reporter gene under the control of the HIV-1 LTR, maximum levels of luciferase activity were achieved at approximately the same time (8 h) for all activators tested (Fig. 1, panels A and B). In stably transfected Jkappa B cells expressing luciferase under the control of five consensus binding sites for NF-kappa B, the induction kinetics were different since PMA, PHA, PMA/PHA, and TNF all showed a peak of activity after a 6-h treatment (Fig. 1, panel C), whereas that of cells stimulated with bpV appeared later, between 8 and 12 h (Fig. 1, panel D, and data not shown). Furthermore, luciferase activity for both HIV-1 LTR- and NF-kappa B-driven expression vectors was much more transient when cells were stimulated with bpV compounds than with any other activator. When electrophoretic mobility shift assays were performed, nuclear translocation of NF-kappa B correlated with transcriptional assays, showing a delayed and less sustained activation of NF-kappa B (compare lanes 3-7 with lanes 8-12). In fact, NF-kappa B activation by TNF appeared within no more than 10 min (lane 3), while detectable nuclear translocation by bpV required at least 30 min (lane 10). Furthermore, peak activation of NF-kappa B was delayed in cells stimulated with bpV and started declining at the 120-min time point (lanes 11 and 12). All induced signals were found to be specific to the NF-kappa B probe as these latter were outcompeted by 100-fold excess of cold NF-kappa B oligonucleotide (lanes 14 and 15) but not by excess of a nonspecific oligonucleotide (lanes 17 and 18). Our results hence suggest that NF-kappa B activation by either TNF or bpV does not proceed through similar signaling cascade.


View larger version (54K):
[in this window]
[in a new window]
  		Fig. 1.   bpV compounds induce a slower and more transient activation of HIV-1 LTR- and NF-kappa B-driven reporter gene activity than PMA, PHA, PMA/PHA, or TNF. Panel A, 1G5 cells were either left untreated or were stimulated with PMA (open circle ) (20 ng/ml), PHA () (3 µg/ml), a combination of PMA and PHA (), or TNF (black-square) (2 ng/ml) for 2, 4, 6, 8, and 24 h. Panel B, 1G5 cells were either left untreated or were stimulated with 10 µM bpV[bipy] (), bpV[pic] (), or bpV[HOpic] (open circle ) for 2, 4, 6, 8, and 24 h. Panel C, Jkappa B cells were either left untreated or were stimulated with PMA, PHA, PMA/PHA, and TNF (8 ng/ml) for the indicated times. Panel D, Jkappa B cells were either left untreated or were stimulated with different bpV molecules for the specified times. Luciferase activity was measured as described under "Experimental Procedures." Panel E, Jurkat cells were either left untreated (lanes 1 and 2) or were stimulated with TNF (8 ng/ml) (lanes 3-7) or bpV[pic] (10 µM) (lanes 8-12) for 10 (lanes 3 and 8), 20 (lanes 4 and 9), 30 (lanes 5 and 10), 60 (lanes 6 and 11), and 120 min (lanes 7 and 12). Nuclear extraction and electrophoretic mobility shift assays were then performed as described under "Experimental Procedures." Cold double-stranded NF-kappa B oligonucleotide was used as specific competition at 100× concentration for untreated (lane 13), 60-min TNF-stimulated (lane 14), and 60-min bpV[pic]-stimulated extracts (lane 15). Cold double-stranded Oct2-A oligonucleotide was used as nonspecific competition at 100× concentration for untreated (lane 16), 60-min TNF-stimulated (lane 17), and 60-min bpV[pic]-stimulated extracts (lane 18). Results shown are representative of three independent experiments.

Decreased Activation of NF-kappa B following bpV Treament of Cells Lacking p56lck and ZAP-70-- TCR-oriented signaling is one of the most important activation pathways of T lymphocytes. Such activation first requires the participation of two major types of PTK, the src and the syk family PTK. The src family PTK p56lck is physically linked with CD4 in helper T lymphocytes and has been reported to phosphorylate immunoreceptor tyrosine-based activation motifs of the CD3 zeta  chains (38). These phosphorylated immunoreceptor tyrosine-based activation motifs provide anchoring for the syk family PTK ZAP-70 (39) which becomes activated (40) and is then responsible for phosphorylation of downstream effectors such as p36LAT (41) and SLP-76 (42). In order to find possible effectors of NF-kappa B activation following PTP inhibition by bpV, cell lines deficient for either p56lck, ZAP-70, or the TCR·CD3 complex were transfected with a NF-kappa B-driven luciferase reporter gene and stimulated with TNF, PHA, and bpV[pic]. Transfection of NF-kappa B-LUC in the p56lck-deficient cell line JCAM1.6 showed a dramatic loss of activation in terms of luciferase activity by either PHA or bpV[pic] (Fig. 2, panel A). A similar loss of activation was clearly apparent when the ZAP-70-deficient cell line P116 was instead transfected and stimulated by either of these NF-kappa B activators (Fig. 2, panel A). The absence of TCR/CD3 expression (JRT3 cells), surprisingly, seemed to have no consequences on NF-kappa B activation by bpV[pic]. As expected, PHA treatment of transfected JRT3 cells resulted in total abrogation of the induction of luciferase activity. However, TNF-induced activation of NF-kappa B was found to be unaffected in JCAM1.6, JRT3, and P116 cells. Electrophoretic mobility shift assays were performed with the same cell lines stimulated with TNF or bpV[pic] for 10, 60, or 240 min. These data confirmed results from the transcriptional activation experiments since, upon bpV[pic] stimulation, no translocation of NF-kappa B could be seen in JCAM1.6 (p56lck-deficient) cells (Fig. 2, panel B, lanes 5-8), whereas greatly reduced NF-kappa B translocation occurred in P116 (ZAP-70-deficient) cells (Fig. 2, panel B, lanes 13-16). Furthermore, although JRT3 cells stimulated with bpV[pic] showed a lesser extent of NF-kappa B translocation as compared with the parental Jurkat cells (Fig. 2, panel B, lanes 9-12), NF-kappa B activation seemed to be faster, which might account for the observed similarity in luciferase activity between bpV-treated Jurkat and JRT3 cell lines. For all cell lines tested, TNF stimulation resulted in fast and strong NF-kappa B translocation independently of the deficiency characterizing these cell lines (Fig. 2, panel C). Our findings indicate that, although the TCR itself is not absolutely required per se, bpV-mediated activation of NF-kappa B involves several effectors shared with TCR-mediated signaling pathway, and such signal transducers are not necessary for induction of NF-kappa B by TNF.


View larger version (78K):
[in this window]
[in a new window]
  		Fig. 2.   Diminished bpV-mediated induction of NF-kappa B is seen in p56lck and ZAP-70-deficient cells. Panel A, cells (parental Jurkat, JCAM1.6, JRT3, and P116) were transfected with 5 µg of pNF-kappa B-LUC construct using DEAE-dextran protocol as described under "Experimental Procedures." After 16 h, cells were stimulated with TNF (8 ng/ml), PHA (3 µg/ml), or bpV[pic] (10 µM) for 6 h, and luciferase activity was monitored as described under "Experimental Procedures." Panel B, Jurkat (lanes 1-4), JCAM1.6 (lanes 5-8), JRT3 (lanes 9-12), and P116 cells (lanes 13-16) were either left untreated (lanes 1, 5, 9, and 13) or were stimulated with bpV[pic] (10 µM) for 10 (lanes 2, 6, 10, and 14), 60 (lanes 3, 7, 11, and 15) or 240 min (lanes 4, 8, 12, and 16). Cold double-stranded NF-kappa B oligonucleotide (lane 17) and Oct-2A oligonucleotide (lane 18) were used as specific and nonspecific competition at 100 × concentration for 60 min bpV[pic]-stimulated Jurkat extracts. Panel C, Jurkat (lanes 1-4), JCAM1.6 (lanes 5-8), JRT3 (lanes 9-12), and P116 cells (lanes 13-16) were either left untreated (lanes 1, 5, 9, and 13) or were stimulated with TNF (8 ng/ml) for 10 (lanes 2, 6, 10, and 14), 60 (lanes 3, 7, 11, and 15), or 240 min (lanes 4, 8, 12, and 16). Nuclear extraction and electrophoretic mobility shift assay were then performed as described under "Experimental Procedures." Cold double-stranded NF-kappa B oligonucleotide (lane 17) and Oct-2A oligonucleotide (lane 18) were used as specific and nonspecific competition at 100× concentration for 60-min TNF-stimulated Jurkat extracts. All results shown are representative of two independent experiments.

p56lck Is Critical for bpV-induced NF-kappa B Activation-- PTKs of the src family are critical in many signal transduction pathways, and p56lck is especially important in TCR signaling. Its absence leads to unresponsiveness of the cell to its nominal antigen, anti-CD3 or -TCR antibodies as well as mitogenic agents such as PHA. Since p56lck-negative cell line were found to be unresponsive to bpV as well, reconstitution experiments were performed in which JCAM1.6 cells were transfected with the pNF-kappa B-LUC construct and a p56lck expression vector or a control plasmid. As previously demonstrated (Fig. 2, panel A), a minimal fold induction was measured in pNF-kappa B-LUC-transfected JCAM1.6 cells after bpV treatment (Fig. 3, panel A). Expression of p56lck restored NF-kappa B responsiveness of the JCAM1.6 cell line toward bpV induction. These results clearly demonstrate that a defect in the expression of p56lck results in an unresponsive state with respect to the induction of NF-kappa B upon bpV treatment.


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 3.   p56lck is critical for bpV-mediated NF-kappa B activation, and the CD4-p56lck interaction promotes activation of NF-kappa B upon bpV treatment. Panel A, Jurkat and JCAM1.6 cells were cotransfected using DEAE-dextran protocol with 5 µg of pNF-kappa B-LUC construct and 25 µg of either pEFneo (control) or pEFneo LCK wt expression vectors. Following a 16-h incubation period, cells were stimulated with TNF (8 ng/ml) or bpV[pic] (10 µM) for 6 h, and luciferase activity was assayed as described under "Experimental Procedures." black-square, Jurkat/pNF-kappa B-LUC/pEFneo; , JCAM1.6/pNF-kappa B-LUC/pEFneo; , JCAM1.6/pNF-kappa B-LUC/pEFneo LCK-wt. Panel B, A2.01 (black-square), A2D8 (), and 3D4D8 () cells were transfected using DEAE-dextran protocol with 15 µg of pNF-kappa B-LUC construct. After 16 h, cells were stimulated with TNF (8 ng/ml) or bpV[pic] (10 µM) for 6 h, and luciferase activity was assayed as described under "Experimental Procedures." Results shown are representative of two independent experiments.

p56lck Interaction with the Intracellular Domain of CD4 Enhances NF-kappa B Induction by bpV-- Intracellular localization of many enzymes is critical for their action by allowing interactions either with their substrate or with needed cofactors. p56lck interacts with the intracellular portion of the CD4 glycoprotein and this interaction allows it to colocalize with the TCR·CD3 complex during antigenic recognition (43, 44). In order to assess if this interaction is important for NF-kappa B activation following PTP inhibition, we used the CD3- and CD4-deficient cell line A2.01 and reconstituted clones expressing either wild-type CD4 or a truncated CD4 version lacking the intracellular portion. Such pNF-kappa B-LUC-transfected cells were next stimulated with TNF or bpV[pic] prior to monitoring of luciferase activity. Results showed a 4-fold enhancement of NF-kappa B-driven luciferase activity by bpV[pic] with the A2.01 cell line expressing full-length CD4 (A2D8) in comparison to the parental A2.01 cell line or the derivative expressing the truncated CD4 version (3D4D8) (Fig. 3, panel B). TNF induction of NF-kappa B was not significantly altered by the presence or the absence of cell surface CD4, further showing that TNF-mediated NF-kappa B signaling pathway is independent of either p56lck, CD4, or their physical association. These results thus further argued for the importance of the most proximal events of TCR signaling in bpV-mediated induction of NF-kappa B, most importantly the CD4-p56lck interaction.

ZAP-70 and Its Downstream Target, SLP-76, Are Both Required for Optimal Induction of NF-kappa B by bpV Molecules-- The syk family PTK ZAP-70 is a major integrator of TCR-mediated signaling. Its induced phosphorylation of critical adaptors such as p36LAT and SLP-76 leads to signaling complex formation recruiting important enzymes such as phospholipase Cgamma 1 (33, 41, 45), phosphatidylinositol 3-kinase (41), the guanine nucleotide exchange factors Vav (46-48) and, from their interaction with Grb2 (45, 49) or Grb2-related adaptors (50, 51), Sos. The physiological importance of ZAP-70 is provided by the observation that deficiency in ZAP-70 expression or activity results in profound lymphocyte activation defects (52-54). Reconstitution experiments were performed with P116 cells to evaluate clearly the need for ZAP-70 in NF-kappa B activation by bpV treatment. Stable ZAP-70 transfectants P116 clone 39 and P116 clone 40 were used for these experiments as they have been shown to express similar levels of ZAP-70 as compared with the parental cell line Jurkat E6.1 and to contain no alteration of other signaling molecules important in TCR-mediated cell signaling. ZAP-70-deficient and -reconstituted cell lines were thus transfected with pNF-kappa B-LUC construct and stimulated with PMA, PHA, or bpV[pic]. NF-kappa B stimulation by PMA was similar in all three cell lines, and ZAP-70-deficient P116 cells showed a profound defect in NF-kappa B stimulation by PHA, whereas ZAP-70-reconstituted P116 cl.39 and P116 cl.40 cells had much stronger levels of NF-kappa B activation. Interestingly, inhibition of PTP by bpV[pic] resulted in a slight induction of NF-kappa B even in the absence of ZAP-70, but upon restoration of ZAP-70 expression at wild-type levels, bpV-induced NF-kappa B activation was 4-5-fold stronger (Fig. 4, panel A) thus demonstrating that ZAP-70 is necessary for optimal induction of NF-kappa B following PTP inhibition by bpV molecules.


View larger version (21K):
[in this window]
[in a new window]
  		Fig. 4.   ZAP-70 and its in vivo target, SLP-76, are involved in NF-kappa B activation following PTP inhibition by bpV compounds. Panel A, ZAP-70-deficient cells (P116, black-square) and ZAP-70-reconstituted cells (P116 cl.39 (), and P116 cl.40 ()) were transiently transfected with 5 µg of pNF-kappa B-LUC construct using DEAE-dextran protocol as described under "Experimental Procedures." After 16 h, cells were stimulated with PMA (20 ng/ml), PHA (3 µg/ml) or bpV[pic] (10 µM) for 6 h prior monitoring for luciferase activity. Panel B, SLP-76-deficient cells (J14-V-29, black-square) and SLP-76-reconstituted cells (J14-76-11, ) were transiently transfected using DEAE-dextran protocol with 5 µg of pNF-kappa B-LUC construct. After 16 h, cells were stimulated with PMA (20 ng/ml), PHA (3 µg/ml), or bpV[pic] (10 µM) for 6 h, and luciferase activity was assayed as described under "Experimental Procedures." All results shown are representative of two independent experiments.

Downstream effectors of ZAP-70 include p36LAT and SLP-76. Given that SLP-76 is the main Vav-interacting protein in T lymphocytes (42, 46, 48) and that Vav has been shown to play a cardinal role in activation of NF-kappa B (55), we thus assessed the implication of SLP-76. J14-V-29 and J14-76-11 cell lines that are deficient and reconstituted, respectively, for SLP-76 were transfected with pNF-kappa B-LUC construct and stimulated with PMA, PHA, and bpV[pic]. Although transfected SLP-76-deficient cell lines were responsive to bpV[pic] stimulation, a 2-fold increase in bpV-mediated activation of NF-kappa B was seen in SLP-76-restored cells (Fig. 4, panel B). As observed with ZAP-70-deficient cell lines, SLP-76-deficient cells were as responsive as their SLP-76-positive counterpart to PMA stimulation, whereas the absence of SLP-76 completely abrogated NF-kappa B induction by PHA. Thus, SLP-76, as it is the case for ZAP-70, is only required to achieve an optimal activation of NF-kappa B by bpV compounds. These results indicate that activation of the NF-kappa B signaling pathway seen following treatment of human T lymphoid cells with bpV is partially dependent on ZAP-70 and SLP-76, thus suggesting that a portion of the bpV-mediated signaling cascade is independent of both ZAP-70 and SLP-76.

Capacitative Entry of Calcium and the Calcium-regulated Effectors Calmodulin and Calcineurin Are Critical for NF-kappa B Activation by bpV-- Following TCR/CD3 stimulation of a T lymphocyte, phospholipase Cgamma 1-dependent inositol triphosphate generation from membrane-bound phosphatidylinositol bisphosphate leads to the release of calcium from intracellular stores. Because the amount of calcium present inside intracellular stores is limited, full activation of the cell can only occur by following this initial burst of calcium by an influx of extracellular calcium ions that will activate calcium effectors for a longer period and replenish depleted intracellular stores. The influx of extracellular calcium ions following depletion of intracellular stores is called capacitative calcium entry (56). This mechanism has been implicated in many signaling cascades, and we decided to evaluate its role in NF-kappa B activation after PTP inhibition by bpV. Previously described Jurkat-derived cell lines demonstrating either full (CJ parental), intermediate (CJ5.13), or low (CJ1.1) capacitative entry of calcium were transfected with pNF-kappa B-LUC construct and stimulated with PMA, PHA, and bpV[pic]. Results with the CJ1.1 cell line demonstrate that capacitative calcium entry is critical for PHA- as well as bpV-induced NF-kappa B activation, while unnecessary for the induction of NF-kappa B by PMA (Fig. 5, panel A).


View larger version (38K):
[in this window]
[in a new window]
  		Fig. 5.   Capacitative entry of calcium is crucial for bpV-mediated activation of NF-kappa B, and calcium-activated effectors calmodulin and calcineurin are also important in the induction of NF-kappa B upon treatment with bpV molecules. Panel A, Jurkat cells with a normal (CJ parental), intermediate (CJ 5.13), or very low (CJ 1.1) capacitative entry of calcium were transiently transfected with 5 µg of pNF-kappa B-LUC construct using DEAE-dextran protocol as described under "Experimental Procedures." After 16 h, cells were stimulated with PMA (20 ng/ml), PHA (3 µg/ml), or bpV[pic] (10 µM) for 6 h prior to evaluation of luciferase activity. Panel B, Jkappa B cells were either left untreated or were pretreated for 60 min at 37 °C with calmodulin inhibitor calmidazolium chloride (5 and 10 µM) prior to stimulation with TNF (8 ng/ml), PMA (20 ng/ml), and ionomycin (1 µM) or bpV[pic] (10 µM) for 6 h. Panel C, Jkappa B cells were also either left untreated or were pretreated for 30 min at 37 °C with calcineurin inhibitors (CsA at 50 and 100 ng/ml; FK506 at 5 and 10 ng/ml) prior to treatment with PMA (20 ng/ml), PMA (20 ng/ml), and ionomycin (1 µM) or bpV[pic] (10 µM) for 6 h (panel C). Luciferase activity was next monitored as described under "Experimental Procedures." All results shown are representative of three independent experiments.

Calcineurin is a serine/threonine phosphatase well known for its role in activation of the nuclear factor of activated T cells (NF-AT) and as a target for the immunosuppressive drugs CsA and FK506. Increase of intracellular calcium ions concentration leads to binding of calcium to calmodulin, which will in turn induce a conformational change of the protein. Once calmodulin is conformationally active, it binds strongly to calcineurin and activates it by unmasking its catalytic site. Many reports now describe other targets of calcineurin besides NFAT (57-59), and some have shown a role for this enzyme and its activator, calmodulin, in NF-kappa B activation by PMA and TNF (60-62). In order to assess the role of these important calcium-regulated second messengers, we pretreated cells stably transfected with pNF-kappa B-LUC (Jkappa B) with calmidazolium chloride, a well known calmodulin inhibitor, before stimulation with TNF, PMA/Iono, or bpV[pic]. Pretreatment of cells with increasing concentrations of calmidazolium chloride decreased in a dose-dependent fashion both PMA/Iono- and bpV[pic]-induced NF-kappa B activation without affecting the TNF-mediated effect (Fig. 5, panel B).

Pretreatment of transiently transfected Jkappa B cells with CsA or FK506 led also to a noticeable inhibition of NF-kappa B activation by either PMA/Iono or bpV[pic] without affecting PMA-mediated induction of NF-kappa B (Fig. 5, panel C). Given that calcineurin is targeted via different pathways by CsA and FK506 (63, 64), our results present compelling evidence that calcineurin is indeed important in TCR-mimicking stimuli such as the PMA/Iono combination as well as in the bpV-mediated activation of the NF-kappa B signaling pathway.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The overall purpose of this study was to characterize second messengers involved in the activation of NF-kappa B following inhibition of PTP activity by novel and potent inhibitors, the bpV compounds. Time course analysis performed with HIV-1 LTR- and consensus NF-kappa B-driven reporter gene vectors as well as electrophoretic mobility shift assays for nuclear translocation of NF-kappa B revealed differences between the mode of action of bpV molecules and widely used NF-kappa B inducers such as PMA, PHA, or TNF. Indeed, activation of NF-kappa B by these new inhibitors of PTP was shown to be slower and more transient than by the other activators. The more transient nature of the bpV-mediated NF-kappa B translocation might be due to the instability of the molecules themselves as these compounds are most likely rapidly reduced intracellularly. In addition, the possibility that several PTP enzymes are most likely targeted by the bpV compounds might also cause the observed delay in NF-kappa B activation when compared, for example, with TNF. Although up-regulation of the regulatory elements of HIV-1 was also demonstrated to be more transient after bpV treatment, HIV-1 LTR-dependent activation was, however, not delayed in its onset in comparison with the other activators. In fact, peak activation of HIV-1 LTR was achieved at approximately the same time for all activators tested. This could be due either by a delay in activation of the HIV-1 LTR by PMA, PHA, and TNF caused by already identified negative regulatory elements located in the HIV-1 LTR or by a faster bpV-mediated induction of another cellular transcription factor that could enhance HIV-1 LTR activation kinetics compared with NF-kappa B activation alone. Since activation kinetics are so different between bpV and other activators, mechanisms of NF-kappa B induction at work are likely to be quite distinct. Evaluation of the second messengers involved in the cascade allowed us to demonstrate that bpV-induced NF-kappa B activation shares no common membrane-proximal signaling components with the induction of NF-kappa B upon TNF treatment but share many of its components with NF-kappa B activation seen after TCR stimulation.

Common effectors between PHA, a plant lectin that acts as a T cell mitogen by activating resting T cells through CD3 molecule on the T cell membrane (65), and bpV compounds include p56lck and capacitative entry of calcium. Another TCR-mimicking stimulus, the combination of the phorbol ester PMA and the calcium ionophore ionomycin, shares calmodulin and calcineurin with bpV compounds as effectors of NF-kappa B activation. Moreover, association of p56lck with the intracellular portion of CD4 was found to greatly enhance induction of NF-kappa B by bpV compounds in a way that is highly reminiscent of TCR-induced cellular activation. The level of activation that remained in either CD4-deficient cell line or cell line expressing the truncated version of CD4 that can no longer bind to p56lck might stem from the fact that p56lck, being a myristoylated protein, is inherently associated to the inner leaflet of the cytoplasmic membrane, which might be sufficient to allow a certain degree of bpV-mediated NF-kappa B activation. These findings demonstrate that inhibition of PTP activity triggers activation of p56lck and leads to a signaling cascade highly similar to that induced by antigenic recognition.

Differences can be seen, however, between effectors needed for TCR- and bpV-induced NF-kappa B signaling pathway. First of all, surface expression of TCR·CD3 complex is not crucial for NF-kappa B induction by bpV compounds while absolutely necessary for PHA-induced NF-kappa B activation. This could come from the highly facilitated tyrosine phosphorylation of a number of molecules upon PTP inhibition that would ultimately lead to transmission of a signal even in the absence of the CD3 zeta  chain. Alternatively, bpV compounds might initiate the TCR signaling cascade at a more downstream point which then might equally require, to a certain extent, the involvement of PTK. These results also show that receptor clustering is unnecessary for cellular activation and especially for NF-kappa B activation in the context of abrogated PTP activity. A second difference is found in the absolute need for ZAP-70 and SLP-76 for PHA-induced NF-kappa B activation, whereas PTP inhibition by bpV leads to induction of NF-kappa B even in the absence of either protein. Receptor clustering by PHA thus induces a remarkably specific complex formation in which almost all enzymes or adaptors play a critical role, likely because of a tight control of complex formation exerted by PTP. In the context of PTP inhibition following bpV treatment, it can be postulated that a higher number of effectors are recruited with, as a final outcome, a more efficient activation of signal transducers. Compared with PHA, induction of NF-kappa B by bpV thus present an SLP-76- and ZAP-70-independent portion that could arise from other TCR-dependent or -independent p56lck-activated enzymes or adaptors such as phosphatidylinositol 3-kinase (66), Sam68 (67), Shc (68), or yet unidentified targets.

Our studies on the importance of capacitative entry of calcium for NF-kappa B activation by bpV compounds gave contrasting results compared with those obtained by Imbert and co-workers (25) who have used another PTP inhibitor, the pervanadate. They effectively demonstrated that EGTA treatment of human T lymphoid cells did not have any effect on NF-kappa B nuclear translocation by pervanadate (25) even if it totally abrogated pervanadate-induced intracellular calcium increase (23). In the case of bpV compounds, we observed that a defect in capacitative entry of calcium completely abrogates bpV-induced NF-kappa B-mediated gene transcription, showing a striking similarity with TCR signaling. The necessity for calcium in induction of NF-kappa B is thus remarkably different for pervanadate and bpV compounds. Further experiments are thus warranted to solve this issue.

The majority of studies aimed at studying the implication of calcium-regulated effectors calmodulin and calcineurin in NF-kappa B activation used either PMA, the combination of PMA and ionomycin, or TNF as agents to stimulate NF-kappa B (60, 61). We used similar activators for our study, and the results demonstrate clearly that bpV-induced activation of NF-kappa B resembles very closely that of PMA/Iono, an established simulacrum of antigenic recognition. In addition, our findings clarify the role of calcium in NF-kappa B induction by bpV molecules as they provide known second messengers activated by calcium that are directly implicated in NF-kappa B induction by bpV and TCR-derived signals but not in NF-kappa B induction by protein kinase C- or TNF receptor-derived signals.

Induction of cytokine production following antigenic stimulation of a helper T lymphocyte is the final step of a cascade of events that culminates in binding of critical transcription factors to specific DNA sequence in promoters and enhancers of activation-induced genes. NF-kappa B is known to be a determining transcription factor for induction of important immune response modulators such as IL-1, IL-2, IL-6, IL-8, granulocyte macrophage colony-stimulating factor, TNF, and lymphotoxin but also of adhesion molecules like intercellular adhesion molecule-1, vascular cell adhesion molecule-1, and endothelial cell adhesion molecule-1. Its role in lymphocyte activation and protection from apoptosis makes it a major target for therapeutic approaches, and every piece of knowledge regarding its activation mechanisms could lead to significant advances in the treatment of a variety of conditions, diseases, and infections. In light of the fact that bpV compounds are presently studied for the treatment of diabetes due to their insulinomimetic properties (16, 19, 20) and that administration of these compounds to mice infected with the protozoan parasite Leishmania resulted in a facilitated clearance of the parasite (69), bpV compounds could become a new class of immunomodulators for which knowledge of the mechanisms at work will be required. Moreover, distinctions between classical antigenic recognition-induced cascade and bpV-induced cascade could become useful in order to restore a defective lymphocyte-mediated immunity such as in HIV-infected individuals if virus replication is controlled by an effective medication. Our study thus represents a groundwork for subsequent studies involving bpV compounds in lymphocyte activation and characterization of signaling cascades controlled by phosphotyrosyl phosphatases.

    ACKNOWLEDGEMENTS

We thank B. I. Posner for providing bpV compounds; A. Weiss for J14-V-29 and J14-76-11 cells; R. Lewis for CJ parental, CJ 5.13, and CJ 1.1 cell lines; and R. Abraham for P116, P116 cl. 39, and P116 cl. 40 cells. We are indebted to C. Couture for pEFneo and pEFneo LCK-wt. The JCAM1.6 and JRT3 cell lines were provided by the American Type Culture Collection. The following items were obtained from the NIH AIDS Research and Reference Reagent Program, 1G5 and Jurkat E6.1.

    FOOTNOTES

* This work was supported in part by Grant AI-15575 (to M. J. T.) from the National Health Research and Development Program/Medical Research Council (MRC) of Canada HIV/AIDS Research Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Both authors contributed equally to this work.

§ Recipient of an MRC Scientist award. To whom correspondence should be addressed: Unité d'ImmunoRétrovirologie Humaine, Centre de Recherche en Infectiologie, RC709, Centre Hospitalier Universitaire de Québec, Pavillon CHUL, 2705 Blvd. Laurier, Sainte-Foy, G1V 4G2 Québec, Canada. Tel.: 418-654-2705; Fax: 418-654-2715; E-mail: Michel.J.Tremblay@crchul.ulaval.ca.

    ABBREVIATIONS

The abbreviations used are: NF-kappa B, nuclear factor kappa B; bpV, bisperoxovanadium; HIV-1, human immunodeficiency virus type-1; Iono, ionomycin; LTR, long terminal repeat; NF-AT, nuclear factor of activated T cells; PHA, phytohemagglutinin A; PMA, phorbol 12-myristate 13-acetate; PTP, phosphotyrosyl phosphatase or protein tyrosine phosphatase; PTK, protein tyrosine kinase; TNF, tumor necrosis factor-alpha ; IL, interleukin; TCR, T cell receptor; CsA, cyclosporin A; [bipy], bipyridine; [HOpic], 5-hydroxypyridine-2-carboxylic acid anion; [pic], pyridine-2-carboxylic acid anion.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Ghosh, S., May, M. J., and Kopp, E. B. (1998) Annu. Rev. Immunol. 16, 225-260[CrossRef][Medline] [Order article via Infotrieve]
2. Baeuerle, P. A., and Baltimore, D. (1988) Science 242, 540-546[Abstract/Free Full Text]
3. Traenckner, E. B., Pahl, H. L., Henkel, T., Schmidt, K. N., Wilk, S., and Baeuerle, P. A. (1995) EMBO J. 14, 2876-2883[Medline] [Order article via Infotrieve]
4. Chen, Z., Hagler, J., Palombella, V. J., Melandri, F., Scherer, D., Ballard, D., and Maniatis, T. (1995) Genes Dev. 9, 1586-1597[Abstract/Free Full Text]
5. Rodriguez, M. S., Wright, J., Thompson, J., Thomas, D., Baleux, F., Virelizier, J. L., Hay, R. T., and Arenzana-Seisdedos, F. (1996) Oncogene 12, 2425-2435[Medline] [Order article via Infotrieve]
6. Malek, S., Huxford, T., and Ghosh, G. (1998) J. Biol. Chem. 273, 25427-25435[Abstract/Free Full Text]
7. Jamieson, C., McCaffrey, P. G., Rao, A., and Sen, R. (1991) J. Immunol. 147, 416-420[Abstract]
8. Lowenthal, J. W., Ballard, D. W., Bohnlein, E., and Greene, W. C. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 2331-2335[Abstract/Free Full Text]
9. Osborn, L., Kunkel, S., and Nabel, G. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 2336-2340[Abstract/Free Full Text]
10. Natoli, G., Costanzo, A., Moretti, F., Fulco, M., Balsano, C., and Levrero, M. (1997) J. Biol. Chem. 272, 26079-26082[Abstract/Free Full Text]
11. Kontgen, F., Grumont, R. J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995) Genes Dev. 9, 1965-1977[Abstract/Free Full Text]
12. Weih, F., Carrasco, D., Durham, S. K., Barton, D. S., Rizzo, C. A., Ryseck, R. P., Lira, S. A., and Bravo, R. (1995) Cell 80, 331-340[CrossRef][Medline] [Order article via Infotrieve]
13. Snapper, C. M., Rosas, F. R., Zelazowski, P., Moorman, M. A., Kehry, M. R., Bravo, R., and Weih, F. (1996) J. Exp. Med. 184, 1537-1541[Abstract/Free Full Text]
14. Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S., and Baltimore, D. (1995) Nature 376, 167-170[CrossRef][Medline] [Order article via Infotrieve]
15. Doi, T. S., Takahashi, T., Taguchi, O., Azuma, T., and Obata, Y. (1997) J. Exp. Med. 185, 953-961[Abstract/Free Full Text]
16. Posner, B. I., Faure, R., Burgess, J. W., Bevan, A. P., Lachance, D., Zhang-Sun, G., Fantus, I. G., Ng, J. B., Hall, D. A., Lum, B. S., and Shaver, A. (1994) J. Biol. Chem. 269, 4596-4604[Abstract/Free Full Text]
17. Huyer, G., Liu, S., Kelly, J., Moffat, J., Payette, P., Kennedy, B., Tsaprailis, G., Gresser, M. J., and Ramachandran, C. (1997) J. Biol. Chem. 272, 843-851[Abstract/Free Full Text]
18. Morinville, A., Maysinger, D., and Shaver, A. (1998) Trends Pharmacol. Sci. 19, 452-460[CrossRef][Medline] [Order article via Infotrieve]
19. Eriksson, J. W., Lonnroth, P., Posner, B. I., Shaver, A., Wesslau, C., and Smith, U. P. (1996) Diabetologia 39, 235-242[CrossRef][Medline] [Order article via Infotrieve]
20. Bevan, A. P., Drake, P. G., Yale, J. F., Shaver, A., and Posner, B. I. (1995) Mol. Cell. Biochem. 153, 49-58[CrossRef][Medline] [Order article via Infotrieve]
21. Secrist, J. P., Burns, L. A., Karnitz, L., Koretzky, G. A., and Abraham, R. T. (1993) J. Biol. Chem. 268, 5886-5893[Abstract/Free Full Text]
22. Imbert, V., Farahifar, D., Auberger, P., Mary, D., Rossi, B., and Peyron, J. F. (1996) J. Inflamm. 46, 65-77[Medline] [Order article via Infotrieve]
23. Imbert, V., Peyron, J. F., Farahi Far, D., Mari, B., Auberger, P., and Rossi, B. (1994) Biochem. J. 297, 163-173
24. Zhao, Z., Tan, Z., Diltz, C. D., You, M., and Fischer, E. H. (1996) J. Biol. Chem. 271, 22251-22255[Abstract/Free Full Text]
25. Imbert, V., Rupec, R. A., Livolsi, A., Pahl, H. L., Traenckner, E. B., Mueller-Dieckmann, C., Farahifar, D., Rossi, B., Auberger, P., Baeuerle, P. A., and Peyron, J. F. (1996) Cell 86, 787-798[CrossRef][Medline] [Order article via Infotrieve]
26. Barbeau, B., Bernier, R., Dumais, N., Briand, G., Olivier, M., Faure, R., Posner, B. I., and Tremblay, M. (1997) J. Biol. Chem. 272, 12968-12977[Abstract/Free Full Text]
27. Krejsa, C. M., Nadler, S. G., Esselstyn, J. M., Kavanagh, T. J., Ledbetter, J. A., and Schieven, G. L. (1997) J. Biol. Chem. 272, 11541-11549[Abstract/Free Full Text]
28. Gillis, S., and Watson, J. (1980) J. Exp. Med. 152, 1709-1719[Abstract/Free Full Text]
29. Straus, D. B., and Weiss, A. (1992) Cell 70, 585-593[CrossRef][Medline] [Order article via Infotrieve]
30. Aguilar-Cordova, E., Chinen, J., Donehower, L., Lewis, D. E., and Belmont, J. W. (1994) AIDS Res. Hum. Retroviruses 10, 295-301[Medline] [Order article via Infotrieve]
31. Williams, B. L., Schreiber, K. L., Zhang, W., Wange, R. L., Samelson, L. E., Leibson, P. J., and Abraham, R. T. (1998) Mol. Cell. Biol. 18, 1388-1399[Abstract/Free Full Text]
32. Morley, B. J., Chin, K. N., Newton, M. E., and Weiss, A. (1988) J. Exp. Med. 168, 1971-1978[Abstract/Free Full Text]
33. Yablonski, D., Kuhne, M. R., Kadlecek, T., and Weiss, A. (1998) Science 281, 413-416[Abstract/Free Full Text]
34. Fanger, C. M., Hoth, M., Crabtree, G. R., and Lewis, R. S. (1995) J. Cell Biol. 131, 655-667[Abstract/Free Full Text]
35. Folks, T., Powell, D. M., Lightfoote, M. M., Benn, S., Martin, M. A., and Fauci, A. S. (1986) Science 231, 600-602[Abstract/Free Full Text]
36. Tremblay, M., Meloche, S., Gratton, S., Wainberg, M. A., and Sekaly, R. P. (1994) EMBO J. 13, 774-783[Medline] [Order article via Infotrieve]
37. Couture, C., Baier, G., Oetken, C., Williams, S., Telford, D., Marie-Cardine, A., Baier-Bitterlich, G., Fischer, S., Burn, P., and Altman, A. (1994) Mol. Cell. Biol. 14, 5249-5258[Abstract/Free Full Text]
38. Barber, E. K., Dasgupta, J. D., Schlossman, S. F., Trevillyan, J. M., and Rudd, C. E. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3277-3281[Abstract/Free Full Text]
39. Wange, R. L., Malek, S. N., Desiderio, S., and Samelson, L. E. (1993) J. Biol. Chem. 268, 19797-19801[Abstract/Free Full Text]
40. Neumeister, E. N., Zhu, Y., Richard, S., Terhorst, C., Chan, A. C., and Shaw, A. S. (1995) Mol. Cell. Biol. 15, 3171-3178[Abstract]
41. Zhang, W., Sloan-Lancaster, J., Kitchen, J., Trible, R. P., and Samelson, L. E. (1998) Cell 92, 83-92[CrossRef][Medline] [Order article via Infotrieve]
42. Wardenburg, J. B., Fu, C., Jackman, J. K., Flotow, H., Wilkinson, S. E., Williams, D. H., Johnson, R., Kong, G., Chan, A. C., and Findell, P. R. (1996) J. Biol. Chem. 271, 19641-19644[Abstract/Free Ful