|
J Biol Chem, Vol. 274, Issue 6, 3300-3307, February 5, 1999
Identification of an RcsA/RcsB Recognition Motif in the Promoters
of Exopolysaccharide Biosynthetic Operons from Erwinia
amylovora and Pantoea stewartii Subspecies
stewartii*
Markus
Wehland ,
Clemens
Kiecker ,
David L.
Coplin§,
Olaf
Kelm ,
Wolfram
Saenger , and
Frank
Bernhard ¶
From the Freie Universität Berlin, Institut
für Kristallographie, Takustrasse 6, D-14195 Berlin, Germany and § Department of Plant
Pathology, the Ohio State University, Columbus, Ohio 43210-1087
 |
ABSTRACT |
The regulation of capsule synthesis (Rcs)
regulatory network is responsible for the induction of
exopolysaccharide biosynthesis in many enterobacterial species. We have
previously shown that two transcriptional regulators, RcsA and RcsB, do
bind as a heterodimer to the promoter of amsG, the first
reading frame in the operon for amylovoran biosynthesis in the plant
pathogenic bacterium Erwinia amylovora. We now identified a
23-base pair fragment from position 555 to 533 upstream of the
translational start site of amsG as sufficient for the
specific binding of the Rcs proteins. In addition, we could detect an
RcsA/RcsB-binding site in a corresponding region of the promoter of
cpsA, the homologous counterpart to the E. amylovora
amsG gene in the operon for stewartan biosynthesis of
Pantoea stewartii. The specificity and characteristic
parameters of the protein-DNA interaction were analyzed by DNA
retardation, protein-DNA cross-linking, and directed mutagenesis. The
central core motif TRVGAAWAWTSYG of the amsG promoter was
found to be most important for the specific interaction with RcsA/RcsB,
as evaluated by mutational analysis and an in vitro
selection approach. The wild type P. stewartii Rcs binding
motif is degenerated in two positions and an up-mutation according to
our consensus motif resulted in about a 5-fold increased affinity of
the RcsA/RcsB proteins.
 |
INTRODUCTION |
The ability to produce capsules or exopolysaccharides
(EPS)1 is characteristic for
most bacterial species. General benefits of encapsulation are the
prevention of desiccation, advantages in the degradation of substrates
by adherence, and the binding of toxins and nutrients (1). EPS is
furthermore an essential determinant for the bacterial virulence in
several host-pathogen interactions (2), e.g. during
infections by the plant pathogenic bacteria Erwinia
amylovora and Pantoea stewartii subsp.
stewartii (Ref. 3; formerly Erwinia stewartii).
The dense layer of EPS is supposed to shield invading microorganisms
against host defense systems like the hypersensitive response reaction.
It might further prevent cell aggregation by agglutinins, and it has
been reported to accelerate the wilting of infected plants by plugging
xylem vessels (4).
The EPS structure is highly variable, and different types have been
classified by molecular weight and structural properties (5). The
biosynthesis of the high molecular weight EPS type IA in several
enterobacterial species is modulated by the Rcs (regulation
of capsule synthesis) regulatory network (6).
Prominent examples are the regulation of colanic acid and many K
antigens in Escherichia coli (7, 8), Klebsiella
aerogenes (9-11), and Salmonella typhi (12). In plant
pathogenic bacteria, the regulation of amylovoran synthesis in E. amylovora (13-16) and stewartan synthesis in P. stewartii (17) by Rcs proteins has been reported. EPS biosynthesis
is supposed to be induced after perception of external signals by
membrane-located sensors like the RcsC protein. The signal might be
subsequently transduced by phosphorylation of the response regulator
RcsB, and the two proteins represent a typical bacterial two-component
system (18). High levels of EPS biosynthesis require the coinduction by
the unstable protein RcsA (7, 19, 20). RcsA and RcsB are grouped into
the LuxR class of bacterial regulators based on the sequence of their
C-terminal helix-turn-helix DNA binding motifs.
The structural genes for the biosynthesis of amylovoran in E. amylovora, stewartan in P. stewartii, and colanic acid
in E. coli are clustered and regulated as operons
(21-23).2 The essential
regulatory region upstream of the first open reading frame of the
ams operon covers an unusually large region of about 700 bp
(21). The transcriptional start site of the homologous cps
operon of E. coli was mapped at 340 bp upstream of the
translational start site (23). The transcriptional units of EPS operons
may therefore contain large leader regions of yet unknown function. We
recently reported the binding of RcsA and RcsB proteins from E. amylovora and E. coli to a putative promoter region
located between 578 and 501 relative to the translational start
site of amsG, the first reading frame in the ams
operon (24). We could demonstrate the binding of RcsA and RcsB as a
heterodimer and that RcsB, but not RcsA, is able to bind alone at
higher concentrations.
In this report, we could confine the essential Rcs-binding region, and
we present the recognition motif for the RcsA/RcsB dimer at the
amsG promoter of E. amylovora. We could
furthermore identify an RcsA/RcsB-binding site at the corresponding
location in the P. stewartii cpsA promoter. Our results give
evidence that the binding of RcsA/RcsB to promoters in EPS operons
could be a common principle for triggering the capsule synthesis in the Rcs regulatory pathway.
 |
MATERIALS AND METHODS |
Strains, Plasmids, and Growth Conditions--
The bacterial
strains and plasmids used in this work are described in Table
I. Bacterial cells were routinely grown
in LB broth at 37 °C, and ampicillin was added, if appropriate, to a final concentration of 100 µg/ml.
DNA Techniques--
Standard techniques such as DNA cloning, DNA
analysis, and cell transformations were done as described (25).
Sequencing grade plasmid DNA was isolated from strain XL1-Blue. DNA
sequencing was done by the chain termination technique (26). The
polymerase chain reaction (PCR) was performed with Vent polymerase
after optimization for Mg2+ concentration. The P. stewartii rcsA gene was amplified from chromosomal DNA of the
P. stewartii wild type strain DC283 by using the
following primers: RcsAPS forward,
GGGGATCCATGCCAACGATTATTATGGATTCC; RcsAPS reverse,
GGAAGCTTCTATCTTACGTTCACGTAAATACCAG. The plasmid pM-RcsAES was constructed by cloning the rcsA
gene into the BamHI/HindIII site of the
expression vector pMalc2. The fragment F183 with the Rcs-binding site of the amsG promoter was amplified from
plasmid pEA131 by PCR as described (24). The GenBankTM
accession number for the P. stewartii cpsA promoter is
AF077292.
Expression and Purification of Proteins--
The bacteria were
grown in a 10-liter fermenter at 28 °C with 90% O2
saturation and at pH 7.0. LB broth was subcultured (1:200) into fresh
medium from an overnight culture, and 0.5 mM
isopropyl-1-thio- -D-galactopyranoside was added when the
A590 reached 0.5. The cells were incubated for
additional 3 h, pelleted by centrifugation, and stored at 25 °C. The RcsA proteins were expressed from plasmids
pM-RcsAEA and pM-RcsAES in strain JB3034 as a
C-terminal fusion to the maltose-binding protein. The RcsB proteins
were expressed from plasmids pM-RcsBEA with an
N-terminal fusion to the maltose-binding protein and
pQ-RcsBEA with an N-terminal poly(His)6-tag in
the strain BL21. The Rcs proteins were purified in a two-step procedure
by affinity chromatography using purified starch or metal chelate
resin, followed by anionic exchange chromatography as described (24).
If applicable, the purified proteins were further designated as M-Rcs
proteins when fused with the maltose-binding protein and as H-Rcs
proteins when fused with a poly(His)6-tag.
Electrophoretical Gel Mobility Shift Assay (EMSA)--
DNA
labeling with [ -32P]dATP, DNA binding assays, and
separation of protein-DNA complexes from unbound DNA by native PAGE
were performed as described (24). Retardation of DNA fragments by Rcs
proteins was monitored by gel electrophoresis and exposure of the dried
gels to x-ray films. For quantitative assays, the developed x-ray films
were aligned with the corresponding dried gel, the bands of retarded
and free DNA were cut out, and the amount of labeled DNA in the gel
slices was quantified in a scintillation counter.
In Vitro Selection of DNA Fragments--
The 23-bp fragment
F23, representing the minimal RcsA/RcsB binding region, was
fused to a restriction linker and to an approximately 0.2-kilobase pair
DNA fragment from the vector pBluescript by PCR to facilitate the
selection procedure. The complete sequence of the fragment
F23 was then permutated by generating six DNA pools in
which three or four bases of the wild type sequence were replaced by
randomized bases. The DNA pools were synthesized by PCR using
the following oligonucleotides: S-A,
GCAAGCTTAAATTAAGATTATTCTCAANNNNACGGCCAGTGAGCGCGCGTAATACG; S-B,
GCAAGCTTAAATTAAGATTATTCNNNNTATAACGGCCAGTGAGCGCGCGTAATACG; S-C,
GCAAGCTTAAATTAAGATTANNNTCAATATAACGGCCAGTGAGCGCGCGTAATACG; with
SABC-rev, GCAAGCTTAAATTAAGATTA; and S-D,
CGCTGCAGCGGTATATTGAGAANNNNCTTAATTTGGCGAGTTACATGATCCCCCATGTTG; S-E,
CGCTGCAGCGGTATATTGAGAATAATNNNNATTTGGCGAGTTACATGATCCCCCATGTTG; S-F,
CGCTGCAGCGGTATATTGAGAATAATCTTANNNNGGCGAGTTACATGATCCCCCATGTTG; with
SDEF-rev, CGGGATCCCACTATTCTCAGAATGACTTGGTTG as primers, and with
pBluescript KS+ as a template. The primers S-A until S-F
contained the fragment F23 with the randomly substituted
positions and a suitable restriction site as a linker. The primers
annealed to a specific region of pBluescript KS+ and
generated with the reverse primers SABC-rev and SDEF-rev DNA fragments
of about 0.2 kilobase pairs. The amplified DNA fragments were purified
by agarose gel electrophoresis, and about 1 µg of each DNA pool was
used as target DNA in an EMSA with 1.89 µM RcsA and 0.17 µM RcsB at optimized conditions. The native
polyacrylamide gels were stained with ethidium bromide, and the shifted
DNA bands were cut out. The DNA was eluted from the gel slices by
shaking overnight in 50 mM Tris-Cl (pH 7.4), 0.5 M sodium acetate, 1 mM EDTA, at 37 °C, and
the selected fragments were reamplified by PCR using the primers
SABC-rev with SABC-for, CCGAATTCCTGCAGCCCGGG, and SDEF-rev with
SDEF-for, CGCTGCAGCGGTATATTGAGAA. The selection was repeated
twice, and the DNA fragments were finally cloned into pBluescript
KS+ and sequenced.
DNA-Protein Cross-link--
Reactions were set up as described
for the EMSA (24). After 20 min at 28 °C, the solution was
irradiated 5 cm from the ultraviolet light source for various times (as
specified) with 312 nm. The reactions were cooled on ice during
illumination. Oligonucleotides labeled with the photoreactive thymine
analogue 5'-iododeoxyuracil were purchased from TIB-MolBiol/Berlin and
reconstituted to double-stranded DNA. The proteins directly interacting
with the template were photo-cross-linked to it and resolved by
denaturing gel electrophoresis. Cross-links were carried out in
combination with competitor -DNA and bovine serum albumin.
 |
RESULTS |
Location of an RcsA/RcsB-binding Site in the amsG
Promoter--
The binding region for the RcsA/RcsB heterodimer was
located by making deletions from each terminus of the previously
identified 183-bp fragment F183 and testing the retardation
of each in EMSAs. The smallest retarded fragment was 23 bp
(F23) (Fig. 1). Further deletions of 5 bp from either end of F23 either reduced or
completely abolished the binding of the E. amylovora
RcsA/RcsB dimer (Fig. 1). The 23-bp Rcs binding region is localized
from 555 to 533 upstream of the translational start site of
amsG, the first reading frame of the ams operon
(Fig. 2). The identified Rcs-binding site overlapped with the previously proposed promoter region of the ams operon and included the putative 35 region.

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 1.
Confinement of the RcsA/RcsB-binding site to
a 23-bp fragment of the amsG promoter.
Double-stranded DNA fragments were reconstituted from complementary
oligonucleotides and analyzed for binding of Rcs proteins in EMSAs with
1.7 µM RcsB and increasing concentrations of RcsA of
(lane 2) 0.3 µM, (lane 3) 0.5 µM, (lane 4) 1.0 µM, (lane
5) 3.1 µM, and (lane 6) 6.2 µM. A, 23-bp fragment F23 from
555 to 533 of the amsG promoter; B, 18-bp
fragment from 555 to 538; C, 18-bp fragment from 550
to 533. I, nonretarded DNA; II, retarded
DNA.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 2.
Localization of the RcsA/RcsB-binding site in
the promoters of amsG from E. amylovora and
cpsA from P. stewartii. Regions from about
200 bp to about 600 bp upstream of the start codons of
amsG and cpsA were aligned. The RcsA/RcsB-binding
sites in the two promoters are in bold. Identical nucleotide
positions are marked by vertical lines, and
arrows indicate positions in the amsG promoter
used for cross-linking to the Rcs proteins. A putative 35 consensus
in the amsG promoter is underlined twice. The
start codons of amsG and cpsA are
underlined, and asterisks indicate the JUMPstart
consensus sequence in the two promoters.
|
|
Fragment F23 was analyzed by mutation for nucleotide
positions responsible for the specific DNA-protein recognition. Sets of
two or three nucleotides were mutated by nucleotide transitions, and
the binding of RcsA/RcsB to the fragments was quantified in EMSAs (Fig.
3). Most important for the recognition by
RcsA/RcsB was the region from nucleotide positions 4-14. The A-C and
T-G transitions at position 4 and 6 of fragment M4/6
resulted in a decrease of retardation to about 18% compared with the
wild type sequence. The nucleotide substitutions of positions 7-14 in
the fragments M7-9, M9-11, and
M12-14 completely abolished a DNA shift by RcsA/RcsB. The
terminal mutations at nucleotide positions 18/20 and 21/23 were
tolerated by the Rcs proteins, and no or only minor decreases in the
DNA retardation were detected. These results gave evidence that a
specific recognition by the RcsA/RcsB dimer might be determined by the
central region of fragment F23, whereas the obvious
essential contacts to nucleotides at positions 18-23 might not be
sequence-specific and could occur with the phosphate backbone.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
Binding of E. amylovora RcsA
and RcsB proteins to the mutated fragment F23. The DNA
retardation was analyzed in EMSAs with 1.7 µM RcsB and
RcsA concentrations of 0.3, 0.5 , 2.6, and 5.2 µM. Mean
values of three determinations are given, and the standard errors were
not shown to improve clarity, and they have been less than 10%.
+, M18/19, ×, M20/22; ,
M9/10/11; , M12/13/14; ,
M7/8/9; , F23; , M4/6.
|
|
The protein-DNA interaction of RcsA/RcsB with nucleotides of the
central region of fragment F23 was verified by UV
cross-linking. The thymine bases at nucleotide positions 8, 10, 11, and
13 were substituted by 5'-iododeoxyuracil and the modified fragment
F23 was incubated with RcsA/RcsB proteins at optimal
DNA-binding conditions. The formation of cross-linked protein-DNA
complexes was analyzed by SDS-PAGE after illumination of the DNA
binding assay for 30 min at 312 nm (Fig.
4). A cross-linked band was clearly
visible and demonstrated the close contact of the Rcs proteins with at least some of the labeled thymines.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 4.
Cross-linking of RcsA/RcsB with the
5-iododeoxyuracil-labeled fragment F23. The 23-bp
fragment with the Rcs-binding site of the amsG promoter was
incubated with about 1.9 µM RcsA and 0.2 µM
RcsB protein at standard conditions and illuminated at 312 nm for
(lane 1) 15 min, (lane 2) 30 min, and (lane
3) 60 min. The arrow indicates the cross-linked DNA
fragments after separation by SDS-PAGE.
|
|
Characterization of the RcsA-RcsB-DNA Complex--
We estimated
the affinity of the RcsA/RcsB heterodimer for fragment F183
with increasing concentrations of an equimolar solution of RcsA and
RcsB. With this approach, the apparent binding constant of the
RcsA/RcsB heterodimer was calculated at about 100 nM. The same result was obtained by using a constant amount of 30 nM RcsB or 2.5 µM RcsB with increasing
amounts of RcsA starting from 19 nM up to 1.5 µM. The usage of different protein ratios did not change
the DNA binding kinetics as the binding constant of a heterodimer to
DNA should depend only on an equilibrium between the putative free
RcsA/RcsB dimer and an RcsA-RcsB-DNA complex. The increase of one
protein component will therefore affect the equilibrium between protein
dimer and monomers in favor of the RcsA/RcsB heterodimer formation.
However, the protein dimer might be rather unstable as we have not been
able to detect any RcsA/RcsB dimer formation neither in the yeast
two-hybrid system nor by affinity chromatography of RcsA with the
immobilized poly(His)6-tagged RcsB (data not shown).
Relatively high protein concentrations of about 1.7 µM
RcsA with 33 nM RcsB in the EMSA with fragment
F183 of the amsG promoter resulted in an
additional supershifted band (Fig. 5). We
investigated whether this complex included additional copies of RcsB.
The 24-kDa poly(His)6-tagged RcsB protein in the
protein-DNA complex was subsequently replaced by increasing
concentrations of the 68-kDa RcsB protein modified with an N-terminal
fusion of the maltose-binding protein. The resulting band pattern shown
in Fig. 5 demonstrates that the supershifted protein-DNA complex
obviously contains two copies of the RcsB protein. The appearance of
the supershift was dependent on the concentration of RcsA and at least
one additional copy of RcsA might also be included in the complex. We
could not prove this possibility, as the expression of unmodified or
poly(His)6-tagged RcsA proteins results in the formation of
inclusion bodies, and only the RcsA fusion to the maltose-binding
protein was produced as soluble protein. Therefore it could not be
completely ruled out that the supershifted complex does contain only
one copy of RcsA together with two copies of RcsB. In that case, RcsB
might be able to bind to the preexisting RcsA-RcsB heterodimer complex already formed with lower concentrations of RcsA. However, the lack of
a supershifted band even at high concentrations of RcsA with smaller
DNA targets like the fragments F28 or F23 of
the amsG promoter make this assumption more unlikely. We
propose that the supershifted complex represents an additional
RcsA/RcsB heterodimer bound to a second less specific region in
fragment F183.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
Identification of two RcsB copies in the
supershifted DNA fragment F183 from the amsG
promoter. Only retarded DNA fragments are shown. The labeled
fragment F183 was incubated in standard retardation assays
with about 1.9 µM RcsA, 100 nM H-RcsB
(lanes 1-4), or 40 nM M-RcsB (lanes
5-8). The M-RcsB protein was added in concentrations of
40 nM (lane 2), 110 nM (lane
3), and 180 nM (lane 4). The H-RcsB protein
was added in concentrations of 100 nM (lane 6),
300 nM (lane 7), and 600 nM
(lane 8). I and II, RcsA-RcsB
heterodimer complex with fragment F183; III-V,
supershifted protein-DNA complexes. The proposed compositions of the
protein-DNA complexes are shown in the scheme. M-RcsB,
fusion with the 44-kDa maltose-binding protein; H-RcsB,
fusion with a poly(His)6-tag.
|
|
An important factor for the binding efficiency of the RcsA/RcsB dimer
is the length of the offered target DNA. We determined the retardation
of different DNA fragments containing the mapped Rcs recognition site
at identical assay conditions in EMSAs by using 7.6 µM
RcsA and 1.6 µM RcsB protein. Relatively high protein concentrations had to be used to obtain substantial amounts of retarded
DNA even with the smallest fragment F23. The largest target
was fragment F183, and the amount of retarded DNA was
calculated at 52 ± 6%. The retardation of the smaller 28- and
23-bp fragments F28 and F23 were clearly
decreased to 14.2 ± 8.8 and 10.1 ± 5.4%, respectively. The
results demonstrate that additional and nonspecific nucleotides might
stabilize the protein-DNA interactions.
Once formed, the stability of the RcsA-RcsB-DNA complex might be one
major determinant for the induction of ams expression. We
determined the half-life of the complex in a competition experiment with the labeled fragment F183 as a target and about 30 nM RcsB and 550 nM RcsA, respectively. These
conditions were found to be ideal for the retardation of fragment
F183. The binding assays were first incubated at standard
conditions for 10 min to receive an equilibrium between free ligands
and the RcsA-RcsB-DNA complex. The assays were then supplemented at
varying time intervals starting from 2 s to 1 h with about
30-fold excess of unlabeled fragment F183. Finally, all
samples were analyzed by native PAGE, and the amounts of protein-DNA
complex and unbound DNA were quantified. The results were plotted, and
the half-life of the RcsA-RcsB-F183 complex could be
calculated at about 42 s. The Rcs-DNA complex can be considered to
be of only low stability if compared with known half-lives of
transcriptional repressors to their target DNAs. However, this result
is expected for a transcriptional inducer, as the EPS biosynthesis is
controlled by environmental signals and the relative low stability of
the inductive Rcs-DNA complex might be essential for a fast response to
changing conditions.
Determination of the RcsA/RcsB Recognition Motif in the amsG
Promoter--
The sequence of the identified Rcs binding region in the
amsG promoter shows some palindrome elements, which could be
important for the recognition by the proteins. However, the binding of
a protein heterodimer does not require a palindromic binding motif. To
identify nucleotide positions, which are responsible for the specificity of the RcsA/RcsB binding, we analyzed the sequence of
fragment F23 by an in vitro selection approach.
The sequence of fragment F23 was permutated by substitution
of 3- or 4-bp-long stretches of nucleotides by randomized nucleotides.
The resulting six probes contained random positions in different
regions throughout the fragment F23 and represented a pool
of 64 and 256 DNA fragments, respectively. Each mixture was used as
target DNA in EMSAs with 1.89 µM RcsA and 0.17 µM RcsB protein as described under "Materials and
Methods." The higher protein concentrations had to be used to obtain
sufficient retarded DNA for the visualization by ethidium bromide
staining. The retarded DNA fragments were isolated, and the selection
was repeated twice. The retarded DNA fraction after the third selection
by the RcsA/RcsB proteins was quantified and compared with the
retardation efficiencies of the unselected DNA mixtures (Table
II). The retardation of each DNA mixture
was enhanced after the selection for at least 200%. The sequence of
the nucleotide positions 9-11 of fragment F23 was most
important for the binding of the RcsA/RcsB proteins as almost no
retardation of the corresponding unselected DNA mixture was notable.
This result corresponds to our previous findings in the mutation
analysis and is also in agreement with the observed UV cross-link of
the Rcs proteins to that DNA region. The sequence of the terminal
nucleotide positions of fragment F23 seems to be of minor
importance for a specific binding of RcsA/RcsB, as already the
unselected pools showed a considerable retardation in the EMSA.
The DNA fragments of the selected pools were cloned into pBluescript
KS+, and at least 27 clones of each pool were sequenced
(Table III). Corresponding to our
previous results, a stringent selection was found at the nucleotide
positions 9-11, and a purine was absolutely required for the positions
10 and 11. Only 5 of 64 possible codons were obtained after selection
of the random positions 9-11 with a clear preference for the wild type
sequence GAA. Further conserved bases were a thymine at position 6 and
the sequence WAWT from positions 12-15. The center of the Rcs binding
region from positions 6-15 had a high A/T content of about 80%.
View this table:
[in this window]
[in a new window]
|
Table III
Evaluation of the RcsA/RcsB recognition motif at the amsG promoter
Degenerated positions are classified after IUPAC nomenclature. The most
frequent bases in the analyzed sequences are in bold. Lines indicate
conserved positions in the E. amylovora (EA) and P. stewartii (PS) wild type (wt) sequence, less conserved positions
are marked with colon, and degenerated positions are in lowercase.
Palindromic elements in the wild type sequences are underlined. The
in vitro selection was carried out with 1.89 µM RcsA and 0.17 µM RcsB protein. Top line
of boxhead is wt (EA); middle line is consensus (consensus determined
after in vitro selection and analysis of mutated fragments
in the EMSA); bottom line is wt (PS). Bases not found by sequencing are
indicated by
dashes.
|
|
The results of the in vitro selection were verified by two
different approaches using the EMSA. First we quantified the
retardation of representative DNA fragments isolated from the selection
procedure (Table IV). The selected DNA
fragments (SF) were approximately 200 bp in length and contained
fragment F23 from the amsG promoter with
mutations relative to the wild type sequence. As expected, the
nucleotides at both ends of fragment F23 did not show high sequence specificity in the in vitro selection. However, the
increase in DNA retardation of the optimized fragment SF
(C1C2C3T4) indicates
that some selectivity does exist. Substitution of a thymine and an
adenine residue in fragment SF (G5C8) by
guanine and cytosine resulted in an about 2-fold increase in
retardation. Fragments SF (G5A7C8)
and SF (G5C7C8) demonstrate the
requirement for a purine in position 7. The thymine at position 6 was
shown to be essential in fragment SF (G5A6C7C8). The
positions 9-16 were already optimal in the amsG wild type sequence. The positions 9 and 10 tolerated only purines, whereas guanine was almost strictly required at position 9 and an adenine at
position 10 enhanced the retardation about 2-fold. The adenine at
position 11 could be replaced with pyrimidines with some decrease of
the retardation efficiencies. Substitution of the thymine residue at
position 16 by cytosine resulted in only about 25% residual retardation. Replacement of the thymine at position 18 with guanine in
fragment SF (G18) did not increase the retardation as
expected from the in vitro selection. Position 17 required a
pyrimidine, and an adenine considerably diminished the retardation as
shown with fragments SF (C17G18) and SF
(A17G18). Position 19 might be specific for
purines as the replacement of adenine by thymine in fragment SF
(G18T19) only yielded about 25% residual
retardation.
View this table:
[in this window]
[in a new window]
|
Table IV
Retardation of selected DNA fragments with a mutated RcsA/RcsB-binding
site
DNA fragments of about 200 bp were analysed in EMSAs with 33 nM RcsB and 1.89 µM RcsA; only the sequences
of one strand of the 23-bp RcsA/RcsB binding region are shown, mean
values of three determinations.
|
|
In a second approach, we analyzed the retardation of 23-bp DNA
fragments reconstituted from oligonucleotides and designed according to
our consensus motif (Table V). Fragment
F23
(A1C2T4G5C8)
contained optimized substitutions at the 5'-end, and the retardation in
EMSAs was enhanced about 2-fold. This result does completely agree with
our observations with fragments SF
(C1C2C3T4) and SF
(G5C8) (Table IV). The optimization of
positions 20-23 in fragment F23
(G20G21C22A23) resulted
in about a 4-fold enhancement of retardation. Interestingly, the
replacement of the wild type thymine at position 18 with guanine in
fragment F23 (G18) increased the retardation
about 3-fold, whereas the same mutation in the context of the ~200-bp
fragment SF (G18) did not show notable effects on the
retardation efficiency (Table IV). Substitution of the thymine at
position 17 with adenine completely abolished the retardation of
fragment F23 (A17G18). This is in
agreement with the observed drastically reduced retardation of the
200-bp fragment SF (A17G18). Fragment
F23 (consensus) combined all optimized positions previously analyzed in the fragments F23
(A1C2T4G5C8),
F23
(G20G21C22A23), and
F23 (G18). However, the retardation was not
enhanced as expected but diminished to about 50% of the wild type
sequence. This result gave evidence that the recognition of the
distinct nucleotide positions does not take place independently and/or
secondary structures of the DNA target might be important for the
recognition by RcsA/RcsB proteins.
View this table:
[in this window]
[in a new window]
|
Table V
Optimization of RcsAEA/RcsBEA-binding sites from E. amylovora and P. stewartii
Complementary oligonucleotides of the given sequences were hybridized,
and their retardation was analyzed in EMSAs with 5.7 µM
RcsAEA and 1.7 µM RcsBEA at optimal
conditions. Values are means of at least three determinations. wt, wild
type.
|
|
Identification of an RcsA/RcsB-binding Site in the P. stewartii
cpsA Promoter--
The cps operon for stewartan
biosynthesis in P. stewartii is homologous to the
ams operon of E. amylovora, and both are
regulated by Rcs proteins. The sequence of an about 600-bp region
containing the promoter of cpsA, the first reading frame of
the cps operon, was aligned with the sequence of the
amsG promoter (Fig. 2). The nucleotide positions 538 to
516 correspond to the Rcs binding region of the amsG
promoter, and they were analyzed as a 28-bp fragment in EMSAs with the
RcsB protein of E. amylovora and the RcsA protein of
E. amylovora (RcsAEA) or P. stewartii
(RcsAES). The fragment was clearly retarded with both
protein combinations (Fig. 6), giving
evidence that the binding of an RcsA/RcsB heterodimer to a region from
about 510 to 540 bp upstream of the translational start site might
be a common principle in the regulation of EPS biosynthesis in
Erwinia. The retardation with RcsAES compared with RcsAEA seems to be somewhat better with the fragment
F23 of the homologous cpsA promoter. Vice versa,
RcsAEA seems to be more effective in the retardation of the
fragment F23 from the amsG promoter. This gives
evidence that the RcsA proteins are involved in the specific DNA
recognition. According to the consensus motif of the amsG
promoter, the RcsA/RcsB-binding site of the cpsA promoter
was degenerated in two essential positions (Table III) and did not
contain palindromic elements. The replacement of the degenerated
adenine by the conserved guanine in fragment FcpsA-(G9)
resulted in about a 5-fold enhanced retardation in the EMSA (Table V).
Despite the degenerated positions, the analyzed 28-bp fragment from the
cpsA promoter showed a similar retardation compared with
fragment F23 from the amsG promoter (Table V). The degeneration might therefore be compensated by optimized
nucleotides at other positions of the cpsA Rcs binding
motif.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 6.
Binding activities of the RcsA proteins from
E. amylovora and P. stewartii at the
promoters of amsG and cpsA. The
23-bp DNA fragment from 555 to 533 of the amsG promoter
and the 28-bp fragment from 538 to 516 of the cpsA
promoter were analyzed in EMSAs at standard conditions. Rcs proteins
were added in the following concentrations: RcsB, 1.7 µM;
RcsAEA, 5.7 µM; RcsAES, 5.7 µM.
|
|
 |
DISCUSSION |
Genetic data gave evidence that RcsA/RcsB heterodimers play a
major role in mediating transcriptional activation on positively regulated genes involved in EPS biosynthesis. The principal aim of this
study was to identify essential nucleotide positions implicated in Rcs
protein recognition within promoters of EPS biosynthetic operons. We
previously described a synergistic binding of RcsA and RcsB to the
promoter of amsG, the first reading frame of the E. amylovora operon for amylovoran biosynthesis. The minimal DNA fragment retaining substantial RcsA/RcsB binding has been confined to a
23-bp region now. Both gel mobility assays and protein-DNA cross-linking studies indicate the interaction of purified RcsA/RcsB proteins with that region. The RcsA/RcsB binding region covers the
putative 35 consensus of the amsG promoter (21). Its
relatively poor homology to E. coli 70
promoters (27) is consistent with RcsA/RcsB acting as activators for
the amsG promoter. The confined minimal RcsA/RcsB-binding site is small compared with those covered from transcriptional regulators of other two-component systems. Footprinting revealed protected DNA fragments of about 80 bp for VirG and VanR (28, 29).
Additional sequences might also be bound by the RcsA/RcsB proteins as
longer DNA fragments stabilized the protein-DNA complex more than
5-fold, but the analyzed 23-bp fragment appears to contain the
nucleotide positions responsible for the RcsA/RcsB binding specificity.
The affinity of the RcsA/RcsB heterodimer to its target sequence in the
amsG promoter was determined with an apparent
KD value of 100 nM. It has to be
considered that the determination of the KD values
is based on the assumption that the activities of the protein fractions
are 100%. In other well characterized bacterial two-component systems,
e.g. NtrB/NtrC (30), EnvZ/OmpR (31), PhoR/PhoB (32),
ComP/ComA (33), and VanS/VanR (29), phosphorylation of the response
regulators increased affinity, presumably due to the formation of
higher oligomeric protein states and cooperative binding (34, 35). RcsB
contains a well conserved phosphorylation motif, and its activity might
be modulated upon phosphotransfer by RcsC (36). The percentage of
phosphorylation in our RcsB preparations was unknown, but it might be
rather low due to the kinetic lability of aspartyl-phosphate linkages.
It is therefore possible that the KD values could be
considerably increased after an increased phosphorylation of RcsB. An
apparent KD value of 40 nM was reported
for the transcriptional regulator VanR after increasing the percentage
of phosphorylated protein with acetyl phosphate to a total of about
8%, whereas the KD value of unphosphorylated VanR
was found to be about 500-fold lower (29). Both forms of VanR bind to
identical DNA regions, but the phosphorylated VanR covers a larger part of DNA. Additionally, the KD value of 14 nM for the unphosphorylated form of the transcriptional
regulator NtrC could be increased to a KD value of 1 nM upon phosphorylation (37). However, the affinities of
the phosphorylated procaryotic transcriptional activators ComA and OmpR
to their DNA targets with KD values of 1 µM (33) and 1.5 µM (31), respectively, are
significantly lower than the affinity of RcsB to its target. The
RcsA-RcsB-DNA complex shows a relative short half-life of 42 s,
and there might be a continuous association/dissociation. In general,
transcriptional activator-DNA complexes tend to have a much shorter
half-life than transcriptional repressor-DNA complexes, most probably
to ensure continuous gene activation only upon the ongoing stimulation of the activator protein. It is further possible that additional factors might bind in vivo to stabilize the complex. As
in vitro transcription data are not available so far, it is
not known whether the formation of the DNA bound RcsA/RcsB heterodimer
alone is sufficient to dictate transcriptional activity.
RcsA and RcsB are grouped into the LuxR family of transcriptional
regulators (7), but the determined RcsA/RcsB recognition motif at the
amsG promoter did not show extensive similarities to the
lux box, a 20-bp palindrome similar to the LexA repressor recognition motif (38). Palindromic elements were not necessary in the
recognition motif derived by in vitro selection, and they are absent in the RcsA/RcsB-binding site at the P. stewartii
cpsA promoter. The in vitro selection revealed a region
of about 13 bp as most important for the RcsA/RcsB binding specificity.
The cross-link of 5-iododeoxyuracil-substituted thymines within this area demonstrated its close contact to the Rcs proteins. The binding mechanism of RcsA/RcsB to their target DNA seems to include a complex
combination of recognition of specific bases in concert with local
structural features. Proposed local single or multiple "up"
mutations according to our consensus motif within the 23-bp fragment
always increased the binding of RcsA/RcsB. However, the binding was
decreased upon combination of up mutations from more distantly located
areas, indicating that the tight binding of one Rcs protein at the
23-bp fragment requires some flexibility of the second Rcs protein.
Heterodimerization of transcriptional regulators is quite uncommon in
procaryotic systems but prevalent in eucaryotic regulation mechanisms
(39), and one advantage might be the recognition of additional DNA
targets. RcsB, but not RcsA, is essential for the stimulation of EPS
biosynthesis, and it is involved in the regulation of further
RcsA-independent pathways like the stimulation of Vi polymer synthesis
in Salmonella typhimurium (12) and ftsZ expression in E. coli (40). It might therefore be speculated that RcsB is responsible for the initiation of transcription, possibly
by interacting with RNA polymerase, and the alternative association
with specific coinducers like RcsA might enable RcsB to bind and
regulate different promoters in the cell. It is yet uncertain if RcsB
first binds weakly to DNA and the complex is then recognized by RcsA,
or if a preformed RcsA/RcsB heterodimer binds to the recognition site.
Evidence for the latter possibility could be the appearance of the
supershifted band, notable after increasing the concentration of RcsA
to about 40-fold excess. The increased RcsA concentration could enhance
the formation of RcsA/RcsB heterodimers, resulting in the binding of
secondary sites with lower affinity. However, the supershifted band
would also be consistent with the formation of a nucleoprotein complex and a secondary binding of RcsB and possibly RcsA to the already bound
RcsA/RcsB heterodimer (41). The presence of a free heterodimer is
further supported by the observation that overexpression of the
C-terminal deleted RcsB protein inhibits EPS biosynthesis in E. coli, presumably by competition with the wild type RcsB for the
RcsA protein,3 resulting in
the formation of a nonproductive heterodimer. However, the heterodimers
of RcsA/RcsB might associate only weakly, as we could not detect an
interaction in the yeast two-hybrid system or by affinity
chromatography of RcsA with immobilized RcsB.3
In summary, the identification of RcsA/RcsB-binding sites at
corresponding locations in the main promoters of the EPS operons of
E. amylovora and P. stewartii gave evidence for a
conserved regulation mechanism for type IA polysaccharide biosynthesis. The description of critical nucleotides in the RcsA-RcsB-DNA complex should help to analyze further the molecular interactions in the regulation of capsule biosynthesis by Rcs proteins.
 |
ACKNOWLEDGEMENTS |
We are grateful to Clemens Langner and Doris
Majerczak for technical assistance.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF077292.
¶
To whom correspondence should be addressed. Tel.:
49-30-838-3463; Fax: 49-30-838-6702; E-mail:
fbern{at}fu-berlin.chemie.de.
The abbreviations used are:
EPS, exopolysaccharide; RCS, regulation of capsule synthesis; EMSA, electrophoretic mobility shift assay; bp, base pair; PCR, polymerase
chain reaction; PAGE, polyacrylamide gel electrophoresis.
2
D. L. Coplin, unpublished observations.
3
F. Bernhard, unpublished observations.
 |
REFERENCES |
-
Beveridge, T. J.,
and Graham, L. L.
(1991)
Microbiol. Rev.
55,
684-705[Abstract/Free Full Text]
-
Leigh, J. A.,
and Coplin, D. L.
(1992)
Annu. Rev. Microbiol.
46,
307-346[CrossRef][Medline]
[Order article via Infotrieve]
-
Mergaert, J.,
Verdonck, L.,
and Kersters, K.
(1993)
Int. J. Syst. Bacteriol.
43,
162-173[Abstract/Free Full Text]
-
Hsu, S. T.,
and Goodman, R. N.
(1978)
Phytopathology
68,
351-354
-
Jayaratne, P.,
Keenleyside, W. J.,
MacLachlan, P. R.,
Dodgson, C.,
and Whitfield, C.
(1993)
J. Bacteriol.
175,
5384-5394[Abstract/Free Full Text]
-
Gottesman, S.
(1995)
in
Regulation of Capsule Synthesis: Modification of the Two-component Paradigm by an Accessory Unstable Regulator (Hoch, J. A., and Silhavy, T. J., eds), pp. 253-262, American Society for Microbiology, Washington, D. C.
-
Stout, V.,
Torres-Cabassa, A.,
Maurizi, M. R.,
Gutnick, D.,
and Gottesman, S.
(1991)
J. Bacteriol.
173,
1738-1747[Abstract/Free Full Text]
-
Keenleyside, W. J.,
Jayaratne, P.,
MacLachlan, P. R.,
and Whitfield, C.
(1992)
J. Bacteriol.
174,
8-16[Abstract/Free Full Text]
-
Allen, P.,
Hart, C. A.,
and Saunders, J. R.
(1987)
J. Gen. Microbiol.
133,
331-340[Abstract/Free Full Text]
-
Mc Callum, K. L.,
and Whitfield, C.
(1991)
Infect. Immun.
59,
494-502[Abstract/Free Full Text]
-
Wacharotayankun, R.,
Arakawa, Y.,
Ohta, M.,
Hasegawa, T.,
Mori, M.,
Horii, T.,
and Kato, N.
(1992)
J. Bacteriol.
174,
1063-1067[Abstract/Free Full Text]
-
Virlogeux, I.,
Waxin, H.,
Ecobichon, C.,
Lee, J. O.,
and Popoff, M. Y.
(1996)
J. Bacteriol.
178,
1691-1698[Abstract/Free Full Text]
-
Bernhard, F.,
Poetter, K.,
Geider, K.,
and Coplin, D. L.
(1990)
Mol. Plant-Microbe Interact.
3,
429-437[Medline]
[Order article via Infotrieve]
-
Chatterjee, A.,
Chun, W.,
and Chatterjee, A. K.
(1990)
Mol. Plant-Microbe Interact.
3,
144-148
-
Coleman, M.,
Pearce, R.,
Hitchin, E.,
Busfield, F.,
Mansfield, J. W.,
and Roberts, I. S.
(1990)
J. Gen. Microbiol.
136,
1799-1806[Abstract/Free Full Text]
-
Bereswill, S.,
and Geider, K.
(1997)
J. Bacteriol.
179,
1354-1361[Abstract/Free Full Text]
-
Poetter, K.,
and Coplin, D. L.
(1991)
Mol. Gen. Genet.
229,
155-160[Medline]
[Order article via Infotrieve]
-
Stout, V.,
and Gottesman, S.
(1990)
J. Bacteriol.
172,
659-669[Abstract/Free Full Text]
-
Trisler, P.,
and Gottesman, S.
(1984)
J. Bacteriol.
160,
184-191[Abstract/Free Full Text]
-
Torres-Cabassa, A. S.,
and Gottesman, S.
(1987)
J. Bacteriol.
169,
981-989[Abstract/Free Full Text]
-
Bugert, P.,
and Geider, K.
(1995)
Mol. Microbiol.
15,
917-935[Medline]
[Order article via Infotrieve]
-
Stevenson, G.,
Andrianopoulos, K.,
Hobbs, M.,
and Reeves, P. R.
(1996)
J. Bacteriol.
178,
4885-4893[Abstract/Free Full Text]
-
Stout, V.
(1996)
J. Bacteriol.
178,
4273-4280[Abstract/Free Full Text]
-
Kelm, O.,
Kiecker, C.,
Geider, K.,
and Bernhard, F.
(1997)
Mol. Gen. Genet.
256,
72-83[CrossRef][Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
in
Molecular Cloning: A Laboratory Manual (Ford, N., Nolan, C., and Ferguson, M., eds), 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467[Abstract/Free Full Text]
-
Hoopes, B. C.,
and McClure, W.
(1987)
in
Escherichia coli and Salmonella typhimurium Cellular and Molecular Biology (Neidhardt, F. C., Ingram, J. L., Low, K. B., Magasanik, B., Schaechter, M., and Umbarger, H. E., eds), pp. 1231-1240, American Society for Microbiology, Washington, D. C.
-
Roitsch, T.,
Wang, H.,
Jin, S.,
and Nester, E.
(1990)
J. Bacteriol.
172,
6054-6060[Abstract/Free Full Text]
-
Holman, T. R.,
Wu, Z.,
Wanner, B. L.,
and Walsh, C. T.
(1994)
Biochemistry
33,
4625-4631[CrossRef][Medline]
[Order article via Infotrieve]
-
Ninfa, A.,
Reitzer, L. J.,
and Magasanik, B.
(1987)
Cell
50,
1039-1046[CrossRef][Medline]
[Order article via Infotrieve]
-
Aiba, H.,
Nakasai, F.,
Mizushima, S.,
and Mizuno, T.
(1989)
J. Biochem. (Tokyo)
106,
5-7[Abstract/Free Full Text]
-
Makino, K.,
Shinagawa, H.,
Amemura, M.,
Kawamoto, T.,
Yamada, M.,
and Nakata, A.
(1989)
J. Mol. Biol.
210,
551-559[CrossRef][Medline]
[Order article via Infotrieve]
-
Roggiani, M.,
and Dubnau, D.
(1993)
J. Bacteriol.
175,
3182-3187[Abstract/Free Full Text]
-
Nakashima, K.,
Kanamura, K.,
Aiba, H.,
and Mizuno, T.
(1991)
J. Biol. Chem.
266,
10775-10780[Abstract/Free Full Text]
-
Weiss, V.,
Claverie-Martin, G.,
and Magasanik, B.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
5088-5092[Abstract/Free Full Text]
-
Gupte, G.,
Woodward, C.,
and Stout, V.
(1997)
J. Bacteriol.
179,
4328-4335[Abstract/Free Full Text]
-
Weiss, V.,
and Magasanik, B.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
8919-8923[Abstract/Free Full Text]
-
Devine, J. H.,
Shadel, G. S.,
and Baldwin, T. O.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
5688-5692[Abstract/Free Full Text]
-
Meroni, G.,
Reymond, A.,
Alcalay, M.,
Borsani, G.,
Tanigami, A.,
Tonlorenzi, R.,
Lo Nigro, C.,
Messali, S.,
Zollo, M.,
Ledbetter, D. L.,
Brent, R.,
Ballabio, A.,
and Carrozzo, R.
(1976)
EMBO J.
16,
2892-2906[CrossRef][Medline]
[Order article via Infotrieve]
-
Gervais, F. G.,
Phoenix, P.,
and Drapeau, G. R.
(1992)
J. Bacteriol.
174,
3964-3971[Abstract/Free Full Text]
-
Lane, D.,
Prentki, P.,
and Chandler, M.
(1992)
Microbiol. Rev.
3,
455-458
-
Bullock, W. O.,
Fernandez, J. M.,
and Stuart, J. M.
(1987)
BioTechniques
5,
376-379
-
Brill, J. A.,
Quinlan-Walshe, C.,
and Gottesman, S.
(1988)
J. Bacteriol.
170,
2599-2611[Abstract/Free Full Text]
-
Coplin, D. L.,
Frederick, R. D.,
Majerczak, D. R.,
and Haas, E. S.
(1986)
J. Bacteriol.
168,
619-623[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. K. Carroll, X. Liao, L. K. Morgan, E. M. Cicirelli, Y. Li, W. Sheng, X. Feng, and L. J. Kenney
Structural and Functional Analysis of the C-terminal DNA Binding Domain of the Salmonella typhimurium SPI-2 Response Regulator SsrB
J. Biol. Chem.,
May 1, 2009;
284(18):
12008 - 12019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Schwan, S. Shibata, S.-I. Aizawa, and A. J. Wolfe
The Two-Component Response Regulator RcsB Regulates Type 1 Piliation in Escherichia coli
J. Bacteriol.,
October 1, 2007;
189(19):
7159 - 7163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Pruss, C. Besemann, A. Denton, and A. J. Wolfe
A Complex Transcription Network Controls the Early Stages of Biofilm Development by Escherichia coli
J. Bacteriol.,
June 1, 2006;
188(11):
3731 - 3739.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhao, S. E. Blumer, and G. W. Sundin
Identification of Erwinia amylovora Genes Induced during Infection of Immature Pear Tissue
J. Bacteriol.,
December 1, 2005;
187(23):
8088 - 8103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Majdalani, M. Heck, V. Stout, and S. Gottesman
Role of RcsF in Signaling to the Rcs Phosphorelay Pathway in Escherichia coli
J. Bacteriol.,
October 1, 2005;
187(19):
6770 - 6778.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Boulanger, A. Francez-Charlot, A. Conter, M.-P. Castanie-Cornet, K. Cam, and C. Gutierrez
Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to {sigma}S or to the RcsCDB His-Asp Phosphorelay
J. Bacteriol.,
May 1, 2005;
187(9):
3282 - 3286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Mouslim, T. Latifi, and E. A. Groisman
Signal-dependent Requirement for the Co-activator Protein RcsA in Transcription of the RcsB-regulated ugd Gene
J. Biol. Chem.,
December 12, 2003;
278(50):
50588 - 50595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Pristovsek, K. Sengupta, F. Lohr, B. Schafer, M. W. von Trebra, H. Ruterjans, and F. Bernhard
Structural Analysis of the DNA-binding Domain of the Erwinia amylovora RcsB Protein and Its Interaction with the RcsAB Box
J. Biol. Chem.,
May 9, 2003;
278(20):
17752 - 17759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Conter, R. Sturny, C. Gutierrez, and K. Cam
The RcsCB His-Asp Phosphorelay System Is Essential To Overcome Chlorpromazine-Induced Stress in Escherichia coli
J. Bacteriol.,
May 15, 2002;
184(10):
2850 - 2853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Davalos-Garcia, A. Conter, I. Toesca, C. Gutierrez, and K. Cam
Regulation of osmC Gene Expression by the Two-Component System rcsB-rcsC in Escherichia coli
J. Bacteriol.,
October 15, 2001;
183(20):
5870 - 5876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wehland and F. Bernhard
The RcsAB Box. CHARACTERIZATION OF A NEW OPERATOR ESSENTIAL FOR THE REGULATION OF EXOPOLYSACCHARIDE BIOSYNTHESIS IN ENTERIC BACTERIA
J. Biol. Chem.,
March 15, 2000;
275(10):
7013 - 7020.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|