J Biol Chem, Vol. 274, Issue 53, 37750-37754, December 31, 1999

Signal Peptides Having Standard and Nonstandard Cleavage Sites Can Be Processed by Imp1p of the Mitochondrial Inner Membrane Protease^*

Xuemin Chen, Clint Van Valkenburgh, Hong Fang, and Neil Green

From the Department of Microbiology and Immunology, School of Medicine, Vanderbilt University, Nashville, Tennessee 37232-2363

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We have performed a site-directed mutagenesis study showing that residues comprising the type I signal peptidase signature in the two catalytic subunits of the yeast inner membrane protease, Imp1p and Imp2p, are functionally important, consistent with the idea that these subunits contain a serine/lysine catalytic dyad. Previous studies have shown that Imp1p cleaves signal peptides having asparagine at the 1 position, which deviates from the typical signal peptide possessing a small uncharged amino acid at this position. To determine whether asparagine is responsible for the nonoverlapping substrate specificities exhibited by the inner membrane protease subunits, we have substituted asparagine with 19 amino acids in the Imp1p substrate i-cytochrome (cyt) b₂. The resulting signal peptides containing alanine, serine, cysteine, leucine, and methionine can be cleaved efficiently by Imp1p. The remaining mutant signal peptides are cleaved inefficiently or not at all. Surprisingly, none of the amino acid changes results in the recognition of i-cyt b₂ by Imp2p, whose natural substrate, i-cyt c₁, has alanine at the 1 position. The data demonstrate that (i) although the 1 residue is important in substrates recognized by Imp1p, signal peptides having standard and nonstandard cleavage sites can be processed by Imp1p, and (ii) a 1 asparagine does not govern the substrate specificity of the inner membrane protease subunits.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The type I signal peptidase family consists of enzymes located in the plasma membranes of eubacterial cells, the endoplasmic reticulum (ER)¹ membrane, and the inner membrane of mitochondria. These enzymes function similarly to cleave signal peptides from the amino termini of precursor proteins after the delivery of these precursors to their appropriate cellular compartments (reviewed in Ref. 1). Based on the crystal structure of leader peptidase from Escherichia coli (2), the eubacterial signal peptidases exhibit five characteristic residues that make up a type I signature sequence consisting of a serine/lysine catalytic dyad and three structurally important amino acids, an arginine and two aspartic acids, that are positioned close to the catalytic site. The ER homolog of the eubacterial signal peptidases, Sec11p, has a similar signature; however, Sec11p contains histidine in place of lysine. Because this histidine is important for catalysis (3), Sec11p may utilize a serine/histidine dyad or a catalytic triad of serine/histidine/aspartic acid. The type I signal peptidase found in the inner membrane of mitochondria consists of two subunits, both of which are catalytic (4-6). Termed inner membrane protease (IMP), sequence comparisons suggest that the IMP subunits, Imp1p and Imp2p, may contain serine/lysine dyads, like their eubacterial counterparts (1).

Imp1p from the yeast Saccharomyces cerevisiae cleaves the signal peptides from the precursors to cytochrome (cyt) b₂, a nuclear encoded protein, and cyt oxidase subunit II, a protein encoded within the mitochondrion. The signal peptides of these precursors possess asparagine at the 1 position from the cleavage site (4). The presence of a 1 asparagine in the Imp1p substrates violates the "1, 3 rule" proposed in previous studies (7-9), which is based on the fact that signal peptides in the eubacterial and ER systems contain small uncharged amino acids at the 1 position and, to a lesser extent, the 3 position. Indeed, site-directed mutagenesis studies have confirmed the critical role of the 1 amino acid for the correct cleavage of signal peptides in the ER and in eubacterial cells (10-12). From the crystallographic analysis of leader peptidase, the 1 and 3 amino acids probably help to position the signal peptide relative to the active site through their interactions with distinct binding pockets on the enzyme's surface (2).

In agreement with the 1, 3 rule, Imp2p cleaves a more conventional signal peptide such as that of the cyt c₁ precursor, which has alanine at the 1 position (5). A reasonable hypothesis to explain why Imp1p cleaves a different signal peptide from that of Imp2p is that Imp1p is able to recognize a 1 asparagine (5). An extension of this idea is that asparagine may fit into the appropriate binding pocket of Imp1p and be excluded from the corresponding site in Imp2p. To address this hypothesis, we have asked the following question: do mutations affecting the 1 asparagine of the cyt b₂ precursor inhibit its cleavage by Imp1p and, conversely, allow for its cleavage by Imp2p? We have also asked whether the type I signature sequences of Imp1p and Imp2p are important for their enzymatic activities.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Yeast Strains, Media, and Antibodies-- Media for growing yeast (13) and glycerol-containing media (5) have been described. A rat anti-HA antibody (clone 3F10; Roche Molecular Biochemicals) was used in this study. Yeast strain JNY34 (MATa imp2-1 ura3-52 trp1) was obtained from Jodi Nunnari (University of California, Davis, CA). Strain XCY101 (MAT  imp1::HIS3 ura3-52 leu2-3,112 his3-200 trp1-901 suc2-9 lys2-80) was constructed as follows. A BamHI fragment encoding the HIS3 gene (14) was inserted into the BamHI site of IMP1, which corresponds to amino acid 97. A linear DNA fragment containing the IMP1 gene disrupted with HIS3 was introduced by homologous recombination into the chromosome of strain SEY6210 (MAT  ura3-52 leu2-3,112 his3-200 trp1-901 suc2-9 lys2-80) (14). The disruption was confirmed by the fact that strain XCY101 failed to grow in glycerol-containing media, and this growth defect was complemented by plasmids bearing the wild-type IMP1 gene.

Biochemical Procedures-- Pulse-chase methods have been published (13, 15). For immunoprecipitation analysis, the procedure published previously (15) was used, except for the following modifications. Anti-HA antibodies and protein G (instead of protein A)-Sepharose were used. After the wash of the protein G-Sepharose pellet, the material was resuspended in 0.1 ml of 1% SDS, 50 mM Tris (pH 7.5) and boiled for 4 min. PBS containing 1% Triton X-100 (1.0 ml) and a protease inhibitor mixture (15) was added. The mixture was vortexed briefly in an Eppendorf tube and placed on ice for 10 min. The tube was subjected to centrifugation (14,000 × g) for 10 s, and the supernatant was transferred to a new Eppendorf tube. A second aliquot of anti-HA antibody (2 µg/3 A₆₀₀ cell equivalents) was added, and the immunoprecipitation procedure described previously (15) was followed.

Epitope Tagging-- Protein tagging using the HA epitope (16) was performed as follows. The CYB2 gene encoding the precursor to cyt b₂ was amplified by the polymerase chain reaction using upstream primer TCCCCCGGGATGCTAAAATACAAACCTTTAC containing a SmaI site and downstream primer GCGAATTCTTACGCGTAGTCTGGGACGTCGTATGGGTATGCATCCTCAAATTCTGTTAAAGTAGGTCCC containing a EcoRI site and encoding the HA epitope. The product was inserted between the SmaI and EcoRI sites of pHF454 (2 µm TRP1) (3), which placed the CYB2 coding sequence immediately downstream of the ADH1 promoter (17).

The CYT1 gene encoding the precursor to cyt c₁ was amplified using upstream primer CGGGATCCATGTTTTCAAATCTATCTAAACG containing a BamHI site and downstream primer GCGAATTCTTACGCGTAGTCTGGGACGTCGTATGGGTACTTTCTTGGTTTTGGTGGATTGAAAACG containing a EcoRI site and encoding the HA epitope. The product was inserted between the BamHI and EcoRI sites of pHF454 (2 µm TRP1) immediately downstream of the ADH1 promoter.

Site-directed Mutagenesis-- All site-directed mutagenesis reactions were performed as described previously (3). The wild-type IMP1 gene and the mutations constructed in IMP1 were introduced into pRS426 (2 µm URA3) (18). The DNA fragment that was used included the native IMP1 promoter carried by a 400-nucleotide stretch upstream of the Imp1p coding sequence. The wild-type IMP2 gene and the mutations constructed in IMP2 were introduced into pHF455 (2 µm URA3), which placed the IMP2 coding sequence immediately downstream of the ADH1 promoter. To mutagenize CYB2, the wild-type CYB2 gene and the mutations constructed in CYB2 (tagged with a sequence encoding the HA epitope as described above) were introduced into pHF454 (2 µm TRP1), which placed the CYB2 gene downstream of the ADH1 promoter. To mutagenize CYT1, the wild-type CYT1 gene and the mutations constructed in CYT1 (tagged with a sequence encoding the HA epitope as described above) were introduced into pHF454 (2 µm TRP1), placing the CYT1 gene immediately downstream of the ADH1 promoter. The sequences of the oligonucleotides used to construct these mutations are available upon request.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Amino Acids Comprising the Type I Signal Peptidase Signature Are Important for Imp1p and Imp2p Function-- Five key amino acids have been found to serve critical roles in catalysis and structural maintenance of the type I signal peptidases in eubacteria, including leader peptidase from E. coli (2, 19-21) and SipS from Bacillus subtilis (22). This signature sequence includes the catalytic dyad residues, serine and lysine, and three amino acids, an arginine and two aspartic acids, that are structurally important (Fig. 1). Because Imp1p and Imp2p of the mitochondrial signal peptidase from the yeast S. cerevisiae contain this signature, we asked whether these five amino acids were important for enzyme function using a site-directed mutagenesis approach. Mutations altering these five residues were constructed in the IMP1 gene and inserted into pRS426 (2 µm URA3) (see "Experimental Procedures"). The constructs were then introduced into yeast strain XCY101 (imp1::HIS3). The genotypes of strains used in this study are listed under "Experimental Procedures." To determine whether these mutations inhibited enzyme activity, a pulse-chase assay was used to monitor for cleavage of the Imp1p substrate i-cyt b₂. Pre-cyt b₂ (p-cyt b₂) contains a bipartite signal sequence (23). The amino-terminal half is cleaved by the mitochondrial processing protease (/) within the mitochondrial matrix (24-27). This cleavage event liberates an intermediate form, i-cyt b₂, that contains the second half of the bipartite signal, which is cleaved by Imp1p. Cells of strain XCY101 bearing the imp1 mutations and bearing pXC2 (2 µm TRP1) that contained the wild-type CYB2 gene (encoding p-cyt b₂ that had been tagged at the carboxyl terminus with the HA epitope) (see "Experimental Procedures") were grown to log phase in a glucose-containing medium and treated with a 10-min pulse using [³⁵S]methionine and [³⁵S]cysteine, followed by a 60-min chase with excess unlabeled methionine and cysteine. Proteins were precipitated from cell extracts using anti-HA antibodies and subjected to SDS-PAGE and fluorography.

View larger version (11K): [in this window] [in a new window]   Fig. 1.   Regions of homology among members of the type I signal peptidase family. Box I, Box II, and Box III represent sequences that are homologous in leader peptidase from E. coli, SipS from B. subtilis, and the Imp1p and Imp2p subunits of the yeast IMP. The positions of the catalytic serine and lysine of leader peptidase are indicated (*), and the amino acids important for maintaining the structure of leader peptidase are indicated (#). Gaps in these sequences are indicated by a dash.

After the 60-min chase, mature cyt b₂HA (m-cyt b₂HA) was present in cells carrying the wild-type IMP1 gene, whereas the intermediate species, but no mature species, was found in XCY101 cells (imp1::HIS3) lacking Imp1p (Fig. 2). The p-cyt b₂HA protein containing the bipartite signal was not detected under these conditions. In cells carrying the S40A, S40T, K84R, K84H, D131Y, D138N, and D138E mutations, i-cyt b₂HA was seen exclusively, indicating a strong inhibition of cleavage by these mutated forms of Imp1p. In agreement with this result, yeast cells bearing these imp1 mutations were not viable on agar plates containing glycerol, a nonfermentable carbon source. Imp1p is required for cellular respiration, probably because at least one of the Imp1p substrates is nonfunctional when its signal peptide is still attached. Therefore, growth of yeast cells in the presence of a nonfermentable carbon source is an indicator of Imp1p function (4, 5). The remaining imp1 mutations (D131N, D131E, and R85A) inhibited the cleavage of i-cyt b₂HA less well (Fig. 1). Furthermore, yeast cells bearing these mutations were able to grow on agar plates containing glycerol as the sole carbon source. Taken together, all five amino acids comprising the type I signature of Imp1p were important for function, although Asp¹³¹ could be changed to asparagine and glutamic acid without appreciable loss of activity, and Arg⁸⁵ could be changed to alanine, resulting in only a partial enzymatic defect.

View larger version (6K): [in this window] [in a new window]   Fig. 2.   Processing of the cyt b2 precursor by mutant forms of Imp1p. Processing of the cyt b2 precursor tagged with the HA epitope was examined in XCY101 cells (imp1::HIS3)/pXC2 (CYB2-HA TRP1) bearing a URA3-marked plasmid containing the wild-type (wt) IMP1 gene or one of a number of imp1 mutations that are indicated at the top of the figure (see "Experimental Procedures"). Cells were subjected to a 10-min pulse and a 60-min chase, and proteins were precipitated using anti-HA antibodies (see "Experimental Procedures"). Intermediate (i) and mature (m) cyt b2 were resolved on a 7% SDS-PAGE gel. Each lane represents two A600 equivalents of log-phase yeast cells.

We next asked whether the type I signature amino acids in Imp2p were important for its function. A series of imp2 mutations was constructed by site-directed mutagenesis. The IMP2 gene and the imp2 mutations were introduced into pHF455 (2 µm URA3) (see "Experimental Procedures"). This plasmid series was then introduced into strain JNY34 (imp2), which contained pXC1 (2 µm TRP1) that bore the CYT1 gene (encoding p-cyt c₁ that had been tagged at the carboxyl terminus with the HA epitope) (see "Experimental Procedures"). Cells were grown in a medium containing glucose and then subjected to a 15-min pulse and a 30-min chase.

When the wild-type IMP2 gene was present in cells, a large amount of m-cyt c₁HA was exhibited (Fig. 3). These cells also displayed both p-cyt c₁HA, which contains a bipartite signal peptide (28), and i-cyt c₁HA, which contains the second half of the bipartite signal. The presence of these two immature species in cells containing wild-type Imp2p may be due to the fact that the CYT1 gene was overexpressed (see "Experimental Procedures" for a description of the plasmid used). A novel species of slightly smaller molecular mass than m-cyt c₁HA was also present in cells containing wild-type Imp2p (Fig. 3, see lane IMP2(wt)). The identity of this novel form is not known; however, it may represent a proteolytic fragment arising from overexpression of the apoprotein. In JNY34 (imp2) cells lacking Imp2p, m-cyt c₁HA was absent (Fig. 3). Likewise, little or no production of m-cyt c₁HA was detected in cells carrying the S41A, S41T, K91R, K91H, D124N, D124Y, D131N, and D131E mutations. One of these mutations, the S41A mutation, was also constructed in a previous study, and results similar to those reported here were obtained (5). The R92A and D124E mutations only partially inhibited the production of m-cyt c₁HA (Fig. 3).

View larger version (9K): [in this window] [in a new window]   Fig. 3.   Processing of the cyt c1 precursor by mutant forms of Imp2p. Processing of the cyt c1 precursor tagged with the HA epitope was examined in JNY34 cells (imp2)/pXC1 (CYT1-HA TRP1) bearing a URA3-marked plasmid containing the wild-type (wt) IMP2 gene or one of a number of imp2 mutations that are indicated at the top of the figure (see "Experimental Procedures"). Cells were subjected to a 15-min pulse and a 30-min chase, and proteins were precipitated using anti-HA antibodies (see "Experimental Procedures"). The precursor (p) containing a bipartite signal sequence, an intermediate (i) form containing only the second half of the bipartite signal, and mature (m) cyt c1 were resolved on a 10% SDS-PAGE gel. A novel species of unknown origin is sometimes seen below the band labeled m. Each lane represents three A600 equivalents of log-phase yeast cells.

None of these imp2 mutations inhibited the growth of JNY34 cells on agar plates containing glycerol, consistent with the fact that Imp2p activity is nonessential for cellular respiration (5). However, a physical interaction between Imp1p and Imp2p is important for the stability of Imp1p and thus for the growth of yeast cells in the presence of a nonfermentable carbon source (5). The fact that none of the imp2 mutations inhibited the growth of JNY34 cells in the presence of glycerol suggests that the imp2 mutations did not prevent the binding of Imp2p to Imp1p. Indeed, we have shown that Imp2p containing the above-mentioned mutations altering Ser⁴¹ or Lys⁹¹ was stable in yeast cells for at least 30 min, whereas mutations altering Arg⁹², Asp¹²⁴, and Asp¹³¹ led to the degradation of Imp2p in vivo (data not shown).

In summary, the data show that, as with Imp1p, the five amino acids comprising the type I signature of Imp2p are important for its enzymatic activity. Considering that mutations altering Ser⁴¹ and Lys⁹¹ of Imp2p inhibit enzyme activity completely but do not affect Imp2p stability in vivo, Imp2p and, by extension, Imp1p probably contain a serine/lysine catalytic dyad.

Imp1p Cleaves Signal Peptides Containing Standard and Nonstandard Cleavage Sites-- Imp2p cleaves the signal peptide of i-cyt c₁ that contains the 1 residue, alanine, whereas Imp1p cleaves the signal peptide of i-cyt b₂ that has a nonstandard 1 residue, asparagine. Because current models suggest that asparagine may provide a determinant for this substrate specificity, we prepared a series of constructs that introduced 19 amino acids into the 1 position of i-cyt b₂HA to identify amino acid substitutions that inhibit cleavage by Imp1p and promote cleavage by Imp2p. These changes were constructed by site-directed mutagenesis (see "Experimental Procedures"). To determine whether Imp1p was able to cleave signal peptides containing these amino acid substitutions, a series of plasmids was introduced into cells of strain JNY34 (imp2). Because Imp1p is unstable in the absence of Imp2p, the cells also carried plasmid pXC3 that contained the imp2 (S41A) mutation. This mutation renders Imp2p enzymatically inactive (see Fig. 3) but does not affect Imp2p stability and thus Imp1p stability (5). Cells were grown to log phase and subjected to a 10-min pulse followed by a 60-min chase, and proteins were precipitated from cell extracts using anti-HA antibodies.

As shown in Fig. 4A, the placement of five different amino acids into the signal peptide of i-cyt b₂HA led to its efficient cleavage by Imp1p. Serine, cysteine, methionine, alanine, and leucine were tolerated almost as well as the naturally occurring asparagine residue. Only a small amount of cleavage of i-cyt b₂HA by Imp1p was detected when glutamine and threonine were present and no cleavage was detected when any other amino acid was present at the 1 position (Fig. 4A). The inhibition of cleavage by 14 different amino acid substitutions at the 1 position argues against the idea that cleavage can occur at a nearby asparagine when serine, cysteine, methionine, alanine, and leucine are present.

View larger version (37K): [in this window] [in a new window]   Fig. 4.   Cleavage of 1 mutant forms of p-cyt b2. A series of TRP1-based plasmids encoding the cyt b2HA precursor containing 20 different amino acids at the 1 position (indicated by the one-letter code) was introduced into strain JNY34 (imp2)/pXC3 (imp2 (S41A) URA3) (A) and strain XCY101 (imp1::HIS3) (B). Strain JNY34 (imp2)/pXC3 (imp2 (S41A) URA3) containing the wild-type cyt b2HA precursor is depicted in the first lane of B. Cells were subjected to a 10-min pulse and a 60-min chase, and proteins were precipitated using anti-HA antibodies. The precursor (p), intermediate (i), and mature (m) forms of cyt b2 were resolved on a 7% SDS-PAGE gel. Each lane represents two A600 equivalents of log-phase yeast cells.

We next introduced this series of mutations into cells of strain XCY101 (imp1::HIS3), and then we performed a pulse-chase analysis to determine whether Imp2p could cleave these mutant forms of i-cyt b₂HA. As shown in Fig. 4B, Imp2p was unable to cleave i-cyt b₂HA containing any amino acid at the 1 position.

We reasoned that the introduction of a 1 methionine into i-cyt b₂HA may result in a new translational start site, which could be mistaken for cleavage at the 1 site by Imp1p (Fig. 4A). We therefore repeated the pulse-chase analysis, only this time, proteins were immunoprecipitated from cell extracts of strain JNY34 (imp2)/pXC3 (imp2 (S41A)) after both the pulse and the chase. The p-cyt b₂HA protein was present after the pulse, and m-cyt b₂HA was present after a 30-min chase (data not shown). This precursor-product relationship established that a cleavage event had occurred, supporting the idea that Imp1p can cleave i-cyt b₂HA after the 1 methionine. Further support for this conclusion comes from the fact that a protein having the size of m-cyt b₂HA was absent from strain XCY101 (Fig. 4B).

The data presented in Fig. 4B show that, surprisingly, Imp2p could not cleave i-cyt b₂HA that had alanine at the 1 position. Because the natural substrate for Imp2p, i-cyt c₁, contains a 1 alanine, we chose to examine the 3 residue of i-cyt b₂HA. Both of the Imp1p substrates, i-cyt b₂ and p-cyt oxidase subunit II, contained isoleucine at the 3 position, whereas the Imp2p substrate had a 3 alanine. It thus seemed plausible that in order to promote cleavage of i-cyt b₂ by Imp2p, it may be necessary to change the 1 and 3 amino acids to alanine. To this end, we constructed a series of mutations in which different combinations of asparagine and alanine were placed at the 1 position, and different combinations of isoleucine and alanine were placed at the 3 position of i-cyt b₂HA. The mutations were introduced into plasmid pHF454 (2 µm TRP1) (see "Experimental Procedures"), and the constructs were transformed into strains XCY101 (imp1::HIS3) and JNY34 (imp2)/pXC3 (imp2 (S41A)). Cells were then examined by pulse-chase analysis. As shown in Fig. 5, none of the mutational combinations led to a form of i-cyt b₂HA that could be cleaved by Imp2p, including the (1A 3I) form that was described earlier (Fig. 4B, see lane A). Of particular interest is the (1A 3A) double mutation. Whereas the natural substrate for Imp2p contained a 1 and 3 alanine, Imp2p was unable to cleave the double alanine form of i-cyt b₂HA (Fig. 5). In contrast, Imp1p was able to cleave some forms of i-cyt b₂HA, including the wild-type species (1N 3I) and two mutant species, (1N 3A; Fig. 5) and (1A 3I; Fig. 4A, see lane A). These two mutations demonstrated that Imp1p can cleave a signal peptide containing alanine at the 1 or 3 position. However, introducing alanine at both positions of i-cyt b₂HA inhibited cleavage by Imp1p (Fig. 5), demonstrating the importance of the 1 and 3 amino acids in determining cleavage by Imp1p.

View larger version (40K): [in this window] [in a new window]   Fig. 5.   Effect of changing the 1 and 3 amino acids of p-cyt b2. A series of TRP1-based plasmids encoding the cyt b2HA precursors containing the amino acid changes listed at the top of the figure was introduced into strain XCY101 (imp1::HIS3) (first three lanes) and strain JNY34 (imp2)/pXC3 (imp2 (S41A) URA3) (last three lanes). Cells of these strains and strain JNY34/pXC3 lacking the plasmid encoding the cyt b2-HA precursor (middle lane) were subjected to a 10-min pulse and a 60-min chase, and proteins were precipitated using anti-HA antibodies. The intermediate (i) and mature (m) forms of cyt b2 are indicated. Proteins were resolved on a 7% SDS-PAGE gel. Each lane represents two A600 equivalents of log-phase yeast cells.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study, we have asked whether amino acids comprising the type I signal peptidase signatures of the IMP subunits are functionally important. Studies in eubacterial systems have shown that the type I signature consists of a serine, lysine, arginine, and two aspartic acid residues that are important for the function of leader peptidase from E. coli and SipS from B. subtilis (21, 22). Imp1p and Imp2p from the yeast mitochondrion contain similar signatures (Fig. 1); however, functional studies have been lacking, except for an analysis of Ser⁴¹, which has been shown to be essential to Imp2p (5). Here, we have demonstrated that conservative changes of the signature serine and lysine residues of Imp1p (Fig. 2) and Imp2p (Fig. 3) abolish their enzymatic activity. Moreover, Imp2p containing conservative changes of the signature serine and lysine residues is stable in vivo (data not shown), consistent with studies in eubacterial systems showing that the corresponding residues make up a catalytic serine/lysine dyad (2, 21, 22). In the eubacterial studies, the remaining amino acids, an arginine and two aspartic acid residues, are important structural amino acids, and from the data presented here, it is plausible that the corresponding amino acids in Imp1p and Imp2p serve a similar role. Considering these results, Imp1p and Imp2p contain similar type I signatures, although they cleave different signal peptides inside the mitochondrion.

Another goal of this study is to understand why Imp1p and Imp2p exhibit nonoverlapping substrate specificities. To this end, we have tested the hypothesis that the presence of asparagine at the 1 position directs signal peptides to Imp1p and away from Imp2p. We have substituted the 1 asparagine of i-cyt b₂ with 19 amino acids and then examined the mutant signal peptides for cleavage by Imp1p (Fig. 4A) and Imp2p (Fig. 4B). The data reveal that five different amino acids can be introduced into the 1 position of i-cyt b₂ without appreciable loss of cleavage efficiency by Imp1p. The amino acids tolerated are serine, cysteine, methionine, alanine, and leucine. Including the naturally occurring amino acid, asparagine, this group includes polar (asparagine, serine, and cysteine) and nonpolar (methionine, alanine, and leucine) amino acids and amino acids with varying side-chain lengths. Both of the sulfur-containing amino acids (cysteine and methionine) are permitted. Surprisingly, the alanine substitution is recognized by Imp1p, despite the fact that the Imp2p substrate, i-cyt c₁, contains a 1 alanine. Indeed, alanine, serine, cysteine, and leucine have been seen at the 1 positions of signal peptides targeted to the ER membrane (29-31). From the fact that Imp1p can cleave these signal peptides and cleave the highly unusual signal peptides containing asparagine and methionine at the 1 position, we conclude that Imp1p is capable of processing signal peptides exhibiting both standard and nonstandard cleavage sites.

A caveat to this conclusion is that without amino-terminal sequencing of the cleavage product, we cannot be absolutely certain that cleavage did not occur at a nearby asparagine residue in the linear amino acid sequence. However, 14 amino acid substitutions at the 1 position of i-cyt b₂ produce signal peptides that are recognized poorly or not at all by Imp1p (Fig. 4A). Signal peptides containing glutamine and threonine are cleaved to a small extent, and the remaining amino acid substitutions are not recognized, including the substitutions of the aromatic and charged amino acids and substitutions of proline, glycine, isoleucine, and valine. The absence of efficient cleavage of 14 mutant signal pepides thus argues strongly against the idea that cleavage can occur at a nearby asparagine.

Although the Imp2p substrate i-cyt c₁ contains alanine at the 1 position, Imp2p cannot cleave i-cyt b₂ containing a 1 alanine (Fig. 4B). In fact, Imp2p cannot cleave i-cyt b₂ regardless of the amino acid present at the 1 position. This argues against the hypothesis that asparagine is responsible for directing signal peptides toward Imp1p and away from Imp2p. During the course of this study, we noted that Imp1p substrates i-cyt b₂ and p-cyt oxidase subunit II contain a 3 isoleucine, whereas the Imp2p substrate, i-cyt c₁, contains a 3 alanine. Because the 3 position is thought to be important for signal peptide recognition in the ER and eubacterial systems (2, 29-31), we constructed another series of mutations, changing the 1 and 3 amino acids of i-cyt b₂. However, not even i-cyt b₂ containing alanine at both the 1 and 3 positions could be cleaved by Imp2p (Fig. 5).

Thus, the goal of identifying factors that govern the substrate specificities exhibited by the IMP subunits has been achieved only partially in this study. We have shown that amino acids at the 1 and 3 positions are important for proper cleavage of the signal peptide of i-cyt b₂. In contrast to previous models, however, a 1 asparagine is not required to direct signal peptides to Imp1p. Because the attachment of heme c to the i-cyt c₁ apoprotein is essential for cleavage of this substrate by Imp2p (28), and the heme binding domain of i-cyt b₂ is needed for its efficient cleavage by Imp1p (32, 33), current studies are focused on determining whether the mature portions of these proteins are important for their recognition by specific IMP subunits.

	ACKNOWLEDGEMENT

We thank Jodi Nunnari (University of California, Davis, CA) for providing yeast strains.

	FOOTNOTES

^* This work was supported by Department of Health and Human Services Training Grant 2 T32 CA09385-11 (to C. V.) and by grants from the National Science Foundation (to H. F. and N. G.) and American Heart Association (to N. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 615-343-0453; Fax: 615-343-7392; E-mail: neil.green@mcmail.vanderbilt.edu.

	ABBREVIATIONS

The abbreviations used are: ER, endoplasmic reticulum; PAGE, polyacrylamide gel electrophoresis; IMP, inner membrane protease; cyt, cytochrome; HA, hemagglutinin.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES