JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsunaga, J.
Right arrow Articles by Hearing, V. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsunaga, J.
Right arrow Articles by Hearing, V. J.

J Biol Chem, Vol. 274, Issue 6, 3268-3271, February 5, 1999

COMMUNICATION
Enzyme Activity of Macrophage Migration Inhibitory Factor toward Oxidized Catecholamines*

Jun MatsunagaDagger §, Debasish Sinha§parallel , Lew Pannell**, Chie SantisDagger , Francisco SolanoDagger Dagger , Graeme J. Wistow, and Vincent J. HearingDagger §§

From the Dagger  Pigment Cell Biology Section, Laboratory of Cell Biology, NCI, the  Section on Molecular Structure and Function, National Eye Institute, the ** Laboratory of Bioorganic Chemistry, NIDDK, National Institutes of Health, Bethesda, Maryland 20892 and the Dagger Dagger  Department of Biochemistry, University of Murcia, E-30100 Murcia, Spain

    ABSTRACT
Top
Abstract
Introduction
References

Macrophage migration inhibitory factor (MIF) is a relatively small, 12.5-kDa protein that is structurally related to some isomerases and for which multiple immune and catalytic roles have been proposed. MIF is widely expressed in tissues with particularly high levels in neural tissues. Here we show that MIF is able to catalyze the conversion of 3,4-dihydroxyphenylaminechrome and norepinephrinechrome, toxic quinone products of the neurotransmitter catecholamines 3,4-dihydroxyphenylamine and norepinephrine, to indoledihydroxy derivatives that may serve as precursors to neuromelanin. This raises the possibility that MIF participates in a detoxification pathway for catecholamine products and could therefore have a protective role in neural tissues, which as in Parkinson's disease, may be subject to catecholamine-related cell death.

    INTRODUCTION
Top
Abstract
Introduction
References

Macrophage migration inhibitory factor (MIF)1 was originally named for a lymphokine activity (1-3) but has since emerged in various catalytic and immune guises (4-11). X-ray studies have recently shown that MIF is structurally related to some small isomerases in bacteria (12-15). Furthermore, MIF is about 30% identical in sequence to a protein named D-DOPAchrome tautomerase (D-Dct), which specifically catalyzes the isomerization of the D-isomer of DOPAchrome (DC) (16), a nonphysiological stereoisomer of L-DC, a precursor of melanin, as indicated in Fig. 1. Despite its fairly low sequence identity with D-Dct, MIF itself has been shown to have a nondecarboxylative activity for the same substrate leading to 5,6-dihydroxyindole-2-carboxylic acid (DHICA) (17). MIF has also recently been shown to have phenylpyruvate tautomerase (18) and thiol protein oxidoreductase (19) activities.

DC is chemically related to DOPamine (DN), a sterically inactive intermediate (due to the lack of the carboxyl group at position 2), as well as to norepinephrine (NE) and epinephrine (EP), all of which are neurotransmitters synthesized in catecholaminergic neurons in various parts of the brain. Loss of dopaminergic neurons, particularly in the substantia nigra, is associated with Parkinson's disease (20, 21). DN itself has been shown to induce apoptosis in neurons, thymocytes, and other types of cells (22-25). DN, NE, and EP can be oxidized to toxic quinones, such as DOPaminechrome (DNc), norepinephrinechrome (NEc), and epinephrinechrome (EPc), which are precursors of neuromelanin (26, 27). Neuromelanin is a pigment that accumulates in neurons and glial cells, particularly in the human substantia nigra (28-30). Regulation of neuromelanin biosynthesis at the molecular or biochemical level is poorly understood at this time. Its function in the brain is also unknown, but among other possibilities it may act as a sink for toxic by-products of catecholamine synthesis (26, 31). Whatever its role, neuromelanin content in the substantia nigra is inversely correlated with neurological degeneration in Parkinson's disease.

Although MIF carries a name associated with the immune system, it is widely expressed and is a prominent component of the immunologically privileged ocular lens and brain (4, 32). It is also a delayed early response gene in fibroblasts induced during the proliferative response to growth factors (5). Thus, in addition to any effects MIF has in the immune system, it seems likely that it has important roles elsewhere.

Because MIF is highly expressed in the brain and because several catecholamines have structural similarity to DC (Fig. 1), especially DN, which is sterically inactive, the possibility that one or more of these catecholamines is a physiological substrate for MIF is a tantalizing possibility. Here we characterize the catalytic activity of purified recombinant MIF toward catecholamines and their derivatives. The results demonstrate that MIF has the potential to metabolize several catecholamines and thus may play an important protective role in neural tissues. As such, decline in the level of MIF might contribute to aging and to degenerative processes in the brain and the central nervous system.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic of melanogenic and catecholamine biosynthetic pathways in melanocytes and catecholaminergic neurons.


    EXPERIMENTAL PROCEDURES

Northern Blot Analysis-- Two human brain multiple tissue Northern (MTN II and III) blots (CLONTECH, Palo Alto, CA) were probed with human MIF cDNA. A 382-base pair human MIF cDNA fragment derived by RT-PCR was labeled with 32P by random priming (Amersham Pharmacia Biotech) for use as a probe. Hybridization in Expresshyb (CLONTECH) was carried out at 68 °C for 1 h, washed in 0.1× SSC/0.1% SDS at 50 °C, and autoradiographed for 1-3 days at -70 °C. For normalization, the blot was stripped and reprobed with a beta -actin probe (CLONTECH) following the manufacturer's instructions.

Expression and Purification of MIF-- Recombinant mouse MIF was produced as follows: RT-PCR of mouse lens RNA was used to amplify the coding sequence of mouse MIF using the primers TCCGCCCATATGCCTATGTTCATCGTGAACACC (5' primer) and AGCGGTGGATCCAAGTGGGGCCAGGACTCAAGC (3' primer), which incorporated NdeI (5') and BamHI (3') restriction sites. The cDNA was first cloned into the pCRII vector (InVitrogen, Carlsbad, CA) and sequenced and then subcloned into NdeI and BamHI sites of PET 17b vector (Novagen, Madison, WI). Following the manufacturer's protocol, protein was expressed in BL21 (DE3) pLysS cells and induced with 0.4 mM IPTG for 3 h at 25 °C. The induced cells were washed, and the cells were stored as frozen pellets at -70 °C. The cells were lysed by thawing and sonication with a microtip at a high output setting for two 10-s pulses and centrifuged, and the supernatant (soluble fraction) was dialyzed overnight. The dialyzed sample was centrifuged and concentrated. From the concentrated sample, MIF was purified in the AKTA FPLC system (Amersham Pharmacia Biotech) by ion exchange chromatography on a Q-Sepharose high performance column (Amersham Pharmacia Biotech), followed by gel filtration on a Superdex 75 pg column (Amersham Pharmacia Biotech).

Mass Spectrometry-- Electrospray spectra were run on a Hewlett Packard 1100 MSD fitted with an electrospray source. Samples were applied to a Zorbax 300SB C8-column (2.1 × 150 mm) and eluted with a linear gradient from 0 to 90% acetonitrile in 5% acetic acid. The mass spectrometer was scanned from 600-1600 m/z with a spectrum recorded every 3 s.

Enzymatic Assays-- Use of various substrates and identification of products was performed using HPLC under standard conditions (33). Briefly, isocratic elution with 0.15 M sodium borate buffer (pH 2.5), 25% methanol was used with a C18 column at a flow rate of 0.5 ml/min. Peaks were detected using UV absorbance (280 nm), and pmol were calculated based on the absorption of known standards. L-DOPA, D-DOPA, DN, NE, and EP were purchased from Sigma; the "chrome" derivatives of those substrates were generated as described previously (34). Briefly, substrates were dissolved in 0.1 M phosphate buffer (pH 6.8) and cooled to 4 °C; they were mixed continuously for 3 min on ice with 1 mg/ml silver oxide, then filtered through a 0.22 µm filter, and kept on ice until use. Enzymatic assays were performed with various substrates and purified MIF at 37 °C for 1 h; reactions were stopped by the addition of an equal volume of the acidic HPLC buffer, and 20 µl was injected on the column. DHI and DHICA used as standards were generous gifts of Prof. Shosuke Ito (Fujita Health Sciences University, Nagoya, Japan). Spontaneous oxidation of all substrates was determined in the presence of buffer without MIF and has been subtracted from the results.

    RESULTS

MIF Expression in Brain-- MIF is widely expressed in newborn mouse and fetal human tissues without regard to their immune status (4, 35). To examine expression of MIF mRNA in the adult human brain, Northern blots for different regions of the brain were probed with human MIF cDNA (Fig. 2). High levels of MIF expression were noted in all regions of the adult human brain, including the substantia nigra.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2.   Northern blot analysis of MIF in adult human brain. MIF expression in various regions of the brain as noted was assessed by commercial Northern blots as detailed under "Experimental Procedures." Hybridization with a probe for beta -actin is shown as a loading control.

Preparation and Purification of Recombinant MIF-- Recombinant MIF was prepared to examine catalytic activity(s) toward possible physiologically relevant substrates. Mouse MIF cDNA (4, 5) was amplified by RT-PCR of mouse lens total RNA and was cloned into the pET17b expression vector. Because of the high conservation of residues at the N and C termini of MIF, which may be involved in enzyme activity (12-15), no fusion peptides were included. High yields of MIF protein were obtained after induction by IPTG (Fig. 3A, inset).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Synthesis and purification of recombinant mouse MIF. A, gel filtration of recombinant MIF. Four peaks containing immunoreactive MIF are labeled A, B, C, and D. Inset, SDS-polyacrylamide gel electrophoresis of Escherichia coli pLysS soluble extracts. Lane 1, bacteria containing the "empty" pET17b plasmid; lane 2, uninduced bacteria containing pET17-MIF; lane 3, bacteria with pET17-MIF induced by IPTG; lane A, MIF fraction A; lane B, MIF fraction B; lane C, MIF fraction C; lane D, MIF fraction D. Migrations of molecular mass standards are shown in kDa on the left; and the position of the 12.4-kDa MIF is indicated with an arrow on the right. B, mass spectrometry profile of purified recombinant MIF. Peaks correspond in size to MIF and to Met-MIF as shown.

Recombinant MIF was then isolated from these extracts by fast protein liquid chromatography. Four fractions containing MIF were obtained by gel filtration (Fig. 3A) and were analyzed by SDS-polyacrylamide gel electrophoresis (Fig. 3A, inset), by two-dimensional gel electrophoresis, and by Western immunoblotting (data not shown). Fraction D contained a relatively low level of MIF (apparently in association with some nonprotein absorbance), whereas Fractions A-C contained comparable amounts of MIF. Multiple forms of MIF have been previously reported (36-38). Fractions A-C were subjected to mass spectroscopy (Fraction B is shown in Fig. 3B) and showed identity with the size expected for native mouse MIF (12,372 Da), with an additional minor component 131 Da greater in size, presumably due to failure to remove the N-terminal initiator methionine. All fractions thus contain chemically similar MIF, and our preliminary results show that these fractions are in dynamic equilibrium involving at least monomer and trimer forms. Other studies have implicated trimeric MIF as the principal native form (12-14, 39) although other native forms of MIF may exist (32, 40, 41). Fractions A, B, and C were determined to be enzymatically active in preliminary experiments. In this study, we concentrated on the substrate specificity of Fraction B because ultracentrifugation confirmed that 95% of MIF in that fraction was present as a trimer, the rest being in monomeric form. Fraction B has also been tested for biological activity, including the macrophage migration inhibition capillary assay, and was found to be active (11).

Enzyme Activity-- As expected (16), recombinant MIF was positive for D-Dct activity (Table I), converting D-DC to DHICA (17). The catalytic activity of MIF was highly stereospecific, as previously reported; MIF was not active toward the L-isomer of DC, nor was it active toward the L- or D-forms of DOPA, the precursors of DC (Table I). Because the D-isomer of DC is not likely to be the physiological substrate of MIF (because the occurrence of D-DOPA or a DOPA racemase has never been reported), we next examined the potential catalytic function of MIF toward structurally related catecholamines, including DN, NE, and EP and their dihydroxyindole derivatives, DNc, NEc, and EPc (Table I). Although there was no activity of MIF toward DN, NE, or EP, it was quite active toward DNc and NEc and to a lesser extent EPc, converting them to their natural dihydroxyindole derivatives, DHI, 3,5,6-trihydroxyindole (THI), and 3,5,6-trihydroxyindole-1-methylindole (THMI), respectively.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Enzyme activity of MIF fraction towards catecholamine-related substrates
Purified recombinant MIF was incubated with substrates as noted for 60 min at 37 °C, then acidified, and separated on HPLC as detailed under "Experimental Procedures." Under these HPLC conditions, typical elution times are as follows: DOPA, 4.6 min; DHI, 7.8 min; DHICA 9.1 min; DN, 4.6 min; DNc, 5.0 min; NE, 4.3 min; NEc, 4.5 min; EP, 4.4 min; EPc, 4.7 min; THI, 6.3 min; and THMI, 6.5 min. Absorption by MIF in the absence of substrate and by spontaneous oxidation has been subtracted; results are reported as means ± S.E. in pmol/µg protein/h.


    DISCUSSION

Neural tissue, particularly brain, maintains a relatively high level of MIF mRNA, and our laboratory2 and others (42-44) have shown that MIF has a steady level of expression in neuronal tissues. Because MIF seems to be a multifunctional protein, it could have more than one role there. As evidence accumulates that MIF belongs to an enzyme superfamily (12-19, 45), a catalytic role seems likely. Previously it was found that MIF and the related D-Dct are capable of catalyzing the conversion of D-DC to the indole-quinones DHI or DHICA (16, 17). Although the D-stereoisomer of DC is not known to occur naturally, it is chemically related to other physiologically relevant compounds, such as DN, NE, and EP and their chrome derivatives, which are also derived from tyrosine during catecholamine biosynthesis (Fig. 1). Several of these compounds have great significance for brain function. Most notably, DN and NE are neurotransmitters, and the loss of dopaminergic neurons is associated with Parkinson's disease, a progressive neurological degeneration (20, 21). DN itself has been shown to induce apoptosis in neural cells and thymocytes (22-25). Furthermore, oxidation of DN, NE, or EP leads to the formation of highly toxic quinones, including DNc, NEc, and EPc. These quinones are known to be precursors of neuromelanin, a pigment that accumulates in neurons and astrocytes, particularly in the substantia nigra (26, 27). As shown here, MIF can readily metabolize DNc to DHI, NEc to THI, a DHI-like indole-quinone, and, to a lesser extent, EPc to THMI. All these DHI-like indole-quinones can undergo spontaneous oxidation and polymerization into melanins, although DNc seems to be the most relevant precursor of neuromelanin formation (26, 29). Thus MIF has the potential to contribute to the biosynthesis of neuromelanin. Various roles have been suggested for neuromelanin; however, it seems likely that it acts as a sink for toxic products of catecholamine synthesis, including DNc and NEc (26, 27, 31).

Melanin biosynthesis occurs within melanocytes in skin, hair, and eye and requires the enzymatic activity of tyrosinase and several tyrosinase-related proteins, known as Tyrp1 and Dct (Fig. 1). Interestingly, Dct is a melanocyte-specific enzyme considered to be a "rescue" enzyme essential for melanocyte survival (46, 47). Mutations in Dct that decrease catalytic function affect DHICA production and are generally quite toxic to melanocytes. Melanocytes typically express Dct before any of the other melanogenic enzymes, presumably to minimize such toxicity (48). Catecholamine biosynthesis occurs within neural cells and requires a set of distinct enzymes, including tyrosine hydroxylase, DOPA decarboxylase, DOPamine beta -hydroxylase, and phenylethanol amine-N-methyl transferase, for the production of DN, NE, and EP. Several mechanisms, enzymatic and nonenzymatic, have been proposed to result in the oxidation of these precursors to their cyclized chrome derivatives (27), and MIF should now be included in the neuromelanin biosynthetic pathway, as noted in Fig. 1. It may also have a similar protective function in catecholaminergic neurons in minimizing intracellular cytotoxicity, comparable with Dct function in melanocytes. To emphasize the importance of neuronal protective mechanisms against catecholamines, it is worth noting that other antioxidant activities contributing to prevent the formation of o-quinones derived from catecholamines have been reported that are based on the conjugation of these compounds to GSH catalyzed by class Mu glutathione transferase M2-2 (49). Interestingly, this GST isoenzyme and MIF share a proline residue surrounded by a number of aromatic residues in the N-terminal region, which forms a large hydrophobic pocket that has been proposed to be the active site interacting with the catecholamine substrate (50).

MIF is expressed throughout the adult brain and is therefore widely available to participate in the metabolism of oxidized catecholamines and related compounds. To what extent MIF participates directly in neuromelanin synthesis remains to be seen. However, MIF may have a direct role in helping to detoxify catecholamine-derived quinones, thereby contributing to protection of catecholaminergic neurons and surrounding cells. Indeed, it has been shown that mesencephalic glial cells produce soluble factors that protect dopaminergic neurons from the toxic effects of quinones (51). Conceivably MIF may participate in this detoxification process; for although DHI, the immediate product of the reaction with DNc, is itself cytotoxic (46, 52), it is less soluble than DNc, and its spontaneous polymerization into melanin-like compounds would further reduce its half-life and consequently, its toxicity. In this context, it is of interest to note that one form of Parkinson's disease has recently been mapped to chromosome 22q13 (53), which is close to or at the human MIF locus on human chromosome 22q11.2 (45). Preliminary results suggest that exogenous MIF can protect cultured cells from the toxic effects of catecholamine exposure.3

MIF is expressed in many tissues with no clear connection to catecholamine or to melanin biosynthesis. It also has been identified with a wide range of biological activities, and perhaps these apparently disparate roles are connected. MIF may exert its effects through catalytic activities toward a family of compounds, including the amino acid-derived catecholamines, which, like DN itself, act as important signaling molecules.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ These authors contributed equally to this work.

parallel Present address: Metamorphix Inc, 1450 S. Rolling Rd., Baltimore, MD 21227.

§§ To whom correspondence should be addressed: Pigment Cell Biology Section, Laboratory of Cell Biology, NCI, Bldg. 37, Rm. 1B25, NIH, Bethesda, MD 20892. Tel.: 301-496-1564; Fax: 301-402-8787; E-mail: hearingv{at}nih.gov.

The abbreviations used are: MIF, macrophage migration inhibitory factor; DC, DOPAchrome; Dct, DOPAchrome tautomerase; DHI, 5,6-dihydroxyindole; DHICA, 5,6-dihydroxyindole-2-carboxylic acid; DN, 3,4-dihydroxyphenylamine; DNc, 3,4-dihydroxyphenylaminechrome; DOPA, 3,4-dihydroxyphenylalanine; EP, epinephrine; EPc, epinephrinechrome; NE, norepinephrine; NEc, norepinephrinechrome; THI, 3,5,6-trihydroxyindole; THMI, 3,5,6-trihydroxy-1-methylindole; HPLC, high pressure liquid chromatography; RT-PCR, reverse transcription-polymerase chain reaction; IPTG, isopropyl-1-thio-beta -D-galactopyranoside.

2 D. Sinha, J. Matsunaga, L. Pannell, C. Santis, F. Solano, G. J. Wistow, and V. J. Hearing, unpublished observations.

3 D. Sinha, J. Matsunaga, V. J. Hearing, and G. J. Wistow, unpublished observations.

    REFERENCES
Top
Abstract
Introduction
References

  1. Weiser, W. Y., Temple, P. A., Witek-Giannotti, J. S., Remold, H. G., Clark, S. C., and David, J. R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 7522-7526[Abstract/Free Full Text]
  2. Bloom, B. R., and Bennett, B. (1966) Science 153, 80-82[Abstract/Free Full Text]
  3. David, J. R. (1966) Proc. Natl. Acad. Sci. U. S. A. 56, 72-77[Free Full Text]
  4. Wistow, G. J., Shaughnessy, M. P., Lee, D. C., Hodin, J., and Zelenka, P. S. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1272-1275[Abstract/Free Full Text]
  5. Lanahan, A., Williams, J. B., Sanders, L. K., and Nathans, D. (1992) Mol. Cell. Biol. 12, 3919-3929[Abstract/Free Full Text]
  6. Mikayama, T., Nakano, T., Gomi, H., Nakagawa, Y., Liu, Y. C., Sato, M., Iwamatsu, A., Ishii, Y., Weiser, W. Y., and Ishizaka, K. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10056-10060[Abstract/Free Full Text]
  7. Calandra, T., and Bucala, R. (1997) Crit. Rev. Immunol. 17, 77-88[Medline] [Order article via Infotrieve]
  8. Donnelly, S. C., Haslett, C., Reid, P. T., Grant, I. S., Wallace, W. A., Metz, C. N., Bruce, L. J., and Bucala, R. (1997) Nat. Med. 3, 320-323[CrossRef][Medline] [Order article via Infotrieve]
  9. Waeber, G., Calandra, T., Roduit, R., Haefliger, J. A., Bonny, C., Thompson, N., Thorens, B., Temler, E., Meinhardt, A., Bacher, M., Metz, C. N., Nicod, P., and Bucala, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4782-4787[Abstract/Free Full Text]
  10. Wistow, G. J. (1998) in Encyclopedia of Immunology (Delves, P. J., and Roitt, I. M., eds), pp. 1658-1665, Academic Press, London
  11. Apte, R. S., Sinha, D., Mayhew, E., Wistow, G. J., and Niederkorn, J. Y. (1998) J. Immunol. 160, 5693-5696[Abstract/Free Full Text]
  12. Suzuki, M., Sugimoto, H., Nakagawa, A., Tenaka, I., Nishihira, J., and Sakai, M. (1996) Nat. Struct. Biol. 3, 259-266[CrossRef][Medline] [Order article via Infotrieve]
  13. Sugimoto, H., Suzuki, M., Nakagawa, A., Tanaka, I., and Nishihira, J. (1996) FEBS Lett. 389, 145-148[CrossRef][Medline] [Order article via Infotrieve]
  14. Sun, H.-W., Bernhagen, J., Bucala, R., and Lolis, E. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5191-5196[Abstract/Free Full Text]
  15. Subramanya, H. S., Roper, D. I., Dauter, Z., Dodson, E. J., Davies, G. J., Wilson, K. S., and Wigley, D. B. (1996) Biochemistry 35, 792-802[CrossRef][Medline] [Order article via Infotrieve]
  16. Zhang, M., Aman, P., Grubb, A., Panagopoulos, I., Hindermith, A., Rosengren, E., and Rorsman, H. (1995) FEBS Lett. 373, 203-206[CrossRef][Medline] [Order article via Infotrieve]
  17. Rosengren, E., Bucala, R., Aman, P., Jacobsson, L., Odh, G., Metz, C. N., and Rorsman, H. (1996) Mol. Med. 2, 143-149[Medline] [Order article via Infotrieve]
  18. Rosengren, E., Aman, P., Thelin, S., Hansson, C., Ahlfors, S., Bjork, P., Jacobsson, L., and Rorsman, H. (1997) FEBS Lett. 417, 85-88[CrossRef][Medline] [Order article via Infotrieve]
  19. Kleemann, R., Kapurniotu, A., Frank, R. W., Gessner, A., Mischke, R., Flieger, O., Juttner, S., Brunner, H., and Bernhagen, J. (1998) J. Mol. Biol. 280, 85-102[CrossRef][Medline] [Order article via Infotrieve]
  20. Temlett, J. A. (1996) Curr. Opin. Neurol. 9, 303-307[Medline] [Order article via Infotrieve]
  21. Hastings, T. G., and Zigmond, M. J. (1997) J. Neural Transm. Suppl. 49, 103-110[Medline] [Order article via Infotrieve]
  22. Offen, D., Ziv, I., Barzilai, A., Gorodin, S., Glater, E., Hochman, A., and Melamed, E. (1997) Neurochem. Int. 31, 207-216[CrossRef][Medline] [Order article via Infotrieve]
  23. Shinkai, T., Zhang, L., Mathias, S. A., and Roth, G. S. (1997) J. Neurosci. Res. 47, 393-399[CrossRef][Medline] [Order article via Infotrieve]
  24. Offen, D., Ziv, I., Gorodin, S., Barzilai, A., Malik, Z., and Melamed, E. (1995) Biochim. Biophys. Acta 1268, 171-177[Medline] [Order article via Infotrieve]
  25. Ziv, I., Melamed, E., Nardi, N., Luria, D., Achiron, A., Offen, D., and Barzilai, A. (1994) Neurosci. Lett. 170, 136-140[CrossRef][Medline] [Order article via Infotrieve]
  26. Smythies, J. (1996) Proc. R. Soc. Lond. Ser. B Biol. Sci. 263, 487-489[Medline] [Order article via Infotrieve]
  27. d'Ischia, M., and Prota, G. (1997) Pigment Cell Res. 10, 370-376[CrossRef][Medline] [Order article via Infotrieve]
  28. Zecca, L., Mecacci, C., Seraglia, R., and Parati, E. (1992) Biochim. Biophys. Acta 1138, 6-10[Medline] [Order article via Infotrieve]
  29. Enochs, W. S., Nilges, M. J., and Swartz, H. M. (1993) J. Neurochem. 61, 68-79[CrossRef][Medline] [Order article via Infotrieve]
  30. Prota, G., and d'Ischia, M. (1993) Pigment Cell Res. 6, 333-335[CrossRef][Medline] [Order article via Infotrieve]
  31. Lindquist, N. G., Larsson, B. S., and Lyden-Sokolowski, A. (1987) Pigment Cell Res. 1, 133-136[CrossRef][Medline] [Order article via Infotrieve]
  32. Galat, A., Riviere, S., and Bouet, F. (1993) FEBS Lett. 319, 233-236[CrossRef][Medline] [Order article via Infotrieve]
  33. Palumbo, A., d'Ischia, M., Misuraca, G., and Prota, G. (1987) Biochim. Biophys. Acta 925, 203-209[Medline] [Order article via Infotrieve]
  34. Pawelek, J. M., Körner, A. M., Bergstrom, A., and Bolognia, J. (1980) Nature 286, 617-619[CrossRef][Medline] [Order article via Infotrieve]
  35. Paralkar, V., and Wistow, G. J. (1994) Genomics 19, 48-51[CrossRef][Medline] [Order article via Infotrieve]
  36. Galat, A., Riviere, S., Bouet, F., and Menez, A. (1994) Eur. J. Biochem. 224, 417-421[Medline] [Order article via Infotrieve]
  37. Mischke, R., Kleemann, R., Brunner, H., and Bernhagen, J. (1998) FEBS Lett. 427, 85-90[CrossRef][Medline] [Order article via Infotrieve]
  38. Magi, B., Bini, L., Liberatori, S., Marzocchi, B., Raggiaschi, R., Archuri, F., Tripodi, S. A., Cintorino, M., Tosi, P., and Pallini, V. (1998) Electrophoresis 19, 2010-2013[CrossRef][Medline] [Order article via Infotrieve]
  39. Sun, H.-W., Swope, M., Cinquina, C., Bedarkar, S., Bernhagen, J., Bucala, R., and Lolis, E. (1996) Protein Eng. 9, 631-635[Abstract/Free Full Text]
  40. Mozetic-Francky, B., Cotic, V., Ritonja, A., Zerovnik, E., and Francky, A. (1997) Protein Expression Purif. 9, 115-124[CrossRef][Medline] [Order article via Infotrieve]
  41. Mischke, R., Gessner, A., Kapurniotu, A., Juttner, S., Kleemann, R., Brunner, H., and Bernhagen, J. (1997) FEBS Lett. 414, 226-232[CrossRef][Medline] [Order article via Infotrieve]
  42. Nishibori, M., Nakaya, N., Tahara, A., Kawabata, M., Mori, S., and Saeki, K. (1996) Neurosci. Lett. 213, 193-196[Medline] [Order article via Infotrieve]
  43. Nishibori, M., Nakaya, N., Mori, S., and Saeki, K. (1997) Brain. Res. 758, 259-262[CrossRef][Medline] [Order article via Infotrieve]
  44. Bacher, M., Meinhardt, A., Lan, H. Y., Dhabhar, F. S., Mu, W., Metz, C. N., Chesney, J. A., Gemsa, D., Donnelly, T., Atkins, R. C., and Bucala, R. (1998) Mol. Med. 4, 217-230[Medline] [Order article via Infotrieve]
  45. Esumi, N., Budarf, M., Ciccarelli, L., Sellinger, B., Kozak, C. A., and Wistow, G. J. (1998) Mamm. Genome 9, 753-757[CrossRef][Medline] [Order article via Infotrieve]
  46. Urabe, K., Aroca, P., Tsukamoto, K., Mascagna, D., Palumbo, A., Prota, G., and Hearing, V. J. (1994) Biochim. Biophys. Acta 1221, 272-278[Medline] [Order article via Infotrieve]
  47. Tsukamoto, K., Jackson, I. J., Urabe, K., Montague, P. M., and Hearing, V. J. (1992) EMBO J. 11, 519-526[Medline] [Order article via Infotrieve]
  48. Steel, K. P., Davidson, D. R., and Jackson, I. J. (1992) Development 115, 1111-1119[Abstract]
  49. Segura-Aguilar, J., Baez, S., Widersten, M., Welch, C. J., and Mannervik, B. (1997) J. Biol. Chem. 272, 5727-5731[Abstract/Free Full Text]
  50. Suzuki, M., Sugimoto, H., Tanaka, I., and Nishihara, J. (1997) J. Biochem. (Tokyo) 122, 1040-1045[Abstract/Free Full Text]
  51. Mena, M. A., Casarejos, M. J., Carazo, A., Paino, C. L., and de Yebenes, G. (1996) Neuroreport 7, 441-445[Medline] [Order article via Infotrieve]
  52. Pawelek, J. M., and Lerner, A. B. (1978) Nature 276, 627-628[CrossRef]
  53. Wilhelmsen, K., Mirel, D., Marder, K., Berstein, M., Naini, A., Leal, S. M., Cote, L. J., Tang, M. X., Freyer, G., Graziano, J., and Mayeux, R. (1997) Ann. Neurol. 41, 813-817[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
X. Zang, P. Taylor, J. M. Wang, D. J. Meyer, A. L. Scott, M. D. Walkinshaw, and R. M. Maizels
Homologues of Human Macrophage Migration Inhibitory Factor from a Parasitic Nematode. GENE CLONING, PROTEIN ACTIVITY, AND CRYSTAL STRUCTURE
J. Biol. Chem., November 8, 2002; 277(46): 44261 - 44267.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. B. Lubetsky, A. Dios, J. Han, B. Aljabari, B. Ruzsicska, R. Mitchell, E. Lolis, and Y. Al-Abed
The Tautomerase Active Site of Macrophage Migration Inhibitory Factor Is a Potential Target for Discovery of Novel Anti-inflammatory Agents
J. Biol. Chem., July 5, 2002; 277(28): 24976 - 24982.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. M. Isidori, G. A. Kaltsas, M. Korbonits, M. Pyle, M. Gueorguiev, A. Meinhardt, C. Metz, N. Petrovsky, V. Popovic, R. Bucala, et al.
Response of Serum Macrophage Migration Inhibitory Factor Levels to Stimulation or Suppression of the Hypothalamo-Pituitary-Adrenal Axis in Normal Subjects and Patients with Cushing's Disease
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1834 - 1840.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. D. Senter, Y. Al-Abed, C. N. Metz, F. Benigni, R. A. Mitchell, J. Chesney, J. Han, C. G. Gartner, S. D. Nelson, G. J. Todaro, et al.
Inhibition of macrophage migration inhibitory factor (MIF) tautomerase and biological activities by acetaminophen metabolites
PNAS, January 1, 2002; (2002) 11569399.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
L Zecca, D Tampellini, M Gerlach, P Riederer, R G Fariello, and D Sulzer
Substantia nigra neuromelanin: structure, synthesis, and molecular behaviour
Mol. Pathol., December 1, 2001; 54(6): 414 - 418.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Busche, S. Gallinat, M. A. Fleegal, M. K. Raizada, and C. Sumners
Novel Role of Macrophage Migration Inhibitory Factor in Angiotensin II Regulation of Neuromodulation in Rat Brain
Endocrinology, November 1, 2001; 142(11): 4623 - 4630.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. D. Senter, Y. Al-Abed, C. N. Metz, F. Benigni, R. A. Mitchell, J. Chesney, J. Han, C. G. Gartner, S. D. Nelson, G. J. Todaro, et al.
Inhibition of macrophage migration inhibitory factor (MIF) tautomerase and biological activities by acetaminophen metabolites
PNAS, January 8, 2002; 99(1): 144 - 149.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsunaga, J.
Right arrow Articles by Hearing, V. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsunaga, J.
Right arrow Articles by Hearing, V. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.