|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 5, 3222-3227, January 29, 1999
From the Laboratory of Immune Cell Biology, NCI, National
Institutes of Health, Bethesda, Maryland 20892-1152
We previously identified a Fas ligand regulatory
element (FLRE) in the Fas ligand (fasL) promoter that binds
Egr family proteins and demonstrated that Egr-3 (PILOT) but not Egr-1
(NGFI-A, Krox-24, Tis-8, and Zif-268) induces transcription of
fasL. The aberrant CD4 Apoptotic death of T cells at the conclusion of an immune response
is critical for homeostasis of the immune system. T cell receptor
(TCR)-mediated1 activation of
T cells induces the transcription and synthesis of the cell surface
molecule Fas and its ligand, FasL (1). Although activated T cells are
initially resistant to death signals mediated by Fas, prolonged
activation increases their sensitivity, presumably owing to
down-regulation of such cellular inhibitors of the Fas/FADD/caspase 8 cascade as c-FLIPs (2) and IAPs (3, 4). The murine lpr and
gld mutations result in the loss of function of Fas (5) and
FasL (6-8), respectively. As a result, these mice lack a functional
Fas death pathway, preventing deletion of activated T cells and leading
to the accumulation of large numbers of abnormal
CD4 Control of fasL transcription in different settings has been
attributed to several transcription factors. For example,
fasL can be induced by DNA-damaging agents such as UV
irradiation or topoisomerase inhibitors (14). In this case, mutant
reporter constructs have indicated that control of fasL
transcription can be attributed directly to NF- There are a number of lines of evidence to suggest that NF-AT plays a
critical role in fasL up-regulation. First, fasL
induction by TCR-mediated stimulation is sensitive to cyclosporin A
(CsA) (23, 24). Furthermore, anti-TCR-induced up-regulation of
fasL in vivo is impaired in NF-ATp knockout mice
(25). Footprinting analysis of the fasL promoter with the
use of recombinant proteins identified two potential NF-AT-binding
sites (22). The distal site, located at Transcription of Egr family genes is up-regulated after TCR activation
(27, 28). These Zn2+ finger-containing proteins have
similar DNA-binding domains and similar DNA sequence preference (29).
Other domains of the proteins differ, and the expression of Egr family
genes can be differentially regulated, suggesting that individual
members fulfill nonredundant biological roles (30). In this report we
examine MRL-lpr/lpr and C3H-gld/gld DN T cells
for the presence of FLRE-binding proteins that might contribute to the
constitutive activation of the fasL promoter. The results
indicate that Egr-2, like Egr-3, can directly mediate TCR-induced
transcription of fasL, and it is this member of the Egr
family that appears to be responsible for the aberrant up-regulation of
this gene in lpr and gld mice.
Cell Lines, Mice, and Reagents--
2B4.11 is a murine T cell
hybridoma specific for peptide 81-104 of pigeon cytochrome
c presented by I-Ek (31) and was maintained in
RPMI 1640 (Biofluids, Rockville, MD) supplemented with 4 mM
glutamine, 50 µM Plasmids--
The 16-mer plasmid, with a 16-bp FLRE-containing
element (from Transient Transfection Assays--
In cotransfection
experiments, a Gene Pulser (Bio-Rad) was used to electroporate 2B4.11
cells (2 × 106) in 0.2 ml of complete medium in 4-mm
cuvettes, with 7.5 µg of expression plasmid and 2.5 µg of reporter
plasmid, by using 960 microfarads at 220 V. The plasmid pCB6 (33) was
used as a control for the expression plasmids. Each transfection was
cultured in 1-ml volumes in complete medium and, the luciferase
activity in 20% of each was measured. Error bars represent
the standard deviation of the fold inductions (Egr-expressing plasmid
relative to empty plasmid) of duplicate samples. MRL-lpr/lpr
lymph node cells (4 × 107) were electroporated with
10 µg of fasL-dependent luciferase-encoding reporter plasmid by using 960 microfarads at 250 V. Each transfection was cultured in 4 ml of complete medium, and the luciferase activity in
20% of it was measured. Error bars represent the standard
deviation of duplicate transfections. HeLa cells were transfected by
the calcium phosphate method (34). In reporter assays, triplicate 200-µl cultures were transfected with 150 ng of luciferase reporter plasmid and 150 ng of expression plasmid, and the amount of luciferase activity in 40% of each culture was measured. In RT-PCR assays, 4-ml
cultures were transfected with 7.5 µg of expression plasmid, and 20%
of the resulting RNA was used for synthesis of cDNA.
Gel Shift Assays--
Whole cell extracts were prepared by
resuspending phosphate-buffered saline-washed cells in 10 mM HEPES, pH 7.9, 400 mM KCl, 10% glycerol, 1 mM dithiothreitol, and 1 mM
phenylmethylsulfonyl fluoride and subjecting them to three rounds of
freezing on dry ice followed by rapid thawing in a 37 °C water bath.
Extracts were obtained from the supernatants after 5 min of
centrifugation at 14,000 × g at 4 °C. Binding
reactions were carried out at 22 °C for 30 min by combining 3-µl
extracts with 12 µl of binding buffer (10 mM HEPES, pH
7.9, 10% glycerol, 1 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride) containing 1 µg of
poly(dI-dC) and 0.02 pmol of 32P end-labeled
double-stranded oligonucleotide probe. In antibody supershift assays,
1-2 µl (1-2 µg) of total antiserum or phosphate-buffered saline
was added to the binding reaction. Complexes and unbound probe were
separated on 4.5% polyacrylamide gels with the use of 0.5 × TBE
running buffer.
Northern Blot Analysis--
Total RNA (1 µg) isolated using
the Trizol denaturant (Life Technologies, Inc.) was separated by
electrophoresis through a 1.5% agarose gel containing 6% formaldehyde
and buffered with MOPS (Quality Biological, Inc., Gaithersburg, MD).
After transfer to a HyBond-N membrane (Amersham Pharmacia Biotech), RNA
was covalently bound by UV cross-linking. Hybridization with
32P-labeled cDNA probes was carried out at 65 °C in
0.5 M sodium, 7% SDS, and 1 mM EDTA and
buffered to pH 7.2 with phosphate (35). The cDNAs encoding the
extracellular part of mouse FasL and the Pst-1 fragment of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (36) were used as
probes. Final washes were performed at 60 °C in 80 mM
sodium, phosphate-buffered as before, with 1% SDS and 1 mM
EDTA. After exposure to detect fasL, the membrane was stripped by boiling in 0.1× SSC and 1% SDS and probed for
gapdh.
RT-PCR--
cDNA was synthesized with the use of random
hexamers and avian myeloblastosis virus reverse transcriptase
(Invitrogen, San Diego, CA). The PCR primers, which were designed to
amplify cDNA and not genomic DNA, were: human fasL,
ATGTTTCAGCTCTTCCACCTACAGA (forward) and CCAGAGAGAGCTCAGATACGTTGACA
(reverse), and human gapdh, AGGTCGGAGTCAACGGATTT (forward)
and CAGCAGAGGGGGCAGAGATG (reverse). 1 µl of cDNA was amplified in
a 25-µl PCR reaction with the use of "Ready To Go" PCR beads
(Amersham Pharmacia Biotech) with MgCl2 supplemented to 2 mM. Products derived from 40 amplification cycles of 1 min
at 95 °C, 1 min at 62 °C, and 1 min at 72 °C were separated by
electrophoresis through a 2% agarose gel and transferred to a HyBond-N
membrane. The membrane was probed with the 32P-labeled
human fasL cDNA. To control for the integrity and
uniformity of the sample preparations, gapdh was amplified
with 25 cycles of 1 min at 95 °C, 1 min at 55 °C, and 1 min at
72 °C, and the products were transferred and probed as before.
lpr and gld Lymph Node T Cells Contain Elevated Levels of the
FLRE-binding Proteins Egr-1 and Egr-2--
Mice of the
C3H-gld/gld (gld) and MRL-lpr/lpr (lpr)
background acquire massive numbers of
CD4
The expression of the different Egr family transcription factors in DN
T cells was further analyzed by Northern blot analysis. RNA from
freshly isolated lpr and gld DN T cells had elevated levels of
egr-1 and egr-2 when compared with unactivated
normal C3H T cells (Fig. 2). In contrast,
the level of egr-3 in DN T cells was, although slightly
higher than that in unstimulated normal T cells, substantially lower
than that in activated normal T cells. These data demonstrate that lpr
and gld lymph node DN T cells have an activated phenotype with regard
to Egr family protein expression, with constitutively high levels of
Egr-1 and Egr-2 and relatively little Egr-3.
Egr-2 Is Among the Induced FLRE-binding Proteins in Activated
2B4.11 and Normal T Cells--
The expression of Egr-2 in a T
hybridoma cell line and normal T cells was examined. Egr-2, whose
migration is only slightly faster than Egr-1, was not previously
recognized by gel shift analysis in extracts of activated 2B4.11 T
hybridoma cells, and no supershifted material was detected with a
commercially available putative anti-Egr-2 polyclonal antiserum (20).
Reexamination of cell extracts from activated 2B4.11 cells revealed,
however, that supershifting with anti-Egr-1 and anti-Egr-3 antibodies
left a faint band that migrated slightly faster than the bulk of the Egr-1 material and co-migrated with recombinant Egr-2 (Fig. 1 and data
not shown). Furthermore, addition of a different anti-Egr-2 antiserum,
which we have found supershifts recombinant Egr-2 (data not shown)
removed this band entirely (Fig. 1), indicating that the FLRE binding
activity in activated 2B4.11 cells consists of Egr-1, Egr-2, and Egr-3.
To determine what FLRE-binding proteins are induced in normal T cells,
C3H lymph node cells were studied. Small amounts of shifted material in
the region corresponding to bands I, II, and III could be seen in
untreated lymph node cells (Fig. 3). All
of these bands, in particular the slower species corresponding to bands
I and II, were increased in cells stimulated for 3 h with PMA and
ionomycin. Antisera against Egr-1 removed most, but not all, of the
more slowly migrating species and caused the appearance of supershifted
material, and antisera against Egr-2 removed a part of the more slowly
migrating species and caused the appearance of a correspondingly
smaller amount of supershifted material. The combination of the two
antisera completely removed bands I and II. As with 2B4.11 cells, an
antiserum against Egr-3 specifically removed band III. Consistent with
the gel shift data, Northern blot analysis demonstrated that mRNA
for all three Egr family members was induced by activation (Fig. 2).
Therefore, in normal lymph node T cells, activation induces the
appearance of Egr-1, -2, and -3.
TCR-mediated Egr-2 Induction Is Sensitive to CsA--
TCR-mediated
induction of FasL expression is inhibited by CsA, which blocks
activation of the NF-AT transcription factor as a consequence of
inhibiting the phosphatase calcineurin (38, 39). Similarly,
activation-induced activity of the FLRE reporter and induction of
Egr-3, but not Egr-1, are sensitive to CsA (20). The issue of whether
induced Egr-2 expression is sensitive to inhibition by CsA is
controversial. In one study with peripheral blood cells (28), CsA was
found to have a relatively small effect on egr-2 induction,
whereas in another study on a thymocyte cell line, CsA was found to
inhibit activation-induced egr-2 (40). To determine whether
Egr-2 induction in normal murine T cells is CsA-sensitive, normal lymph
node cells were activated by PMA plus ionomycin in the presence or
absence of CsA (Fig. 4). Egr-2 mRNA
levels were substantially increased by activation, a response that was
inhibited by CsA. Thus, in normal T cells Egr-2, like Egr-3 (20), is a
CsA-sensitive T cell activation-inducible transcription factor.
Egr-2 Expression Is Sufficient to Induce fasL
Transcription--
Egr family transcription factors contain no known
dimerization domains, and their genetic target sites are asymmetrical.
Therefore, they are thought to bind to DNA and activate transcription
as monomers. In addition, their transcriptional activity is not thought to depend on post-translational modification (41). Accordingly, transient overexpression of Egr-3 was previously found to be sufficient for induction of a fasL promoter reporter plasmid in the
absence of any TCR-mediated activation (20). Egr-2 was likewise tested for its ability to independently induce fasL-specific
transcription. 2B4.11 cells were transfected with a reporter construct
encoding the luciferase gene driven by a minimal fasL
promoter to which was appended the region from
We previously showed that overexpression of Egr-3 is sufficient to
induce the appearance of fasL mRNA in HeLa cells.
Similar experiments were performed to determine whether the same is
true for Egr-2 (Fig. 5B). Expression of Egr-1 had only a
small effect on fasL mRNA levels as measured by RT-PCR.
In contrast, Egr-2, just like Egr-3, induced easily detectable
fasL mRNA. Thus, Egr-2 can activate
fasL-specific transcription without other methods of
cellular activation.
Mutation of the FLRE Diminishes Expression of fasL Reporters in lpr
and gld DN T Cells--
To determine whether the FLRE and by
implication Egr-2 are necessary for the up-regulation of FasL in lpr
and gld DN T cells, these cells were transiently transfected with
reporter constructs driven by parts of the fasL promoter
(Fig. 6). A reporter containing the
proximal 225 bp of the fasL gene was induced to a much
greater extent than one containing just the proximal 212 bp (and thus having a disrupted Egr-binding site ( The importance of the FasL-triggered apoptotic death pathway for T
cell homeostasis is well established. The regulation of fasL
transcription is a critical control point in this phenomenon. A single
Egr family binding element appears to account for the majority of the
activation-induced cis-acting regulation of fasL (20). In
this report we identify Egr-2, along with the previously identified
Egr-3, as a direct regulator of fasL transcription in
activated T cells. Like Egr-3, this factor inducibly binds to the FLRE
in the fasL promoter and is synthesized de novo
in a CsA-sensitive manner upon T cell activation. Ectopically expressed Egr-2, like Egr-3, was sufficient to induce fasL-specific
transcription, as indicated by both fasL reporter construct
activity and the measurement of cellular fasL mRNA. Egr
family genes are transcriptionally up-regulated from low
basal levels in response to a multitude of cellular stimuli (41). TCR
induction of Egr family gene transcription is differentially sensitive
to CsA; transcription of Egr-2 and Egr-3 is sensitive to CsA, but Egr-1
is not. That the more abundant Egr-1 protein does not up-regulate
fasL was confirmed by transient expression in T and HeLa
cells, in which it was found to be ineffective at inducing
fasL reporter constructs and fasL mRNA
expression. Thus, by these criteria Egr-2 and Egr-3 are the likely Egr
family members to mediate transcriptional activation through the FLRE and thus are likely themselves to be regulated by NF-AT.
Little is known about the function of Egr-2 in vivo. As with
the other Egr family members, egr-2 mRNA is not detected
in most adult tissues by Northern analysis. An exception is the thymus, where some of the cells are undergoing antigen-driven selection (42),
and activated T cells (28, 40). Egr-2 is also expressed in the course
of embryogenesis (days 8-9 postcoitum in the mouse) in rhombomeres r3
and r5 of the hindbrain. Egr-2-deficient mice have disruptions of these
rhombomeres (43) as well as defects in myelination of peripheral nerves
(30), and the mice are nonviable. Proposed target genes of Egr-2
include HoxB-2 and HoxA-2 (44), which encode
homeobox domain transcription factors (45), and EphA4, which
encodes a receptor tyrosine kinase (46). Treatment of mouse embryos
with retinoic acid, which activates retinoic acid receptors (RARs/RXRs)
that are themselves transcription factors, inhibits egr-2
expression in rhombomere 3 and prevents maturation of this hindbrain
segment (47-49). Interestingly, in T cells and thymocytes, retinoic
acid inhibits activation-induced fasL up-regulation and
apoptosis (50-52). The mechanism by which retinoic acid inhibits TCR-inducible fasL promoter activity remains to be
determined. Thus, some of the genetic interrelationships that underlie
neural development may be recapitulated in that of the immune system.
The aberrant DN T cells found in lpr and gld mice have an activated
phenotype yet are refractory to stimuli such as TCR cross-linking, interleukin-2, CD28, PMA, and phytohemagglutinin (53). The activated state presumably arises from continual contact with self-antigens because of the inability of the peripheral T cells to be deleted by the
normal Fas-dependent mechanisms. DN T cells spontaneously turn over inositol phosphates (54), display elevated
tyrosine-phosphorylation of TCR By Northern analysis, lpr and gld DN T cells were found to contain
elevated egr-2 mRNA levels relative to activated C3H
normal T cells. mRNA for egr-3, and to a lesser extent
egr-1, was less abundant in DN T cells than in activated
normal T cells. These relative levels correlated with those observed by
gel shift. On the other hand, activated 2B4.11 cells contained similar
amounts of Egr-2- and Egr-3-specific FLRE binding activity. Thus, of
the Egr family members capable of inducing fasL
transcription, Egr-2 is selectively expressed in lpr and gld DN T
cells. Differential regulation of Egr family member expression is thus
another characteristic distinguishing the chronic state of activation
of lpr and gld DN T cells from that of normal T cells responding
acutely to antigen. Analysis of the correlation between the signaling
pathways constitutively activated and the Egr family members expressed
in DN T cells will further understanding of both normal and abnormal
TCR signaling.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
TCR, T cell
receptor; DN, double-negative; CsA, cyclosporin A; FLRE, fasL regulatory element; bp, base pair(s); RT, reverse
transcriptase; PCR, polymerase chain reaction; MOPS, 3-(N-morpholino)propanesulfonic acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PMA, phorbol
12-myristate 13-acetate.
Role of Egr-2 in Up-regulation of Fas Ligand in Normal T Cells
and Aberrant Double-negative lpr and gld T
Cells*
ABSTRACT
Top
Abstract
Introduction
References
CD8 T
cells from lpr/lpr and gld/gld mice, which have
mutations in the genes encoding Fas and FasL, respectively, have an
activated phenotype and constitutively express high levels of
fasL mRNA, prompting us to ask what role if any the
FLRE and Egr family proteins have in this aberrant expression of
fasL. Unstimulated MRL-lpr/lpr and
C3H-gld/gld CD4CD8 T cells
constitutively contained high levels of two proteins that bound to the
FLRE. Supershift analysis revealed these proteins to be Egr-1 and Egr-2
(Krox-20); Egr-3 was not detected. Activation of normal lymph node
cells resulted in increased expression of Egr-1, -2, and -3. As with
egr-3, expression of egr-2 was blocked by
cyclosporin A. Although overexpressed Egr-1 was ineffective, overexpressed Egr-2 was as potent as Egr-3 in inducing fasL
promoter-dependent reporter constructs in T cell hybridomas
and HeLa cells, and both up-regulated endogenous fasL
mRNA in HeLa cells. FasL-dependent reporter constructs
in MRL-lpr/lpr and C3H-gld/gld
CD4CD8 T cells were constitutively active,
and this activity was largely prevented by mutation of the critical Egr
family binding element. Thus, Egr-2, in addition to Egr-3, regulates
FasL expression in activated normal T cells, and Egr-2 is likely to
play a direct role in aberrant fasL up-regulation in
lpr/lpr and gld/gld
CD4CD8 T cells.
INTRODUCTION
Top
Abstract
Introduction
References
CD8, B220+, TCR+
lymph node cells (referred to as double-negative (DN) T cells). Humans
with defects in Fas-mediated killing have an lpr-like syndrome, with
accumulation of DN (TCR+CD4CD8)
T lymphocytes and autoimmune phenomena (9-11). MRL-lpr/lpr
(lpr) and C3H-gld/gld (gld) cells have many features
characteristic of activated T cells, and their presence is associated
with the development of autoimmunity. As a presumed consequence of
being chronically activated, lpr and gld lymph node cells
constitutively express high levels of fasL mRNA (12,
13).
B- and AP-1-binding
sites located more than 1 kilobase upstream of the coding region.
Overexpression of a dominant negative form of the NF-B inhibitor
I-B blocked the induction of the
fasL-dependent reporter by these treatments. Some correlative evidence has suggested that NF-B also has a role in
TCR-induced fasL expression. For example, NF-B activity, which is increased by proteasome-mediated degradation of its
cytoplasmic inhibitor I-B (15), and fasL expression are
both blocked by proteasome inhibitors (16). Furthermore, induction of
both NF-B transcriptional activity and fasL transcription
by TCR signals is sensitive to antioxidants, and pro-oxidants such as
hydrogen peroxide can induce both (17, 18). Both activation- and
peroxide-induced apoptosis were inhibited by overexpression of dominant
negative I-B (18). However, the NF-B site that apparently takes
part in stress-induced fasL up-regulation lies outside of
the region that confers TCR inducibility of fasL
transcription, and a potential NF-B site that does lie in this
region (19) is dispensable for TCR-mediated fasL
up-regulation (20-22).
275 relative to the coding
region, was found to contribute to fasL reporter activity in
Jurkat cells (22, 26). In contrast, we found that mutation or deletion
of the NF-AT site at 275 did not have a substantial effect on
fasL up-regulation and described a fasL
regulatory element (FLRE) located from 214 to 207 in the
fasL promoter (20). The FLRE conferred the majority of
TCR-inducible fasL promoter activity in a murine T cell
hybridoma and in human T cell blasts and proved to be a binding site
for Egr-1 and Egr-3, members of the Egr (early
growth response) family of transcription
factors. Overexpression of Egr-3 but not Egr-1 was sufficient to induce
an FLRE-dependent reporter construct as well as an increase
in cellular fasL mRNA. TCR-mediated induction of Egr-3
but not Egr-1 was sensitive to inhibition by CsA, suggesting that Egr-3
may be a transcriptional target of NF-AT. These data indicated that
Egr-3 rather than the more abundant Egr-1 is likely to be a direct
mediator of fasL transcription in activated T cells.
MATERIALS AND METHODS
-mercaptoethanol, 100 units/ml
penicillin, 150 µg/ml gentamicin, and 10% heat-inactivated fetal
calf serum (complete medium). HeLa (human cervical carcinoma) cells
were cultured in Dulbecco's modified Eagle's medium (Biofluids) with
the foregoing supplements. C3H (10 weeks of age), and
C3H-gld/gld MRL-lpr/lpr mice (4-5 months of age)
were obtained from Jackson Laboratories (Bar Harbor, ME). In some
experiments, interbred (C57BL/6 × DBA2)F1 mice
maintained in our animal facility were used. CsA was obtained from
Sandoz. Protein A-purified antisera against Egr-1, Egr-3, WT-1, and an
unknown protein (anti-Egr-2) were obtained from Santa Cruz Technologies
(Santa Cruz, CA). An antiserum against Egr-2 was obtained from Berkeley
Antibody (Berkeley, CA).
220 to 205, relative to the initiating codon)
appended to a fasL minimal promoter (from 137 to 1), the
"m16-mer" plasmid, in which a 4-bp substitution in the FLRE (214
to 211: GTGG 
CACC) was made, the 305-mer, the 225-mer, and the
212-mer plasmids, all driving the luciferase reporter gene of the
vector pGL3 (Promega), were described (20). The expression plasmids
encoding NGFI-A (Egr-1), Egr-2, and Egr-3 were described (32).
RESULTS
CD8 T cells that bear characteristics
indicative of chronic activation and express constitutively elevated
levels of fasL mRNA (12, 13). Because we have recently
found that the fasL promoter is under the direct control of
the activation-inducible and CsA-sensitive transcription factor Egr-3
(20), we asked whether T cells from lpr and gld mice contain elevated
levels of FLRE-binding proteins. Extracts derived from freshly isolated
lymph nodes from 3-5-month-old lpr and gld mice, which consist almost
entirely of DN T cells (Ref. 37 and data not shown), were examined by
the electrophoretic mobility shift assay (gel shift). Incubating
extracts from either mouse with the labeled FLRE revealed a major
retarded species (Fig. 1, bands
I and II). The center of migration of this band was
slightly faster than that of a band previously identified as Egr-1 in
activated 2B4.11 T hybridoma cells (Fig. 1, stimulated 2B4.11 cells)
and corresponded to the migration of Egr-1 and Egr-2 generated by
transient expression in HeLa cells (data not shown). Addition of a
nonspecific antiserum or an antiserum specific for the distantly
related Egr family member WT-1, the product of the Wilms' tumor
suppressor gene locus, did not affect the gel shift patterns. In
contrast, antisera specific for Egr-1 caused a reduction in the
intensity of the major shifted band I, and the remaining material (band
II) migrated slightly more rapidly than the mean of bands I and II. The
anti-Egr-1 antibodies also caused the appearance of supershifted
antibody-antigen-DNA complexes of slower mobility. Antibodies against
Egr-2 also reduced the intensity of the principal band; in this case
the remaining material (band I) migrated more slowly than the combined
bands I and II. Anti-Egr-2 caused the appearance of a supershifted
complex of mobility different from that of the Egr-1 supershifted
complex. Simultaneous addition of both Egr-1 and Egr-2-specific
antisera caused the complete disappearance of the major retarded
species. Only a very small amount of material migrated more rapidly
than band II, and, unlike activated 2B4.11 cells (Fig. 1 and Ref. 20),
antisera against Egr-3 had little effect on this band III in lpr and
gld cell extracts. Finally, as with 2B4.11 cells, band IV is
constitutively present and is not eliminated by the unlabeled FLRE
oligonucleotide (20). Therefore, unstimulated DN T cells from both lpr
and gld mice have little if any Egr-3 but, unlike normal unactivated T
cells (20), constitutively express Egr-1 and Egr-2, as evidenced by binding to the FLRE.
View larger version (50K):
[in a new window]
Fig. 1.
Analysis of FLRE-binding proteins in lpr and
gld DN T cell extracts. Extracts of freshly isolated and untreated
lpr and gld lymph node DN T cells or 2B4.11 cells stimulated for 3 h with PMA (10 ng/ml) and ionomycin (1 µg/ml) were incubated with the
end-labeled oligonucleotide corresponding to the region from 220 to
205 (16-mer) of the fasL promoter. Complexes were resolved
by electrophoresis on 5% nondenaturing polyacrylamide gels. Antisera
raised against the indicated molecules were added during the
incubation. Bands corresponding to Egr-1 (band I), Egr-2
(band II), Egr-3 (band III), and a nonspecific
(NS) band (band IV) are indicated. The mobility
of these species correlated with that of the homologous rat proteins
expressed in HeLa cells by transient transfection (data not shown).
WT, Wilms' tumor antigen WT-1.
View larger version (52K):
[in a new window]
Fig. 2.
Expression of Egr family mRNA in normal T
cells and in lpr and gld DN T cells. Northern blots were prepared
with RNA from freshly isolated lpr and gld DN T cells and from C3H
lymph node cells that were unstimulated or stimulated for 3 h with
PMA and ionomycin. Individual blots prepared from the same set of RNA
samples were probed with the indicated 32P-labeled
cDNAs. P+I, PMA and ionomycin.
View larger version (66K):
[in a new window]
Fig. 3.
Analysis of FLRE-binding proteins in normal T
cells. Extracts of C3H lymph node cells that were either freshly
isolated or stimulated for 3 h with PMA and ionomycin were
analyzed by gel shift as in Fig. 1.
View larger version (24K):
[in a new window]
Fig. 4.
Egr-2 mRNA induction in activated normal
T cells is sensitive to CsA. Total RNA from (C57BL/6 × DBA2)F1 mice either unstimulated or stimulated for 3 h
with PMA and ionomycin in the absence or presence of 100 ng/ml CsA was
subjected to Northern blot analysis for egr-2 mRNA
expression. P+I, PMA and ionomycin.
220 to 205, which
contains the FLRE. Enforced expression of Egr-1 had little effect on
the activity of the intact reporter (Fig.
5A). As previously shown (20), the Egr-3 expression plasmid induced significantly higher activity. Overexpression of Egr-2 resulted in a response that was similar to that
induced by Egr-3. Cotransfection of plasmids encoding the Egr family
gene products had little effect on the activity of a reporter construct
with a mutation in the FLRE that eliminated TCR-induced activity of
fasL reporter constructs (20). To determine whether Egr-2
activates the FLRE in a nonlymphoid cell, the effect of its
overexpression was tested in HeLa cells. As with the 2B4.11 cells, the
mutated reporter was only minimally affected by cotransfected Egr-expressing plasmids. In contrast, although the reporter bearing the
wild type FLRE was minimally affected by cotransfected Egr-1, it was
driven by Egr-3 and even more strongly by Egr-2. Thus, expression of
either Egr-2 or Egr-3 is sufficient to induce the fasL
promoter, and this response does not require the presence of
lymphoid-specific accessory factors.
View larger version (11K):
[in a new window]
Fig. 5.
Induction of
fasL-dependent transcription by transient
overexpression of Egr family members. A, 2B4.11 or HeLa
cells were transfected with the indicated Egr family expression
plasmids and luciferase reporter plasmids that were dependent on either
a wild type or a mutated FLRE, and luciferase activity was measured
14 h (2B4.11) or 32 h (HeLa) later. Results are expressed as
fold inductions by Egr protein-expressing plasmids relative to the
empty parental plasmid. The data represent the geometric means of three
independent experiments for each cell type. B, Hela cells
were transiently transfected with Egr family expression plasmids, and
the relative levels of human fasL mRNA were determined
by RT-PCR and Southern blotting 32 h later. The lane labeled
RT contains the PCR products of a mock reverse
transcriptase reaction with the Egr-3-transfected RNA sample from which
reverse transcriptase was omitted. One representative experiment of
five is shown.
214 to 207)). Moreover, a
reporter driven by a larger segment of the promoter (305 bp) also was
active in these cells, and this activity was largely lost by mutation
of the FLRE. Similar results were obtained with gld DN T cells (data
not shown). These results support the notion that the FLRE, principally
by binding the constitutively present transcription factor Egr-2, plays
a major role in the maintenance of fasL mRNA expression
in both lpr and gld DN T cells and in an additional context confirm the
role of this site in fasL regulation in T cells.
View larger version (10K):
[in a new window]
Fig. 6.
An intact FLRE is required for optimal
constitutive fasL-dependent reporter
activity in lpr lymph node DN T cells. Lpr lymph node DN T cells
were electroporated with the indicated fasL promoter-driven
luciferase reporter plasmids, and luciferase activity was measured
15 h later. One representative experiment of three is shown.
DISCUSSION
(55) and Vav (56), and express
increased levels of the tyrosine kinase Fyn (57). Also increased is the
DNA binding activity of the transcription factors NF-B, AP-1, and an
uncharacterized DNA binding activity, NF-ATb, that
recognized the DNA sequence of the interleukin-2 promoter NF-AT site
(58). DN T cells do not proliferate upon TCR cross-linking in part
because they are unable to up-regulate production of interleukin-2
(59). To account for this, it was proposed that NFATb
functions as a transcriptional repressor that overrides the activating
potential of the aforementioned constitutive transcription factors
activity, although no such repressive activity was demonstrated (58).
It is possible that in the context of the egr-2 and
egr-3 promoters NF-ATb functions as an activator
of transcription. Attempts to analyze the promoters of these genes are
currently underway.
FOOTNOTES
To whom correspondence should be addressed. Tel.: 301-496-4931;
Fax: 301-402-4844; E-mail: jda{at}Box-j.nih.gov.
REFERENCES
Top
Abstract
Introduction
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Gururajan, A. Simmons, T. Dasu, B. T. Spear, C. Calulot, D. A. Robertson, D. L. Wiest, J. G. Monroe, and S. Bondada Early Growth Response Genes Regulate B Cell Development, Proliferation, and Immune Response J. Immunol., October 1, 2008; 181(7): 4590 - 4602. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Zhu, A. L.J. Symonds, J. E. Martin, D. Kioussis, D. C. Wraith, S. Li, and P. Wang Early growth response gene 2 (Egr-2) controls the self-tolerance of T cells and prevents the development of lupuslike autoimmune disease J. Exp. Med., September 29, 2008; 205(10): 2295 - 2307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fionda, F. Nappi, M. Piccoli, L. Frati, A. Santoni, and M. Cippitelli 15-Deoxy-{Delta}12,14-Prostaglandin J2 Negatively Regulates rankl Gene Expression in Activated T Lymphocytes: Role of NF-{kappa}B and Early Growth Response Transcription Factors J. Immunol., April 1, 2007; 178(7): 4039 - 4050. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Manicassamy and Z. Sun The Critical Role of Protein Kinase C-{theta} in Fas/Fas Ligand-Mediated Apoptosis J. Immunol., January 1, 2007; 178(1): 312 - 319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Collins, L. A. Wolfraim, C. G. Drake, M. R. Horton, and J. D. Powell Cutting Edge: TCR-Induced NAB2 Enhances T Cell Function by Coactivating IL-2 Transcription J. Immunol., December 15, 2006; 177(12): 8301 - 8305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Castellano, B. Vire, M. Pion, V. Quivy, D. Olive, I. Hirsch, C. Van Lint, and Y. Collette Active Transcription of the Human FASL/CD95L/TNFSF6 Promoter Region in T Lymphocytes Involves Chromatin Remodeling: ROLE OF DNA METHYLATION AND PROTEIN ACETYLATION SUGGEST DISTINCT MECHANISMS OF TRANSCRIPTIONAL REPRESSION J. Biol. Chem., May 26, 2006; 281(21): 14719 - 14728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Askenasy, E. S. Yolcu, I. Yaniv, and H. Shirwan Induction of tolerance using Fas ligand: a double-edged immunomodulator Blood, February 15, 2005; 105(4): 1396 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Jayanthi, X. Deng, B. Ladenheim, M. T. McCoy, A. Cluster, N.-s. Cai, and J. L. Cadet Calcineurin/NFAT-induced up-regulation of the Fas ligand/Fas death pathway is involved in methamphetamine-induced neuronal apoptosis PNAS, January 18, 2005; 102(3): 868 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Torgler, S. Jakob, E. Ontsouka, U. Nachbur, C. Mueller, D. R. Green, and T. Brunner Regulation of Activation-induced Fas (CD95/Apo-1) Ligand Expression in T Cells by the Cyclin B1/Cdk1 Complex J. Biol. Chem., September 3, 2004; 279(36): 37334 - 37342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-G. Yoo and M.-O. Lee Hepatitis B Virus X Protein Induces Expression of Fas Ligand Gene through Enhancing Transcriptional Activity of Early Growth Response Factor J. Biol. Chem., August 27, 2004; 279(35): 36242 - 36249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Xi and G. J. Kersh Early Growth Response Gene 3 Regulates Thymocyte Proliferation during the Transition from CD4-CD8- to CD4+CD8+1 J. Immunol., January 15, 2004; 172(2): 964 - 971. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. M. Droin, M. J. Pinkoski, E. Dejardin, and D. R. Green Egr Family Members Regulate Nonlymphoid Expression of Fas Ligand, TRAIL, and Tumor Necrosis Factor during Immune Responses Mol. Cell. Biol., November 1, 2003; 23(21): 7638 - 7647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. DeRyckere, D. L. Mann, and J. DeGregori Characterization of Transcriptional Regulation During Negative Selection In Vivo J. Immunol., July 15, 2003; 171(2): 802 - 811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Li, X. Qi, M. Williams, Y. Shi, and A. D. Keegan Overexpression of Insulin Receptor Substrate-1, But Not Insulin Receptor Substrate-2, Protects a T Cell Hybridoma from Activation-Induced Cell Death J. Immunol., June 15, 2002; 168(12): 6215 - 6223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yang, B. Dong, P. R. Mittelstadt, H. Xiao, and J. D. Ashwell HIV Tat Binds Egr Proteins and Enhances Egr-dependent Transactivation of the Fas Ligand Promoter J. Biol. Chem., May 24, 2002; 277(22): 19482 - 19487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. T. Miller and L. J. Berg Defective Fas Ligand Expression and Activation-Induced Cell Death in the Absence of IL-2-Inducible T Cell Kinase J. Immunol., March 1, 2002; 168(5): 2163 - 2172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kirchhoff, T. Sebens, S. Baumann, A. Krueger, R. Zawatzky, M. Li-Weber, E. Meinl, F. Neipel, B. Fleckenstein, and P. H. Krammer Viral IFN-Regulatory Factors Inhibit Activation-Induced Cell Death Via Two Positive Regulatory IFN-Regulatory Factor 1-Dependent Domains in the CD95 Ligand Promoter J. Immunol., February 1, 2002; 168(3): 1226 - 1234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Devadas, L. Zaritskaya, S. G. Rhee, L. Oberley, and M. S. Williams Discrete Generation of Superoxide and Hydrogen Peroxide by T Cell Receptor Stimulation: Selective Regulation of Mitogen-Activated Protein Kinase Activation and Fas Ligand Expression J. Exp. Med., January 7, 2002; 195(1): 59 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Kennedy, J. Q. Russell, N. Michail, and R. C. Budd Liver Damage by Infiltrating CD8+ T Cells Is Fas Dependent J. Immunol., December 1, 2001; 167(11): 6654 - 6662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wasem, C. Frutschi, D. Arnold, C. Vallan, T. Lin, D. R. Green, C. Mueller, and T. Brunner Accumulation and Activation-Induced Release of Preformed Fas (CD95) Ligand During the Pathogenesis of Experimental Graft-Versus-Host Disease J. Immunol., September 1, 2001; 167(5): 2936 - 2941. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-M. Steff, S. Trop, M. Maira, J. Drouin, and P. Hugo Opposite Ability of Pre-TCR and {{alpha}}{{beta}}TCR to Induce Apoptosis J. Immunol., April 15, 2001; 166(8): 5044 - 5050. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Dzialo-Hatton, J. Milbrandt, R. D. Hockett Jr., and C. T. Weaver Differential Expression of Fas Ligand in Th1 and Th2 Cells Is Regulated by Early Growth Response Gene and NF-AT Family Members J. Immunol., April 1, 2001; 166(7): 4534 - 4542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Delgado and D. Ganea Vasoactive Intestinal Peptide and Pituitary Adenylate Cyclase-Activating Polypeptide Inhibit Expression of Fas Ligand in Activated T Lymphocytes by Regulating c-Myc, NF-{{kappa}}B, NF-AT, and Early Growth Factors 2/3 J. Immunol., January 15, 2001; 166(2): 1028 - 1040. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. De Paepe, L. P. Rubin, C. Jude, A. M. Lesieur-Brooks, D. R. Mills, and F. I. Luks Fas ligand expression coincides with alveolar cell apoptosis in late-gestation fetal lung development Am J Physiol Lung Cell Mol Physiol, November 1, 2000; 279(5): L967 - L976. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Norian, K. M. Latinis, S. L. Eliason, K. Lyson, C. Yang, T. Ratliff, and G. A. Koretzky The Regulation of CD95 (Fas) Ligand Expression in Primary T Cells: Induction of Promoter Activation in CD95LP-Luc Transgenic Mice J. Immunol., May 1, 2000; 164(9): 4471 - 4480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Sevetson, J. Svaren, and J. Milbrandt A Novel Activation Function for NAB Proteins in EGR-dependent Transcription of the Luteinizing Hormone beta Gene J. Biol. Chem., March 24, 2000; 275(13): 9749 - 9757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Matsui, S. Xiao, A. Fine, and S.-T. Ju Role of Activator Protein-1 in TCR-Mediated Regulation of the Murine fasl Promoter J. Immunol., March 15, 2000; 164(6): 3002 - 3008. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Milner, S. C. Kent, T. A. Ashley, S. B. Wilson, J. L. Strominger, and D. A. Hafler Differential Responses of Invariant V{alpha}24J{alpha}Q T Cells and MHC Class II-Restricted CD4+ T Cells to Dexamethasone J. Immunol., September 1, 1999; 163(5): 2522 - 2529. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |