HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chien, Y.-t. Articles by Cheung, A. L. Search for Related Content PubMed PubMed Citation Articles by Chien, Y.-t. Articles by Cheung, A. L. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 52, 37169-37176, December 24, 1999

SarA, a Global Regulator of Virulence Determinants in Staphylococcus aureus, Binds to a Conserved Motif Essential for sar-dependent Gene Regulation^*

Yueh-tyng Chien^§, Adhar C. Manna^¶, Steven J. Projan, and Ambrose L. Cheung^**

From the  Laboratory of Bacterial Pathogenesis and Immunology, The Rockefeller University, New York, New York 10021 and  Wyeth-Ayerst Research, Lederle Laboratories, Pearl River, New York 10965

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The expression of many virulence determinants in Staphylococcus aureus including -hemolysin-, protein A-, and fibronectin-binding proteins is controlled by global regulatory loci such as sar and agr. In addition to controlling target gene expression via agr (e.g. -hemolysin), the sar locus can also regulate target gene transcription via agr-independent mechanisms. In particular, we have found that SarA, the major regulatory protein encoded within sar, binds to a conserved sequence, homologous to the SarA-binding site on the agr promoter, upstream of the 35 promoter boxes of several target genes including hla (-hemolysin gene), spa (protein A gene), fnb (fibronectin-binding protein genes), and sec (enterotoxin C gene). Deletion of the SarA recognition motif in the promoter regions of agr and hla in shuttle plasmids rendered the transcription of these genes undetectable in agr and hla mutants, respectively. Likewise, the transcription activity of spa (a gene normally repressed by sar), as measured by a XylE reporter fusion assay, became derepressed in a wild type strain containing a shuttle plasmid in which the SarA recognition site had been deleted from the spa promoter region. However, DNase I footprinting assays demonstrated that the SarA-binding region on the spa and hla promoter is more extensive than the predicted consensus sequence, thus raising the possibility that the consensus sequence is an activation site within a larger binding region. Because the sar and agr regulate an assortment of virulence factors in S. aureus, we propose, based on our data, a unifying hypothesis for virulence gene activation in S. aureus whereby SarA is a regulatory protein that binds to its consensus SarA recognition motif to activate (e.g. hla) or repress (e.g. spa) the transcription of sar target genes, thus accounting for both agr-dependent and agr-independent mode of regulation.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Staphylococcus aureus is a major cause of human infections ranging from superficial abscesses, pneumonia, and endocarditis to sepsis (1). The capability of S. aureus to cause a multiplicity of infections is probably attributable to the impressive array of extracellular and cell wall-associated virulence determinants produced by this organism (2). The expression of many virulence determinants in S. aureus is highly coordinated and is generally controlled by global regulatory elements such as agr (accessory gene regulator) and sar (staphylococcal accessory regulator) (3, 4). The regulatory elements, in turn, control the transcription of a wide variety of unlinked genes, many of which have been demonstrated to be involved in pathogenesis.

The global regulatory locus agr consists of two divergent transcripts, RNAII and RNAIII, initiated from two distinct promoters, P2 and P3, respectively. RNAIII is the effector molecule of the agr response and hence is responsible for the up-regulation of extracellular protein production and down-regulation of cell wall-associated protein synthesiss during the postexponential phase (3). The RNAII molecule, driven by the P2 promoter, encodes a four gene operon, agrBDCA. AgrC and AgrA correspond to the sensor and activator proteins of two component regulatory systems, respectively. Additionally, agrD, in concert with agrB, participates in the generation of an octapeptide with quorum sensing properties (5, 6). Accordingly, AgrC, upon sensing a critical extracellular concentration of the octapeptide, becomes phosphorylated and activates AgrA by a second phosphorylation step. Activated AgrA would then, presumably, stimulate the transcription of the agr regulatory molecule RNAIII, which ultimately interacts with target genes to modulate transcription (7, 8) and possibly translation (9).

Another regulatory locus, designated sar, was uncovered in our laboratory (4). Unlike agr, the sar locus activates the synthesis of both extracellular (e.g. hemolysins) and cell wall proteins (e.g. fibronectin-binding protein) in S. aureus (4). The sar locus, contained within a 1.2-kb¹ fragment, is composed of three overlapping transcripts designated sarA (0.56 kb), sarC (0.8 kb), and sarB (1.2 kb). These transcripts, all encoding the major 372-bp sarA open reading frame, have common 3' ends but originate from three distinct promoters (10). Transcription and gel shift studies (11, 12) revealed that the SarA protein preferentially binds to the P2-, and to a lesser extent, to the P3-agr promoter region, thereby augmenting RNAII and the ensuing RNAIII transcription. RNAIII would then modulate the transcription of sar target genes (e.g. hla). More recently, we demonstrated that the SarA protein level is an important determinant of agr activation (13). In particular, the sequence upstream of the sarA gene may play a role in modulating the translation of the sarA gene product, the level of which correlates with agr expression (13). However, phenotypic and transcriptional analyses suggest that the sar locus can also regulate target gene transcription via a SarA-dependent but agr-independent mechanism. Supporting this notion is the observation that the synthesis of -hemolysin was further reduced in a double sar/agr mutant as compared with the single agr mutant (14, 15). Additionally, a recent report by Chan and Foster (16) provided evidence that SarA may up-regulate -hemolysin production independently of agr. The sar locus, contrary to agr, is apparently a repressor of (V8) protease activity (16). Taken together, these data imply that SarA, the major sar effector molecule, may somehow interact directly with sar target genes (e.g.  hemolysin) as well as with intermediate regulatory molecules such as that of agr to control gene expression.

We have analyzed the SarA protein/agr promoter-DNA complex by DNase I footprinting assay (12). The SarA-binding site on the agr promoter, as mapped by this method, covers a 29-bp sequence, more proximal to P2, in the P2 and P3 interpromoter region. In this report, we demonstrate that the SarA-binding site on the agr promoter appears to constitute a conserved SarA recognition motif found in many of the sar target genes in S. aureus including hla (-hemolysin gene), spa (protein A gene), and fnb (fibronectin-binding protein genes). This concept was supported by data from gel shift assays using purified recombinant SarA and synthetic oligonucleotides encompassing the putative SarA recognition site. Similarly, DNase I footprinting assays with hla and spa promoter fragments and purified SarA protein also uncovered binding sites encompassing the putative SarA recognition site. A deletion of the consensus binding site, as found in the promoter regions of agr, hla, and spa, rendered the target genes unresponsive to sar regulation. Because the region of SarA binding on the hla and spa promoters, as determined by footprinting assays, was wider than the consensus binding sites, our data strongly support the existence of a common "effector" site among a larger binding region to which SarA binds in sar target genes. We propose that the binding of SarA to a common recognition motif in target genes alters (i.e. activates or represses, depending on the target) the transcription of these genes in S. aureus, thus explaining both agr-dependent and agr-independent modes of regulation by sar. Because the sar locus controls the expression of a variety of extracellular and cell wall-associated virulence determinants in S. aureus, the identification of a common regulatory pathway may provide clues to the development of novel antimicrobial strategies.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Bacterial Strains and Plasmids-- The bacterial strains and plasmids used in this study are listed in Table I. Phage 11 was used as a generalized transducing phage for S. aureus strains. CYGP, 0.3GL medium (17), and tryptic soy broth were used for the growth of S. aureus strains, whereas LB was used for growing Escherichia coli. Antibiotics were used at the following concentrations: erythromycin at 5 µg/ml, chloramphenicol at 10 µg/ml, and tetracycline at 5 µg/ml for S. aureus and ampicillin at 50 µg/ml for E. coli.

Genetic Manipulations in S. aureus-- Genetic constructs were first transformed by electroporation to S. aureus RN4220, a restriction-deficient derivative of strain 8325-4 (18). Transformants were selected on NYE agar (18) containing 10 µg/ml of chloramphenicol. For transduction, phage 11 was used to produce a phage lysate of strain RN4220 containing various genetic constructs. The phage lysate was then used to infect S. aureus recipient strains as described (4). The presence of the correct plasmids was confirmed by restriction mapping. Chromosomal transduction was verified by Southern blots with gene-specific probes as described (4).

Construction and Purification of GST-SarA and SarA-- The intact 372-bp sarA gene was amplified by polymerase chain reaction and introduced into GST vector pGEX-4T-1 (Amersham Pharmacia Biotech) as described (12). Enhanced expression of the GST-SarA construct was induced by adding isopropyl-1-thio--D-galactopyranoside (1 mM) to a growing culture (30 °C) at an A₆₀₀ of 0.5 and purified as described (12). Besides the GST-SarA fusion protein, SarA was also expressed in E. coli BL21 containing pET14b with the 372-bp sarA gene. Induction by isopropyl-1-thio--D-galactopyranoside for the T7 RNA polymerase-based system in BL21 and purification on a His tag column were conducted following the manufacturer's instructions.

Gel Shift Analysis-- Polymerase chain reaction fragments as well as complementary synthetic DNA fragments (~45 bp) containing putative SarA-binding motifs of sar target genes were end-labeled with [-³²P]ATP and T4 polynucleotide kinase (Amersham Pharmacia Biotech). DNA fragments were purified by ProbeQuant G-50 microcolumns (Amersham Pharmacia Biotech) according to the manufacturer's instructions. For gel shift assays, protein samples were mixed with 5,000 cpm of end-labeled double-stranded DNA fragments (0.3 g) in the presence of 1 µg of calf thymus DNA (Amersham Pharmacia Biotech) in a final volume of 25 µl. Incubations were carried out on ice for 30 min in 10 mM Tris-HCl (pH 7.6), 50 mM NaCl, 5% (v/v) glycerol, 0.1 mM EDTA, and 1 mM dithiothreitol. Samples were then resolved on 5 or 8% polyacrylamide gels in 0.5× TBE buffer. Following electrophoresis, gels were dried and autoradiographed.

DNase I Footprinting-- Binding reactions were performed as described for the gel mobility shift assay except that a total volume of 100 µl was used. DNase I (Roche Molecular Biochemicals) (0.01 unit) was added and incubated for 2 min at room temperature. The reaction was terminated by adding 100 µl of freshly made stop solution (50 mM Tris-HCl, pH 8.0, 2% (w/v) SDS, 10 mM EDTA, proteinase K at 0.4 µg/ml). The reaction mixture was extracted with phenol/chloroform. DNA samples were ethanol-precipitated, washed with 70% ethanol, and resuspended in loading buffer (98% deionized formamide, 10 mM EDTA, pH 8.0, 0.025% (w/v) xylene cyanol FF, and 0.025% (w/v) bromphenol blue). DNA samples were denatured at 95 °C for 3 min and run on a 6% polyacrylamide sequencing gel. Chemical cleavages at purine (A+G) residues were performed by the standard method (19).

Site-specific Deletions of sar Target Promoter Fragments-- To introduce deletions of the putative SarA-binding sites within agr, hla, and spa promoters, site-directed mutagenesis was performed with the Stratagene Quick Change kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The following oligonucleotides and their complements were used to delete the SarA-binding sites from plasmid templates (pALC772, pALC829, and pALC1639 for deletions in agr, hla, and spa, respectively): for agr, 5'-¹⁶³³TTCTTAACTGTAAATTTTTTTA^{1654 1684}AACAGTTAAGTATTTATTTCCT¹⁷⁰⁵-3' (4); for hla, 5'-¹²⁵³TCTATTTATTAATTTACAGTAGTTA^{1277 1311}ATTGATTTAATTCTAAGATATTTGT¹³³⁵-3'²; for spa, 5'- ⁵⁸⁹AAGTTGTAAAACTTACCTTTAAA^{611 634}AGTATTGCAATACATAATTCGTT⁶⁵⁶-3' (20); and for spa mock mutation, 5'-⁴²¹TTCCATTTTATTCTTAAAAATA^{443 467}CCGCTTTCATTATAAAAAATATC⁴⁸⁹-3'. After constructing the mutations, the recombinant plasmids were transformed into XL1-Blue competent cells (Stratagene). The deletion within each promoter in the vector was confirmed by DNA sequencing. DNA fragments containing the mutations were gel purified and ligated into shuttle vector pSK236 or pLC4. Electroporation of S. aureus RN4220 with recombinant pSK236 or pLC4 containing the mutated fragments was performed as described previously (18). Phage 11 was used to transduce the plasmid from RN4220 into the recipient S. aureus strains (4). The presence of correct plasmids was confirmed by restriction mapping.

Isolation of RNA and Northern Blot Hybridization-- Overnight cultures of S. aureus were diluted 1:50 in CYGP and grown to mid log (A₆₅₀ = 0.7), late log (A₆₅₀ = 1.1), and postexponential (A₆₅₀ = 1.7) phases. The cells were pelleted and processed with a FastRNA isolation kit (BIO 101, Vista, CA) in combination with 0.1-mm-diameter sirconia-silica beads in a FastPrep reciprocating shaker (BIO 101) as described (21). 10 µg of each sample was electrophoresed through a 1.5% agarose-0.66 M formaldehyde gel in MOPS running buffer (20 mM MOPS, 10 mM sodium acetate, 2 mM EDTA, pH 7.0). Blotting of RNA onto Hybond N⁺ membranes (Amersham Pharmacia Biotech) was performed with the Turboblotter alkaline transfer system (Schleicher & Schuell). For detection of specific transcripts (agr, sar, and hla), gel purified DNA probes were radiolabeled with [-³²P]dCTP by the random-primed method (Ready-To-Go labeling kit, Amersham Pharmacia Biotech) and hybridized under high stringency conditions (14). The blots were subsequently washed and autoradiographed.

Construction of Transcriptional Fusions-- A 491-bp fragment encompassing the spa promoter region (see Fig. 5A) was amplified by polymerase chain reaction using genomic DNA of S. aureus strain RN6390 as the template with the following primers: upper primer, 5'-CCGGAATTC¹⁹⁸AAGACCATGCTGAACAA²¹⁴ (EcoRI site underlined), and lower primer, 5'-AACGCAAGCTT⁶⁸⁸CCCTGTATGTATTTGTAAAGTC⁶⁶⁷ (HindIII underlined) (20). The polymerase chain reaction fragment was cloned into the TA cloning vector pCR2.1 (Invitrogen, San Diego, CA). The recombinant pCR2.1 plasmid was used as the template for mutagenesis to delete the SarA-binding site as well as the control upstream AT-rich sequence (mock mutation) as described above. The EcoRI/HindIII fragments containing the natural or the mutated promoter region were cleaved from pCR2.1 and recloned into plasmid pLC4 (22), generating transcriptional fusions to the xylE reporter gene. The recombinant pLC4 plasmids were then electroporated into RN4220 and then transduced into recipient S. aureus strains. All transcriptional fusions and relevant constructs in different mutants are described in Table I.

Catechol 2,3-Dioxygenase Assays-- For enzymatic assays, overnight cultures were diluted 1:50 in 250 ml of tryptic soy broth containing appropriate antibiotics and shaken at 37 °C and 200 rpm. After few hours of growth, 50 ml of cell culture at A₆₀₀ of 1.7 (stationary phase) was removed and centrifuged. Following two washes in ice-cold potassium phosphate buffer (20 mM, pH 7.2), pellets were resuspended in 500 µl of 100 mM potassium phosphate buffer (pH 8.0) containing 10% acetone and 25 µg/ml of lysostaphin and incubated for 15 min at 37 °C and then iced for 5 min. Extracts were centrifuged at 20,000 × g for 50 min at 4 °C to pellet cellular debris. XylE (catechol 2, 3-dioxygenase) expression were assayed spectrophotometrically at 30 °C in a total volume of 3 ml of 100 mM potassium phosphate buffer (pH 8.0) containing 100 µl of cell extract and 0.2 mM catechol as described (22). The reactions were allowed to proceed for 15 min with A₃₇₅ readings taken at 5-, 10-, and 15-min time points, with the data being presented as the average of three time points. One milliunit is equivalent to the formation of 1.0 nmol of 2-hydroxymuconic semialdehyde/min at 30 °C. Specific activity is defined as milliunit/milligram of cellular protein (22).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

SarA Binds to a Consensus Motif Present in sar Target Genes-- The SarA protein is the major regulatory molecule within the sar locus (13). In previous studies, we have demonstrated by gel shift and footprinting studies that the SarA protein binds to the agr promoter region, probably activating the global regulatory locus agr and the corresponding genes downstream of the agr-activating cascade (12). The SarA-binding site on the agr promoter has been mapped to a 29-bp sequence (12) in the agr P2-P3 interpromoter region. However, we recognize that SarA can also modulate other target genes via agr-independent pathways (e.g. hla and fnb) (15, 16, 23). Because of this observation, we wanted to explore whether the regions upstream of 35 promoter boxes of several sar target genes contain sequences homologous to the SarA-binding site on the agr promoter. An alignment of sequences from the promoter regions of hla, spa, fnbA, fnbB, and sec revealed an apparent 26-bp consensus sequence (Fig. 1) that shares homology with the SarA-binding site on the agr promoter (12). Because both the S. aureus genome and the consensus sequence are AT-rich, the specificity of such an alignment for a conserved sequence requires a rigorous confirmation. Toward that end, we synthesized ~45-bp complementary oligonucleotides encompassing the 26-bp sar recognition motif together with 9-11 bp of bilateral flanking sequence (Fig. 2) for each of the five genes. Using ³²P end-labeled oligonucleotides, we found that purified SarA was able to retard the mobility of each of these synthetic DNA fragments in gel shift assays. For illustrative purposes, only gel shift data with 46-bp hla and 45-bp spa oligonucleotides probes are shown (Fig. 2). In contrast, increasing concentrations of a 165-bp nifH2 promoter fragment did not bind to SarA or GST-SarA (data not shown). Similarly, an unrelated 45-bp AT-rich fragment from the promoter region of the -hemolysin gene also did not exhibit binding activity to purified SarA protein.

View larger version (28K): [in this window] [in a new window]   Fig. 1.   Alignment of a putative common SarA recognition sequence from promoters of sar target genes. hla, -hemolysin gene; spa, protein A gene; fnbA, fibronectin-binding protein A gene; fnbB, fibronectin-binding protein B gene; sec, enterotoxin C gene. The consensus sequence was derived as follows: 4/6, capital letter; 3/6, small letter. An even distribution of nucleotides at a specific position is presented as combinations of small letters.

View larger version (47K): [in this window] [in a new window]   Fig. 2.   Binding of SarA to a 46-bp oligonucleotide from the spa promoter region (A) or a 45-bp oligonucleotide from the hla promoter region encompassing the putative SarA recognition site (B). The 32P end-labeled fragment was incubated with 1 µg of calf thymus DNA and 0, 1, 2, 3, or 4 µg of SarA followed by electrophoresis through a 5% polyacrylamide gel (see "Experimental Procedures"). Similar results were obtained when GST-SarA was used in place of SarA (data not shown). Binding of SarA to the fnbA, fnbB, and sec ds-DNA probes were also demonstrated by gel shift assays (data not shown).

To determine the SarA-binding site on target promoters more precisely, we elected to analyze two representative protein-DNA complexes (hla and spa) by DNase I footprinting. These two target genes were chosen because they represent the opposite ends of the spectrum in sar regulation, with up-regulation of hla and down-regulation of spa transcription by the sar locus. Additionally, hla is positively controlled by a SarA-dependent but agr-mediated pathway (11) as well as by direct binding of SarA to the hla promoter fragment as demonstrated by the gel shift assay (Fig. 2B). In contrast, spa is negatively regulated by sar and agr at the transcriptional level (24, 25); however, cross-complementation studies of an agr mutant with a plasmid carrying an intact sar locus revealed that spa transcription can be repressed by sar independent of agr (24).

In analyzing the DNase I footprinting data for a 235-bp hla promoter (nucleotides 1-80 plus 155 bp upstream of the start site), it was evident that the area protected by SarA (2-5 µg of protein) covered several regions, spanning 32 to 126 bp upstream of the transcription start site (Fig. 3A). Notably, the protected site encompassed the conserved SarA-binding sequence (double underlined in Fig. 3A). To assess the specificity of the binding region, we also performed DNaseI footprinting assay with a 192-bp hla promoter fragment (nucleotides 1-80 plus 112 bp upstream). Within the DNA region available (up to 112 bp upstream), the protected area essentially concurred with that of the longer hla promoter fragment (data not shown). Interestingly, as the amount of SarA was increased in the reaction, some of the nucleotides in the hla promoter DNA became more exposed, probably as a result of conformational changes, thus rendering these residues more susceptible to DNase I digestion and hence resulting in enhanced bands (see arrows in Fig. 3A). We also performed a DNase I footprinting assay with the spa promoter fragment. As with hla, the protected region was significantly wider (from 38 to 182 bp upstream of the transcription start) than the conserved 26-bp SarA-binding motif (Fig. 3B). Because of this observation with both hla and spa promoters, we speculate that the broadly protected region may constitute multiple binding sites rather than a complex conformational requirement for SarA binding. Despite the multiplicity of binding regions, it is our hypothesis that the consensus binding motif may be required for gene activation (hla) or suppression (spa) as mediated by sar. Deletion analyses seem to support this premise because hla and spa promoters, devoid of the consensus sequence, failed to activate the respective hla and spa transcription, whereas binding, albeit at a lower affinity, was maintained (see below).

View larger version (78K): [in this window] [in a new window]   Fig. 3.   DNase I protection footprint analysis of SarA binding to the hla (A) and spa (B) promoter regions of S. aureus. A, footprint analysis of protein binding to the hla promoter region. The 235-bp hla promoter fragment (nucleotide positions 1-80 (31) plus 155-bp upstream sequence) was end-labeled with -32P. Labeled DNA (2 g) was incubated with DNase I. Lanes 2 and 8, no protein; lanes 3-7, 1, 2, 3, 4 and 5 µg of SarA. Lane M represents chemical cleavage at purine residues (A/G ladder). The bracketed region represents the protected bases. The bases that became exposed as a result of increased SarA binding and hence more susceptible to DNase I digestion are highlighted with arrows. The nucleotide position is given as the number of bases upstream of the transcription start. The protected region is underlined, with the consensus SarA-binding site double-underlined. B, footprinting analysis of SarA binding to the spa promoter. The 302-bp spa fragment was end-labeled and incubated with DNase I in the presence or absence of proteins similar to above. Lanes 3-6 represent 1, 2, 3, and 4 µg of SarA protein. The conserved SarA-binding site is underlined in the protected region illustrated below.

The SarA-binding Motif Is Required for agr and hla Activation and spa Repression Mediated by the sar Locus-- To assess whether the SarA-binding site identified in the agr promoter region in vitro (12) is required for agr activation in S. aureus, we introduced into the agr deletion mutant strain RN6911 a shuttle plasmid (pALC1354) containing a fragment encoding RNAII but lacking the 29-bp SarA-binding site (AAATGTTATTTGTATTTAATATTTTAACA, consensus region underlined). Northern analysis disclosed that the transcription of RNAII was reduced to a very low level in this strain (ALC1388) (lane 2 in Fig. 4A). In contrast, the agr mutant strain carrying an analogous plasmid with the consensus binding motif intact (ALC1389 in lane 3, Fig. 4A) was able to express RNAII normally, whereas the agr mutant alone (RN6911 in lane 1) did not. These data confirmed that the SarA-binding site in the agr P2 and P3 promoter region is required for agr activation in S. aureus cells.

View larger version (24K): [in this window] [in a new window]   Fig. 4.   A, Northern blots of RNAII in agr mutant clones carrying shuttle plasmids (pSK236 derivatives) containing fragments that encoded intact or mutated RNAII. 10 µg of RNA obtained from cells grown to A650 of 1.1 (late log) and 1.7 (postexponential phase) was applied to each lane. Lane 1, agr mutant RN6911; lane 2, agr mutant complemented with pSK236 containing a fragment encoding RNAII but devoid of the 29-bp SarA recognition site; lane 3, agr mutant complemented with a fragment encoding intact RNAII. B, Northern blots of the hla transcript in hla mutant clones containing shuttle plasmids with intact or mutated hla fragments. The transcription start site (labeled +1), together with the putative 10 and 35 promoter regions of the hla gene are show above; the deleted region corresponding to the consensus sequence (double-underlined) is shown in parentheses. 10 µg of RNA was applied to each lane. Lane 1, parental strain RN6390; lane 2, hla mutant of RN6390 (ALC837); lane 3, hla mutant with a recombinant shuttle plasmid pSK236 with a 3-kb hla fragment (ALC1525); lane 4, hla mutant with pSK236 containing a 3-kb hla fragment but devoid of a 33-bp SarA-binding site (ALC1526). The deleted sequence and its relationship to the transcription start (arrow) is shown above. The blot was also probed with a labeled fragment of the gene encoding HU. The HU transcript, stably expressed in S. aureus, served as an internal marker.

To confirm the hypothesis that the SarA-binding site in the agr promoter region represents a conserved recognition motif required for activating or suppressing a variety of sar target genes, we deleted the homologous sequences within the promoter regions of hla and spa, two target genes representing extracellular and cell wall-associated virulence determinants, respectively. For the hla experiment, a recombinant shuttle plasmid (derived from pSK236) containing a 3-kb fragment that encodes the hla gene was introduced into a hla mutant (ALC837) of S. aureus to form strain ALC1525. As expected, hla transcription was not detected in the hla mutant ALC837 alone (lane 2 in Fig. 4B), although it was restored by a plasmid carrying the intact hla gene (ALC1525) (lane 3 in Fig. 4B). However, if the 33-bp SarA-binding site in the hla promoter region was deleted from the 3-kb fragment (ALC1526), the transcription of the hla gene was disrupted despite the fact that the sar and agr loci are intact in this strain. To ensure that equivalent amounts of total cellular RNA were loaded onto each lane, we also probed the same blot with a fragment encoding the HU gene the transcription of which had been found to be relatively constant during the growth cycle.³ As displayed in Fig. 4B, the intensity of the HU transcript was comparable among all four samples, essentially showing that the discrepancy in hla transcription between lanes was not attributable to a loading artifact.

Because the consensus SarA-binding motif is very AT-rich, we wanted to rule out the possibility that the binding site may be an UP element that has been shown to be the binding site for the  subunit of the RNA polymerase and is usually situated upstream of the 35 promoter boxes of target genes (26). For this reason, we deleted a major portion of the SarA-binding motif (40 to 61 bp upstream of the transcription start) (27) from a 491-bp promoter fragment of spa (nucleotides 198-688) (20, 27), a gene normally repressed by the sar locus (Fig. 5A). The rationale here is that an up-regulation in spa transcription as a result of the deleted SarA-binding site would lessen the possibility that it is part of an UP element homologous to those found in E. coli (26). As a negative control, a mock deletion of an AT-rich region 142-bp upstream of the SarA-binding site (204 to 229 bp of the transcription start site) was separately constructed. The intact and mutated spa promoter fragments were separately cloned into the shuttle plasmid pLC4 containing a promoterless xylE reporter gene (22). The recombinant plasmids were then introduced into the parental strain RN6390. In assaying activities of catechol 2,3-dioxygenase, the enzyme encoded by the xylE gene, the RN6390-derived clone lacking the SarA-binding site in the spa promoter fragment (ALC1795) expressed a high level of XylE activity (Fig. 5B), thus indicating a lack of repression in the absence of the SarA-binding motif. In contrast, the corresponding clone with a deletion in an unrelated AT-rich region (ALC1796) as well as that of the nonmutated control (ALC1794) exhibited reduced XylE activity as one would predict from the intact nature of sar, based upon the wild type genotype of this strain.³ To confirm that the deleted SarA recognition site upstream of the spa transcription start (40 to 61 bp) was indeed responsive to SarA, we introduced the plasmids constructed above into a sar mutant (ALC488), which has been found not to produce SarA as evaluated by an immunoblot probed with anti-SarA monoclonal antibodies. As anticipated, the XylE activity of the sar mutant clone containing the deletion in the SarA recognition motif (ALC1667) was not repressed in the sar minus background. Contrary to the parental strain harboring the mock deletion (ALC1796), the analogous strain carrying the identical plasmid (pALC1641) or the nonmutated control (pALC1639) was no longer amenable to repression in the sar mutant (ALC1668 and ALC1669) as confirmed by elevated levels of XylE activity (Fig. 5B). This implies that SarA, the major sar regulatory molecule, is required for binding to the conserved binding motif to affect gene repression. As controls, the shuttle plasmid pLC4 alone, without any spa promoter sequence, did not direct expression of any XylE in either the parental or in the sar minus background.

View larger version (28K): [in this window] [in a new window]   Fig. 5.   Transcriptional activity of the spa promoter lacking a SarA recognition site based on XylE fusion. A schematic representation of the promoter constructs fused to xylE gene is presented in A. The results of the XylE activity for different constructs in parental strain RN6390 or its isogenic sar mutant are tabulated in B. The XylE activities are given in milliunits/mg of cellular protein. Gel shift studies of three different promoter constructs with purified SarA are given in C. I, II, and III represent promoter fragments as derived from ALC1794 (nonmutated control), ALC1795 (40 to 61) and ALC1796 (204 to 229), with the numbers indicating the deleted nucleotides upstream of the transcription start. The left-most lanes do not contain SarA. The amounts of SarA in subsequent lanes are as follows: I and II, 0.1, 0.2, 0.5, 1.0, and 2.0 µg; III, 0.1, 0.2, 0.5, and 1.0 µg. 0.5 µg of SarA can retard the nonmutated fragment as well as that of the mock mutation (I and III) but not the fragment devoid the conserved SarA-binding site.

To validate the SarA recognition motif as a "SarA-responsive element" among several binding regions, we performed gel shift assays with a spa promoter fragment devoid of the SarA recognition motif. For positive controls, we used an intact spa fragment as well as a corresponding fragment with the mock deletion. In repeated experiments, we consistently found that a lesser amount of SarA was required for binding to the intact spa promoter fragment (Fig. 5C) than the mutated fragments (1 versus 2 µg). Despite modest differences in binding affinity, all three spa promoter fragments were clearly capable of binding purified SarA (Fig. 5C). Likewise, an hla promoter fragment devoid of the SarA-binding site was found to bind purified SarA, but the amount of protein required to completely retard the mutated promoter fragment (2 µg) was consistently more than its wild type counterpart (1 µg) (data not shown).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The control of expression of virulence determinants by the sar locus in S. aureus is complex, in part because the major 372-bp open reading frame (sarA) within sar is driven by a triple promoter system that is interspersed with putative regulatory elements (10-12). Because of their overlapping nature, each of these transcripts (sarA, sarC, and sarB transcripts) also includes the sarA coding region (10). With the promoters for the sarA and sarB transcripts being A-dependent (active during the exponential phase) (10, 28) and that of sarC being B-dependent (active during the postexponential phase) (28, 29), it is not surprising that sar transcription varies during the growth cycle. Dependent on the pattern of sar promoter activation, the SarA level may conceivably fluctuate (12, 28). Ultimately, the level of SarA correlates positively with the degree of agr expression (13).

We previously showed that the SarA protein binds to the agr promoter region, presumably stimulating transcription, in particular, from the agr P2 promoter (11). Activation of RNAII and, subsequently, RNAIII would lead to alterations in target gene expression (e.g. hla and spa), presumably by virtue of the interaction of RNAIII with the target gene at the level of transcription (8, 27) and possibly translation (9). However, phenotypic analyses indicated that SarA can also modulate target genes via an agr-independent mechanism. In particular, the transcription of the fibronectin-binding gene (fnbA) is positively regulated by sar via an agr-independent mechanism (30).³ Likewise, supplying the sar locus in trans can repress spa transcription in an agr mutant. Additionally, recent data from Chan and Foster (16) also disclosed that sar may up-regulate hla transcription via both agr-dependent and agr-independent pathways. These three diverse modes of sar-mediated regulation of target genes (i.e. fnb, spa and hla) strongly imply that SarA may directly interact with target gene promoters, with or without any involvement from the agr gene product. In mapping the 29-bp SarA-binding site on the agr promoter with in vitro footprinting assay (12), we explored the sequence upstream of the 35 promoter boxes of several virulence determinants representative of the three putative modes of sar-mediated regulation via a common sequence motif. Interestingly, a consensus sequence sharing a homology with the SarA-binding site on the agr promoter emerged (Fig. 1). In a recent study, Chan and Foster (16) had also aligned the promoter sequence upstream of several sar target genes including hla, hlb, tst, seb, spa, and spr (V8 protease gene). However, the data of Chan and Foster are not in agreement with the sequences displayed here (Fig. 1), partly because their alignment was based solely on comparing stretches of nucleotide sequences that are extremely AT-rich (86%) and lacked any supporting biological or biochemical data. Additionally, the transcription start site of the hla gene is upstream of the published sequence (accession number X01645) (31),² thus rendering their alignment problematic. To confirm the validity of our alignment, gel shift assays of SarA and GST-SarA with ~45-bp oligonucleotide probes encompassing the putative SarA recognition motif of spa, fnb, hla, and sec were performed. Our results demonstrated that SarA did indeed bind to these probes whereas the control nifH2 fragment and an unrelated fragment from the -hemolysin gene did not. Additional confirmation of the SarA recognition motif in the hla and spa promoter regions was obtained by DNase I footprinting. Surprisingly, the protected region as revealed by the footprinting assay was larger than the SarA recognition motif, thus suggesting either multiple binding sites or a complex conformational requirement for binding (discussed below).

Cognizant of the AT-rich nature of our consensus sequence (95% AT), it was important to rule out the possibility that the SarA recognition motif may be an UP element the absence of which would lead to defective binding by core RNA polymerase and hence reduce target gene transcription (26). More importantly, it will be essential to examine the role of this recognition motif in vivo (in the bacteria). For this reason, we chose to delete the SarA recognition motif in the promoter region of spa, a gene normally repressed by the sar locus and examine the resultant spa promoter activation. Using a xylE reporter fusion to generate quantitative data from a clone derived from the parental strain (ALC1795), we found that in the absence of the recognition motif, the transcription of spa in this staphylococcal strain became derepressed, thus resulting in significant up-regulation in XylE activity. This enhancement effect in spa transcription attributable to a lack of a SarA recognition site was completely abolished in a S. aureus sar mutant (ALC1667). Taken together, these data clearly indicated that the SarA recognition motif, present in a variety of sar target genes including hla and spa, is probably not an UP element and, in the absence of SarA or its binding motif, sar-mediated regulation (both up and down-regulation) will not occur.

In deleting the consensus SarA-binding site on the agr and hla promoters, we verified that this recognition motif is likely required for SarA binding and the ensuing activation of these genes in S. aureus. This observation was confirmed by Northern blots in which we found that the SarA recognition motif upstream of the hla and agr promoters was required for gene activation in vivo in the respective hla and agr mutant clones, respectively. We also found in vitro that a 160-bp hla promoter fragment lacking the SarA-binding site was still able to maintain SarA binding, albeit at a lower affinity than the 192-bp nonmutated counterpart (data not shown). Similarly, a spa promoter fragment devoid of the SarA recognition motif also binds to SarA with lower affinity than the intact control (Fig. 5C). Despite variable levels of binding in vitro by all promoter fragments to SarA in gel shift assays (Fig. 5C), only the intact spa promoter and its analogous counterpart lacking an unrelated AT-rich region were amenable to repression in vivo in a sar-positive strain (ALC1796) but not in a sar minus background (ALC1668), whereas a spa promoter fragment missing the SarA recognition motif was not repressible in either genetic background (see ALC1795 and ALC1667 in Fig. 5B). This discrepancy in binding and effector activity implies that only the conserved SarA-binding sequence represents the effector site in vivo among a broader binding region(s) within the promoter regions of spa and hla as determined by DNase I footprinting assay in vitro (Fig. 3B).

SarA, the major sar effector molecule, is thus capable of modulating the transcription of multiple target genes, thus accounting for its pleiotropic effects in S. aureus. Prior in vitro data clearly establish that SarA can bind to the agr promoter region to influence primarily agr-P2 transcription. Besides the indirect control via agr, the mechanism by which SarA directly up-regulates (e.g. hla) and down-regulates target genes (e.g. spa) has not been previously defined. In identifying a SarA recognition motif among the promoters of sar target genes, we presented a unifying hypothesis whereby SarA can modulate a variety of target genes via both agr-dependent and agr-independent pathways. The SarA recognition motif likely represents the sar-responsive element of the target gene. Accordingly, activation or repression of target gene promoters is dependent on the binding of SarA to the consensus binding site. In the case of hla, it is evident that this gene can be turned on by a double switch mechanism (via agr and by direct SarA binding to the hla promoter). Because the protected region identified by DNase I footprinting is wider than the SarA recognition motif, we propose that the promoters of target genes contain multiple bindings sites, but the SarA recognition motif by itself probably represents the effector (activation/suppression) site. Whether the expansive binding site serves as binding regions for regulatory factors other than SarA (e.g. RNAIII) is not clear. Depending on the threshold of activation, the level of SarA protein may ultimately determine the pattern of regulation of SarA-responsive genes in S. aureus. Because of the multiplicity of sar promoters with diverse activation requirements (e.g. sarC activated by SigB) (28, 29), the precise control of SarA protein levels as a result of differential sar promoter activation is likely to be dependent on a variety of environmental and intracellular factors. Notably, we recently identified a regulatory protein that binds to the sar promoter region to down-regulate sarC transcription (28).³ Characterization of this protein and its effect on SarA expression are currently in progress.

	ACKNOWLEDGEMENT

We thank Tim Foster for providing strain DU1090.

	FOOTNOTES

^* This work was supported in part by National Institutes of Health Grants AI30061 and AI37142.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Supported by a New York Heart Participatory Laboratory Award. Present address: Scriptgen Pharmaceuticals Inc. 610 Lincoln St., Waltham, MA 02451.

^¶ Present address: Dept. of Microbiology, Dartmouth Medical School, Hanover, NH 03755.

^** Recipient of the Irma T. Hirschl Career Scientist Award as well as the Genentech Established Investigator Award from the American Heart Association. To whom correspondence should be addressed. Present address: Dept. of Microbiology, Dartmouth Medical School, Hanover, NH 03755.

² S. J. Projan, personal communication.

³ Y. Chien, A. C. Manna, S. J. Projan, and A. L. Cheung, unpublished data.

	ABBREVIATIONS

The abbreviations used are: kb, kilobase(s); bp, base pair(s); GST, glutathione S-transferase; MOPS, 4-morpholinepropanesulfonic acid.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Ballal and A. C. Manna Expression of the sarA family of genes in different strains of Staphylococcus aureus Microbiology, July 1, 2009; 155(7): 2342 - 2352. [Abstract] [Full Text] [PDF]

				G. A. Somerville and R. A. Proctor At the Crossroads of Bacterial Metabolism and Virulence Factor Synthesis in Staphylococci Microbiol. Mol. Biol. Rev., June 1, 2009; 73(2): 233 - 248. [Abstract] [Full Text] [PDF]

				A. Ballal and A. C. Manna Regulation of Superoxide Dismutase (sod) Genes by SarA in Staphylococcus aureus J. Bacteriol., May 15, 2009; 191(10): 3301 - 3310. [Abstract] [Full Text] [PDF]

				N. P. Donegan and A. L. Cheung Regulation of the mazEF Toxin-Antitoxin Module in Staphylococcus aureus and Its Impact on sigB Expression J. Bacteriol., April 15, 2009; 191(8): 2795 - 2805. [Abstract] [Full Text] [PDF]

				A. Ballal, B. Ray, and A. C. Manna sarZ, a sarA Family Gene, Is Transcriptionally Activated by MgrA and Is Involved in the Regulation of Genes Encoding Exoproteins in Staphylococcus aureus J. Bacteriol., March 1, 2009; 191(5): 1656 - 1665. [Abstract] [Full Text] [PDF]

				S. Tamber and A. L. Cheung SarZ Promotes the Expression of Virulence Factors and Represses Biofilm Formation by Modulating SarA and agr in Staphylococcus aureus Infect. Immun., January 1, 2009; 77(1): 419 - 428. [Abstract] [Full Text] [PDF]

				R. M. Q. Shanks, M. A. Meehl, K. M. Brothers, R. M. Martinez, N. P. Donegan, M. L. Graber, A. L. Cheung, and G. A. O'Toole Genetic Evidence for an Alternative Citrate-Dependent Biofilm Formation Pathway in Staphylococcus aureus That Is Dependent on Fibronectin Binding Proteins and the GraRS Two-Component Regulatory System Infect. Immun., June 1, 2008; 76(6): 2469 - 2477. [Abstract] [Full Text] [PDF]

				A. L. Cheung, K. Nishina, and A. C. Manna SarA of Staphylococcus aureus Binds to the sarA Promoter To Regulate Gene Expression J. Bacteriol., March 15, 2008; 190(6): 2239 - 2243. [Abstract] [Full Text] [PDF]

				M. J. H. Goldsworthy Gene expression of Pseudomonas aeruginosa and MRSA within a catheter-associated urinary tract infection biofilm model Bioscience Horizons, March 1, 2008; 1(1): 28 - 37. [Abstract] [Full Text] [PDF]

				N. Harraghy, D. Homerova, M. Herrmann, and J. Kormanec Mapping the Transcription Start Points of the Staphylococcus aureus eap, emp, and vwb Promoters Reveals a Conserved Octanucleotide Sequence That Is Essential for Expression of These Genes J. Bacteriol., January 1, 2008; 190(1): 447 - 451. [Abstract] [Full Text] [PDF]

				A. C. Manna and B. Ray Regulation and characterization of rot transcription in Staphylococcus aureus Microbiology, May 1, 2007; 153(5): 1538 - 1545. [Abstract] [Full Text] [PDF]

				J. Oscarsson, A. Kanth, K. Tegmark-Wisell, and S. Arvidson SarA Is a Repressor of hla ({alpha}-Hemolysin) Transcription in Staphylococcus aureus: Its Apparent Role as an Activator of hla in the Prototype Strain NCTC 8325 Depends on Reduced Expression of sarS J. Bacteriol., December 15, 2006; 188(24): 8526 - 8533. [Abstract] [Full Text] [PDF]

				J. Cassat, P. M. Dunman, E. Murphy, S. J. Projan, K. E. Beenken, K. J. Palm, S.-J. Yang, K. C. Rice, K. W. Bayles, and M. S. Smeltzer Transcriptional profiling of a Staphylococcus aureus clinical isolate and its isogenic agr and sarA mutants reveals global differences in comparison to the laboratory strain RN6390. Microbiology, October 1, 2006; 152(Pt 10): 3075 - 3090. [Abstract] [Full Text] [PDF]

				L. N. Shaw, J. Aish, J. E. Davenport, M. C. Brown, J. K. Lithgow, K. Simmonite, H. Crossley, J. Travis, J. Potempa, and S. J. Foster Investigations into {sigma}B-Modulated Regulatory Pathways Governing Extracellular Virulence Determinant Production in Staphylococcus aureus. J. Bacteriol., September 1, 2006; 188(17): 6070 - 6080. [Abstract] [Full Text] [PDF]

				K. Sambanthamoorthy, M. S. Smeltzer, and M. O. Elasri Identification and characterization of msa (SA1233), a gene involved in expression of SarA and several virulence factors in Staphylococcus aureus. Microbiology, September 1, 2006; 152(Pt 9): 2559 - 2572. [Abstract] [Full Text] [PDF]

				A. C. Manna and A. L. Cheung Expression of SarX, a Negative Regulator of agr and Exoprotein Synthesis, Is Activated by MgrA in Staphylococcus aureus. J. Bacteriol., June 1, 2006; 188(12): 4288 - 4299. [Abstract] [Full Text] [PDF]

				C. Roberts, K. L. Anderson, E. Murphy, S. J. Projan, W. Mounts, B. Hurlburt, M. Smeltzer, R. Overbeek, T. Disz, and P. M. Dunman Characterizing the Effect of the Staphylococcus aureus Virulence Factor Regulator, SarA, on Log-Phase mRNA Half-Lives. J. Bacteriol., April 1, 2006; 188(7): 2593 - 2603. [Abstract] [Full Text] [PDF]

				Y. Liu, A. C. Manna, C.-H. Pan, I. A. Kriksunov, D. J. Thiel, A. L. Cheung, and G. Zhang Structural and function analyses of the global regulatory protein SarA from Staphylococcus aureus PNAS, February 14, 2006; 103(7): 2392 - 2397. [Abstract] [Full Text] [PDF]

				D. Frees, K. Sorensen, and H. Ingmer Global Virulence Regulation in Staphylococcus aureus: Pinpointing the Roles of ClpP and ClpX in the sar/agr Regulatory Network Infect. Immun., December 1, 2005; 73(12): 8100 - 8108. [Abstract] [Full Text] [PDF]

				M. P. Trotonda, A. C. Manna, A. L. Cheung, I. Lasa, and J. R. Penades SarA Positively Controls Bap-Dependent Biofilm Formation in Staphylococcus aureus J. Bacteriol., August 15, 2005; 187(16): 5790 - 5798. [Abstract] [Full Text] [PDF]

				C. W. Tseng and G. C. Stewart Rot Repression of Enterotoxin B Expression in Staphylococcus aureus J. Bacteriol., August 1, 2005; 187(15): 5301 - 5309. [Abstract] [Full Text] [PDF]

				A. L. Cheung and A. C. Manna Role of the Distal sarA Promoters in SarA Expression in Staphylococcus aureus Infect. Immun., July 1, 2005; 73(7): 4391 - 4394. [Abstract] [Full Text] [PDF]

				P. J. McNamara and A. S. Bayer A rot Mutation Restores Parental Virulence to an agr-Null Staphylococcus aureus Strain in a Rabbit Model of Endocarditis Infect. Immun., June 1, 2005; 73(6): 3806 - 3809. [Abstract] [Full Text] [PDF]

				M. A. Tormo, M. Marti, J. Valle, A. C. Manna, A. L. Cheung, I. Lasa, and J. R. Penades SarA Is an Essential Positive Regulator of Staphylococcus epidermidis Biofilm Development J. Bacteriol., April 1, 2005; 187(7): 2348 - 2356. [Abstract] [Full Text] [PDF]

				S. Ingavale, W. van Wamel, T. T. Luong, C. Y. Lee, and A. L. Cheung Rat/MgrA, a Regulator of Autolysis, Is a Regulator of Virulence Genes in Staphylococcus aureus Infect. Immun., March 1, 2005; 73(3): 1423 - 1431. [Abstract] [Full Text] [PDF]

				J. E. Cassat, P. M. Dunman, F. McAleese, E. Murphy, S. J. Projan, and M. S. Smeltzer Comparative Genomics of Staphylococcus aureus Musculoskeletal Isolates J. Bacteriol., January 15, 2005; 187(2): 576 - 592. [Abstract] [Full Text] [PDF]

				B. Fournier and A. Klier Protein A gene expression is regulated by DNA supercoiling which is modified by the ArlS-ArlR two-component system of Staphylococcus aureus Microbiology, November 1, 2004; 150(11): 3807 - 3819. [Abstract] [Full Text] [PDF]

				A. C. Manna, S. S. Ingavale, M. Maloney, W. van Wamel, and A. L. Cheung Identification of sarV (SA2062), a New Transcriptional Regulator, Is Repressed by SarA and MgrA (SA0641) and Involved in the Regulation of Autolysis in Staphylococcus aureus J. Bacteriol., August 15, 2004; 186(16): 5267 - 5280. [Abstract] [Full Text] [PDF]

				J. Gao and G. C. Stewart Regulatory Elements of the Staphylococcus aureus Protein A (Spa) Promoter J. Bacteriol., June 15, 2004; 186(12): 3738 - 3748. [Abstract] [Full Text] [PDF]

				L. Shaw, E. Golonka, J. Potempa, and S. J. Foster The role and regulation of the extracellular proteases of Staphylococcus aureus Microbiology, January 1, 2004; 150(1): 217 - 228. [Abstract] [Full Text] [PDF]

				K. A. Schmidt, A. C. Manna, and A. L. Cheung SarT Influences sarS Expression in Staphylococcus aureus Infect. Immun., September 1, 2003; 71(9): 5139 - 5148. [Abstract] [Full Text] [PDF]

				J. Rossi, M. Bischoff, A. Wada, and B. Berger-Bachi MsrR, a Putative Cell Envelope-Associated Element Involved in Staphylococcus aureus sarA Attenuation Antimicrob. Agents Chemother., August 1, 2003; 47(8): 2558 - 2564. [Abstract] [Full Text] [PDF]

				K. M. Sterba, S. G. Mackintosh, J. S. Blevins, B. K. Hurlburt, and M. S. Smeltzer Characterization of Staphylococcus aureus SarA Binding Sites J. Bacteriol., August 1, 2003; 185(15): 4410 - 4417. [Abstract] [Full Text] [PDF]

				R. Li, A. C. Manna, S. Dai, A. L. Cheung, and G. Zhang Crystal Structure of the SarS Protein from Staphylococcus aureus J. Bacteriol., July 15, 2003; 185(14): 4219 - 4225. [Abstract] [Full Text] [PDF]

				T. T. Luong, S. W. Newell, and C. Y. Lee mgr, a Novel Global Regulator in Staphylococcus aureus J. Bacteriol., July 1, 2003; 185(13): 3703 - 3710. [Abstract] [Full Text] [PDF]

				B. Said-Salim, P. M. Dunman, F. M. McAleese, D. Macapagal, E. Murphy, P. J. McNamara, S. Arvidson, T. J. Foster, S. J. Projan, and B. N. Kreiswirth Global Regulation of Staphylococcus aureus Genes by Rot J. Bacteriol., January 15, 2003; 185(2): 610 - 619. [Abstract] [Full Text] [PDF]

				A. C. Manna and A. L. Cheung sarU, a sarA Homolog, Is Repressed by SarT and Regulates Virulence Genes in Staphylococcus aureus Infect. Immun., January 1, 2003; 71(1): 343 - 353. [Abstract] [Full Text] [PDF]

				P. Vaudaux, P. Francois, C. Bisognano, W. L. Kelley, D. P. Lew, J. Schrenzel, R. A. Proctor, P. J. McNamara, G. Peters, and C. Von Eiff Increased Expression of Clumping Factor and Fibronectin-Binding Proteins by hemB Mutants of Staphylococcus aureus Expressing Small Colony Variant Phenotypes Infect. Immun., October 1, 2002; 70(10): 5428 - 5437. [Abstract] [Full Text] [PDF]

				M. J. Horsburgh, J. L. Aish, I. J. White, L. Shaw, J. K. Lithgow, and S. J. Foster {sigma}B Modulates Virulence Determinant Expression and Stress Resistance: Characterization of a Functional rsbU Strain Derived from Staphylococcus aureus 8325-4 J. Bacteriol., October 1, 2002; 184(19): 5457 - 5467. [Abstract] [Full Text] [PDF]

				B. D. Shepard and M. S. Gilmore Differential Expression of Virulence-Related Genes in Enterococcus faecalis in Response to Biological Cues in Serum and Urine Infect. Immun., August 1, 2002; 70(8): 4344 - 4352. [Abstract] [Full Text] [PDF]

				T. Luong, S. Sau, M. Gomez, J. C. Lee, and C. Y. Lee Regulation of Staphylococcus aureus Capsular Polysaccharide Expression by agr and sarA Infect. Immun., February 1, 2002; 70(2): 444 - 450. [Abstract] [Full Text] [PDF]

				G. Heyer, S. Saba, R. Adamo, W. Rush, G. Soong, A. Cheung, and A. Prince Staphylococcus aureusagr and sarA Functions Are Required for Invasive Infection but Not Inflammatory Responses in the Lung Infect. Immun., January 1, 2002; 70(1): 127 - 133. [Abstract] [Full Text] [PDF]

				P. M. Dunman, E. Murphy, S. Haney, D. Palacios, G. Tucker-Kellogg, S. Wu, E. L. Brown, R. J. Zagursky, D. Shlaes, and S. J. Projan Transcription Profiling-Based Identification of Staphylococcus aureus Genes Regulated by the agr and/or sarA Loci J. Bacteriol., December 15, 2001; 183(24): 7341 - 7353. [Abstract] [Full Text] [PDF]

				M. Bischoff, J. M. Entenza, and P. Giachino Influence of a Functional sigB Operon on the Global Regulators sar and agr in Staphylococcus aureus J. Bacteriol., September 1, 2001; 183(17): 5171 - 5179. [Abstract] [Full Text] [PDF]

				K. A. Schmidt, A. C. Manna, S. Gill, and A. L. Cheung SarT, a Repressor of {alpha}-Hemolysin in Staphylococcus aureus Infect. Immun., August 1, 2001; 69(8): 4749 - 4758. [Abstract] [Full Text] [PDF]

				Y. Liu, A. Manna, R. Li, W. E. Martin, R. C. Murphy, A. L. Cheung, and G. Zhang Crystal structure of the SarR protein from Staphylococcus aureus PNAS, May 24, 2001; (2001) 121013398. [Abstract] [Full Text] [PDF]

				A. L. Cheung, K. Schmidt, B. Bateman, and A. C. Manna SarS, a SarA Homolog Repressible by agr, Is an Activator of Protein A Synthesis in Staphylococcus aureus Infect. Immun., April 1, 2001; 69(4): 2448 - 2455. [Abstract] [Full Text] [PDF]

				A. Manna and A. L. Cheung Characterization of sarR, a Modulator of sar Expression in Staphylococcus aureus Infect. Immun., February 1, 2001; 69(2): 885 - 896. [Abstract] [Full Text] [PDF]

				S. K. Chakrabarti and T. K. Misra SarA Represses agr Operon Expression in a Purified In Vitro Staphylococcus aureus Transcription System J. Bacteriol., October 15, 2000; 182(20): 5893 - 5897. [Abstract] [Full Text]

				Y. Liu, A. Manna, R. Li, W. E. Martin, R. C. Murphy, A. L. Cheung, and G. Zhang Crystal structure of the SarR protein from Staphylococcus aureus PNAS, June 5, 2001; 98(12): 6877 - 6882. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chien, Y.-t. Articles by Cheung, A. L. Search for Related Content PubMed PubMed Citation Articles by Chien, Y.-t. Articles by Cheung, A. L. Social Bookmarking                      What's this?