HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delmotte, M.-H. Articles by Lefebvre, P. Search for Related Content PubMed PubMed Citation Articles by Delmotte, M.-H. Articles by Lefebvre, P. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 53, 38225-38231, December 31, 1999

Serine 157, a Retinoic Acid Receptor  Residue Phosphorylated by Protein Kinase C in Vitro, Is Involved in RXR·RAR Heterodimerization and Transcriptional Activity^*

Marie-Hélène Delmotte, Ali Tahayato^§, Pierre Formstecher, and Philippe Lefebvre^¶

From INSERM Unité 459, Faculté de Médecine Henri Warembourg, 1, place de Verdun, 59045 Lille cedex, France

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Retinoic acid (RA) regulation of cellular proliferation and differentiation is mediated, at least in part, through two related nuclear receptors, RAR and RXR. RA-induced modulation of gene expression leads generally to cellular differentiation, whereas stimulation of the protein kinase C (PKC) signaling pathway is associated with cellular proliferation. Pursuant to our discovery that prolonged activation of PKCs induced a strong decrease in RA responsiveness of a retinoid-inducible reporter gene, we have further investigated the connections between these two signaling pathways. We demonstrate that PKC isoforms  and  are able to phosphorylate human RAR (hRAR) in vitro on a single serine residue located in the extended DNA binding domain (T box). The introduction of a negative charge at this position (serine 157) strongly decreased hRAR transcriptional activity, whereas a similar mutation at other PKC consensus phosphorylation sites had no effect. The effect on transcriptional activation was correlated with a decrease in the capacity of hRAR to heterodimerize with hRXR. Thus hRAR is a direct target for PKC and , which may control retinoid receptor transcriptional activities during cellular proliferation and differentiation.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

External stimuli (neurotransmitters, hormones, mitogens) activating G-protein-coupled receptors and growth factor receptors induce the activity of phospholipases, which in turn generate membrane lipid metabolites. Among them, diacylglycerol (DAG)¹ and others are able to modulate cellular protein kinase C (PKC) activities needed for sustained cellular responses (1, 2). The PKC superfamily contains to date 11 isoforms encoded by 10 genes. The isoforms can be classified into three groups based on sequence homologies and biochemical properties: conventional PKCs (isoforms , 1, 2, and ) are DAG- and calcium-dependent kinases; novel PKCs (isoforms , , , ) are dependent only on DAG; and a third group of atypical PKCs (isoforms , /) is unresponsive to DAG and calcium. The µ isoform (mouse protein kinase D) is a high molecular weight enzyme with specific properties such as a transmembrane domain, but it can be considered an atypical PKC in view of its very low affinity for DAG (for review, see Refs. 3 and 4). All of these kinases need negatively charged phospholipids (phosphatidylserine) to exert their phosphorylating activities, triggering major cellular events such as differentiation and proliferation. Although a clear physiological role for each isozyme has not been established definitively, the existence of these isotypes with unique subcellular and tissue distribution suggests a specialized role for each isoform (for review, see Ref. 5). Most notably, gene transfer experiments have underlined a role of these protein kinases in cellular proliferation and tumor growth progression.

Nuclear receptors are ligand-dependent transcription factors that control a wide range of cellular events, including cellular proliferation and differentiation. Several lines of evidence point to a direct role of the PKC signaling pathway in modulating the transcriptional activity of some members of this superfamily. The thyroid hormone receptor appears to be a target for PKC (6) as well as the human vitamin D receptor (hVDR). hVDR is phosphorylated by PKC in the DNA binding domain (DBD), and phosphorylated serine (Ser-51) is important for hVDR transactivation properties (7, 8). Regulation of other nuclear receptors (glucocorticoid receptor, peroxisome proliferator-activated receptor, estrogen receptor) through activation of the MAP kinase cascade has also been documented and suggests that PKC, as an activator of the MAP kinase pathway, might participate indirectly in the control of the transcriptional activity of these nuclear receptors (9-13).

Our previous experiments pointed to a role of PKC in the regulation of hRAR transcriptional activity. They indicated that chronic treatment of COS-7 cells with TPA led to the specific inhibition of the activity of a retinoid-inducible reporter gene. We determined that hRAR is a substrate for PKC in vitro, and preliminary results suggested that two to four phosphorylation sites occurred out of the ligand binding domain (LBD) of this nuclear receptor (14). In light of these results, we addressed in this study several questions to elucidate further the role of PKC isozymes in the regulation of the transcriptional activity of hRAR. We characterized PKC isoforms for their capacity to phosphorylate hRAR in vitro and identified the target amino acid. Mutation of the phosphorylated serine affected hRAR transcriptional activity, and the molecular basis for the observed inhibition was investigated. Our results support the hypothesis that PKC and PKC are direct regulators of hRAR transcriptional activity by altering its ability to dimerize with RXRs.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- TPA and atRA were obtained from Sigma (Saint Quentin Fallavier, France). Purified rat brain PKC was purchased from Calbiochem-Novabiochem Corp. (Meudon, France). [-³²P]ATP (3,000 Ci/mmol), the ECLplus detection kit, and polyvinylidene difluoride transfer membranes were from Amersham Pharmacia Biotech (Les Ulis, France). DNA restriction and modifications enzymes were from Promega (Charbonnieres, France). Site-directed mutagenesis reactions were carried out using the QuickChange system from Stratagene (San Diego, CA). Polyethyleneimine (ExGen 500) was from EuroMedex (Souffelweyersheim, France). Oligonucleotides were purchased from Eurogentec (Le Sart-Tilman, Belgium).

Plasmids-- Constructs containing either the wild-type (wt) hRAR and wt hRXR cDNAs subcloned into pSG5 (Stratagene) or pQE9 (Qiagen, Diagen Gmbh, Dusseldorf, Germany). ) have been described in (15, 16). Mutations at potential phosphorylation sites were generated using the appropriate oligonucleotide that contained the desired mutation and a silent mutation introducing or inactivating a restriction site. The following mutagenic primers were used in this study (parentheses indicate the new restriction site, mutations are indicated in bold characters).

S115G: 5'-ggcttcttccgccgcggcatccagaagaacatg-3' (SacII);

S115D: 5'-cgccgcgacatccagaagaacatggtgtacacgtgtcaccgggacaagaactgcatcatcaacaaggtgactcggaaccgc-3' (BstEII);

S154A: 5'-gaagtgggcatggccaaggagtctgtgagaaacgatcgaaacaagaagaag-3' (PvuI);

S157A: 5'-atgtccaaggaggctgtgagaaacgatcgaaacaagaagaag-3' (PvuI);

S154A,S157A: 5'- gccgactgcagaagtgcttcgaagtgggcatggccaaggaggctgtgagaaacgaccg-3' (XmnI);

S154D: 5'-actcggaaccgctgccagtactgccgactgcagaagtgctttgaagtgggcatggacgtgagaaac-3' (BstEII);

S157D: 5'-atgtccaaggaggctgtgagaaacggacgaaacaagaagaag-3' (PvuI);

S154D,S157D: 5'-atgtccaaggaggctgtgggcatggacaaggaggatgtgagaaac-3' (PvuI);

S232A: 5'-gggacaagttcagtgagctcgctaccaagtgcatc-3' (SacI);

S232D: 5'-cgtgtctctctagacattgacctctgggacaagttcagttcagtgaactcgccacctcgcc-3' (XbaI);

S388A: 5'-gaagattactgacctgaggagcatcgccgccaagggggctgagcggg-3' (Bsu36I);

S388D: 5'-gaagattacctgacctgaggagcatcgacgccaagggggctgagcggg-3' (Bsu36I);

S452A: 5'-ccaggcagctgtagcccaagcttaagccccagcgccaacagaagcagccc-3' (HindII);

S452D: 5'-gccaggcagctgcagccccagcctcagccccagcgacaacagaagcagcc-3' (PstI).

All mutations were checked by restriction analysis and automatic sequencing. Detailed sequence information is available upon request.

Cell Culture and Transfections-- HeLa cells were cultured as monolayers in Dulbecco's minimal essential medium supplemented with 10% fetal calf serum. Cells were treated when indicated with TPA and/or retinoids to a final concentration of 10⁷ M and 10⁶ M, respectively. Transfections were carried out using the polyethyleneimine coprecipitation method as described (17). The luciferase assay was performed as described (15).

Receptor Purification and Phosphorylation Analysis-- A detailled procedure has been published elsewhere (18). Briefly, His₆-hRAR was overexpressed in Escherichia coli and purified to homogeneity by nickel-immobilized affinity chromatography. The purified polypeptide was phosphorylated and purified further by 8% SDS-PAGE. Gel slices containing the phosphorylated receptor were desiccated and rehydrated with trypsin digestion buffer, and trypsin was added to a 1:50 (w:w) ratio. Peptides were extracted and purified on a C18 column and submitted to Edman degradation reaction for sequencing. Phosphoamino acid determination was as follows. The phosphorylated hRAR was purified by 8% SDS-PAGE and transfer onto a polyvinylidene difluoride membrane. Bands containing the radioactive receptor were cut out and transferred into an Eppendorf tube containing 200 µl of 5.7 N HCl. After a 1-h incubation at 110 °C, the hydrolysate was dried and resuspended in 20 µl of electrophoresis buffer (0.5% acetic acid, 0.5% pyridine at pH 3.5). 10 µg of phosphoserine, phosphothreonine, and phosphotyrosine (Sigma) were added to the sample, which was submitted to electrophoresis on a cellulose glass-backed plate for 30 min at 1,000 V (30 mA). Plates were then dried and sprayed with ninhydrin to locate phosphoamino acid standard. ³²P-Labeled amino acids were identified by autoradiography.

Western Blotting and Antibodies-- Antibodies directed against isoforms of PKC were obtained from Transduction Laboratories (Lexington, KY). The anti-MRGS(His)₆ and anti-(His)₅ monoclonal antibodies were purchased from Qiagen. The anti-RAR monoclonal antibody was from Affinity BioReagents (Neshanic Station, NJ). Peroxidase-coupled anti-mouse and anti-rabbit IgGs were from Sigma. Immunodetections were carried out as described previously using the Amersham ECLplus detection system. SDS-PAGE, electrotransfer of proteins, and immunodetection procedures have been described in Ref. 14.

Protein-Protein Interaction Assays-- Protocols for glutathione S-transferase pull-down experiments have been described elsewhere (17, 19). Matrix-bound receptors were then resolved by 8% SDS-PAGE and detected by autoradiography or quantified using a Storm PhosphorImager (Molecular Dynamics). The RXR binding assay used in Fig. 6B was carried out as described in Ref. 16. Briefly, native or PKC-phosphorylated purified His₆-hRAR was diluted to a final concentration of 20 µg/ml in 1 × phosphate-buffered saline and adsorbed (~ 0.5 µg/well) to a Corning 96-well tissue culture-treated plate for 16 h at 4 °C. Wells were then washed three times with 1 × phosphate-buffered saline and coated for 3 h with a 5% fetal calf serum solution in 1 × phosphate-buffered saline to saturate nonspecific binding sites. Wells were washed three times with 1 × phosphate-buffered saline, and 10⁶ cpm of ³⁵S-labeled hRXR was loaded into each well and incubated for 90 min at 4 °C in 30 µl of binding buffer (20 mM HEPES, pH 7.8, 130 mM KCl, 1 mM EDTA, 1 mM -mercaptoethanol, 0.05% Nonidet P-40, and 20% glycerol). Unbound hRXR was removed by four washes with ice-cold binding buffer, and the specifically adsorbed ³⁵S-labeled hRXR was released by incubation with 50 µl of 0.1% SDS, 0.4 M HCl. Radioactivity was quantified by scintillation counting. Protein assays were carried out according to Bradford (20) using bovine serum albumin as a standard.

Statistical Analysis-- All incubations or assays were performed at least in triplicate. Measured values were used to calculate a mean ± S.E., and groups of data were compared using a two-sided analysis of variance test followed by a Dunnett test. Significance was defined as p < than 0.01. Calculations were carried out using the Prism software (GraphPad Inc., San Diego, CA).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

hRAR Is Phosphorylated by PKC and PKC on Serine Residues in Vitro-- We reported previously that one or two amino acids in the hRAR sequence located outside of the LBD were phosphorylated by PKCs purified from rat brain (14). We thus determined which isoforms of PKC were present in these commercial preparations by Western blotting analysis using a panel of isozyme-selective monoclonal antibodies. We found that rat brain extracts contained exclusively the PKC and  isoforms, with trace amounts of the µ isoform (Fig. 1A). Using this protein kinase mixture in an in vitro phosphorylation reaction with purified His₆-tagged hRAR as a substrate, we found that this receptor was a substrate for PKCs, as reported previously (Fig. 1B). PKCs were able, in these conditions, to display autophosphorylating activity as documented previously (for review, see Ref. 21), but no kinase activity was detected in purified hRAR preparations. The PKC-catalyzed hRAR phosphorylation was inhibited by GF109203X, a specific but general inhibitor of PKCs, and by an inhibitor specific for , , and  isoforms (Gö6976; Ref. 22). Gö6976 strongly inhibited PKC-directed phosphorylation of hRAR, but phosphate incorporation was still detectable, suggesting that PKCµ may display some weak phosphorylating activity in these conditions. From these experiments, we conclude that PKC and/or PKC is the most active isozyme phosphorylating hRAR in vitro.

View larger version (70K): [in this window] [in a new window]   Fig. 1.   Phosphorylation of hRAR by PKCs in vitro. Panel A, identification of PKC isoforms purified from rat brain. 1 ng of purified rat brain PKC (Calbiochem) was fractionated by 8% SDS-PAGE and blotted on a polyvinylidene difluoride membrane. Immunodetection of each isoform was carried out using specific monoclonal antibodies as described under "Experimental Procedures." Molecular masses are indicated on the left. Panel B, hRAR is phosphorylated by PKC and PKC in vitro. His6-tagged hRAR was purified to near homogeneity from E. coli extracts using NiTA affinity chromatography and incubated with purified rat brain PKCs and [-32P]ATP, in the presence of a PKC inhibitor (100 nM GF109203X) or an inhibitor specific for , , and  isoforms (100 nM Gö6976). Phosphorylated proteins were analyzed by 8% SDS-PAGE, and gels were either silver stained (left panel) or autoradiographed (right panel). Panel C, PKC and PKC phosphorylate hRAR on serine residues. hRAR was phosphorylated by rat brain PKCs and gel purified as in panel B. The polypeptide was submitted to total acid hydrolysis, and reaction products were separated by thin layer chromatography and identified by comigration with phosphoamino acid standards.

Phosphorylated hRAR was gel purified and submitted to acid hydrolysis to determine which type of amino acid was phosphorylated in these conditions. Products were analyzed by thin layer chromatography and identified by comigration with phosphoamino acid standards (Fig. 1C). Only phosphoserine was detected in these conditions, suggesting that hRAR is phosphorylated by PKC only on serine(s) located outside of the LBD.

Identification of Serine Residues Phosphorylated in Vitro by PKC and PCK-- To identify hRAR amino acids phosphorylated by PKC and  isoforms further, we submitted the purified, denatured, phosphorylated receptor to trypsin digestion. Proteolysis products were fractionated by reverse phase high performance liquid chromatography, and two labeled peptides (Fig. 2B) were reproducibly detected in these conditions, albeit in varying ratio.² These peptides were NH₂-terminally sequenced by the Edman reaction. Peak I corresponded to the sequence (K)¹⁴⁸CFEVGMS, whereas peak II was identified as peptide (R)¹³⁹CQYCRLQ. The occurrence of lysine (K) and of arginine (R) upstream of the cleavage site in the primary sequence of hRAR identified these peptides as products of trypsin cleavage. These results indicated, however, that partial tryptic digests were generated in our conditions but nevertheless mapped phosphorylated serine(s) to the same region of the DBD, spanning the T and A boxes. A PKC consensus phosphorylation site is found at position 157. Because partial proteolysis was likely, Ser-154 remained a possible target for PKC-catalyzed phosphorylation, although this amino acid is not surrounded by amino acids usually defining a PKC-directed phosphorylation site (RXXS/TXR). Thus we converted Ser-157 and Ser-115, Ser-154, Ser-232, and Ser-388 into an alanine (A) to determine whether these serine residues could be minor phosphorylation sites undetected in our phosphopeptide mapping experiments. His-tagged wt and mutated hRAR were expressed in bacteria, purified by immobilized metal affinity chromatography, and tested for their ability to serve as a substrate for PKC. Phosphorylation reactions were carried out as described above, using an identical amount of each receptor derivative, and products were subjected to SDS-PAGE. Receptor concentrations were controlled by silver staining (Fig. 3, left panels) of gels, which were then dried and autoradiographed (Fig. 3, right panels). We found that only mutation of Ser-157 severely compromised PKC-catalyzed phosphorylation, whereas all other substitutions designed to inactivate other consensus sequences had no significant effect on the phosphate content of hRAR. Residual phosphate incorporation was, however, observed with the S157A mutant, suggesting that other sites may represent poor substrates for PKC. Alternatively, this residual activity might result from contaminating, unidentified protein kinases in the rat brain extract. Thus Ser-157 appeared to be the major target for PKC in vitro, and these data support both peptide mapping results and our previous conclusion that putative phosphorylation site(s) lie outside of the LBD (14). Ser-157 is located in the DBD of the receptor, in a region lying COOH-terminally of the second zinc finger motif. Sequence alignment between RAR and RXR isoforms showed that Ser-157 is found only in RAR and RAR (Fig. 4) and is located in the so-called T box region, which has been reported to be important for dimerization and DNA binding activities of several nuclear receptors (23, 24).

View larger version (24K): [in this window] [in a new window]   Fig. 2.   Identification of PKC phosphorylation sites along the hRAR primary sequence. hRAR was used as a substrate for purified PKCs and gel purified as above. The denaturated polypeptide was then digested with TPCK-treated trypsin, and cleaved peptides were fractionated on a C18 reverse phase HPLC column. Peptides were identified by monitoring OD at 225 nm (panel A), and phosphorylated species were localized by quantifying radioactivity in each fraction (panel B). Fractions containing phosphorylated peptides (I and II) were lyophilized and subjected to automatic Edman degradation. The first radioactive peak (panel B) corresponds to unbound radioactivity, and the dotted lines indicate the acetonitrile concentration in percent (right axis).

View larger version (61K): [in this window] [in a new window]   Fig. 3.   Mutation of serine 157 prevents phosphorylation of hRAR by PKCs. Wild-type or mutated hRAR was overexpressed in E. coli and purified by NiTA chromatography. Each receptor was submitted to a phosphorylation reaction in the presence of [-32P]ATP and PKCs from rat brain. Samples were resolved by 8% SDS-PAGE, gels were silver stained (left panels, Proteins) and autoradiographed (right panels, 32P). Positions of molecular mass markers are indicated on the left, and the hRAR position is indicated by an arrowhead (right). Note that electrophoresis conditions were slightly different for mutants S157A and S388A, explaining the observed different mobility for labeled polypeptides of ~25 and 18 kDa.

View larger version (21K): [in this window] [in a new window]   Fig. 4.   Localization of phosphorylated serine 157 in hRAR domain D. Sequence alignment of hRAR1, hRAR2, hRAR2, hRXR, and hRXR1 is shown. The phosphorylated serine are located in the D domain (amino acids 153-198 of hRAR) and map to the T box (amino acids 154-165), a region involved in receptor dimerization and DNA binding. The NCoR box maps to the COOH terminus of domain D from residue 181 to residue 198.

Converting Serine 157 into Aspartic Acid Decreases Transcriptional Activity of hRAR-- To examine the role of this phosphorylatable amino acid in regulating the transcriptional activity of hRAR, we constructed eukaryotic expression vectors encoding Ser to Ala or Gly, and Ser to Asp hRAR mutants, either to prevent constitutive phosphorylation by PKC (Ser to Ala/Gly mutants) or to mimic the net charge increase brought by phosphorylation (Ser to Asp mutants). As for in vitro experiments, we deliberately mutated all potential phosphorylation sites for PKC (Ser-115, Ser-157, Ser-232, Ser-388, and Ser-452) and compared the activity of Ser to Ala and of Ser to Asp mutants with that of the wt hRAR. HeLa cells express low levels of RARs and RXRs which are able to activate prototypical retinoid response elements such as the direct repeat found in the RAR2 gene promoter (DR5). To avoid any interference with endogenous receptors, we used the luciferase reporter gene driven by the synthetic, palindromic thyroid response element TREpal, which is also activated by retinoids but necessitates high levels of receptors which are only achieved upon transfection of RAR and/or RXR expression vectors (17, 25). We thus monitored the transcriptional activity of Ser to Ala and of Ser to Asp mutants in the presence of hRXR in this system and compared them with the activity of wt hRAR, using atRA as an inducer at a 10⁶ M final concentration (Fig. 5). The basal level of luciferase activity measured in the presence of wt hRAR or mutant receptors did not fluctuate significantly, suggesting that these receptors have a similar affinity for nuclear corepressors. In vitro protein-protein interaction assays revealed that all of these receptors bound to the nuclear corepressor SMRT with a wt affinity.³ The addition of atRA to the culture medium leads typically to a 5-10-fold increase in luciferase activity: only two mutations affected the ability of hRAR to respond to atRA, S115G and S157D, although both receptors were expressed at levels comparable to that of wt hRAR.³ S115G activity decreased by 30% compared with wt hRAR. Because Ser-115 is not phosphorylated by PKCs (Fig. 3), and S115D displayed a wt activity, it is likely that the observed decreased activity results from structural alterations of the DBD and not from direct phosphorylation. Ser-115 is indeed located between the two zinc fingers of hRAR, and mutations at this position in the hVDR sequence (S51) were proposed to alter the -helical structure of this region (8). A decrease of at least 50% was observed in atRA-induced luciferase activity in cells overexpressing S157D, whereas S157A retained wt activity, consistent with our working hypothesis of a PKC-mediated inactivation of hRAR. The latter observation also suggests that no phosphorylation of Ser-157 occurs in nonstimulated cells, in agreement with a previous report (27). We also note that this decrease in activity is similar to that observed upon chronic treatment of cells with TPA (14), and therefore identify Ser-157 as a functional substrate for PKCs.

View larger version (39K): [in this window] [in a new window]   Fig. 5.   Comparison of the transcriptional activities of hRAR mutants in HeLa cells. HeLa cells were cotransfected with (TREpal)TATA3Luc, pSG5 wt hRAR, or mutants and pSG5hRXR. Basal and ligand-induced activities of the (TREpal)3 luciferase reporter gene are represented as bar chart for each mutant, in the presence (atRA) or absence (basal) of 1 µM atRA. Each mutant activity was assayed when overexpressed together with hRXR, thus reflecting heterodimeric RAR activity. The average luciferase activity from at least six experiments (± S.E.) is given for each mutant, with the level of luciferase activity of wt hRAR observed in the presence of 1 µM atRA taken as 100%. * p = 0.01; **p = 0.04.

Phosphorylation of Serine 157 Decreases the Ability of hRAR to Heterodimerize with RXR-- The effects of the Ser-157 mutation on RAR properties were investigated: the ability of the mutated receptor to bind natural and synthetic ligands, its subcellular localization in response to ligand as well as its half-life, its interaction with nuclear corepressor (SMRT) and coactivators (SRC-1, RIP140) were tested. None of these assays revealed functional alterations of the receptor.³ The ability of the receptor to interact with RXR in a ligand-dependent manner in the absence of DNA was quantified in glutathione S-transferase pull-down experiments (Fig. 6). A Sepharose GST-RXR affinity matrix was used as a bait for ³⁵S-labeled wt hRAR and receptor mutants S157A and S157D, in the presence or not of 1 µM atRA. Similar amounts of receptors were used in each condition and high salt washes allowed to monitor the ligand-induced stabilization of RAR-RXR interaction. Heterodimer formation was stimulated 3-fold for wt hRAR and the S157A mutant (Fig. 6A). S157D displayed a slightly but significantly decreased constitutive dimerization (in the absence of atRA) and a 2-fold reduction in its ability to dimerize with RXR in the presence of atRA. This result was confirmed using an independent assay in which phosphorylated or native His-tagged RAR was immobilized on a hydrophobic matrix (8). ³⁵S-Labeled RXR was then incubated, in the presence of 1 µM atRA, with this matrix, and specifically bound receptors were quantified (Fig. 6B). RAR phosphorylation by PKC, in conditions where more than 80% of the receptor was phosphorylated by PKCs, led to a 50% decrease in RXR retention on this matrix, in agreement with results generated by the glutathione S-transferase pull-down assay. Thus to a 50% decreased transcriptional activity is associated with a decreased ability to form a dimer with hRXR, strongly suggesting that PKC-catalyzed post-translational modification of hRAR is controlling the ability of RAR to heterodimerize with RXR.

View larger version (27K): [in this window] [in a new window]   Fig. 6.   hRAR heterodimerization with hRXR is inhibited by phosphorylation of serine 157. Panel A, 35S-Labeled hRAR polypeptides were produced by in vitro coupled transcription-translation, incubated for 2 h with dimethyl sulfoxide or 1 µM atRA, and adsorbed on a Sepharose-GST-hRXR affinity matrix. Bound receptors were resolved by SDS-PAGE and quantified by PhosphorImager analysis. Results are shown as the average of three independent experiments (± S.D.) and are presented with a typical autoradiogram. Results from analysis were normalized for translation efficiency using the protein input lane as a reference (which represents 20% of total input) and expressed as the ratio of bound receptor to 20% input protein. Panel B, purified wt hRAR was submitted to a phosphorylation reaction in the presence of rat brain purified PKCs, ATP in the presence or not of a specific inhibitor (100 nM GF109203X) and adsorbed to microtiter wells. After extensive washing to remove unbound ATP, 106 cpm of 35S-labeled hRXR was added to the wells and incubated for 2 h with 1 µM atRA. Bound material was quantified by scintillation counting, and the results are expressed as means ± S.D. of three independent experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Modulation of the phosphorylation state plays an important role in the reversible control of the activity of many proteins, including nuclear receptors. In the case of hRAR1, heterodimerization properties have been shown to be altered by protein phosphatases 1 and 2A (15) and the NH₂-terminal function AF-1 to be activated through the proline-directed Cdk7 (27). We now show that dimerization of hRAR with hRXR can be modulated by PKC-dependent phosphorylation. Several potential phosphorylation sites by PKCs are located along the hRAR sequence. Phosphopeptide mapping studies as well as mutagenesis of hRAR identified Ser-157 as the major target for PKC and PKC isoforms (Figs. 2 and 3). This amino acid is located in the T box of hRAR, which, together with the A box, are part of a larger region (hinge domain) that is organized into an -helical structure in the RXR·T₃R DBD dimer (23). Molecular modeling of RXR·RAR dimers suggested that the T box, forming a loop interrupted by an -helical turn perpendicular to the DNA axis, engages dimerization contacts with the RXR DBD. Interestingly, Ser-157 neighbors amino acids that, in RXR·T₃R and RXR·VDR dimer structures, establish salt bridges with the RXR DBD (Asp-69 and Glu-69, respectively). Thus phosphorylation of Ser-157 may introduce strong conformational constraints on this dimerization region and, as observed, decrease the relative affinity of RAR DBD for RXR DBD and inhibit dimerization. Alternatively, phosphorylation of Ser-157 may perturb the relative orientation of RAR DBD and LBD as suggested for VDR (24) and in turn modify the orientation of the strong dimerization interface located in the hRAR LBD (8). Protein kinases C are a family of Ser/Thr kinases whose activities are involved in the regulation of complex biological responses such as differentiation, proliferation, and apoptosis. They are organized in two domains, a COOH-terminal catalytic domain and an NH₂ -terminal regulatory domain. Their tissue distribution is in most cases ubiquitous, with the exception of PKC, which is expressed specifically in the brain and spinal cord. Response to agonists (hormones, neurotransmitters, growth factors) is mediated through a transient short term production of DAG, essentially through phosphatidylinositol 4,5-bisphosphate hydrolysis. A more sustained response may be observed with phosphatidylcholine hydrolysis or phorbol ester treatment. The basic model of PKC activation suggests that PKC translocation to the plasma membrane is the main event regulating this signaling cascade. However, PKC is often found, irrespective of its activation state, in the particulate fraction (membranes, organelles, and nuclei) of cultured cells and in nuclei themselves. HeLa cells were found to express , , , µ, , and  isozymes, among which  and  isozymes appeared to be sensitive to TPA-induced down-regulation.³ Both PKC and  can be found in nuclei of HeLa cells.³ A prolonged activation of PKCs by phorbol esters or repeated DAG stimulation leads to cellular depletion in PKCs by inducing a high rate of proteolytic clipping of DAG-dependent kinases, concomitantly with the nuclear translocation of the catalytic domain (PKM), which displays unregulated kinase activity (28). We observed that the catalytic domain of PKC and  (PKM) was almost exclusively nuclear and that PKM accumulated in nuclei upon TPA treatment, to reach a 3-5-fold higher concentration than in control cells.³ However, this treatment, much like PKC overexpression, also led to strong alteration of the cellular morphology as well as perturbation of the cell cycle, and therefore made a direct correlation between PKC activation/translocation and hRAR inhibition very difficult to establish. However, in these types of experiments, S157A displayed a very low sensitivity to TPA treatment, in opposition to wt hRAR.³ Several nuclear proteins are potential or known substrates for PKCs: LIM-containing proteins (29), p53 (30), WT1 (31), c-myc (32), and nuclear receptors such as T₃R (6), VDR (7), RAR (14 and this report) and RXR.² PKC activation has been reported to inhibit VDR-controlled transcription (33) through a mechanism involving direct phosphorylation of the DBD (8). RAR-mediated transactivation has also been reported to be strongly potentiated by short term phorbol ester treatment in T cells (34). However, similar experiments carried out in HeLa cells demonstrated a strong inhibition of the atRA-induced transcriptional response, in agreement with the proposed inhibition of the retinoid pathway by the AP-1 signaling module.⁴ It is therefore likely that the reported potentiation arises from an AP-1 independent, cell-type specific indirect mechanism.

atRA has been described as an effector able to modulate PKC isozymes expression (35-38) and/or PKC subcellular repartition in several cell lines (39, 40). However, our data neither provided evidence for significant variation of PKC isoform content in atRA-treated cells, nor we were able to document alteration of the cellular partitioning of expressed intact isoforms by indirect immunofluorescence.³ This set of data clearly suggests that interferences between the PKC and retinoid signaling pathways are cell-specific and diverse and that, in this respect, one must distinguish between short term events (AP-1 induction, PKC activation) and long term events (alteration of PKC expression rate). Short term TPA treatment of HeLa cells may activate several signaling pathways involving PKCs, MAP kinases, and c-Jun NH₂-terminal kinase (JNK). PKC down-regulation has been reported to block completely JNK activation by phorbol esters in HeLa cells (41), and MAP kinase overexpression in COS cells did not modify the phosphorylation pattern of hRAR (27). No increase in MAP kinase activity was detected in TPA-treated HeLa cells,³ thus ruling out a potential involvement of these two protein kinases in the observed inactivation of hRAR.

Furthermore, additional cross-talk processes can be also considered based on the nongenomic effects of steroid and of others ligands for nuclear receptors. For example, vitamin D3 has been shown to activate the MAP kinase signaling cascade through activation of PKC (42) and is able to induce subcellular redistribution of calcium-dependent PKCs. Tamoxifen, a therapeutic/chemopreventive nonsteroidal antagonist of estrogen receptor, induces PKC translocation to the membrane and down-regulation of this enzyme through oxidative stress (43). Finally, retinoids, estrogens, and vitamin D3 treatment of cells modulate the rate of expression of PKC isoforms (26, 44-46), underlining a complex network of intertwined, and often antagonistic, signaling pathways eventually controlling cell differentiation, growth, and death.

In conclusion, our findings establish that PKC isoforms are able to phosphorylate hRAR and control its dimerization properties, very likely through T box conformational alteration. The observed inhibition may be of importance in differentiation and proliferation processes during which sustained activation of PKCs is necessary to induce a full biological response to external stimuli.

	FOOTNOTES

^* This work was supported in part by grants from INSERM, Ligue Nationale contre le Cancer, and Association pour la Recherche sur le Cancer. INSERM U 459 is part of IFR 22 (INSERM, Centre Hospitalier Régional Universitaire, Centre Oscar Lambret, and University of Lille 2).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by a fellowship from Région Nord-Pas de Calais and CHRU.

^§ Present address: Laboratory of Developmental Genetics, Rockefeller University, 1230 York Ave., New York NY 10021.

^¶ To whom correspondence should be addressed. Tel.: 33-3-2062-6887; Fax: 33-3-2062-6884; E-mail: p.lefebvre@lille.inserm.fr.

² A. Tahayato, P. Formstecher, and P. Lefebvre, unpublished data.

³ M.-H. Delmotte and P. Lefebvre, unpublished data.

⁴ M.-H. Delmotte, M. Benkoussa, and P. Lefebvre, unpublished data.

	ABBREVIATIONS

The abbreviations used are: DAG, diacylglycerol; PKC, protein kinase C; VDR, vitamin D3 receptor; h, human; DBD, DNA binding domain; MAP, mitogen-activated protein; TPA, 12-O-tetradecanoylphorbol-13-acetate; LBD, ligand binding domain; wt, wild-type; RAR, retinoic acid receptor; RXR, 9-cis-retinoic acid receptor; atRA, all-trans-retinoic acid; PAGE, polyacrylamide gel electrophoresis; GST, glutathione S-transferase; T₃R, thyroid hormone receptor; SMRT, silencing mediator of RAR and T₃R; RIP140, 140-kDa receptor interacting protein; SRC-1, steroid receptor coactivator-1.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. J Delvecchio and J. P Capone Protein kinase C {alpha} modulates liver X receptor {alpha} transactivation J. Endocrinol., April 1, 2008; 197(1): 121 - 130. [Abstract] [Full Text] [PDF]

				M. B. Miranda, R. L. Redner, and D. E. Johnson Inhibition of Src family kinases enhances retinoic acid induced gene expression and myeloid differentiation Mol. Cancer Ther., December 1, 2007; 6(12): 3081 - 3090. [Abstract] [Full Text] [PDF]

				K. Sun, V. Montana, K. Chellappa, Y. Brelivet, D. Moras, Y. Maeda, V. Parpura, B. M. Paschal, and F. M. Sladek Phosphorylation of a Conserved Serine in the Deoxyribonucleic Acid Binding Domain of Nuclear Receptors Alters Intracellular Localization Mol. Endocrinol., June 1, 2007; 21(6): 1297 - 1311. [Abstract] [Full Text] [PDF]

				P. Germain, B. Staels, C. Dacquet, M. Spedding, and V. Laudet Overview of Nomenclature of Nuclear Receptors Pharmacol. Rev., December 1, 2006; 58(4): 685 - 704. [Abstract] [Full Text] [PDF]

				M. G. Rosenfeld, V. V. Lunyak, and C. K. Glass Sensors and signals: a coactivator/corepressor/epigenetic code for integrating signal-dependent programs of transcriptional response Genes & Dev., June 1, 2006; 20(11): 1405 - 1428. [Abstract] [Full Text] [PDF]