|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 52, 37161-37168, December 24, 1999
From A novel human organic transporter, OATP2, has
been identified that transports taurocholic acid, the adrenal androgen
dehydroepiandrosterone sulfate, and thyroid hormone, as well as the
hydroxymethylglutaryl-CoA reductase inhibitor, pravastatin. OATP2 is
expressed exclusively in liver in contrast to all other known
transporter subtypes that are found in both hepatic and nonhepatic
tissues. OATP2 is considerably diverged from other family members,
sharing only 42% sequence identity with the four other subtypes.
Furthermore, unlike other subtypes, OATP2 did not transport digoxin or
aldosterone. The rat isoform oatp1 was also shown to transport
pravastatin, whereas other members of the OATP family, i.e.
rat oatp2, human OATP, and the prostaglandin transporter, did not.
Cis-inhibition studies indicate that both OATP2 and roatp1 also
transport other statins including lovastatin, simvastatin, and
atorvastatin. In summary, OATP2 is a novel organic anion transport
protein that has overlapping but not identical substrate specificities
with each of the other subtypes and, with its liver-specific
expression, represents a functionally distinct OATP isoform.
Furthermore, the identification of oatp1 and OATP2 as pravastatin
transporters suggests that they are responsible for the hepatic uptake
of this liver-specific hydroxymethylglutaryl-CoA reductase inhibitor in
rat and man.
The liver functions in the clearance of a large variety of
metabolic products, drugs, and other xenobiotics by transporting them
across the sinusoidal membrane into the hepatocyte. Several classes of
transport systems have been described that mediate these processes
including the Na+/taurocholate cotransporter polypeptide,
in rat and human liver (1, 2), and a family of organic anion
transporting polypeptides (OATPs)1 that are principally
expressed in liver, kidney, and brain. These transport a broad spectrum
of substrates in a sodium-independent manner (3, 4). The
distribution of this latter family of transporters in liver, kidney,
and choroid plexus in the brain is thought to reflect common
physiological requirements of these organs for the clearance of a
multitude of organic anions. There are three OATP isoforms identified
to date in the rat: roatp1 (5), roatp2 (6), and roatp3 (7). Rat oatp1
and oatp2 are abundantly expressed in liver and kidney and much less in brain, whereas oatp3 is absent in liver but highly expressed in kidney.
In addition to bile acids, OATPs are known to transport a variety of
other compounds. These include, depending on the transporter,
unconjugated and conjugated steroids, such as estrone sulfate,
estradiol-17B-glucuronide, and aldosterone, and cardiac glycosides (6,
8-11). Bromosulfophthalien (5), mycotoxin (12), leukotriene
C4 (13), and thyroid hormone (7) are additional substrates.
In contrast to the rat, only one transporter of this family, OATP, has
been identified in humans (14). It is expressed most abundantly
throughout the brain and in much lower amounts in liver, kidney, and
lung. In addition to bile acids and the above steroids, human OATP has
recently been shown to transport the adrenal androgen dehydroepiandrosterone sulfate (DHEAS) (15).
HMG-CoA reductase inhibitors, or statins, are members of an important
class of lipid lowering drugs that have been demonstrated to decrease
risk for myocardial infarction (16-18) and stroke (19, 20). This is
due, at least in part, to their ability to lower low density
lipoprotein cholesterol through the inhibition of cholesterol synthesis
in the liver. This results in an induction of hepatic low density
lipoprotein receptors, thereby increasing the catabolism of circulating
low density lipoprotein. The majority of statins, including lovastatin,
simvastatin, and atorvastatin, are lipophilic molecules with high
octanol:water partition coefficients, and, as such, they freely diffuse
across membranes (21). Consequently, they are potent inhibitors of
HMG-CoA reductase in a broad spectrum of tissues. In contrast, the
reductase inhibitor pravastatin is hydrophilic in nature, is relatively
membrane impermeable, and exhibits much greater tissue selectivity than
the other statins. It is taken up, primarily in the liver, by a
transport mechanism that is sodium-independent and is competitively
inhibited by bile acids and dibromosulfophthaein in isolated rat
hepatocytes (22, 23). It is the presence or absence of this transporter
that is likely the basis for the tissue selectivity of pravastatin. However, the protein that is responsible for this pravastatin transport
activity has not been identified. Because of their substrate specificities and tissue localization, members of the OATP family are
good pravastatin transporter candidates.
Clearly the OATP transporter class plays a critical role in hepatic
organic anion uptake mechanisms. However, only a single human isoform
has been identified, and it has very low hepatic expression.
Consequently, we sought to identify additional human OATPs that are
found in liver. The novel transporter, OATP2, was cloned, and its
substrate specificity was examined in expression studies. It transports
taurocholate, DHEAS, and pravastatin and is the only known OATP whose
expression is confined to liver. Furthermore, we have identified oatp1
as a pravastatin transporter in the rat.
cDNA Cloning and Expression--
Full-length rat oatp1 and
oatp2 coding sequences corresponding to nucleotides 75-2077 and
105-2108, respectively, of the published sequences (5, 6) were
amplified by PCR from rat liver poly(A)+ RNA
(CLONTECH). Full-length coding sequence from human
OATP corresponding to nucleotides 42-2101 of the published sequence
was amplified from human liver poly(A)+ RNA
(CLONTECH). The following oligonucleotides were
used as forward and reverse primers to amplify the indicated cDNAs:
rat oatp1, CCGGTACCCAGAAGAACACCATGGAAGAAACAG (forward) and
AGCGGCCGCCATTACAGCTTCGTTTTCAGTTCTC (reverse); rat oatp2,
CCGGTACCATCAGAAGAACAACATGGGAAAATC (forward) and
AGCGGCCGCCAGTAGAAAACTCATTACAGCTTCG (reverse); and human OATP, GCAGATCTACCCTGAAGAGCAACATGGGAGAAACTGAG (forward) and
GCGGTACCATGTCCCTCCTAGGAAAACTCAAGTGTCAC (reverse). The PCR
amplifications were performed using a GeneAmp Amplification kit (Perkin
Elmer, Inc.) according to the following schedule: for hOATP, 94 °C
for 0.5 min, 55 °C for 1 min, and 72 °C for 3 min for 40 cycles
followed by 72 °C for 7 min; for roatp1 and roatp2, 94 °C 1 min,
55 °C for 1 min, and 72 °C for 3 min for 40 cycles followed by
72 °C for 10 min.
The novel oatp family member, human OATP2, was identified by searching
the public EST data bases for sequences homologous to human OATP. One
EST sequence, GenBankTM accession number T73863, shared
41% sequence identity with OATP, and a clone containing full-length
coding sequence was obtained from a human liver library using the Gene
Trapper cDNA Positive Selection System (LifeTechnologies, Inc.).
Briefly, oligonucleotide PY79 (5'-ACCCTGTCTAGCAGGTTGCA-3'),
complementary to the EST sequence, was biotinylated at the 3'-end and
used to hybridize to a single-stranded human liver cDNA library
constructed in pCMVSport2 (LifeTechnologies, Inc.). Hybrids between the
biotinylated oligonucleotides and single-stranded DNA were captured on
streptavidin-coated paramagnetic beads. After washing, the captured
single-stranded DNA target was released from the biotinylated
oligonucleotides and converted to dsDNA by DNA polymerase using
unbiotinylated PY79. Following transformation and plating, several
positive clones were identified by PCR analysis. Full-length cDNA
clones were identified by sequencing.
For expression studies, all cDNAs were cloned into the expression
vector pCEP4 Transport Assays--
For transient transfections, 293c18 cells
(43) were plated in Dulbecco's modified Eagle's medium (DMEM) plus
10% fetal bovine serum and penicillin-streptomycin in
poly-D-lysine coated dishes and co-transfected with
transporter expression plasmids using LipofectAMINE Plus (Life
Technologies, Inc.) according to the manufacturer. The cells and media
were assayed for substrate transport 24 h later. To measure
transport, medium was removed, and monolayers were assayed in
triplicate by washing once in serum-free DMEM and adding the same
medium containing 3H-labeled substrate alone or in the
presence of various concentrations of unlabeled compounds. Monolayers
were incubated at room temperature for 5-10 min depending on the
transporter. Then the cells were rapidly washed once with ice-cold DMEM
containing 5% bovine serum albumin and three times with ice-cold DMEM.
Cells were lysed in 0.1 N NaOH, a fraction of the lysate
was used to determine radiolabel incorporation by liquid scintillation
counting, and another fraction was used to determine protein
concentration in the lysate using the Bradford assay with bovine serum
albumin as a standard.
Northern Blotting--
A Northern blot containing 2 µg each of
human poly(A)+ RNA (CLONTECH) was
prehybridized in Church buffer (0.5 M sodium phosphate, pH
7.0, 7% SDS, 1% bovine serum albumin, 2 mM EDTA) and
hybridized overnight at 65 °C in the same buffer with a
32P-labeled cDNA containing the full-length coding
sequence of OATP2. The blot was washed to a final stringency of 0.1×
SSC, 0.1% SDS at 65 °C and exposed to film at Sequence Analysis--
Data base searches for OATP family
members were performed using the BLAST and tBLAST algorithms (24).
Protein transmembrane domains were predicted using the TMPred
algorithm. Multiple sequence alignments were conducted using the
CLUSTALW (25) algorithm.
Chemicals--
[3H]taurocholate,
[3H]dehydroepiandrosterone,
[125I]thyroxine, and [35S]UTP and were
obtained from NEN Life Science Products. Atorvastatin was obtained from
Parke Davis Pharmaceuticals. Pravastatin,
[3H]pravastatin, simvastatin, lovastatin, and two
atorvastatin hydroxylated metabolites (BMS241423 and BMS243887) were
synthesized at Bristol-Myers Squibb. Simvastatin and lovastatin were
converted to their open acid sodium salts by base hydrolysis as
described (26). Taurocholate was obtained from Sigma. Human liver
I.M.A.G.E. consortium EST clones were obtained from the American Type
Culture Collection.
roatp1 Transports Pravastatin--
293c18 cells transfected with
pCEP4 expression plasmids containing roatp1, roatp2, and hOATP
cDNAs were assayed for the uptake of pravastatin. Specific
transport of [3H]pravastatin was observed in roatp1
transfected cells (Fig. 1A). A
time course experiment showed pravastatin transport to be linear for
approximately 6 min with uptake reaching equilibrium after 10 min (Fig.
1B), whereas uptake was saturable with an apparent Km of 30 µM (Fig. 1C). In
contrast, no pravastatin transport was observed in 293c18 cells
transfected with roatp2, hOATP, or the empty vector, pCEP4 (Fig.
1A). In control experiments all three transporters
transported taurocholate (data not shown), in agreement with earlier
studies demonstrating uptake of taurocholate by oatp1 expressing
Xenopus laevis oocytes and HeLa cells (5, 10); this verifies
that all three transporters are active in this system.
Pravastatin transport in isolated rat hepatocytes is competitively
inhibited by taurocholate and the statins lovastatin and simvastatin
(22). To further characterize statin interactions with roatp1, the
cis-inhibition of pravastatin and taurocholate uptake by statins and
other compounds was examined. Both [3H]pravastatin and
[3H]taurocholate transport was inhibited by 50 µM (100-fold molar excess over tracer) of pravastatin,
taurocholate, and several other HMG-CoA reductase inhibitors including
simvastatin, lovastatin, atorvastatin, BMS241423, and BMS243887 (Fig.
2). The latter are two hydroxylated
atorvastatin metabolites that are found in plasma from treated
subjects. The rank order of statin potency for inhibition of
pravastatin uptake was BMS243887 > BMS241423 = lovastatin = simvastatin > atorvastatin > pravastatin.
A similar pattern was observed for statin inhibition of taurocholate
transport. Taurocholate also blocked pravastatin uptake, consistent
with it being a substrate of roatp1 (Fig. 2 and Ref. 5) and its
inhibition of pravastatin transport in hepatocytes. DHEAS, a substrate
for human OATP, was also an inhibitor of pravastatin and taurocholate
transport by roatp1. In contrast, digoxin and prostaglandin
E2, substrates for the OATP family members roatp2 and PGT,
respectively, are not roatp1 substrates, and these molecules did not
inhibit pravastatin transport.2
Identification of a Novel Human Organic Anion
Transporter--
The lack of pravastatin transport activity by hOATP
plus the existence of multiple OATP isoforms in the rat suggested that an additional OATP exists that could account for the hepatic uptake of
pravastatin in humans. A number of PCR-based approaches utilizing degenerate PCR primers based on conserved sequences within the OATP
family failed to identify any novel sequences from human adult and
fetal liver or kidney cDNA or from human genomic DNA. However, a
search of the GenEMBL EST data base revealed a sequence (GenBankTM accession number T73863) obtained from a human
liver library with significant homology to hOATP. The insert of this
clone did not contain full-length coding sequence. Thus, an
oligonucleotide based on EST T73863 was used to screen for full-length
clones using the Gene Trap method. A 2.8-kilobase cDNA was
identified containing 134, 2076, and 620 nucleotides of
5'-untranslated, coding, and 3'-untranslated sequences, respectively
(Fig. 3). Conceptual translation of the
cDNA sequence predicts a 691-amino acid protein with the following
putative structural features: (i) 12 transmembrane domains (TMDs)
ranging from 18 to 28 amino acids each (Fig.
4) and (ii) 11 potential
N-glycosylation sites. Only two of the latter
(Asn134 and Asn617) are predicted to be in
extracellular loops. No sequence prior to the first TMD that strongly
conforms to a signal peptide consensus predicted by the SPScan
algorithm (27) could be found. This new transporter will be referred to
as OATP2 (organic anion
transporting polypeptide 2.
Four OATPs expressed in liver have been previously reported; three
isoforms have been identified in the rat (oatp1, 2, and 3) and one in
human liver (OATP) (5-7, 14). The alignment of OATP2 with these other
transporters is shown in Fig. 4. 32% of the amino acids are conserved,
and twelve TMDs are found in all five proteins predicted by the
algorithm TMPred. The sequence identities of all pairwise comparisons
are shown in Table I. There is high
homology among human OATP and the three rat oatp isoforms, ranging from
67 to 82% identical residues. However, OATP2 is substantially diverged
in sequence; its sequence is only 42% identical to each of the four
other proteins. Furthermore, the lengths of all of the inter-TMD loops
are identical among the transporters shown in Fig. 4 with the exception
of OATP2. Loops between TMDs 3 and 4, TMDs 6 and 7, and TMDs 9 and 10 are all four to six residues longer in OATP2 compared with the others. In addition, OATP2 is considerably more basic than the other proteins, in particular hOATP; the predicted pI of OATP2 is 8.51 compared with
7.75, 7.74, 7.70, and 5.80 for roatp1, roatp2, roatp3, and hOATP,
respectively. OATP2 has overlapping but not identical substrate specificities with roatp1, roatp2, and hOATP (see below), and these
substrate preferences are presumably reflected in this sequence divergence.
Tissue and Cellular Distribution of OATP2--
The tissue
distribution of OATP2 expression was determined by Northern blotting of
poly(A)+ RNA from a variety of human tissues. OATP, roatp1,
roatp2, and roatp3 are all expressed in liver, kidney, and brain. In
contrast, the expression OATP2 is very hepato-specific; a major
3.2-kilobase band and several minor hybridizing bands were observed
only in RNA from liver and no other tissue (Fig.
5). A potential alternative polyadenylation signal was likely utilized in one of the OATP2 cDNA
clones that was isolated (Fig. 3), which could account for the smaller
2.4-kilobase mRNA species seen in the Northern blot. In
situ hybridization of OATP2 probe to human liver showed signal in
hepatocytes throughout the liver lobule, whereas no signal was observed
in bile ducts, Kupffer cells, or
vessels.3
OATP2 Is a Human Pravastatin Transporter--
The transport of
pravastatin by OATP2 was investigated in transfected 293c18 cells.
Specific uptake of [3H]pravastatin was observed in cells
transfected with OATP2 but not with empty vector (pCEP4) (Fig.
6A). Transport was linear for
approximately 5 min (Fig. 6B) and was saturable with an
apparent Km of 35 µM (Fig.
6C), similar to that of roatp1 for pravastatin. Thus, OATP2
is a liver-specific human pravastatin transporter.
Other Substrates of OATP2--
The ability of OATP2 to transport
other molecules was examined using additional radiolabeled compounds in
addition to assaying the cis-inhibition of
[3H]pravastatin uptake by unlabeled substrates. Known
substrates of other transporters in this family include taurocholate
(all OATPs), DHEAS (human OATP), and thyroid hormone (T3/T4) (roatp2 and roatp3). Of these, taurocholate, DHEAS, and T4, were shown to be
transported by OATP2 (Fig.
7A). Uptake of T4 was only
modestly higher in OATP2 compared with mock transfected cells
(2.38 ± 0.58 and 1.3 ± 0.18 pmol/min/mg, respectively;
p < 0.05) because of a high endogenous uptake by 293 cells. However, this uptake was repeatable and statistically
significant. The apparent Km of OATP2 for
taurocholate uptake was 33.8 µM (Fig. 7B),
compared with 60, 50, 34, and 18 µM for uptake by human
OATP (14), roatp1 (28), roatp2 (6), and roatp3 (7), respectively.
Additional substrates tested but not transported include aldosterone
and digoxin.
The ability of unlabeled compounds to inhibit OATP2 mediated
[3H]pravastatin and [3H]taurocholate uptake
was also determined. Specific uptake was inhibited 36 and 89% by 50 and 500 µM unlabeled pravastatin, respectively (Fig.
8). All other statins tested were much
more potent than pravastatin in this regard: 50 µM each
of simvastatin, atorvastatin, the two hydroxylated atorvastatin
metabolites BMS241423 and BMS243887, and lovastatin inhibited
[3H]pravastatin transport by greater than 95%.
Taurocholate and DHEAS also inhibited pravastatin transport, consistent
with these two compounds being substrates of OATP2 (Fig.
8A). The cis-inhibition of [3H]taurocholate
uptake by the same compounds showed a similar pattern with simvastatin,
atorvastatin, and its metabolites, with lovastatin being the most
potent inhibitors, whereas taurocholate and DHEAS showed more modest
effects.
The present work describes a new member of the organic anion
transporter polypeptide family, OATP2. It was obtained during efforts
to uncover additional hepatic transporters and to define the molecular
mechanism that mediates the transport of HMG-CoA reductase inhibitors.
In addition to the novel human OATP2, oatp1 was also shown to transport
pravastatin in the rat.
OATP2 is unique among OATPs in several ways. It is substantially
diverged in sequence from the other family members; it is only 42%
identical to each of the other OATPs, compared with 67-82% identity
seen among the other transporters. Furthermore, although all of the
loops between TMDs are strictly conserved among the other transporters,
OATP2 has additional amino acids in three of eleven loops. Our
inability to clone the human hepatic pravastatin transporter by PCR
using degenerate oligonucleotides that were conserved among the known
OATPs is likely due to this divergence.
Another distinguishing feature of OATP2 is its restricted pattern of
expression. Out of 16 tissues examined, only liver was found to express
OATP2 mRNA. This is in marked contrast to the other family members,
all of which are found in multiple tissues in addition to liver. This
includes kidney, skeletal muscle and colon for roatp1 (5), and kidney
brain and retina for roatp2 and roatp3 (6, 7). Human OATP mRNA,
although found in liver, kidney, and lung, is expressed much more in
brain than in these other tissues (14).
Although there is evidence for a single multivalent hepatocellular
uptake site for amphipathic compounds (29, 30), the discovery of a
second OATP isoform in human suggests that, as in the rat, such uptake
is in fact mediated by more than one carrier with partially overlapping
substrate specificities. A comparison of OATP2 with human OATP reveals
that the two proteins are functionally distinct with respect to the
types of substrates transported by each. Both OATP2 (Fig. 8) and OATP
(14, 15) transport taurocholate and DHEAS. However, only OATP2
transports HMG-CoA reductase inhibitors. Furthermore, the two appear to
differ in their transport of steroids; OATP mediates the uptake of
conjugates such as estradiol 17 DHEAS along with the nonsulfated DHEA are the major circulating adrenal
steroids, serving as precursors for endogenous sex steroid synthesis
(31). Furthermore, they have been suggested to have positive
neuropsychiatric, immune, and metabolic effects (32). OATP2 is the
second DHEAS transporter described to date and the only hepato-specific
carrier. The majority of DHEAS is formed in the liver from the
sulfation of DHEA, after which it is effluxed back into the circulation
across the sinusoidal surface of the hepatocyte (33). Furthermore,
taurocholate inhibitable DHEAS uptake into isolated rat hepatocytes is
also known to occur (34). Because members of this family are
bi-directional transporters, OATP2 along with OATP are candidates for
either of these transport processes in humans.
A search for pravastatin transport activity in the rat revealed that
rat oatp1 but not oatp2 mediates pravastatin uptake in vitro. In addition to this transport activity in transfected
cells, several other lines of evidence suggest that this is the protein responsible for pravastatin uptake observed in rat hepatocytes. Yamazaki et al. (22) demonstrated that uptake in liver cells was sodium-independent, appeared to be a single component, and was
competitively inhibited by taurocholate and other cholephils as well as
the lipophilic statins, lovastatin, and simvastatin. The order of
potency for inhibition of radiolabeled pravastatin transport into rat
hepatocytes was lovastatin = simvastatin Liver and kidney are the two principle organs of distribution when
pravastatin is administered intravenously to rats. This clearance
occurs by uptake on the sinusoidal or basolateral side of the liver
cell followed by biliary excretion across the canilicular membrane. Rat
oatp1 has been localized to the basolateral surface of the hepatocyte
(34), consistent with a role in hepatic pravastatin clearance (35),
whereas the unrelated multi-drug resistance protein, cMOAT
(canilicular multi-specific organic
anion transporter), is thought to be the
canilicular transporter (36). With regard to renal elimination of this
drug, there is uptake from the basolateral side of the renal tubular
epithelial cell in addition to glomerular filtration (37). However, in
the kidney, in contrast to the situation in liver, roatp1 resides on
the apical surface of the epithelial cell, and thus, it cannot be
responsible for the pravastatin uptake that occurs on the basolateral
side. This implies that there is yet another pravastatin transporter in
rat kidney that has this activity. It could be the recently reported
roatp3, the unrelated rat OAT1 (38), or cMOAT, all of which are
expressed in kidney. Because OATP transporters are bi-directional in
nature (39), roatp1 may transport pravastatin and other statins from the inside of the epithelial cell through the apical membrane to the
lumen of the renal tubule in rat kidney. Alternatively it could be an
as yet undescribed transporter.
Likewise, because significant elimination of pravastatin also occurs
via tubular epithelial cell transport in human kidneys (40), an
additional pravastatin transporter must exist in humans other than the
liver-specific OATP2. Because the uptake of pravastatin into tissues is
absolutely dependent on carrier mediated transport, the difference in
the tissues expressing human and rat pravastatin transporters (oatp1 in
rat liver, kidney, brain, lung, and skeletal muscle, and OATP only in
human liver) could result in pharmacodynamic differences in the
distribution of this drug between the two species.
The importance of heptocellular uptake in the elimination of any drug
is largely determined by its physiochemical properties. Polar organic
hydrophilic compounds require specific carriers for uptake into
hepatocytes, whereas lipophilic compounds are freely permeable to the
basolateral hepatocyte membrane and exhibit flow-dependent
distribution in the liver. Even though such drugs do not require
specific uptake mechanisms, they can act as substrates for transporters
and can potentially alter the hepatic handling of other drugs or
endogenous compounds (41). There are examples of both kinds of drugs
among HMG-CoA reductase inhibitors. Pravastatin is an example of the
former class, in which oatp1 and OATP2 are likely required for rat and
human hepatic uptake, respectively. The lipophilic statins simvastatin,
lovastatin, and atorvastatin are thought to be in the second class;
they do not require carriers for extraction by the liver. However, the
data presented here suggest that they are nevertheless very potent
inhibitors of radiolabeled pravastatin and taurocholate transport by
oatp1 and OATP2, showing much greater inhibition than the unlabeled
substrates themselves. Although the mode of this inhibition will
require more detailed mechanistic studies, it suggests that the
lipophilic statins may utilize these carriers as well.
In summary, we have identified a liver-specific member of the organic
anion transport protein family in humans that mediates the transport of
bile acid, the adrenal androgen DHEAS, and HMG-CoA reductase
inhibitors, a clinically important class of hypolipidemic agents. The
divergent sequence of OATP2, its substrate specificity, and its unique
tissue distribution indicate that it is not the human orthologue of any
previously described OATP, and thus, it represents a new functional
entity. This should further facilitate the understanding of hepatic
transport and clearance mechanisms for the molecules described as well
as additional substrates.
We thank Drs. Rex Parker and Richard Gregg
for helpful discussions and Bernadette Kienzle and Thomas Nelson for
DNA sequencing.
Similar results were recently reported by Abe
et al. (42) following the submission of this manuscript.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF205071.
¶
To whom all correspondence should be addressed: Dept. of
Metabolic Research, Rm. K3111, P.O. Box 4000, Princeton, NJ 08543-4000. Tel.: 609-252-5648; Fax: 609-252-6964; E-mail:
todd.kirchgessner@bms.com.
2
B. Hsiang and T. Kirchgessner, unpublished work.
3
V. Sasseville and T. Kirchgessner, unpublished work.
The abbreviations used are:
OATP, organic anion
transporting polypeptide;
DHEAS, dehydroepiandrosterone sulfate;
HMG-CoA, hydroxymethylglutaryl-CoA;
PCR, polymerase chain reaction;
DMEM, Dulbecco's modified Eagle's medium;
TMD, transmembrane domain;
EST, expressed sequence tag.
A Novel Human Hepatic Organic Anion Transporting Polypeptide
(OATP2)
IDENTIFICATION OF A LIVER-SPECIFIC HUMAN ORGANIC ANION
TRANSPORTING POLYPEPTIDE AND IDENTIFICATION OF RAT AND HUMAN
HYDROXYMETHYLGLUTARYL-CoA REDUCTASE INHIBITOR TRANSPORTERS*
,,,,¶
Bristol-Myers Squibb Co., Pharmaceutical
Research Institute, Princeton, New Jersey 08543-4000 and
§ Bristol-Myers Squibb Co., Pharmaceutical Research
Institute, Hopewell, New Jersey 08543-5400
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
R, a modified form of pCEP4 (Invitrogen, Inc.) in which
the cytomegalovirus promoter-driven expression cassette has been
inverted and used in transient transfections. Rat oatp1 and oatp2
PCR-amplified fragments were prepared for cloning by digestion with
KpnI and NotI. Human OATP2 cDNA in
pCMVSport2, corresponding to nucleotides 59-2361 in Fig. 3, was
excised by digestion with KpnI and NotI. All of
the above cDNAs were cloned into the KpnI and
NotI sites of pCEP4R. Human OATP amplified cDNA was
digested with BglII and KpnI and cloned into the
BglII and KpnI sites of pCEP4R.
80 °C with an
intensifying screen.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (13K):
[in a new window]
Fig. 1.
Assay of pravastatin transport in 293 cells
transfected with known OATPs. A, the uptake of
[3H]pravastatin into 293c18 cells transiently transfected
with the expression vector pCEP4 R containing the indicated cDNAs
or with empty vector was assayed. Transport was determined after 5 min
of incubation with 0.5 µM substrate at room temperature.
B, time course of [3H]pravastatin uptake in
roatp1 transfected cells after incubation with 0.5 µM
substrate for the indicated times. C, dose dependence of
[3H]pravastatin uptake into roatp1 transfected cells for
6 min at room temperature. Inset shows a double reciprocal
plot from which the indicated apparent Km was
calculated. The nonspecific uptake of label determined in the presence
of 1000-fold molar excess of unlabeled pravastatin was subtracted from
all values in B and C. Values are the means ± S.E. of triplicate determinations.
View larger version (23K):
[in a new window]
Fig. 2.
Cis-inhibition by various compounds of
roatp1-mediated pravastatin and taurocholate transport. 293c18
cells transfected with the pCEP4 R roatp1 expression plasmid were
incubated for 5 min with 0.5 µM
[3H]pravastatin or [3H]taurocholate alone
(control) or in the presence of 50 µM of the
indicated compounds, and the uptake of radiolabel was determined. The
incorporation of label in cells transfected with empty vector (mock) is
shown on the right-hand side of the figure. For both roatp1
and mock transfected cells, the incorporation of 3H-labeled
compounds was also determined in the presence of 500 µM
unlabeled compound (nonspecific). Values are the means ± S.E. of
triplicate determinations.
View larger version (59K):
[in a new window]
Fig. 3.
Nucleotide and amino acid sequence of human
OATP2. The nucleotide sequence of the longest OATP2 cDNA clone
is shown with the predicted amino acid sequence underneath. Nucleotide
numbering and amino acid numbering are indicated on the left
and right sides, respectively. Potential N-linked
glycosylation sites are indicated by an asterisk below the
residue. Underlined letters indicate a putative alternative
polyadenylation signal utilized in a shorter cDNA that was also
cloned from the same library.
View larger version (101K):
[in a new window]
Fig. 4.
Amino acid sequence alignment of OATP2 with
other OATP family members. The five proteins were aligned using
the CLUSTAL W algorithm. The bottom row is the consensus
showing residues that are conserved among all five proteins. Residues
that agree with the consensus are capitalized. Putative TMDs
are boxed. The exact borders of the TMDs are based on an
analysis of OATP2 using the program TMPred. The program predicts very
similar TMD regions in the other proteins. Dots indicate
gaps introduced to optimize the alignments.
Percentage of sequence identities among OATPs expressed in liver
View larger version (68K):
[in a new window]
Fig. 5.
Tissue-specific expression of OATP2.
Northern blot of poly(A)+ RNA from various human tissues
probed with OATP2 cDNA. The position of RNA standards is shown on
the right-hand side. Lane 1, heart; lane
2, brain; lane 3, placenta; lane 4, lung;
lane 5, liver; lane 6, skeletal muscle;
lane 7, kidney; lane 8, pancreas; lane
9, spleen; lane 10, thymus; lane 11,
prostate; lane 12, testis; lane 13, ovary;
lane 14, small intestine; lane 15, colon;
lane 16, leukocytes.
View larger version (13K):
[in a new window]
Fig. 6.
Human OATP2 transports pravastatin.
A, transport of pravastatin in 293c18 cells transfected with
the OATP2 expression plasmid, or the empty vector (pCEP4). Cells were
incubated for 5 min with 0.5 µM
[3H]pravastatin alone (total) or in the
presence of 500 µM unlabeled pravastatin
(non-specific) and cellular uptake of radiolabel was
determined. B, time course of pravastatin transport. Cells
were incubated with 0.5 µM [3H]pravastatin
for the indicated times, and uptake was subsequently determined.
Nonspecific uptake was determined as in A and subtracted
from each value. Values are the means ± S.E. for triplicate
determinations. C, dose dependence of
[3H]pravastatin uptake into OATP2 transfected cells for 5 min at room temperature. The inset shows a double reciprocal
plot from which the indicated apparent Km was
calculated.
View larger version (19K):
[in a new window]
Fig. 7.
Substrate specificity of OATP2.
A, 293c18 cells transfected with OATP2 plasmid or empty
vector (MOCK) were incubated for 5 min with 0.5 µM each of the indicated 3H-labeled
substrates, and uptake in the absence (Total) and presence
(nonspecific) of 500 µM (pravastatin, DHEAS, and
taurocholate) or 150 µM (T4) unlabeled substrate was
determined. B, dose dependence of taurocholate uptake. OATP2
transfected cells were incubated for 6 min with the indicated
concentrations of [3H]taurocholate. Nonspecific
incorporation was determined by incubation in the presence of 1000-fold
molar excess of unlabeled substrate and was subtracted from each value.
The apparent Km calculated from the double
reciprocal plot is indicated. Values are the means ± S.E. of
triplicate determinations.
View larger version (29K):
[in a new window]
Fig. 8.
Cis-inhibition by various compounds of
OATP2-mediated [3H]taurocholate and [ 3H]pravastatin transport. 293c18 cells transfected
with OATP2 plasmid were incubated for 5 min with 0.5 µM
3H-labeled substrate alone (control) or in the
presence of 50 µM of the indicated compounds, and the
uptake of radiolabel was determined. The incorporation of label in
cells transfected with empty vector (mock) is shown on the
right-hand side of the figure. For both OATP2 and mock
transfected cells, the incorporation of label was also determined in
the presence of 500 µM unlabeled taurocholate or
pravastatin (nonspecific). Values are the means ± S.E. of
triplicate determinations.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-glucuronide (3) and
estrone-3-sulfate (9), whereas OATP2 transports neither the former nor
the neutral steroid, aldosterone. OATP has been demonstrated to
transport bile acid. However it does so with a 60-fold lower transport
rate in Xenopus oocytes compared with roatp1. This suggests
that OATP may not mediate the majority of hepatic bile acid uptake in
humans. Indeed, the much higher level of expression in brain compared
with other tissues indicates that OATP may be more important in CNS
transport processes than in liver uptake mechanisms (14). Thus, OATP2
may be the predominant sodium-independent transporter of bile acids in
human liver, whereas OATP might be a relatively minor hepatic carrier.
taurocholate > pravastatin. The above characteristics of hepatic pravastatin uptake
mechanisms are consistent with the known properties of roatp1 and its
behavior in mediating pravastatin transport in this study: (i) roatp1
expression is relatively restricted, being expressed in relatively few
organs, including liver, consistent with the relative hepatoselectivity
of pravastatin; (ii) roatp1 is a sodium-independent transporter of bile
acid; and (iii) in the present studies, [3H]pravastatin
transport was inhibited by lovastatin, simvastatin, taurocholate, and
pravastatin in the same rank order as in isolated hepatocytes.
Furthermore, pravastatin inhibits the sodium-independent uptake of
taurocholate in rat hepatocytes (22, 23) and in roatp1-transfected
293c18 cells.
ACKNOWLEDGEMENTS
Addendum
FOOTNOTES
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Hagenbuch, B.,
Stieger, B.,
Foguet, M.,
Lubbert, H.,
and Meier, P. J.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10629-10633 2.
Hagenbuch, B.,
and Meier, P. J.
(1994)
J. Clin. Invest.
93,
1326-1331
3.
Meier, P. J.,
Eckhardt, U.,
Schroeder, A.,
Hagenbuch, B.,
and Stieger, B.
(1997)
Hepatology
26,
1667-1677[CrossRef][Medline]
[Order article via Infotrieve]
4.
Wolkoff, A. W.
(1996)
Semin. Liver. Dis.
16,
121-127[Medline]
[Order article via Infotrieve]
5.
Jacquemin, E.,
Hagenbuch, B.,
Stieger, B.,
Wolkoff, A. W.,
and Meier, P. J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
133-137 6.
Noe, B.,
Hagenbuch, B.,
Stieger, B.,
and Meier, P. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
10346-10350 7.
Abe, T.,
Kakyo, M.,
Sakagami, H.,
Tokui, T.,
Nishio, T.,
Tanemoto, M.,
Nomura, H.,
Hebert, S. C.,
Matsuno, S.,
Kondo, H.,
and Yawo, H.
(1998)
J. Biol. Chem.
273,
22395-22401 8.
Bossuyt, X.,
Muller, M.,
Hagenbuch, B.,
and Meier, P. J.
(1996)
J. Pharmacol. Exp. Ther.
276,
891-896 9.
Bossuyt, X.,
Muller, M.,
and Meier, P. J.
(1996)
J. Hepatol.
25,
733-738[CrossRef][Medline]
[Order article via Infotrieve]
10.
Kanai, N.,
Lu, R.,
Bao, Y.,
Wolkoff, A. W.,
and Schuster, V. L.
(1996)
Am. J. Physiol.
270,
F319-F325 11.
Kanai, N.,
Lu, R.,
Bao, Y.,
Wolkoff, A. W.,
Vore, M.,
and Schuster, V. L.
(1996)
Am. J. Physiol.
270,
F326-F331 12.
Kontaxi, M.,
Eckhardt, U.,
Hagenbuch, B.,
Stieger, B.,
Meier, P. J.,
and Petzinger, E.
(1996)
J. Pharmacol. Exp. Ther.
279,
1507-1513 13.
Li, L.,
Lee, T. K.,
Meier, P. J.,
and Ballatori, N.
(1998)
J. Biol. Chem.
273,
16184-16191 14.
Kullak-Ublick, G. A.,
Hagenbuch, B.,
Stieger, B.,
Schteingart, C. D.,
Hofmann, A. F.,
Wolkoff, A. W.,
and Meier, P. J.
(1995)
Gastroenterology
109,
1274-1282[CrossRef][Medline]
[Order article via Infotrieve]
15.
Kullak-Ublick, G. A.,
Fisch, T.,
Oswald, M.,
Hagenbuch, B.,
Meier, P. J.,
Beuers, U.,
and Paumgartner, G.
(1998)
FEBS Lett.
424,
173-176[CrossRef][Medline]
[Order article via Infotrieve]
16.
Smith, S. C., Jr.
(1997)
Am. J. Cardiol.
80,
10H-13H[CrossRef][Medline]
[Order article via Infotrieve]
17.
Rosenson, R. S.,
and Tangney, C. C.
(1998)
J. Am. Med. Assoc.
279,
1643-1650 18.
Farmer, J. A.,
and Gotto, A. M., Jr.
(1995)
Baillieres. Clin. Endocrinol. Metab.
9,
825-847[CrossRef][Medline]
[Order article via Infotrieve]
19.
Crouse, J. R., 3rd,
Byington, R. P.,
Hoen, H. M.,
and Furberg, C. D.
(1997)
Arch Intern Med
157,
1305-1310 20.
Plehn, J. F.,
Braunwald, E.,
Davis, B. R.,
Sacks, F. M.,
Rouleau, J. L.,
Pfeffer, M. A.,
Bernstein, V.,
Cuddy, T. E.,
Moye, L. A.,
Piller, L. B.,
Rutherford, J.,
Simpson, L. M.,
and Braunwald, E.
(1999)
Circulation
99,
216-223 21.
Hamelin, B. A.,
and Turgeon, J.
(1998)
Trends Pharmacol. Sci.
19,
26-37[CrossRef][Medline]
[Order article via Infotrieve]
22.
Yamazaki, M.,
Suzuki, H.,
Hanano, M.,
Tokui, T.,
Komai, T.,
and Sugiyama, Y.
(1993)
Am. J. Physiol.
264,
G36-G44 23.
Ziegler, K.,
and Stunkel, W.
(1992)
Biochim. Biophys. Acta
1139,
203-209[Medline]
[Order article via Infotrieve]
24.
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410[CrossRef][Medline]
[Order article via Infotrieve]
25.
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680 26.
Parker, R. A.,
Clark, R. W.,
Sit, S. Y.,
Lanier, T. L.,
Grosso, R. A.,
and Wright, J. J.
(1990)
J. Lipid Res.
31,
1271-1282[Abstract]
27.
(1999) Wisconsin Package, Version 9.1, Genetics Computer
Group, Madison, WI
28.
Kullak-Ublick, G. A.,
Hagenbuch, B.,
Stieger, B.,
Wolkoff, A. W.,
and Meier, P. J.
(1994)
Hepatology
20,
411-416[CrossRef][Medline]
[Order article via Infotrieve]
29.
Okudaira, K.,
Yamazaki, M.,
Sawatla, Y.,
Sugiyama, Y.,
Iga, T.,
and Hanano, M.
(1992)
Pharmacol. Res.
9,
1152-1156
30.
Steen, H.,
Merema, M.,
and Meijer, D. K. F.
(1992)
Biochem. Pharmacol.
44,
2323-2331[CrossRef][Medline]
[Order article via Infotrieve]
31.
Longcope, C.
(1996)
J. Endocrinol.
150,
S125-S127[Medline]
[Order article via Infotrieve]
32.
Bates, G. W.,
Buster, J. E.,
and Casson, P. R.
(1998)
Curr. Opin. Endocrinol. Diab.
5,
357-366
33.
Longcope, C.
(1995)
Ann. N. Y. Acad. Sci.
774,
143-148[Medline]
[Order article via Infotrieve]
34.
Reuter, S.,
and Mayer, D.
(1995)
J. Steroid Biochem. Mol. Biol.
54,
227-235[CrossRef][Medline]
[Order article via Infotrieve]
35.
Bergwerk, A. J.,
Shi, X.,
Ford, A. C.,
Kanai, N.,
Jacquemin, E.,
Burk, R. D.,
Bai, S.,
Novikoff, P. M.,
Stieger, B.,
Meier, P. J.,
Schuster, V. L.,
and Wolkoff, A. W.
(1996)
Am. J. Physiol.
271,
G231-G238 36.
Fukumura, S.,
Takikawa, H.,
and Yamanaka, M.
(1998)
Pharmacol. Res.
15,
72-76[CrossRef]
37.
Yamazaki, M.,
Tokui, T.,
Ishigami, M.,
and Sugiyama, Y.
(1996)
Biopharm. Drug Dispos.
17,
775-789[CrossRef][Medline]
[Order article via Infotrieve]
38.
Sweet, D. H.,
Wolff, N. A.,
and Pritchard, J. B.
(1997)
J. Biol. Chem.
272,
30088-30095 39.
Shi, X.,
Bai, S.,
Ford, A. C.,
Burk, R. D.,
Jacquemin, E.,
Hagenbuch, B.,
Meier, P. J.,
and Wolkoff, A. W.
(1995)
J. Biol. Chem.
270,
25591-25595 40.
Singhvi, S. M.,
Pan, H. Y.,
Morrison, R. A.,
and Willard, D. A.
(1990)
Br. J. Clin. Pharmacol.
29,
239-243[Medline]
[Order article via Infotrieve]
41.
Evans, A. M.
(1996)
Clin. Exp. Pharmacol. Physiol.
23,
970-974[Medline]
[Order article via Infotrieve]
42.
Abe, T.,
Kakyo, M.,
Tokui, T.,
Nakagomi, R.,
Nishio, T.,
Nakai, D.,
Nomura, H.,
Unno, M.,
Suzuki, M.,
Naioh, T.,
Matsuno, S.,
and Yawo, H.
(1999)
J. Biol. Chem.
274,
17159-17163 43.
Swirski, R. A.,
Van Den Berg, D.,
Murphy, A. J. M.,
Lambert, C. M.,
Friedberg, E. C.,
and Schimke, R. T.
(1992)
Methods Companion Methods Enzymol.
4,
133-142
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Miyagawa, K. Maeda, A. Aoyama, and Y. Sugiyama The Eighth and Ninth Transmembrane Domains in Organic Anion Transporting Polypeptide 1B1 Affect the Transport Kinetics of Estrone-3-Sulfate and Estradiol-17{beta}-D-glucuronide J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 551 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Oostendorp, E. van de Steeg, C. M. M. van der Kruijssen, J. H. Beijnen, K. E. Kenworthy, A. H. Schinkel, and J. H. M. Schellens Organic Anion-Transporting Polypeptide 1B1 Mediates Transport of Gimatecan and BNP1350 and Can Be Inhibited by Several Classic ATP-Binding Cassette (ABC) B1 and/or ABCG2 Inhibitors Drug Metab. Dispos., April 1, 2009; 37(4): 917 - 923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Elkiweri, Y. L. Zhang, U. Christians, K.-Y. Ng, M. C. Tissot van Patot, and T. K. Henthorn Competitive Substrates for P-Glycoprotein and Organic Anion Protein Transporters Differentially Reduce Blood Organ Transport of Fentanyl and Loperamide: Pharmacokinetics and Pharmacodynamics in Sprague-Dawley Rats Anesth. Analg., January 1, 2009; 108(1): 149 - 159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kitamura, K. Maeda, Y. Wang, and Y. Sugiyama Involvement of Multiple Transporters in the Hepatobiliary Transport of Rosuvastatin Drug Metab. Dispos., October 1, 2008; 36(10): 2014 - 2023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. Wolf, K. R. Brouwer, G. M. Pollack, and K. L. R. Brouwer Effect of Albumin on the Biliary Clearance of Compounds in Sandwich-Cultured Rat Hepatocytes Drug Metab. Dispos., October 1, 2008; 36(10): 2086 - 2092. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chen, J. L. Stock, X. Liu, J. Shi, J. W. Van Deusen, D. A. DiMattia, R. G. Dullea, and S. M. de Morais Utility of a Novel Oatp1b2 Knockout Mouse Model for Evaluating the Role of Oatp1b2 in the Hepatic Uptake of Model Compounds Drug Metab. Dispos., September 1, 2008; 36(9): 1840 - 1845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Zaher, H. E. M. zu Schwabedissen, R. G. Tirona, M. L. Cox, L. A. Obert, N. Agrawal, J. Palandra, J. L. Stock, R. B. Kim, and J. A. Ware Targeted Disruption of Murine Organic Anion-Transporting Polypeptide 1b2 (oatp1b2/Slco1b2) Significantly Alters Disposition of Prototypical Drug Substrates Pravastatin and Rifampin Mol. Pharmacol., August 1, 2008; 74(2): 320 - 329. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Shiraki, K. Umeda, N. Sakashita, M. Takeya, K. Kume, and S. Kume Differentiation of mouse and human embryonic stem cells into hepatic lineages. Genes Cells, July 1, 2008; 13(7): 731 - 746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Bachmakov, H. Glaeser, M. F. Fromm, and J. Konig Interaction of Oral Antidiabetic Drugs With Hepatic Uptake Transporters: Focus on Organic Anion Transporting Polypeptides and Organic Cation Transporter 1 Diabetes, June 1, 2008; 57(6): 1463 - 1469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Kumar, C. C. Benz, V. Shim, C. A. Minami, D. H. Moore, and L. J. Esserman Estrogen Receptor-Negative Breast Cancer Is Less Likely to Arise among Lipophilic Statin Users Cancer Epidemiol. Biomarkers Prev., May 1, 2008; 17(5): 1028 - 1033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ishiguro, K. Maeda, A. Saito, W. Kishimoto, S. Matsushima, T. Ebner, W. Roth, T. Igarashi, and Y. Sugiyama Establishment of a Set of Double Transfectants Coexpressing Organic Anion Transporting Polypeptide 1B3 and Hepatic Efflux Transporters for the Characterization of the Hepatobiliary Transport of Telmisartan Acylglucuronide Drug Metab. Dispos., April 1, 2008; 36(4): 796 - 805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kalliokoski, M. Neuvonen, P. J. Neuvonen, and M. Niemi Different Effects of SLCO1B1 Polymorphism on the Pharmacokinetics and Pharmacodynamics of Repaglinide and Nateglinide J. Clin. Pharmacol., March 1, 2008; 48(3): 311 - 321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Noe, R. Portmann, M.-E. Brun, and C. Funk Substrate-Dependent Drug-Drug Interactions between Gemfibrozil, Fluvastatin and Other Organic Anion-Transporting Peptide (OATP) Substrates on OATP1B1, OATP2B1, and OATP1B3 Drug Metab. Dispos., August 1, 2007; 35(8): 1308 - 1314. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mahagita, S. M. Grassl, P. Piyachaturawat, and N. Ballatori Human organic anion transporter 1B1 and 1B3 function as bidirectional carriers and do not mediate GSH-bile acid cotransport Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G271 - G278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Nogueira and M. Weir The Unique Character of Cardiovascular Disease in Chronic Kidney Disease and Its Implications for Treatment with Lipid-Lowering Drugs Clin. J. Am. Soc. Nephrol., July 1, 2007; 2(4): 766 - 785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Komatsu, T. Furukawa, R. Ikeda, S. Takumi, Q. Nong, K. Aoyama, S.-i. Akiyama, D. Keppler, and T. Takeuchi Involvement of Mitogen-Activated Protein Kinase Signaling Pathways in Microcystin-LR-Induced Apoptosis after its Selective Uptake Mediated by OATP1B1 and OATP1B3 Toxicol. Sci., June 1, 2007; 97(2): 407 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Seithel, S. Eberl, K. Singer, D. Auge, G. Heinkele, N. B. Wolf, F. Dorje, M. F. Fromm, and J. Konig The Influence of Macrolide Antibiotics on the Uptake of Organic Anions and Drugs Mediated by OATP1B1 and OATP1B3 Drug Metab. Dispos., May 1, 2007; 35(5): 779 - 786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Planchamp, A. Hadengue, B. Stieger, J. Bourquin, A. Vonlaufen, J.-L. Frossard, R. Quadri, C. D. Becker, and C. M. Pastor Function of Both Sinusoidal and Canalicular Transporters Controls the Concentration of Organic Anions within Hepatocytes Mol. Pharmacol., April 1, 2007; 71(4): 1089 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. Huber, B. Gao, M.-A. Sidler Pfandler, W. Zhang-Fu, S. Leuthold, B. Hagenbuch, G. Folkers, P. J. Meier, and B. Stieger Characterization of two splice variants of human organic anion transporting polypeptide 3A1 isolated from human brain Am J Physiol Cell Physiol, February 1, 2007; 292(2): C795 - C806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Cheng and C. D. Klaassen Regulation of mRNA Expression of Xenobiotic Transporters by the Pregnane X Receptor in Mouse Liver, Kidney, and Intestine Drug Metab. Dispos., November 1, 2006; 34(11): 1863 - 1867. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sai, Y. Kaneko, S. Ito, K. Mitsuoka, Y. Kato, I. Tamai, P. Artursson, and A. Tsuji PREDOMINANT CONTRIBUTION OF ORGANIC ANION TRANSPORTING POLYPEPTIDE OATP-B (OATP2B1) TO APICAL UPTAKE OF ESTRONE-3-SULFATE BY HUMAN INTESTINAL CACO-2 CELLS Drug Metab. Dispos., August 1, 2006; 34(8): 1423 - 1431. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ishiguro, K. Maeda, W. Kishimoto, A. Saito, A. Harada, T. Ebner, W. Roth, T. Igarashi, and Y. Sugiyama PREDOMINANT CONTRIBUTION OF OATP1B3 TO THE HEPATIC UPTAKE OF TELMISARTAN, AN ANGIOTENSIN II RECEPTOR ANTAGONIST, IN HUMANS Drug Metab. Dispos., July 1, 2006; 34(7): 1109 - 1115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Yamashiro, K. Maeda, M. Hirouchi, Y. Adachi, Z. Hu, and Y. Sugiyama INVOLVEMENT OF TRANSPORTERS IN THE HEPATIC UPTAKE AND BILIARY EXCRETION OF VALSARTAN, A SELECTIVE ANTAGONIST OF THE ANGIOTENSIN II AT1-RECEPTOR, IN HUMANS Drug Metab. Dispos., July 1, 2006; 34(7): 1247 - 1254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Y. Lau, H. Okochi, Y. Huang, and L. Z. Benet PHARMACOKINETICS OF ATORVASTATIN AND ITS HYDROXY METABOLITES IN RATS AND THE EFFECTS OF CONCOMITANT RIFAMPICIN SINGLE DOSES: RELEVANCE OF FIRST-PASS EFFECT FROM HEPATIC UPTAKE TRANSPORTERS, AND INTESTINAL AND HEPATIC METABOLISM Drug Metab. Dispos., July 1, 2006; 34(7): 1175 - 1181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, Y. Cui, A. Y. Chung, Y. Shitara, Y. Sugiyama, D. Keppler, and K. S. Pang Vectorial Transport of Enalapril by Oatp1a1/Mrp2 and OATP1B1 and OATP1B3/MRP2 in Rat and Human Livers J. Pharmacol. Exp. Ther., July 1, 2006; 318(1): 395 - 402. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Yamaguchi, M. Okada, S. Akitaya, H. Ohara, T. Mikkaichi, H. Ishikawa, M. Sato, M. Matsuura, T. Saga, M. Unno, et al. Transport of fluorescent chenodeoxycholic acid via the human organic anion transporters OATP1B1 and OATP1B3 J. Lipid Res., June 1, 2006; 47(6): 1196 - 1202. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Huang, Y. Wang, and S. Grimm ATP-DEPENDENT TRANSPORT OF ROSUVASTATIN IN MEMBRANE VESICLES EXPRESSING BREAST CANCER RESISTANCE PROTEIN Drug Metab. Dispos., May 1, 2006; 34(5): 738 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Letschert, H. Faulstich, D. Keller, and D. Keppler Molecular Characterization and Inhibition of Amanitin Uptake into Human Hepatocytes Toxicol. Sci., May 1, 2006; 91(1): 140 - 149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Y. Lau, H. Okochi, Y. Huang, and L. Z. Benet Multiple Transporters Affect the Disposition of Atorvastatin and Its Two Active Hydroxy Metabolites: Application of in Vitro and ex Situ Systems J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 762 - 771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, A. W. Wolkoff, and M. E. Morris FLAVONOIDS AS A NOVEL CLASS OF HUMAN ORGANIC ANION-TRANSPORTING POLYPEPTIDE OATP1B1 (OATP-C) MODULATORS Drug Metab. Dispos., November 1, 2005; 33(11): 1666 - 1672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. T. Kivisto, O. Grisk, U. Hofmann, K. Meissner, K.-U. Moritz, C. Ritter, K. A. Arnold, D. Lutjoohann, K. von Bergmann, I. Kloting, et al. DISPOSITION OF ORAL AND INTRAVENOUS PRAVASTATIN IN MRP2-DEFICIENT TR- RATS Drug Metab. Dispos., November 1, 2005; 33(11): 1593 - 1596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, E. Mak, R. G. Tirona, E. Tan, P. M. Novikoff, P. Wang, A. W. Wolkoff, and K. S. Pang Vascular Binding, Blood Flow, Transporter, and Enzyme Interactions on the Processing of Digoxin in Rat Liver J. Pharmacol. Exp. Ther., October 1, 2005; 315(1): 433 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kopplow, K. Letschert, J. Konig, B. Walter, and D. Keppler Human Hepatobiliary Transport of Organic Anions Analyzed by Quadruple-Transfected Cells Mol. Pharmacol., October 1, 2005; 68(4): 1031 - 1038. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Matsushima, K. Maeda, C. Kondo, M. Hirano, M. Sasaki, H. Suzuki, and Y. Sugiyama Identification of the Hepatic Efflux Transporters of Organic Anions Using Double-Transfected Madin-Darby Canine Kidney II Cells Expressing Human Organic Anion-Transporting Polypeptide 1B1 (OATP1B1)/Multidrug Resistance-Associated Protein 2, OATP1B1/Multidrug Resistance 1, and OATP1B1/Breast Cancer Resistance Protein J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 1059 - 1067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Morita, H. Kusuhara, Y. Nozaki, H. Endou, and Y. Sugiyama FUNCTIONAL INVOLVEMENT OF RAT ORGANIC ANION TRANSPORTER 2 (SLC22A7) IN THE HEPATIC UPTAKE OF THE NONSTEROIDAL ANTI-INFLAMMATORY DRUG KETOPROFEN Drug Metab. Dispos., August 1, 2005; 33(8): 1151 - 1157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chang, K. S. Pang, P. W. Swaan, and S. Ekins Comparative Pharmacophore Modeling of Organic Anion Transporting Polypeptides: A Meta-Analysis of Rat Oatp1a1 and Human OATP1B1 J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 533 - 541. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Gustavson, S. M. Schweitzer, S. Koehne-Voss, R. Achari, T. O. Chira, H.-U. Esslinger, and H. D. Yannicelli The Effects of Multiple Doses of Fenofibrate on the Pharmacokinetics of Pravastatin and Its 3{alpha}-Hydroxy Isomeric Metabolite J. Clin. Pharmacol., August 1, 2005; 45(8): 947 - 953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Cheng, J. Maher, C. Chen, and C. D. Klaassen TISSUE DISTRIBUTION AND ONTOGENY OF MOUSE ORGANIC ANION TRANSPORTING POLYPEPTIDES (OATPS) Drug Metab. Dispos., July 1, 2005; 33(7): 1062 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Hammer, S. Subtil, P. Lux, C. Maser-Gluth, P. M. Stewart, B. Allolio, and W. Arlt No Evidence for Hepatic Conversion of Dehydroepiandrosterone (DHEA) Sulfate to DHEA: In Vivo and in Vitro Studies J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3600 - 3605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. M Beringer and R. L Slaughter Transporters and Their Impact on Drug Disposition Ann. Pharmacother., June 1, 2005; 39(6): 1097 - 1108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chen, R. J. Mireles, S. D. Campbell, J. Lin, J. B. Mills, J. J. Xu, and T. A. Smolarek DIFFERENTIAL INTERACTION OF 3-HYDROXY-3-METHYLGLUTARYL-COA REDUCTASE INHIBITORS WITH ABCB1, ABCC2, AND OATP1B1 Drug Metab. Dispos., April 1, 2005; 33(4): 537 - 546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nozawa, H. Minami, S. Sugiura, A. Tsuji, and I. Tamai ROLE OF ORGANIC ANION TRANSPORTER OATP1B1 (OATP-C) IN HEPATIC UPTAKE OF IRINOTECAN AND ITS ACTIVE METABOLITE, 7-ETHYL-10-HYDROXYCAMPTOTHECIN: IN VITRO EVIDENCE AND EFFECT OF SINGLE NUCLEOTIDE POLYMORPHISMS Drug Metab. Dispos., March 1, 2005; 33(3): 434 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sun, Y. Huang, L. Frassetto, and L. Z. Benet EFFECTS OF UREMIC TOXINS ON HEPATIC UPTAKE AND METABOLISM OF ERYTHROMYCIN Drug Metab. Dispos., November 1, 2004; 32(11): 1239 - 1246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hirano, K. Maeda, Y. Shitara, and Y. Sugiyama Contribution of OATP2 (OATP1B1) and OATP8 (OATP1B3) to the Hepatic Uptake of Pitavastatin in Humans J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 139 - 146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Shitara, M. Hirano, H. Sato, and Y. Sugiyama Gemfibrozil and Its Glucuronide Inhibit the Organic Anion Transporting Polypeptide 2 (OATP2/OATP1B1:SLC21A6)-Mediated Hepatic Uptake and CYP2C8-Mediated Metabolism of Cerivastatin: Analysis of the Mechanism of the Clinically Relevant Drug-Drug Interaction between Cerivastatin and Gemfibrozil J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 228 - 236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sasaki, H. Suzuki, J. Aoki, K. Ito, P. J. Meier, and Y. Sugiyama Prediction of in Vivo Biliary Clearance from the in Vitro Transcellular Transport of Organic Anions across a Double-Transfected Madin-Darby Canine Kidney II Monolayer Expressing Both Rat Organic Anion Transporting Polypeptide 4 and Multidrug Resistance Associated Protein 2 Mol. Pharmacol., September 1, 2004; 66(3): 450 - 459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Fux, K. Morike, U.-F. Gundel, R. Hartmann, and C. H. Gleiter Ezetimibe and Statin-Associated Myopathy Ann Intern Med, April 20, 2004; 140(8): 671 - 672. [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mizuno, T. Niwa, Y. Yotsumoto, and Y. Sugiyama Impact of Drug Transporter Studies on Drug Discovery and Development Pharmacol. Rev., September 1, 2003; 55(3): 425 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kobayashi, T. Nozawa, K. Imai, J.-i. Nezu, A. Tsuji, and I. Tamai Involvement of Human Organic Anion Transporting Polypeptide OATP-B (SLC21A9) in pH-Dependent Transport across Intestinal Apical Membrane J. Pharmacol. Exp. Ther., August 1, 2003; 306(2): 703 - 708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Suzuki, T. Onogawa, N. Asano, H. Mizutamari, T. Mikkaichi, M. Tanemoto, M. Abe, F. Satoh, M. Unno, K. Nunoki, et al. Identification and Characterization of Novel Rat and Human Gonad-Specific Organic Anion Transporters Mol. Endocrinol., July 1, 2003; 17(7): 1203 - 1215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D. Thompson, P. Clarkson, and R. H. Karas Statin-Associated Myopathy JAMA, April 2, 2003; 289(13): 1681 - 1690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Trauner and J. L. Boyer Bile Salt Transporters: Molecular Characterization, Function, and Regulation Physiol Rev, April 1, 2003; 83(2): 633 - 671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Shitara, T. Itoh, H. Sato, A. P. Li, and Y. Sugiyama Inhibition of Transporter-Mediated Hepatic Uptake as a Mechanism for Drug-Drug Interaction between Cerivastatin and Cyclosporin A J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 610 - 616. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Ugele, M. V. St-Pierre, M. Pihusch, A. Bahn, and P. Hantschmann Characterization and identification of steroid sulfate transporters of human placenta Am J Physiol Endocrinol Metab, February 1, 2003; 284(2): E390 - E398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Tirona, B. F. Leake, A. W. Wolkoff, and R. B. Kim Human Organic Anion Transporting Polypeptide-C (SLC21A6) Is a Major Determinant of Rifampin-Mediated Pregnane X Receptor Activation J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 223 - 228. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Michalski, Y. Cui, A. T. Nies, A. K. Nuessler, P. Neuhaus, U. M. Zanger, K. Klein, M. Eichelbaum, D. Keppler, and J. Konig A Naturally Occurring Mutation in the SLC21A6 Gene Causing Impaired Membrane Localization of the Hepatocyte Uptake Transporter J. Biol. Chem., November 1, 2002; 277(45): 43058 - 43063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Pizzagalli, B. Hagenbuch, B. Stieger, U. Klenk, G. Folkers, and P. J. Meier Identification of a Novel Human Organic Anion Transporting Polypeptide as a High Affinity Thyroxine Transporter Mol. Endocrinol., October 1, 2002; 16(10): 2283 - 2296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nozawa, M. Nakajima, I. Tamai, K. Noda, J.-i. Nezu, Y. Sai, A. Tsuji, and T. Yokoi Genetic Polymorphisms of Human Organic Anion Transporters OATP-C (SLC21A6) and OATP-B (SLC21A9): Allele Frequencies in the Japanese Population and Functional Analysis J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 804 - 813. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Toyobuku, Y. Sai, I. Tamai, and A. Tsuji Enhanced Delivery of Drugs to the Liver by Adenovirus-Mediated Heterologous Expression of the Human Oligopeptide Transporter PEPT1 J. Pharmacol. Exp. Ther., June 1, 2002; 301(3): 812 - 819. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kawabata, S. Furuta, Y. Shinozaki, T. Kurimoto, and R. Nishigaki Carrier-Mediated Active Transport of a Novel Thromboxane A2 Receptor Antagonist [2-(4-Chlorophenylsulfonylaminomethyl)indan-5-yl]acetate (Z-335) into Rat Liver Drug Metab. Dispos., May 1, 2002; 30(5): 498 - 504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. V. St-Pierre, B. Hagenbuch, B. Ugele, P. J. Meier, and T. Stallmach Characterization of an Organic Anion-Transporting Polypeptide (OATP-B) in Human Placenta J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1856 - 1863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Cai, W. Wang, C. J. Soroka, N. Ballatori, and J. L. Boyer An evolutionarily ancient Oatp: insights into conserved functional domains of these proteins Am J Physiol Gastrointest Liver Physiol, April 1, 2002; 282(4): G702 - G710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hasegawa, H. Kusuhara, D. Sugiyama, K. Ito, S. Ueda, H. Endou, and Y. Sugiyama Functional Involvement of Rat Organic Anion Transporter 3 (rOat3; Slc22a8) in the Renal Uptake of Organic Anions J. Pharmacol. Exp. Ther., March 1, 2002; 300(3): 746 - 753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sasaki, H. Suzuki, K. Ito, T. Abe, and Y. Sugiyama Transcellular Transport of Organic Anions Across a Double-transfected Madin-Darby Canine Kidney II Cell Monolayer Expressing Both Human Organic Anion-transporting Polypeptide (OATP2/SLC21A6) and Multidrug Resistance-associated Protein 2 (MRP2/ABCC2) J. Biol. Chem., February 15, 2002; 277(8): 6497 - 6503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Cui, J. Konig, and D. Keppler Vectorial Transport by Double-Transfected Cells Expressing the Human Uptake Transporter SLC21A8 and the Apical Export Pump ABCC2 Mol. Pharmacol., November 1, 2001; 60(5): 934 - 943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Morita, H. Kusuhara, T. Sekine, H. Endou, and Y. Sugiyama Functional Characterization of Rat Organic Anion Transporter 2 in LLC-PK1 Cells J. Pharmacol. Exp. Ther., September 1, 2001; 298(3): 1179 - 1184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Hennemann, R. Docter, E. C. H. Friesema, M. de Jong, E. P. Krenning, and T. J. Visser Plasma Membrane Transport of Thyroid Hormones and Its Role in Thyroid Hormone Metabolism and Bioavailability Endocr. Rev., August 1, 2001; 22(4): 451 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Nakai, R. Nakagomi, Y. Furuta, T. Tokui, T. Abe, T. Ikeda, and K. Nishimura Human Liver-Specific Organic Anion Transporter, LST-1, Mediates Uptake of Pravastatin by Human Hepatocytes J. Pharmacol. Exp. Ther., June 1, 2001; 297(3): 861 - 867. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. Buettner, J. W. Harney, and P. R. Larsen The Role of Selenocysteine 133 in Catalysis by the Human Type 2 Iodothyronine Deiodinase Endocrinology, December 1, 2000; 141(12): 4606 - 4612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Konig, Y. Cui, A. T. Nies, and D. Keppler Localization and Genomic Organization of a New Hepatocellular Organic Anion Transporting Polypeptide J. Biol. Chem., July 21, 2000; 275(30): 23161 - 23168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Cui, J. Konig, I. Leier, U. Buchholz, and D. Keppler Hepatic Uptake of Bilirubin and Its Conjugates by the Human Organic Anion Transporter SLC21A6 J. Biol. Chem., March 23, 2001; 276(13): 9626 - 9630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Tirona, B. F. Leake, G. Merino, and R. B. Kim Polymorphisms in OATP-C. IDENTIFICATION OF MULTIPLE ALLELIC VARIANTS ASSOCIATED WITH ALTERED TRANSPORT ACTIVITY AMONG EUROPEAN- AND AFRICAN-AMERICANS J. Biol. Chem., September 14, 2001; 276(38): 35669 - 35675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Jung, B. Hagenbuch, L. Gresh, M. Pontoglio, P. J. Meier, and G. A. Kullak-Ublick Characterization of the Human OATP-C (SLC21A6) Gene Promoter and Regulation of Liver-specific OATP Genes by Hepatocyte Nuclear Factor 1alpha J. Biol. Chem., September 28, 2001; 276(40): 37206 - 37214. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |