![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 6, 3268-3271, February 5, 1999
§,
,
,
,
§§
From the Macrophage migration inhibitory factor (MIF) is a
relatively small, 12.5-kDa protein that is structurally related to some isomerases and for which multiple immune and catalytic roles have been
proposed. MIF is widely expressed in tissues with particularly high
levels in neural tissues. Here we show that MIF is able to catalyze the
conversion of 3,4-dihydroxyphenylaminechrome and norepinephrinechrome, toxic quinone products of the neurotransmitter catecholamines 3,4-dihydroxyphenylamine and norepinephrine, to indoledihydroxy derivatives that may serve as precursors to
neuromelanin. This raises the possibility that MIF participates in a
detoxification pathway for catecholamine products and could therefore
have a protective role in neural tissues, which as in Parkinson's
disease, may be subject to catecholamine-related cell death.
Macrophage migration inhibitory factor
(MIF)1 was originally named for a
lymphokine activity (1-3) but has since emerged in various catalytic
and immune guises (4-11). X-ray studies have recently shown that MIF
is structurally related to some small isomerases in bacteria (12-15).
Furthermore, MIF is about 30% identical in sequence to a protein named
D-DOPAchrome tautomerase (D-Dct), which
specifically catalyzes the isomerization of the D-isomer of
DOPAchrome (DC) (16), a nonphysiological stereoisomer of L-DC, a precursor of melanin, as indicated in Fig. 1.
Despite its fairly low sequence identity with D-Dct, MIF
itself has been shown to have a nondecarboxylative activity for the
same substrate leading to 5,6-dihydroxyindole-2-carboxylic acid (DHICA)
(17). MIF has also recently been shown to have phenylpyruvate
tautomerase (18) and thiol protein oxidoreductase (19) activities.
DC is chemically related to DOPamine (DN), a sterically inactive
intermediate (due to the lack of the carboxyl group at position 2), as
well as to norepinephrine (NE) and epinephrine (EP), all of which are
neurotransmitters synthesized in catecholaminergic neurons in various
parts of the brain. Loss of dopaminergic neurons, particularly in the
substantia nigra, is associated with Parkinson's disease (20, 21). DN
itself has been shown to induce apoptosis in neurons, thymocytes, and
other types of cells (22-25). DN, NE, and EP can be oxidized to toxic
quinones, such as DOPaminechrome (DNc), norepinephrinechrome (NEc),
and epinephrinechrome (EPc), which are precursors of neuromelanin (26,
27). Neuromelanin is a pigment that accumulates in neurons and glial
cells, particularly in the human substantia nigra (28-30). Regulation
of neuromelanin biosynthesis at the molecular or biochemical level is
poorly understood at this time. Its function in the brain is also
unknown, but among other possibilities it may act as a sink for toxic
by-products of catecholamine synthesis (26, 31). Whatever its role,
neuromelanin content in the substantia nigra is inversely correlated
with neurological degeneration in Parkinson's disease.
Although MIF carries a name associated with the immune system, it is
widely expressed and is a prominent component of the immunologically
privileged ocular lens and brain (4, 32). It is also a delayed early
response gene in fibroblasts induced during the proliferative response
to growth factors (5). Thus, in addition to any effects MIF has in the
immune system, it seems likely that it has important roles elsewhere.
Because MIF is highly expressed in the brain and because several
catecholamines have structural similarity to DC (Fig.
1), especially DN, which is sterically
inactive, the possibility that one or more of these catecholamines is a
physiological substrate for MIF is a tantalizing possibility. Here we
characterize the catalytic activity of purified recombinant MIF toward
catecholamines and their derivatives. The results demonstrate that MIF
has the potential to metabolize several catecholamines and thus may
play an important protective role in neural tissues. As such, decline in the level of MIF might contribute to aging and to degenerative processes in the brain and the central nervous system.
Northern Blot Analysis--
Two human brain multiple tissue
Northern (MTN II and III) blots (CLONTECH, Palo
Alto, CA) were probed with human MIF cDNA. A 382-base pair human
MIF cDNA fragment derived by RT-PCR was labeled with
32P by random priming (Amersham Pharmacia Biotech) for use
as a probe. Hybridization in Expresshyb (CLONTECH)
was carried out at 68 °C for 1 h, washed in 0.1× SSC/0.1% SDS
at 50 °C, and autoradiographed for 1-3 days at Expression and Purification of MIF--
Recombinant mouse MIF
was produced as follows: RT-PCR of mouse lens RNA was used to amplify
the coding sequence of mouse MIF using the primers
TCCGCCCATATGCCTATGTTCATCGTGAACACC (5' primer) and
AGCGGTGGATCCAAGTGGGGCCAGGACTCAAGC (3' primer), which incorporated NdeI (5') and BamHI (3') restriction sites. The
cDNA was first cloned into the pCRII vector (InVitrogen, Carlsbad,
CA) and sequenced and then subcloned into NdeI and
BamHI sites of PET 17b vector (Novagen, Madison, WI).
Following the manufacturer's protocol, protein was expressed in BL21
(DE3) pLysS cells and induced with 0.4 mM IPTG for 3 h
at 25 °C. The induced cells were washed, and the cells were stored
as frozen pellets at Mass Spectrometry--
Electrospray spectra were run on a
Hewlett Packard 1100 MSD fitted with an electrospray source. Samples
were applied to a Zorbax 300SB C8-column (2.1 × 150 mm) and
eluted with a linear gradient from 0 to 90% acetonitrile in 5% acetic
acid. The mass spectrometer was scanned from 600-1600
m/z with a spectrum recorded every 3 s.
Enzymatic Assays--
Use of various substrates and
identification of products was performed using HPLC under standard
conditions (33). Briefly, isocratic elution with 0.15 M
sodium borate buffer (pH 2.5), 25% methanol was used with a C18 column
at a flow rate of 0.5 ml/min. Peaks were detected using UV absorbance
(280 nm), and pmol were calculated based on the absorption of known
standards. L-DOPA, D-DOPA, DN, NE, and EP were
purchased from Sigma; the "chrome" derivatives of those substrates
were generated as described previously (34). Briefly, substrates were
dissolved in 0.1 M phosphate buffer (pH 6.8) and cooled to
4 °C; they were mixed continuously for 3 min on ice with 1 mg/ml
silver oxide, then filtered through a 0.22 µm filter, and kept on ice
until use. Enzymatic assays were performed with various substrates and
purified MIF at 37 °C for 1 h; reactions were stopped by the
addition of an equal volume of the acidic HPLC buffer, and 20 µl was
injected on the column. DHI and DHICA used as standards were generous
gifts of Prof. Shosuke Ito (Fujita Health Sciences University, Nagoya, Japan). Spontaneous oxidation of all substrates was determined in the
presence of buffer without MIF and has been subtracted from the results.
MIF Expression in Brain--
MIF is widely expressed in newborn
mouse and fetal human tissues without regard to their immune status (4,
35). To examine expression of MIF mRNA in the adult human brain,
Northern blots for different regions of the brain were probed with
human MIF cDNA (Fig. 2). High levels of
MIF expression were noted in all regions of the adult human brain,
including the substantia nigra.
Preparation and Purification of Recombinant MIF--
Recombinant
MIF was prepared to examine catalytic activity(s) toward possible
physiologically relevant substrates. Mouse MIF cDNA (4, 5) was
amplified by RT-PCR of mouse lens total RNA and was cloned into the
pET17b expression vector. Because of the high conservation of residues
at the N and C termini of MIF, which may be involved in enzyme activity
(12-15), no fusion peptides were included. High yields of MIF protein
were obtained after induction by IPTG (Fig.
3A, inset).
Recombinant MIF was then isolated from these extracts by fast protein
liquid chromatography. Four fractions containing MIF were obtained by
gel filtration (Fig. 3A) and were analyzed by SDS-polyacrylamide gel electrophoresis (Fig. 3A,
inset), by two-dimensional gel electrophoresis, and by
Western immunoblotting (data not shown). Fraction D contained a
relatively low level of MIF (apparently in association with some
nonprotein absorbance), whereas Fractions A-C contained comparable
amounts of MIF. Multiple forms of MIF have been previously reported
(36-38). Fractions A-C were subjected to mass spectroscopy (Fraction
B is shown in Fig. 3B) and showed identity with the size
expected for native mouse MIF (12,372 Da), with an additional minor
component 131 Da greater in size, presumably due to failure to remove
the N-terminal initiator methionine. All fractions thus contain
chemically similar MIF, and our preliminary results show that these
fractions are in dynamic equilibrium involving at least monomer and
trimer forms. Other studies have implicated trimeric MIF as the
principal native form (12-14, 39) although other native forms of MIF
may exist (32, 40, 41). Fractions A, B, and C were determined to be
enzymatically active in preliminary experiments. In this study, we
concentrated on the substrate specificity of Fraction B because
ultracentrifugation confirmed that 95% of MIF in that fraction was
present as a trimer, the rest being in monomeric form. Fraction B has
also been tested for biological activity, including the macrophage
migration inhibition capillary assay, and was found to be active
(11).
Enzyme Activity--
As expected (16), recombinant MIF was
positive for D-Dct activity (Table
I), converting D-DC to DHICA
(17). The catalytic activity of MIF was highly stereospecific, as
previously reported; MIF was not active toward the L-isomer
of DC, nor was it active toward the L- or
D-forms of DOPA, the precursors of DC (Table I). Because
the D-isomer of DC is not likely to be the physiological substrate of MIF (because the occurrence of D-DOPA or a
DOPA racemase has never been reported), we next examined the potential
catalytic function of MIF toward structurally related catecholamines,
including DN, NE, and EP and their dihydroxyindole derivatives, DNc,
NEc, and EPc (Table I). Although there was no activity of MIF
toward DN, NE, or EP, it was quite active toward DNc and NEc and
to a lesser extent EPc, converting them to their natural
dihydroxyindole derivatives, DHI, 3,5,6-trihydroxyindole (THI), and
3,5,6-trihydroxyindole-1-methylindole (THMI), respectively.
Neural tissue, particularly brain, maintains a relatively high
level of MIF mRNA, and our
laboratory2 and others (42-44)
have shown that MIF has a steady level of expression in neuronal
tissues. Because MIF seems to be a multifunctional protein, it could
have more than one role there. As evidence accumulates that MIF belongs
to an enzyme superfamily (12-19, 45), a catalytic role seems likely.
Previously it was found that MIF and the related D-Dct are
capable of catalyzing the conversion of D-DC to the indole-quinones DHI or DHICA (16, 17). Although the
D-stereoisomer of DC is not known to occur naturally, it is
chemically related to other physiologically relevant compounds, such as
DN, NE, and EP and their chrome derivatives, which are also derived
from tyrosine during catecholamine biosynthesis (Fig. 1). Several of
these compounds have great significance for brain function. Most
notably, DN and NE are neurotransmitters, and the loss of dopaminergic
neurons is associated with Parkinson's disease, a progressive
neurological degeneration (20, 21). DN itself has been shown to induce apoptosis in neural cells and thymocytes (22-25). Furthermore, oxidation of DN, NE, or EP leads to the formation of highly toxic quinones, including DNc, NEc, and EPc. These quinones are known to be
precursors of neuromelanin, a pigment that accumulates in neurons and
astrocytes, particularly in the substantia nigra (26, 27). As shown
here, MIF can readily metabolize DNc to DHI, NEc to THI, a DHI-like
indole-quinone, and, to a lesser extent, EPc to THMI. All these
DHI-like indole-quinones can undergo spontaneous oxidation and
polymerization into melanins, although DNc seems to be the most
relevant precursor of neuromelanin formation (26, 29). Thus MIF has the
potential to contribute to the biosynthesis of neuromelanin. Various
roles have been suggested for neuromelanin; however, it seems likely
that it acts as a sink for toxic products of catecholamine synthesis,
including DNc and NEc (26, 27, 31).
Melanin biosynthesis occurs within melanocytes in skin, hair, and eye
and requires the enzymatic activity of tyrosinase and several
tyrosinase-related proteins, known as Tyrp1 and Dct (Fig. 1).
Interestingly, Dct is a melanocyte-specific enzyme considered to be a
"rescue" enzyme essential for melanocyte survival (46, 47).
Mutations in Dct that decrease catalytic function affect DHICA production and are generally quite toxic to melanocytes. Melanocytes typically express Dct before any of the other melanogenic enzymes, presumably to minimize such toxicity (48). Catecholamine biosynthesis occurs within neural cells and requires a set of distinct
enzymes, including tyrosine hydroxylase, DOPA decarboxylase, DOPamine
MIF is expressed throughout the adult brain and is therefore widely
available to participate in the metabolism of oxidized catecholamines
and related compounds. To what extent MIF participates directly in
neuromelanin synthesis remains to be seen. However, MIF may have a
direct role in helping to detoxify catecholamine-derived quinones,
thereby contributing to protection of catecholaminergic neurons and
surrounding cells. Indeed, it has been shown that mesencephalic glial
cells produce soluble factors that protect dopaminergic neurons from
the toxic effects of quinones (51). Conceivably MIF may participate in
this detoxification process; for although DHI, the immediate product of
the reaction with DNc, is itself cytotoxic (46, 52), it is less soluble
than DNc, and its spontaneous polymerization into melanin-like
compounds would further reduce its half-life and consequently, its
toxicity. In this context, it is of interest to note that one form of
Parkinson's disease has recently been mapped to chromosome 22q13 (53),
which is close to or at the human MIF locus on human
chromosome 22q11.2 (45). Preliminary results suggest that exogenous MIF
can protect cultured cells from the toxic effects of catecholamine
exposure.3
MIF is expressed in many tissues with no clear connection to
catecholamine or to melanin biosynthesis. It also has been identified with a wide range of biological activities, and perhaps these apparently disparate roles are connected. MIF may exert its effects through catalytic activities toward a family of compounds, including the amino acid-derived catecholamines, which, like DN itself, act as
important signaling molecules.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
These authors contributed equally to this work.
§§
To whom correspondence should be addressed: Pigment Cell Biology
Section, Laboratory of Cell Biology, NCI, Bldg. 37, Rm. 1B25, NIH,
Bethesda, MD 20892. Tel.: 301-496-1564; Fax: 301-402-8787; E-mail:
hearingv{at}nih.gov.
The abbreviations used are:
MIF, macrophage
migration inhibitory factor; DC, DOPAchrome; Dct, DOPAchrome
tautomerase; DHI, 5,6-dihydroxyindole; DHICA, 5,6-dihydroxyindole-2-carboxylic acid; DN, 3,4-dihydroxyphenylamine; DNc, 3,4-dihydroxyphenylaminechrome; DOPA, 3,4-dihydroxyphenylalanine; EP, epinephrine; EPc, epinephrinechrome; NE, norepinephrine; NEc, norepinephrinechrome; THI, 3,5,6-trihydroxyindole; THMI, 3,5,6-trihydroxy-1-methylindole; HPLC, high pressure liquid
chromatography; RT-PCR, reverse transcription-polymerase chain
reaction; IPTG, isopropyl-1-thio- 2
D. Sinha, J. Matsunaga, L. Pannell, C. Santis,
F. Solano, G. J. Wistow, and V. J. Hearing, unpublished observations.
3
D. Sinha, J. Matsunaga, V. J. Hearing, and G. J. Wistow, unpublished observations.
Pigment Cell Biology Section,
Department of Biochemistry,
University of Murcia, E-30100 Murcia, Spain
![]()
ABSTRACT
Top
Abstract
Introduction
References
![]()
INTRODUCTION
Top
Abstract
Introduction
References

View larger version (36K):
[in a new window]
Fig. 1.
Schematic of melanogenic and catecholamine
biosynthetic pathways in melanocytes and catecholaminergic
neurons.
![]()
EXPERIMENTAL PROCEDURES
70 °C. For
normalization, the blot was stripped and reprobed with a
-actin
probe (CLONTECH) following the manufacturer's instructions.
70 °C. The cells were lysed by thawing and
sonication with a microtip at a high output setting for two 10-s pulses
and centrifuged, and the supernatant (soluble fraction) was dialyzed
overnight. The dialyzed sample was centrifuged and concentrated. From
the concentrated sample, MIF was purified in the AKTA FPLC system
(Amersham Pharmacia Biotech) by ion exchange chromatography on a
Q-Sepharose high performance column (Amersham Pharmacia Biotech),
followed by gel filtration on a Superdex 75 pg column (Amersham
Pharmacia Biotech).
![]()
RESULTS

View larger version (68K):
[in a new window]
Fig. 2.
Northern blot analysis of MIF in adult human
brain. MIF expression in various regions of the brain as noted was
assessed by commercial Northern blots as detailed under "Experimental
Procedures." Hybridization with a probe for
-actin is shown as a
loading control.

View larger version (35K):
[in a new window]
Fig. 3.
Synthesis and purification of recombinant
mouse MIF. A, gel filtration of recombinant MIF. Four
peaks containing immunoreactive MIF are labeled A,
B, C, and D. Inset,
SDS-polyacrylamide gel electrophoresis of Escherichia coli
pLysS soluble extracts. Lane 1, bacteria containing the
"empty" pET17b plasmid; lane 2, uninduced bacteria
containing pET17-MIF; lane 3, bacteria with pET17-MIF
induced by IPTG; lane A, MIF fraction A; lane B,
MIF fraction B; lane C, MIF fraction C; lane D,
MIF fraction D. Migrations of molecular mass standards are shown in kDa
on the left; and the position of the 12.4-kDa MIF is
indicated with an arrow on the right.
B, mass spectrometry profile of purified recombinant MIF.
Peaks correspond in size to MIF and to Met-MIF as shown.
Enzyme activity of MIF fraction towards catecholamine-related
substrates
![]()
DISCUSSION
-hydroxylase, and phenylethanol amine-N-methyl
transferase, for the production of DN, NE, and EP. Several mechanisms,
enzymatic and nonenzymatic, have been proposed to result in the
oxidation of these precursors to their cyclized chrome derivatives
(27), and MIF should now be included in the neuromelanin biosynthetic pathway, as noted in Fig. 1. It may also have a similar protective function in catecholaminergic neurons in minimizing intracellular cytotoxicity, comparable with Dct function in melanocytes. To emphasize
the importance of neuronal protective mechanisms against catecholamines, it is worth noting that other antioxidant activities contributing to prevent the formation of o-quinones derived
from catecholamines have been reported that are based on the
conjugation of these compounds to GSH catalyzed by class Mu glutathione
transferase M2-2 (49). Interestingly, this GST isoenzyme and MIF share
a proline residue surrounded by a number of aromatic residues in the
N-terminal region, which forms a large hydrophobic pocket that has been
proposed to be the active site interacting with the catecholamine
substrate (50).
![]()
FOOTNOTES
Present address: Metamorphix Inc, 1450 S. Rolling Rd.,
Baltimore, MD 21227.
-D-galactopyranoside.
![]()
REFERENCES
Top
Abstract
Introduction
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
X. Zang, P. Taylor, J. M. Wang, D. J. Meyer, A. L. Scott, M. D. Walkinshaw, and R. M. Maizels Homologues of Human Macrophage Migration Inhibitory Factor from a Parasitic Nematode. GENE CLONING, PROTEIN ACTIVITY, AND CRYSTAL STRUCTURE J. Biol. Chem., November 8, 2002; 277(46): 44261 - 44267. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Lubetsky, A. Dios, J. Han, B. Aljabari, B. Ruzsicska, R. Mitchell, E. Lolis, and Y. Al-Abed The Tautomerase Active Site of Macrophage Migration Inhibitory Factor Is a Potential Target for Discovery of Novel Anti-inflammatory Agents J. Biol. Chem., July 5, 2002; 277(28): 24976 - 24982. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Isidori, G. A. Kaltsas, M. Korbonits, M. Pyle, M. Gueorguiev, A. Meinhardt, C. Metz, N. Petrovsky, V. Popovic, R. Bucala, et al. Response of Serum Macrophage Migration Inhibitory Factor Levels to Stimulation or Suppression of the Hypothalamo-Pituitary-Adrenal Axis in Normal Subjects and Patients with Cushing's Disease J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1834 - 1840. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Senter, Y. Al-Abed, C. N. Metz, F. Benigni, R. A. Mitchell, J. Chesney, J. Han, C. G. Gartner, S. D. Nelson, G. J. Todaro, et al. Inhibition of macrophage migration inhibitory factor (MIF) tautomerase and biological activities by acetaminophen metabolites PNAS, January 1, 2002; (2002) 11569399. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Zecca, D Tampellini, M Gerlach, P Riederer, R G Fariello, and D Sulzer Substantia nigra neuromelanin: structure, synthesis, and molecular behaviour Mol. Pathol., December 1, 2001; 54(6): 414 - 418. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Busche, S. Gallinat, M. A. Fleegal, M. K. Raizada, and C. Sumners Novel Role of Macrophage Migration Inhibitory Factor in Angiotensin II Regulation of Neuromodulation in Rat Brain Endocrinology, November 1, 2001; 142(11): 4623 - 4630. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Senter, Y. Al-Abed, C. N. Metz, F. Benigni, R. A. Mitchell, J. Chesney, J. Han, C. G. Gartner, S. D. Nelson, G. J. Todaro, et al. Inhibition of macrophage migration inhibitory factor (MIF) tautomerase and biological activities by acetaminophen metabolites PNAS, January 8, 2002; 99(1): 144 - 149. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |