|
J Biol Chem, Vol. 274, Issue 5, 2658-2664, January 29, 1999
GATA-6 Activates Transcription of Thyroid Transcription
Factor-1*
Jessica R.
Shaw-White,
Michael D.
Bruno, and
Jeffrey A.
Whitsett
From the Children's Hospital Medical Center, Division of Pulmonary
Biology, Cincinnati, Ohio 45229-3039
 |
ABSTRACT |
Thyroid transcription factor-1 (TTF-1) is
expressed in respiratory epithelial cells, where it regulates the
transcription of target genes expressed in a cell-selective manner.
GATA-5 and -6, members of the zinc finger family of transcription
factors, are also expressed in various cell types within in the
developing lung. In the present work, GATA-6 mRNA was detected in
adult mouse lung, purified mouse type II epithelial cells, and
differentiated mouse pulmonary adenocarcinoma cells (MLE-15 cells),
being co-expressed with TTF-1 mRNA. In order to test whether GATA
factors regulated TTF-1 gene transcription, GATA-5 and -6 expression
vectors were co-transfected with TTF-1 luciferase expression vector.
GATA-6, but not GATA-5, markedly activated TTF-1 gene transcription in HeLa cells. EMSA and supershift analysis with GATA-6 antiserum demonstrated that GATA-6 in MLE-15 cell nuclear extracts bound to an
element located 96-101 base pairs from major start of TTF-1 gene
transcription. Site directed mutagenesis of the GATA element in the
TTF-1 promoter region inhibited transactivation by GATA-6 in HeLa
cells. GATA-6 is co-expressed with TTF-1 in the respiratory epithelium
in vivo and respiratory epithelial cells in
vitro. GATA-6 strongly enhanced activity of the human TTF-1 gene
promoter in vitro. These findings support the concept that
GATA-6 may play an important role in lung cell differentiation and gene
expression, at least in part by altering the expression of TTF-1 and
its potential targets.
 |
INTRODUCTION |
Thyroid transcription factor-1
(TTF-1)1 is a 38-kDa member
of the Nkx family of transcription factors (1). TTF-1 is expressed in
developing thyroid and respiratory epithelium, as well as in subsets of
cells in the embryonic diencephalon (2). In the fetal lung, TTF-1 is
expressed in highly regulated pattern in subsets of respiratory
epithelial cells, both in the conducting and peripheral airways and
lung saccules (3-5). The level of expression of TTF-1 mRNA is
generally higher in fetal than in postnatal lung, being confined
primarily to subsets of bronchiolar and type II epithelial cells in the
postnatal human and mouse lung. TTF-1 binds to and activates the
transcription of a number of genes expressed selectively in thyroid
(e.g. thyroperoxidase, thyroglobulin, and the sodium-iodide
transporter) (6, 7) and in lung (surfactant proteins A, B, and C (SP-A,
SP-B, and SP-C) and Clara cell secretory protein (CCSP)) (8-12). TTF-1
also plays a critical role in lung morphogenesis. Deletion of TTF-1 in
transgenic mice causes severe thyroid and lung hypoplasia (13). Thus,
TTF-1 modulates both lung morphogenesis and respiratory epithelial cell
gene expression in the developing and postnatal lung.
TTF-1 is expressed in the progenitor cells of the lung buds early in
rat, mouse, and human development. TTF-1 is encoded by a single gene in
humans located on chromosome 14q13 (1). While the elements governing
TTF-1 expression have not been defined with certainty, three distinct
transcriptional start sites within the proximal promoter region and the
expression of alternatively spliced TTF-1 cDNAs have been described
in the rat and human TTF-1 genes (14-18). The 5' regulatory regions of
the human and rat TTF-1 genes have been studied in vitro
(15, 19). TTF-1 transcription was enhanced by HNF-3 , which bound to
two distinct sites located at bp 135 to 124 and 14 to 3
relative to the major start of transcription in the human gene,
suggesting that TTF-1 regulation may be influenced by other
transcription factors expressed in the foregut endoderm (19).
The GATA family of transcription factors includes a family of zinc
finger domain-containing nuclear proteins that includes at least six
distinct proteins that are expressed in a variety of tissues. GATA
family members, particularly GATA-1, -2, and -3, were initially
identified as important in the control of gene regulation during
hematopoiesis (20). Gene targeting of GATA-1, -2, and -3 demonstrated
their important roles in the development of the hematopoietic system,
being critical for gene expression and development of erythroid cell
lineages in the developing mouse embryo (21-24). More recently,
several of the GATA family members were identified in nonhematopoietic
sites including the heart, gastrointestinal, and genitourinary tracts.
The finding that GATA-4, -5, and -6 are expressed in the foregut or
cardiac regions of the developing embryo suggested their potential role
in organogenesis and gene expression in the heart and lung (25-27).
GATA-5 and -6 are expressed in developing mouse lung, GATA-6 being
detected primarily in epithelial cell respiratory tubules of the fetal lung, in a pattern similar to that previously described for TTF-1. The
finding that, in the heart, Nkx2.5 (structurally closely related to
TTF-1) and GATA-4 interact in the regulation of cardiac specific gene
expression, suggested that GATA family members and TTF-1 might interact
in respiratory epithelial cells (28).
The present work was undertaken to determine whether GATA-5 or -6 was
expressed in respiratory epithelial cells in vivo and in vitro and whether they might play a role in the
regulation of TTF-1 gene expression, thereby influencing TTF-1
transcriptional targets. GATA-6, but not GATA-5, was expressed at high
levels in the mouse pulmonary adenocarcinoma cells in vitro
and in freshly isolated rat type II epithelial cells. GATA-6 activated
a regulatory region of the mouse TTF-1 gene in HeLa cells and in human
pulmonary adenocarcinoma cells (H441 cells).
 |
EXPERIMENTAL PROCEDURES |
RNA Isolation and Northern Blot Analysis--
Cell lines were
maintained in standard tissue culture conditions prior to isolation of
RNA. Rat type II epithelial cells were isolated after protease
digestion of adult rat lung as described previously (29). Total RNA was
isolated by an adapted method of Chirgwin et al. (30). Cells
were lysed directly on the tissue culture plate using 4 M
guanidine thiocyanate, 0.5% N-lauroylsarcosine, 25 mM sodium citrate, and 0.1 M
-mercaptoethanol. Tissue was homogenized in the same buffer. Phase
lock gels (5 Prime 3 Prime, Inc., Boulder, CO) were used to prepare
RNA. RNA was quantitated by absorbance at 260 nm. Fifteen µg of total
RNA were loaded onto a 0.8% formaldehyde gel and transferred to
Maximum strength Nytran (Schleicher & Schuell) and bound to the filter
by UV cross-linking in a Stratalinker (Stratagene, La Jolla, CA).
Hybridization was done in 50% formamide, 5× SSPE, 2.5× Denhardt's
solution, 1% SDS, and 200 µg/ml salmon sperm DNA at 42° C.
Identification of Genomic Clones--
A 129SvJ mouse liver
genomic DNA library (Lambda DASH II, Stratagene) was provided by Marcia
M. Shull, University of Cincinnati. Approximately 3.4 genome
equivalents were plated and lifted onto Hybond N (Amersham Pharmacia
Biotech). This was screened with a 1.3-kb rat TTF-1 cDNA provided
by Dr. R. Di Lauro (Naples, Italy). The probe was labeled by random
primer labeling and hybridized at a concentration of 106
dpm/ml in 6× SSC, 5× Denhardt's, 0.1% SDS, and 0.1 mg/ml salmon sperm DNA at 55° C. The final wash conditions were 0.5× SSC, 0.1% SDS at 55° C for 30 min. Four clones contained the TTF-1 gene, the
largest clone containing 1.7 kb of 5'-flanking sequence. Sequence of
the promoter region was determined by using the dideoxy sequencing reaction product (Sequenase, U.S. Biochemical Corp.). Restriction fragments were used to compare the maps of the clone with mouse genomic DNA.
TTF-1 Luciferase Plasmid Constructions and
Mutagenesis--
Primers were used to amplify the desired region of
the TTF-1 gene. The 3'-end of all constructs included all of the
5'-untranslated region up to, but not including, the ATG and had a
HindIII site inserted in to aid in cloning. The DNA fragment
was subcloned into pGL2-Basic (Promega, Inc., Madison, WI).
The following primers were used to generate the luciferase constructs
(5'-3' location followed by sequence): +200 to +185, CCCAAGCTTGATTCGGCGTCGGCTG; 168 to 149, TTGAGACCTAAAAATCTTGA; 110
to 87, GTAAGCTAATTATCTCGGGCAAGA; 95 to 72,
TCCCCGGGCAAGATGTAGGCTTCT; 87 to 69, ATGTAGGCTTCTATTGTCT;
110 to 87 (GATA mutant upper), GTAAGCTAATGAATTCGGGCAAGA; 87 to
110 (GATA mutant lower), TCTTGCCCGAATTCATTAGCTTAC; pGL2-Basic (GL1)
(Promega), TGTATCTTATGGTACTGTAACTG.
To make mTTF-1-142 luciferase, primers +200 to +185 and 168 to 149
were used on a mouse genomic clone. The polymerase chain reaction
product was digested with HindIII and cloned into pGL2-Basic (Promega). To make mTTF-1-110 luciferase primers, +200 to +185 and
110 to 87 were used. To make mTTF-95, primers +200 to +185 and 95
to 72 were used. To make mTTF-1-87 luciferase primers, +200 to +185
and 87 to 69 were used. To make a construct mutant for GATA
binding, primers +200 to +185 and 110 to 87 mutant primer and in a
separate reaction primers GL1 and 87 to 110 mutant primer were used
on a mTTF-1-142 template. Products were gel-purified and the combined
in a polymerase chain reaction with primers +200 to +185 and GL1. This
product was digested with HindIII, cloned into pGL2-Basic.
The resultant plasmid was called mTTF-1-142 GATA mutant luciferase.
The veracity of mutations was confirmed by both restriction analysis
and nucleotide sequencing of double-stranded templates.
Cell Transfection, Luciferase, and -Galactosidase
Assays--
Cell transfection was performed by the calcium phosphate
coprecipitation method except that glycerol shock was not used (31). Transfections were done in six-well plates with 0.5 pmol of reporter luciferase construct, 0.2 pmol of transactivator (or empty vector), and
0.1 pmol of CMV- -galactosidase to normalize for transfection efficiency. CMV-rTTF-1 was a gift of Dr. R. Di Lauro (Stazione Zoologica, A. Dohrn, Naples, Italy), and CMV-GATA-5 and CMV-GATA-6 were
a gift of Dr. J. Molkentin (Division of Molecular Cardiology, Children's Hospital Medical Center, Cincinnati, OH). Fresh control medium was added approximately 20 h after transfection. Cells were
harvested in Reporter Lysis Buffer (Promega, Madison, WI). The lysates
were prepared and aliquots assayed for -galactosidase and luciferase
activity with a luminometer (Analytical Luminescence Laboratory, San
Diego, CA). To correct for variations in transfection efficiency,
luciferase activity was normalized to -galactosidase activity. The
normalized luciferase activity of the mTTF promoter was divided by the
normalized luciferase activity of pGL2-Basic in the presence of the
appropriate transactivating plasmid to determine relative luciferase activity.
Preparation of Nuclear Extracts--
Cell lines were maintained
in standard tissue culture conditions prior to making the nuclear
extracts. Cells were cooled to 4° C, washed in phosphate-buffered
saline, and scraped off of the plates. Cells were spun at 3000 rpm at
4° C for 5 min and then washed again twice with phosphate-buffered
saline before lysing. Cells were then resuspended in three packed cell
volumes of lysis buffer consisting of 10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1.5 mM
MgCl2, and 0.2% Nonidet P-40, 100 µM
dithiothreitol, and 50 µM phenylmethylsulfonyl fluoride.
Cells were then vortexed at medium speed for 10 s and incubated on
ice for 5 min. Nuclei were then pelleted at 3000 rpm and 4° C for 5 min. The pellet fraction contained the nuclei. One packed volume of
extract buffer consisting of 20 mM HEPES, pH 7.9, 420 mM NaCl, 0.1 mM EDTA, 1.5 mM
MgCl2, 25% glycerol, 100 µM dithiothreitol,
and 50 µM phenylmethylsulfonyl fluoride was added to the
nuclei and vortexed at medium speed every minute for 10 min. The
nuclear extracts were then centrifuged at 15,000 rpm for 5 min,
aliquoted into chilled tubes, quick frozen in liquid nitrogen, and
stored at 80° C. Protein concentration was determined by the
method of Lowry (32).
Annealing of Synthetic Oligonucleotides--
Oligonucleotides
were annealed at a concentration of 250 mM in 250 mM Tris (pH 7.8) at 95° C for 15 min and then cooled
slowly to room temperature overnight and stored at 20° C. The
annealed oligonucleotides were diluted to 5 mM in the same
buffer. Probes were labeled using [ -32P]ATP and T4
polynucleotide kinase. End-labeled probes were purified from
unincorporated [ -32P]ATP by an Amersham Pharmacia
Biotech Nick column eluted in a 400-µl volume. Unlabeled probe was
placed on a Nick column at a 10-fold greater concentration and also
eluted in 400 µl. Oligonucleotides used in shifts consisted of
nucleotides 110 to 87 and their complement 87 to 110, and the
GATA mutant consisting of the nucleotide 110 to 87 region (and
complement containing the mutation TTATCT TGAATT). Oligonucleotides
were generated from the published sequence of the histidine
decarboxylase promoter (33) consisting of the sequence
TACTGCTGATAAGGAAA and complement TTTCCTTATCAGCAGTA.
Electrophoretic Mobility Gel Shift (EMSA) Assay--
The
procedure for EMSA was adapted from methods previously described (34).
Briefly, 5 µg of extract and 10 µl of unlabeled oligonucleotide
competitor DNA (125 nM) were incubated in the same volume
of buffer consisting of 50 mM HEPES, pH 7.9, 100 mM KCl, 4 mM EDTA, 200 ng/ml poly(dI-dC), 4 mM dithiothreitol, 20 mM MgCl2,
40% glycerol, and 2 mM phenylmethylsulfonyl fluoride for
10 min on ice. One µl of 12.5 nM labeled probe was added, and the mixture was incubated for another 10 min on ice. Supershifts were performed by preincubating anti-GATA-6 antiserum or control rabbit
serum with the labeled oligonucleotide under similar assay conditions.
GATA-6 rabbit polyclonal antiserum was kindly provided by Dr. Kenneth
Walsh (Tufts University, Boston). Bound and free probe were resolved by
nondenaturing polyacrylamide gel electrophoresis. Recombinant rat TTF-1
homeodomain and supershift with rabbit anti-TTF-1 were performed as
described previously (9). Five percent gels (acrylamide/bisacrylamide,
29:1, 0.5× TBE, 2.5% glycerol, 1.5 mm thick) were run in 0.5× TBE
running buffer at constant current (30 mA) for approximately 85 min.
Gels were blotted to Whatman 3 MM paper, dried under vacuum, and
exposed to x-ray film from 4 h to overnight at room temperature.
 |
RESULTS |
GATA-6 and TTF-1 Are Co-expressed in Respiratory Epithelial
Cells--
Northern blot analysis of mRNA obtained from various
respiratory epithelial cells and nonpulmonary cells was used to assess expression of GATA-5, GATA-6, and TTF-1 mRNAs. GATA-5 and -6 mRNAs were readily identified in RNA isolated from whole mouse
lung, migrating as 8.0- and 3.2-kb species, respectively (Fig.
1). GATA-6, but not GATA-5, mRNAs
were detected at high concentrations in freshly isolated rat type II
epithelial cells, previously shown to express TTF-1 and varying amounts
of TTF-1 target genes including surfactant protein A, B, and C (14,
19). GATA-6 and TTF-1 were also co-expressed in various SV40 large T
immortalized clonal mouse lung epithelial cell lines, including MLE-15
and MLE-F6 cells; however, GATA-6 was not readily detected in H441
human pulmonary adenocarcinoma cells by Northern blot analysis. GATA-6 mRNA was detected in 3T3 cells and in SV40 large T antigen
immortalized fetal mouse lung mesenchymal cells (mFLM cells). Neither
GATA-6 nor TTF-1 mRNA was detected in HeLa cells (data not shown).
GATA-5 mRNA was not detected in H441, MLE pulmonary adenocarcinoma
cells or in type II cells. Thus, GATA-6 and TTF-1 were co-expressed in
various differentiated pulmonary adenocarcinoma cells and in freshly
isolated rat type II cells, consistent with the finding that both
mRNAs were detected in subsets of respiratory epithelial cells in
the fetal mouse lung (26, 27). In contrast, GATA-5 mRNA was not
readily identified in the immortalized respiratory epithelial cells or
in type II cells, consistent with its localization in nonepithelial
cells in the developing mouse lung as assessed by in situ
hybridization (26, 27). The co-localization of GATA-6 and TTF-1 with
TTF-1 targets including SP-A, SP-B, and SP-C in various respiratory
epithelial cells is consistent with the possibility that GATA-6 may
influence transcription of TTF-1 or its target genes.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 1.
Northern blot analysis of human and mouse
cell lines and rat type II cells. Northern analysis was performed
with 15 µg of total RNA from mouse cell lines MLE-15 (lane
1), MLE-F6 (lane 2), mFLM91
(lane 3), 3T3 (lane 4),
human cell lines 9/HTEO (lane 5), H441
(lane 6), H446 (lane 7),
Beas2B (lane 8), adult mouse lung
(lane 9), and freshly isolated adult rat type II
cells (lane 10). The probe used to detect GATA-5
was a 2.1-kb EcoRI-XhoI fragment of mouse GATA-5
cDNA, which contained the entire coding sequence. The probe used to
detect GATA-6 was a 2.4-kb XbaI-SalI fragment of
mouse GATA-6 cDNA, which contained the entire coding region. The
probe used for -actin was a 400-bp EcoRI fragment of
human -actin cDNA.
|
|
5' Regulatory Region of the Mouse TTF-1 Gene Contains a GATA
Regulatory Element--
Inspection of the 5' region of the mouse TTF-1
gene revealed the nucleotide sequence TTATCT, located at 101 to 96
relative to the major transcription start site, consistent with its
role as a potential GATA cis-acting element. Previous work from this laboratory identified a large DNase protected site by in
situ footprint analysis with nuclear extracts from MLE-15 cells in this region (14). The nucleotide sequence of this region of the TTF-1
gene is highly conserved in human rat and mouse TTF-1 genes. The
potential GATA site was located near the element TGTTT, previously
demonstrated to bind HNF-3 , activating TTF-1 gene promoter activity
(19). The potential GATA site was also located close to a potential
TTF-1 site (CAAG), located 5 bp from the GATA site. To test whether
GATA family members might regulate TTF-1 promoter activity, the 5'
region of the mouse TTF-1 gene was ligated to the luciferase genes
to produce mTTF-1-142. This region of the TTF-1 gene contains 142 bp
5' of the primary transcription start site, as well as 5'-untranslated
sequence derived from the major TTF-1 transcript (Fig.
2). This 5'-untranslated region encodes two alternative transcripts and includes a small potential intron (15).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Nucleotide sequence of the 5' region of the
mouse gene. Nucleotide sequence was determined as described under
"Experimental Procedures." The downward
arrows represent the 5'-end of the mTTF-1 luciferase
constructs. The upward arrow represents the
3'-end, which stops just short of the ATG codon. The 5'-end of the
fragments are located at 142, 110, 95, and 87 bp upstream of
the major start site. The boldface asterisk
denotes the major transcriptional start site, and the other
two asterisks denote the other minor start sites
as previously published (14, 15). The previously identified HNF-3
and GATA-6 binding sites and the TTF-1 consensus site are illustrated.
The alternatively spliced intron in the 5'-untranslated region is
underlined. The mutant base pair changes for transfections
and EMSA are shown above the GATA binding site.
|
|
Transient co-transfection experiments were performed in which
mTTF-1-142 was co-transfected with expression vectors encoding mouse
GATA-5 (CMV-GATA-5) and GATA-6 (CMV-GATA-6) into HeLa cells. mTTF-1-142 was markedly activated by co-transfection with GATA-6 but
not GATA-5 (Fig. 3) Likewise,
cotransfection of GATA-6 activated the mTTF-1-142 luciferase construct
after transfection into H441 adenocarcinoma cells from 17 ± 2.3 to 28 ± 3.6 luciferase units (mean ± S.E.,
p < 0.01). Deletion mutations were made producing vectors at 110, 95, and 87 bp relative to the start of
transcription of the TTF-1 gene. In HeLa cells, significant stimulation
of TTF-1 promoter activity by GATA-6 was observed with 5' sequences
from 110 bp; however, maximal basal and stimulated activities were observed when a larger region ( 142 bp) was included. The nucleotide sequences between 110 and 95 contained a region that encodes a
consensus GATA binding site TTATCT (Fig.
4). Mutation of the GATA site in
mTTF-1-142 (TTATCT to TGAATT) completely inhibited transactivation by
GATA-6 after co-transfection in HeLa cells (Fig. 4). Thus, a GATA-6
response element was located at 101 to 96 in the murine TTF-1
promoter. In contrast to the findings in HeLa cells, transfection of
MLE-15 cells with CMV-GATA-6 did not further transactivate the wild
type TTF-1-142 construct, perhaps related to the high levels of
exogenous GATA-6 expression in this cell line. Luciferase activity of
the mTTF-1-142 (TGAATT mutant) construct was similar to the wild type
construct in MLE-15 cells (data not shown).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3.
GATA-6, but not GATA-5, transactivates the
TTF-1 promoter. Luciferase assays were performed in HeLa cells
after transient transfection of the mTTF-1-142 luciferase construct
with pCDNA1.1 (vector without transactivator), CMV-GATA-5, and
CMV-GATA-6. Transfections were normalized to -galactosidase
activity. Luciferase activity of the TTF-1 promoter construct was
divided by the luciferase activity from the promoterless luciferase
vector (pGL2-Basic) transfected with the appropriate transactivator.
Values are mean ± S.E. n = 3, p < 0.0005 as assessed by unpaired t test versus
pCDNA1.1.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
A site of GATA-6 activation is located
between 142 and 95. Deletion analysis was used to identify the
site of GATA-6 activation on the mTTF-1 promoter.
GATA-6-dependent activity was lost in deletions between
110 and 95 in the mTTF-1 promoter; however, maximal
GATA-6-dependent activity was observed with the larger
construct 142. A consensus site (TTACTC) for GATA binding was located
at 96 to 101 in this region. This site was mutated to TGAATT and
tested for GATA-6 transactivation in HeLa cells. Relative luciferase
values were determined as described under "Experimental
Procedures." The deletion and mutant constructs are further described
under "Experimental Procedures" and in Fig. 1. Values represent
mean ± S.E. of three separate experiments. * and **,
p < 0.001 and p < 0.005, respectively, versus pCDNA1.1 control.
|
|
GATA-6 Binds to the mTTF-1 Gene--
Electromobility shift assays
were performed using nuclear extracts from MLE-15, MLE-F6, 3T3, and
H441 and HeLa cells (Fig. 5). A gel shift
was readily detected with an oligonucleotide 110 to 87 containing
the GATA site with nuclear extracts from MLE-15, MLE-F6, and 3T3 cells
consistent with the detection of GATA-6 mRNA as determined by
Northern blot analysis. This DNA complex was lacking in HeLa and H441
cells, also consistent with the lack of GATA-6 mRNA in these cells.
The protein-DNA complex was inhibited by paucity or absence of the
unlabeled self-oligonucleotide. The same oligonucleotide containing the
mutated GATA site ( 110 to 87) (TTATCT TGAATT) did not compete
for binding to MLE-15 cell nuclear extracts (Fig. 5, lane
3). An oligonucleotide containing the GATA-6 site identified
in the histidine decarboxylase gene (33) bound to MLE-15 nuclear
extracts. Binding of the histidine carboxylase GATA-6 site was competed
by self oligonucleotide and by the oligonucleotide containing the
GATA-6 site from the TTF-1 gene. Formation of the complex with the
histidine decarboxylase GATA-6 site was not inhibited by the
oligonucleotide containing the mutant GATA site (Fig.
6), further demonstrating the specificity of the interaction.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 5.
A, EMSA of the GATA-6 binding site. EMSA
analysis was performed using an oligonucleotide located 110 to 87
in the mTTF-1 gene using nuclear extracts from MLE-15 (lanes
1-3), HeLa (lanes 4-6), 3T3
(lanes 7-9), H441 (lanes
10-12), and MLE-F6 (lane 13) cells.
The arrow indicates the GATA-6-dependent
complex. Lanes with no competitor are labeled TE.
The complex was inhibited by a 100-fold excess of the same unlabeled
oligonucleotide and labeled self. The same oligonucleotide bearing a
mutant GATA site (TTACTC TGAATT), changed at base pairs 100 to
97, did not compete for binding. These lanes are labeled
mut. B, supershift analysis of the mTTF-1 GATA-6
binding site. EMSA analysis was performed using mTTF-1 gene sequences
from 110 to 87 and MLE-15 cell nuclear extracts. Lane
1 represents a GATA-6-specific complex formed by the wild
type oligonucleotide identified by the arrow. This complex
was supershifted by GATA-6 antiserum (lane 2),
but not by preimmune serum (lane 3). Sera were
diluted 1:100. The formation of a GATA-6-specific protein complex was
markedly inhibited by introduction of a mutation into the GATA binding
site (lanes 4-6).
|
|

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 6.
The GATA-6 binding site in the mouse TTF-1
gene competes with a GATA-6 binding site from the histidine
decarboxylase gene. EMSA analysis was performed using a labeled
histidine decarboxylase (HDC) oligonucleotide (33) with
nuclear extract from MLE-15 cells (lane 1). The
complex was inhibited by 100× self-competitor and labeled self
(lane 2). The addition of an unlabeled
oligonucleotide consisting of 110 to 87 in the mTTF-1 gene resulted
in a loss of this complex (lane 3, TTF-1).
Oligonucleotides with mutations in the GATA-6 site of TTF-1 did not
compete with the histidine decarboxylase probe, labeled MUT
(lane 4).
|
|
Supershift Analysis Identifies GATA-6 Binding--
Antiserum to
human GATA-6 caused a supershift when co-incubated with MLE-15 nuclear
extract and the TTF-1 oligonucleotide 110 to 87 (Fig.
5B). Binding of GATA-6 and the supershift were markedly
decreased when the mutant GATA oligonucleotide was utilized in the EMSA
(Fig. 5B, lanes 4-6).
GATA-6 Enhances TTF-1 Transcription Independently of TTF-1 or
HNF-3 --
A canonical TTF-1 binding site, CAAG, is located in
close apposition to the GATA-6 binding site in the murine TTF-1 gene. Since GATA-4 and Nkx2.5 are known to interact in a synergistic manner
to activate myosin heavy chain gene expression in cardiac cells
(28), we tested whether GATA-6 or TTF-1 might interact synergistically
on the TTF-1 promoter. Expression vectors encoding rat TTF-1
(CMV-TTF-1) and GATA-6 (CMV-GATA-6) were co-transfected with the
parental TTF-1-luciferase reporter construct (TTF-1-142) into HeLa
cells. TTF-1 did not enhance, but slightly inhibited, GATA-6-dependent activity (Fig.
7). Thus, GATA-6 stimulation of TTF-1
transcription neither requires nor is synergized by TTF-1. Consistent
with this observation, recombinant TTF-1 homeodomain did not bind to
the CAAG element in the GATA site-containing oligonucleotide from the
TTF-1 gene. Likewise, MLE-15 nuclear extracts did not bind to the
potential TTF-1 site as assessed by supershift analysis (data not
shown). While HNF-3 enhanced activity of the TTF-1-142 construct
and HeLa cells, co-transfection of CMV-GATA-6 with an expression vector
expressing rat HNF-3 (CMV-HNF-3 ) did not further influence the
effects of GATA-6 on TTF-1 promoter activity.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 7.
GATA-6 activation of the TTF-1 promoter does
not require TTF-1. To test whether TTF-1 and GATA-6 cooperatively
enhanced TTF-1 gene transcription, CMV-TTF-1 (marked TTF-1)
and CMV-GATA-6 (GATA-6) were co-transfected with mTTF-1-142
luciferase in HeLa cells and compared with the activity observed with
the control vector pCDNA1.1. GATA-6-dependent activity
was not increased by the addition of CMV-TTF-1. Relative luciferase
activity (mean ± S.E., n = 3) was determined as
described under "Experimental Procedures." * and **,
p < 0.0009 and p < 0.0008, respectively, versus cDNA1.1 control as assessed by
unpaired t test. S.E. for TTF-1-transfected cells was
±2.7.
|
|
 |
DISCUSSION |
TTF-1 and GATA-6 mRNAs were co-expressed in freshly isolated
type II epithelial cells and immortalized respiratory epithelial adenocarcinoma cells in vitro. GATA-6, but not GATA-5,
activated transcriptional activity of the murine TTF-1 promoter
construct, GATA-6 binding to a cis-active element identified at 101
to 96 from the start of the major start site of TTF-1 gene
transcription. GATA-6 activated transcription of TTF-1 independently of
TTF-1 and HNF-3 . The present findings support the concept that
GATA-6 may influence lung differentiation and gene expression by
modulating TTF-1 gene transcription, thereby potentially influencing
the regulation of TTF-1 transcriptional targets.
Previous studies demonstrated that TTF-1 plays a critical role in
pulmonary morphogenesis and in the regulation of a number of gene
products involved in pulmonary function and host defense. TTF-1 is
expressed in the developing lung buds of the rat, mouse, human, and
chick, the level of expression decreasing in the perinatal and
postnatal period of lung development (2, 4, 5, 35). TTF-1 is
increasingly restricted in the postnatal lung, being detected primarily
in type II epithelial cells and in subsets of bronchiolar epithelial
cells (4). Thus, the concentration of TTF-1 is likely to influence both
respiratory cell differentiation and the expression of target genes,
including surfactant proteins A, B, and C and CCSP (8-11), proteins
that play important roles in host defense and surfactant function.
TTF-1 binds to and activates the promoters of each of these genes, DNA
binding and transcriptional activity of TTF-1 being further modified by
phosphorylation and oxidationreduction (36-38).
Co-localization of GATA-6 and TTF-1 in developing and mature
respiratory epithelial cells and the finding that TTF-1 transcription is activated by GATA-6 are consistent with the potential interaction of
the two gene families during lung development. A similar relationship was demonstrated between TTF-1 and HNF-3 , the latter a member of the
forkhead family of transcription factors. HNF-3 and TTF-1 are also
co-expressed in respiratory epithelial cells of the embryonic and
postnatal lung. Recent studies demonstrated that TTF-1 gene transcription was enhanced by HNF-3 , a process mediated by binding of HNF-3 to a cis-active element located near the presently
described GATA-6 binding site in the TTF-1 gene (19). Thus, distinct
members of the HNF-3, GATA, and Nkx families may act in combination on target genes in the foregut endoderm. The phylogenetic conservation of
such a pathway, wherein members of these same families of transcription factors interact, is supported by recent findings in
Caenorhabditis elegans. Forkhead homologue pha-4,
GATA homologue elt-2, and Nkx homologue ceh-22
interact in a transcriptional pathway mediating pharyngeal and gut
development in the worm (39). In the present study, GATA-6 activation
of the TTF-1 gene transcription did not require expression of TTF-1 or
HNF-3 , neither being expressed in HeLa cells
(14).2 TTF-1, HNF-3 , and
GATA-6 are expressed in a similar distribution in respiratory
epithelial cells in the fetal lung in vivo and in MLE-15
cells in vitro. Expression of TTF-1, HNF-3 , and GATA-6 in
fetal lung overlaps with that of the SP-A, SP-B, and SP-C genes. Recent
findings from this laboratory demonstrated that GATA-6 activated
transcriptional activity of SP-A and SP-C genes by binding to
cis-active elements located in the 5' regulatory regions of each of the
genes.2 The present findings that GATA-6 activates TTF-1,
taken together with observations that GATA-6 directly influences
expression of the surfactant protein genes by binding to their
promoters support a potential regulatory role for GATA-6 in surfactant
protein expression.
The finding that GATA-6, but not GATA-5, activated TTF-1 gene
transcription is consistent with the similar distribution of GATA-6 and
TTF-1 in subsets of developing respiratory epithelial cells in the
mouse lung in vivo (5, 26, 27). GATA-5 mRNA was detected
in mesenchymal but not epithelial cells of the developing lung. The
finding that GATA-6, but not GATA-5, activated TTF-1 gene expression
was somewhat surprising, given that both proteins bind to similar
consensus elements in target genes. Of interest, the selectivity
observed for GATA-6 in activation of the TTF-1 gene was not observed in
the studies with the SP-C promoter, wherein both GATA-5 and GATA-6 were
active in enhancing SP-C gene transcription.2 Thus, the
effects of GATA-6 on TTF-1 gene transcription are probably determined
by mechanisms distinct from that involved in activation of surfactant
protein C gene transcription by GATA-6.
GATA-6 bound to a site in a consensus element located near the start of
transcription of the TTF-1 gene. The cis-active element and flanking
regions are highly conserved in the TTF-1 gene sequences available for
comparison (human, mouse, and rat), supporting the potential importance
of this region in gene regulation (14, 15, 18). The DNA binding site
identified in the murine TTF-1 gene is consistent with binding sites
for many other GATA family members. Therefore, the selectivity of the
response to GATA-6 is likely to be dependent upon the sites of
expression of GATA-6 as distinct from other known GATA family members.
Alternatively, interactions between GATA-6 and other transcription
proteins that are expressed in a cell-selective manner are required.
Other transcription factors are known to form complexes with GATA
factors to activate target gene transcription. These include FOG
(friend of GATA) and GATA-1 (41);
Lmo2 and GATA-1 (42); and EKLF (erythroid kruppel-like factor), Sp1, and
GATA-1 (43). GATA-6 is also expressed in the gastrointestinal and
genitourinary tract, as well as in the heart. Known GATA-6 target genes
include histidine decarboxylase, lactase, vitellogenin II, and cardiac
m2 muscarinic acetylcholine gene (33, 40, 44, 45). While GATA-6
activated TTF-1 transcription in HeLa and H441 cells, GATA-6 did not
activate the promoter in MLE-15 cells, perhaps related to the high
concentrations of GATA-6 present in this cell line or to unique
combinations of transcription factors present in the MLE cell line.
The stimulatory effects of GATA-6 on the TTF-1 promoter in HeLa cells
did not require TTF-1. The finding that the co-expression of TTF-1 and
GATA-6 did not further enhance TTF-1 transcription in HeLa demonstrated
that GATA-6 activity was not dependent upon interactions with this
region of the TTF-1 gene and TTF-1 itself. This finding is distinct
from recent studies in which Nkx2.5 (a TTF-1 family member) and GATA-4
enhanced myosin heavy chain gene expression in the heart (28).
Co-transfection with TTF-1 modestly inhibited transcriptional activity
of the mTTF-1 construct in the presence of GATA-6 in HeLa cells;
however, the significance of this observation is unclear. Activation of
the TTF-1 promoter by GATA-6 was not influenced by co-transfection with
HNF-3 , which is known to bind to two sites in the region 135 to
3 in the human TTF-1 gene. Thus, GATA-6 binds and activates the
cis-acting element in the TTF-1 gene independently of either TTF-1 or
HNF-3 .
The finding that GATA-6 activates the TTF-1 promoter adds to our
understanding of the potential interactions among various families of
transcription factors in the developing respiratory epithelium. Present
data support a model in which the transcription factor(s) bind to and
activate target genes, including the surfactant proteins and CCSP, but
may also interact at the level of regulation of the transcription
factors themselves, HNF-3 and GATA-6 modulating TTF-1 gene
expression. The co-expression of HNF-3 , GATA-6, and TTF-1 in the
developing lung is consistent with the concept that respiratory
epithelial differentiation and gene expression may be modulated by
interactions among these distinct families of transcription factors
(9).
 |
FOOTNOTES |
*
This work was supported by Grant HL56387 (to J. A. W.),
Perinatology Training Grant 5T32 HD07200, and CFF-RDP R457 (to
J. S.-W.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Children's Hospital
Medical Center, Division of Pulmonary Biology, 3333 Burnet Ave.,
Cincinnati, OH 45229-3039. Tel.: 513-636-4830; Fax: 513-636-7868; E-mail: whitj0{at}chmcc.org.
The abbreviations used are:
TTF, thyroid
transcription factor; mTTF, mouse TTF; EMSA, electrophoretic gel shift
assay; SP-A, -B, and -C, surfactant protein A, B, and C, respectively; CCSP, Clara cell secretory protein; kb, kilobase pair(s); bp, base pair(s); CMV, cytomegalovirus; HNF, hepatocyte nuclear factor.
2
J. R. Shaw-White, M. D. Bruno, and
J. A. Whitsett, unpublished observations.
 |
REFERENCES |
-
Guazzi, S.,
Price, M.,
De Felice, M.,
Damante, G.,
Mattei, M.,
and Di Lauro, R.
(1990)
EMBO J.
9,
3631-3639[Medline]
[Order article via Infotrieve]
-
Lazzaro, D.,
Price, M.,
De Felice, M.,
and Di Lauro, R.
(1991)
Development
113,
1093-1104[Abstract]
-
Boshart, M.,
Klüppel, M.,
Schmidt, A.,
Schütz, G.,
and Luckow, B.
(1992)
Gene (Amst.)
110,
129-130[CrossRef][Medline]
[Order article via Infotrieve]
-
Stahlman, M. T.,
Gray, M. E.,
and Whitsett, J. A.
(1996)
J. Histochem. Cytochem.
44,
673-678[Abstract]
-
Zhou, L.,
Lim, L.,
Costa, R. H.,
and Whitsett, J. A.
(1996)
J. Histochem. Cytochem.
44,
1183-1193[Abstract]
-
Francis-Lang, H.,
Zannini, M.,
de Felice, M.,
Berlingieri, M. T.,
Fusco, A.,
and Di Lauro, R.
(1992)
Mol. Cell. Biol.
12,
5793-5800[Abstract/Free Full Text]
-
Endo, T.,
Kaneshige, M.,
Nakazato, M.,
Ohmori, M.,
Harii, N.,
and Onaya, T.
(1997)
Mol. Endocrinol.
11,
1747-1755[Abstract/Free Full Text]
-
Bruno, M. D.,
Bohinski, R. J.,
Huelsman, K. M.,
Whitsett, J. A.,
and Korfhagen, T. R.
(1995)
J. Biol. Chem.
270,
6531-6536[Abstract/Free Full Text]
-
Bohinski, R. J.,
DiLauro, R.,
and Whitsett, J. A.
(1994)
Mol. Cell. Biol.
14,
5671-5681[Abstract/Free Full Text]
-
Yan, C.,
Sever, Z.,
and Whitsett, J. A.
(1995)
J. Biol. Chem.
270,
24852-24857[Abstract/Free Full Text]
-
Kelly, S. E.,
Bachurski, C. J.,
Burhans, M. S.,
and Glasser, S. W.
(1996)
J. Biol. Chem.
271,
6881-6888[Abstract/Free Full Text]
-
Zhang, L.,
Whitsett, J. A.,
and Stripp, B. R.
(1997)
Biochim. Biophys. Acta
1350,
359-367[Medline]
[Order article via Infotrieve]
-
Kimura, S.,
Hara, Y.,
Pineau, T.,
Fernandez-Salguero, P.,
Fox, C. H.,
Ward, J. M.,
and Gonzalez, F. J.
(1996)
Gene Dev.
10,
60-69[Abstract/Free Full Text]
-
Ikeda, K.,
Clark, J. C.,
Shaw-White, J. R.,
Stahlman, M. T.,
Boutell, C. J.,
and Whitsett, J. A.
(1995)
J. Biol. Chem.
270,
8108-8114[Abstract/Free Full Text]
-
Lonigro, R.,
De Felice, M.,
Biffali, E.,
Macchia, P. E.,
Damante, G.,
Asteria, C.,
and Di Lauro, R.
(1996)
Cell Growth & Differ.
7,
251-261[Abstract]
-
Nakazato, M.,
Endo, T.,
Saito, T.,
Harii, N.,
and Onaya, T.
(1997)
Biochem. Biophys. Res. Comm.
238,
748-752[CrossRef][Medline]
[Order article via Infotrieve]
-
Oguchi, H.,
and Kimura, S.
(1998)
Endocrinology
139,
1999-2006[Abstract/Free Full Text]
-
Hamdan, H.,
Liu, H.,
Li, C.,
Jones, C.,
Lee, M.,
deLemos, R.,
and Minoo, P.
(1998)
Biochim. Biophys. Acta
1396,
336-348[Medline]
[Order article via Infotrieve]
-
Ikeda, K.,
Shaw-White, J. R.,
Wert, S. E.,
and Whitsett, J. A.
(1996)
Mol. Cell. Biol.
16,
3626-3636[Abstract]
-
Yamamoto, M.,
Ko, L. J.,
Leonard, M. W.,
Beug, H.,
Orkin, S. H.,
and Engel, J. D.
(1990)
Gene. Develop.
4,
1650-1662
-
Fujiwara, Y.,
Browne, C. P.,
Cunniff, K.,
Goff, S. C.,
and Orkin, S. H.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
12355-12358[Abstract/Free Full Text]
-
Pevny, L.,
Simon, M. C.,
Robertson, E.,
Klein, W. H.,
Tsai, S. F.,
D'Agati, V.,
Orkin, S. H.,
and Costantini, F.
(1991)
Nature
349,
257-260[CrossRef][Medline]
[Order article via Infotrieve]
-
Tsai, F.,
Keller, G.,
Kuo, F. C.,
Weiss, M.,
Chen, J.,
Rosenblatt, M.,
Alt, F. W.,
and Orkin, S. H.
(1994)
Nature
371,
221[CrossRef][Medline]
[Order article via Infotrieve]
-
Pandolfi, P. P.,
Roth, M. E.,
Karis, A.,
Leonard, M. W.,
Dzierzak, E.,
Grosveld, F. G.,
Engel, J. D.,
and Lindenbaum, M. H.
(1995)
Nat. Genet.
11,
40-44[CrossRef][Medline]
[Order article via Infotrieve]
-
Arceci, R. J.,
King, A. A.,
Simon, M. C.,
Orkin, S. H.,
and Wilson, D. B.
(1993)
Mol. Cell. Biol.
13,
2235-2246[Abstract/Free Full Text]
-
Morrisey, E. E.,
Ip, H. S.,
Tang, Z.,
Lu, M. M.,
and Parmacek, M. S.
(1997)
Dev. Biol.
183,
21-36[CrossRef][Medline]
[Order article via Infotrieve]
-
Morrisey, E. E.,
Ip, H. S.,
Lu, M. M.,
and Parmacek, M. S.
(1996)
Dev. Biol.
177,
309-322[CrossRef][Medline]
[Order article via Infotrieve]
-
Durocher, D.,
Charron, F.,
Warren, R.,
Schwartz, R. J.,
and Nemer, M.
(1997)
EMBO J.
16,
5687-5696[CrossRef][Medline]
[Order article via Infotrieve]
-
Dobbs, L. G.,
Gonzalez, R.,
and Williams, M. C.
(1986)
Am. Rev. Respir. Dis.
134,
141-145[Medline]
[Order article via Infotrieve]
-
Chirgwin, J. M.,
Przybyla, A. E.,
MacDonald, R. J.,
and Rutter, W. J.
(1979)
Biochemistry
18,
5294-5299[CrossRef][Medline]
[Order article via Infotrieve]
-
Rosenthal, N.
(1987)
Methods Enzymol.
152,
704-720[Medline]
[Order article via Infotrieve]
-
Lowry, O. H.,
Rosebrough, N. J.,
Farr, A. L.,
and Randall, R. J.
(1951)
J. Biol. Chem.
193,
265-275[Free Full Text]
-
Dimaline, R.,
Campbell, B. J.,
Watson, F.,
Sandvik, A. K.,
Struthers, J.,
and Noble, P. J.
(1997)
Gastroenterology
112,
1559-1567[CrossRef][Medline]
[Order article via Infotrieve]
-
Hennighausen, L.,
and Lubon, H.
(1987)
Methods Enzymol.
152,
721-735[Medline]
[Order article via Infotrieve]
-
Zeng, X., Yutzey, K. E., and Whitsett, J. A. (1998) J. Anat. in press
-
Yan, C.,
and Whitsett, J. A.
(1997)
J. Biol. Chem.
272,
17327-17332[Abstract/Free Full Text]
-
Zannini, M.,
Acebron, A.,
De Felice, M.,
Arone, M. I.,
Martin-Pérez, J.,
Santisteban, P.,
and Di Lauro, R.
(1996)
J. Biol. Chem.
271,
2249-2254[Abstract/Free Full Text]
-
Arnone, M. I.,
Zannini, M.,
and Di Lauro, R.
(1995)
J. Biol. Chem.
270,
12048-12055[Abstract/Free Full Text]
-
Kalb, J. M.,
Lau, K. K.,
Goszczynski, B.,
Fukushige, T.,
Moons, D.,
Okkema, P. G.,
and McGhee, J. D.
(1998)
Development.
125,
2171-2180[Abstract]
-
Rosoff, M. L.,
and Nathanson, N. M.
(1998)
J. Biol. Chem.
273,
9124-9129[Abstract/Free Full Text]
-
Tsang, A. P.,
Visvader, J. E.,
Turner, C. A.,
Fujiwara, Y., Yu, C.,
Weiss, M. J.,
Crossley, M.,
and Orkin, S. H.
(1997)
Cell
90,
109-119[CrossRef][Medline]
[Order article via Infotrieve]
-
Osada, H.,
Grutz, G. G.,
Axelson, H.,
Forster, A.,
and Rabbitts, T. H.
(1997)
Leukemia
11,
307-312
-
Gregory, R. C.,
Taxman, D. J.,
Seshasayee, D.,
Kensinger, M. H.,
Bieker, J. J.,
and Wojchowski, D. M.
(1996)
Blood
87,
1793-1801[Abstract/Free Full Text]
-
Fitzgerald, K.,
Bazar, L.,
and Avigan, M. I.
(1998)
Am. J. Physiol.
274,
G314-G324[Abstract/Free Full Text]
-
Davis, D. L.,
and Burch, J. B.
(1996)
Mol. Endocrinol.
10,
937-944[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P M Lindholm, Y Soini, M Myllarniemi, S Knuutila, M Heikinheimo, V L Kinnula, and K Salmenkivi
Expression of GATA-6 transcription factor in pleural malignant mesothelioma and metastatic pulmonary adenocarcinoma
J. Clin. Pathol.,
April 1, 2009;
62(4):
339 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Zhou, T. A. Francis, H. Yang, W. Tseng, Q. Zhong, B. Frenkel, Edward. E. Morrisey, David. K. Ann, P. Minoo, E. D. Crandall, et al.
GATA-6 mediates transcriptional activation of aquaporin-5 through interactions with Sp1
Am J Physiol Cell Physiol,
November 1, 2008;
295(5):
C1141 - C1150.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol.,
April 1, 2008;
22(4):
781 - 798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Kolla, L. W. Gonzales, J. Gonzales, P. Wang, S. Angampalli, S. I. Feinstein, and P. L. Ballard
Thyroid Transcription Factor in Differentiating Type II Cells: Regulation, Isoforms, and Target Genes
Am. J. Respir. Cell Mol. Biol.,
February 1, 2007;
36(2):
213 - 225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Maeda, V. Dave, and J. A. Whitsett
Transcriptional Control of Lung Morphogenesis
Physiol Rev,
January 1, 2007;
87(1):
219 - 244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Rath, Z. Wang, M. M. Lu, and E. E. Morrisey
LMCD1/Dyxin Is a Novel Transcriptional Cofactor That Restricts GATA6 Function by Inhibiting DNA Binding
Mol. Cell. Biol.,
October 15, 2005;
25(20):
8864 - 8873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Guo, Y. Akiyama, M. G. House, C. M. Hooker, E. Heath, E. Gabrielson, S. C. Yang, Y. Han, S. B. Baylin, J. G. Herman, et al.
Hypermethylation of the GATA Genes in Lung Cancer
Clin. Cancer Res.,
December 1, 2004;
10(23):
7917 - 7924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. De Felice and R. Di Lauro
Thyroid Development and Its Disorders: Genetics and Molecular Mechanisms
Endocr. Rev.,
October 1, 2004;
25(5):
722 - 746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Rahman, S. Kiiveri, A. Rivero-Muller, J. Levallet, S. Vierre, J. Kero, D. B. Wilson, M. Heikinheimo, and I. Huhtaniemi
Adrenocortical Tumorigenesis in Transgenic Mice Expressing the Inhibin {alpha}-Subunit Promoter/Simian Virus 40 T-Antigen Transgene: Relationship between Ectopic Expression of Luteinizing Hormone Receptor and Transcription Factor GATA-4
Mol. Endocrinol.,
October 1, 2004;
18(10):
2553 - 2569.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Takeda, K. Obayashi, A. Kobayashi, and M. Maeda
A Unique Role of an Amino Terminal 16-Residue Region of Long-Type GATA-6
J. Biochem.,
May 1, 2004;
135(5):
639 - 650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liu, M. Ikegami, M. T. Stahlman, C. R. Dey, and J. A. Whitsett
Inhibition of alveolarization and altered pulmonary mechanics in mice expressing GATA-6
Am J Physiol Lung Cell Mol Physiol,
December 1, 2003;
285(6):
L1246 - L1254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A E Bonner, W J Lemon, and M You
Gene expression signatures identify novel regulatory pathways during murine lung development: implications for lung tumorigenesis
J. Med. Genet.,
June 1, 2003;
40(6):
408 - 417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liu, E. E. Morrisey, and J. A. Whitsett
GATA-6 is required for maturation of the lung in late gestation
Am J Physiol Lung Cell Mol Physiol,
August 1, 2002;
283(2):
L468 - L475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Weidenfeld, W. Shu, L. Zhang, S. E. Millar, and E. E. Morrisey
The WNT7b Promoter Is Regulated by TTF-1, GATA6, and Foxa2 in Lung Epithelium
J. Biol. Chem.,
May 31, 2002;
277(23):
21061 - 21070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Taniura, H. Kamitani, T. Watanabe, and T. E. Eling
Transcriptional Regulation of Cyclooxygenase-1 by Histone Deacetylase Inhibitors in Normal Human Astrocyte Cells
J. Biol. Chem.,
May 3, 2002;
277(19):
16823 - 16830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liu, S. W. Glasser, H. Wan, and J. A. Whitsett
GATA-6 and Thyroid Transcription Factor-1 Directly Interact and Regulate Surfactant Protein-C Gene Expression
J. Biol. Chem.,
February 1, 2002;
277(6):
4519 - 4525.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yang, M. M. Lu, L. Zhang, J. A. Whitsett, and E. E. Morrisey
GATA6 regulates differentiation of distal lung epithelium
Development,
January 5, 2002;
129(9):
2233 - 2246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Caramori, S. Lim, K. Ito, K. Tomita, T. Oates, E. Jazrawi, K.F. Chung, P.J. Barnes, and I.M. Adcock
Expression of GATA family of transcription factors in T-cells, monocytes and bronchial biopsies
Eur. Respir. J.,
September 1, 2001;
18(3):
466 - 473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Costa, V. V. Kalinichenko, and L. Lim
Transcription factors in mouse lung development and function
Am J Physiol Lung Cell Mol Physiol,
May 1, 2001;
280(5):
L823 - L838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R Keijzer, M van Tuyl, C Meijers, M Post, D Tibboel, F Grosveld, and M Koutsourakis
The transcription factor GATA6 is essential for branching morphogenesis and epithelial cell differentiation during fetal pulmonary development
Development,
January 2, 2001;
128(4):
503 - 511.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Glasser, M. S. Burhans, S. K. Eszterhas, M. D. Bruno, and T. R. Korfhagen
Human SP-C gene sequences that confer lung epithelium-specific expression in transgenic mice
Am J Physiol Lung Cell Mol Physiol,
May 1, 2000;
278(5):
L933 - L945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Bruno, T. R. Korfhagen, C. Liu, E. E. Morrisey, and J. A. Whitsett
GATA-6 Activates Transcription of Surfactant Protein A
J. Biol. Chem.,
January 14, 2000;
275(2):
1043 - 1049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Whitsett and J. W. Tichelaar
Forkhead Transcription Factor HFH-4 and Respiratory Epithelial Cell Differentiation
Am. J. Respir. Cell Mol. Biol.,
August 1, 1999;
21(2):
153 - 154.
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. He, E. C. Crouch, K. Rust, E. Spaite, and S. L. Brody
Proximal Promoter of the Surfactant Protein D Gene. REGULATORY ROLES OF AP-1, FORKHEAD BOX, AND GT BOX BINDING PROTEINS
J. Biol. Chem.,
September 29, 2000;
275(40):
31051 - 31060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Shu, H. Yang, L. Zhang, M. M. Lu, and E. E. Morrisey
Characterization of a New Subfamily of Winged-helix/Forkhead (Fox) Genes That Are Expressed in the Lung and Act as Transcriptional Repressors
J. Biol. Chem.,
July 13, 2001;
276(29):
27488 - 27497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Molkentin
The Zinc Finger-containing Transcription Factors GATA-4, -5, and -6. UBIQUITOUSLY EXPRESSED REGULATORS OF TISSUE-SPECIFIC GENE EXPRESSION
J. Biol. Chem.,
December 8, 2000;
275(50):
38949 - 38952.
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|