JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, C.-C.
Right arrow Articles by Wojcikiewicz, R. J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, C.-C.
Right arrow Articles by Wojcikiewicz, R. J. H.

J Biol Chem, Vol. 274, Issue 6, 3476-3484, February 5, 1999


Inositol 1,4,5-Trisphosphate Receptor Down-regulation Is Activated Directly by Inositol 1,4,5-Trisphosphate Binding
STUDIES WITH BINDING-DEFECTIVE MUTANT RECEPTORS*

Chang-Cheng ZhuDagger , Teiichi Furuichi§, Katsuhiko Mikoshiba§, and Richard J. H. WojcikiewiczDagger

From the Dagger  Department of Pharmacology, College of Medicine, State University of New York Health Science Center at Syracuse, New York 13210-2339 and the § Department of Molecular Neurobiology, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan

    ABSTRACT
Top
Abstract
Introduction
References

Activation of certain phosphoinositidase C-linked cell surface receptors is known to cause an acceleration of the proteolysis of inositol 1,4,5-trisphosphate (InsP3) receptors and, thus, lead to InsP3 receptor down-regulation. To gain insight into this process, we examined whether or not InsP3 receptor degradation is a direct consequence of InsP3 binding by analyzing the down-regulation of exogenous wild-type and binding-defective mutant InsP3 receptors expressed in SH-SY5Y human neuroblastoma cells. Stimulation of these cells with carbachol showed that wild-type exogenous receptors could be down-regulated but that the binding-defective mutant exogenous receptors were not. Thus, InsP3 binding appears to mediate down-regulation. To validate this conclusion, a comprehensive analysis of the effects of the exogenous receptors was undertaken. This showed that exogenous receptors (i) are localized appropriately within the cell, (ii) enhance InsP3-induced Ca2+ release in permeabilized cells, presumably by increasing the number of InsP3-sensitive Ca2+ channels, (iii) have minimal effects on Ca2+ mobilization and InsP3 formation in intact cells, (iv) form heteromers with endogenous receptors, and (v) do not alter the down-regulation of endogenous receptors. In total, these data show that the introduction of exogenous receptors into SH-SY5Y cells does not compromise intracellular signaling or the down-regulatory process. We can thus conclude that InsP3 binding directly activates InsP3 receptor degradation. Because InsP3 binding induces a conformational change in the InsP3 receptor, these data suggest that this change provides the signal for accelerated proteolysis.

    INTRODUCTION
Top
Abstract
Introduction
References

When certain types of G-protein-coupled cell surface receptors (for example, M3 muscarinic receptors) are occupied by their cognate agonists, phosphoinositidase C (PIC)1 is activated, phosphatidylinositol 4,5-bisphosphate is hydrolyzed and inositol 1,4,5-trisphosphate (InsP3) and diacylglycerol are formed (1). InsP3 is a second messenger that elicits calcium signals within cells that mediate many physiological processes (1, 2). The primary effect of InsP3 is to trigger calcium release from the endoplasmic reticulum, thus raising cytoplasmic free calcium concentration ([Ca2+]i) (1, 2). This is achieved by interaction of InsP3 with InsP3 receptors, proteins that form tetrameric complexes in the endoplasmic reticulum membrane and that act as calcium channels (3, 4).

Three types of InsP3 receptor, namely, types I, II, and III, have been defined; they have similar sizes (2670-2749 amino acids) and the same basic structure (3-7). For the type I InsP3 receptor, which is the predominant type in neuronal cells (3-5), three domains have been defined: an InsP3-binding domain within the N-terminal 650 amino acids, a transmembrane or channel-forming domain close to the C terminus, and an intervening coupling domain (3, 4, 8). Several lines of evidence indicate that a conformational change occurs upon InsP3 binding and that this is responsible for channel opening (3, 4, 8).

The waning of cellular responses during persistent activation of cell surface receptors is a well documented phenomenon (9) and is evident for PIC-coupled receptors (10, 11). Such "desensitization" is mediated by several mechanisms, some of which occur acutely (within minutes), and some of which require long-term exposure to agonists (9-11). One of the mechanisms by which cells adapt during long-term agonist exposure is by down-regulation of cell surface receptors, which is characterized by a decline in the cellular content of these proteins (9-11). Remarkably, it has recently been found that InsP3 receptors are also subject to down-regulation upon stimulation of PIC-linked cell surface receptors (12-16), providing a novel locus of adaptation. It has also been shown that InsP3 receptor down-regulation can be induced by receptor-independent activation of PIC (17-19). This phenomenon is seen with types I, II, and III InsP3 receptors in a range of cell types (12-16). For example, stimulation of M3 muscarinic receptors in SH-SY5Y human neuroblastoma cells with carbachol (CCh), a metabolically stable analogue of acetylcholine, reduces type I InsP3 receptor immunoreactivity by ~90%, with half maximal effect at 0.5-1 h (13, 20). This reduction in InsP3 receptor content is a specific process, as the other proteins are not simultaneously down-regulated (14-16, 20). Moreover, the down-regulation is not related to changes in mRNA levels, but rather, it results from a profound acceleration of InsP3 receptor degradation (13). The responsible proteolytic mechanism has yet to be defined but has been proposed to involve either calpain (20) or the ubiquitin/proteasome pathway (15).

Previous studies have shown that InsP3 receptor down-regulation correlates with persistent increases in InsP3 concentration and is not mediated by a diacylglycerol-dependent pathway (12, 14, 21). As yet, however, it is not clear whether receptor proteolysis is initiated by InsP3 binding to its receptor, by Ca2+ signals generated following activation of InsP3 receptors or by a more indirect cell surface receptor-mediated mechanism (22). Thus, to define whether or not InsP3 binding is the signal that initiates InsP3 receptor degradation, we established SH-SY5Y cell lines stably expressing wild-type and mutant type I InsP3 receptors and focused on the characteristics of a binding-defective mutant. We found that this mutant InsP3 receptor was resistant to down-regulation, whereas wild-type InsP3 receptor was appropriately down-regulated. Thus, our data indicate that InsP3 binding directly activates InsP3 receptor down-regulation.

    EXPERIMENTAL PROCEDURES

Plasmids-- Two mammalian expression plasmids, pcWI and pcWI316, which encode wild-type mouse SI+/SII+ type I InsP3 receptor (InsP3R) and an InsP3 binding-defective mouse type I InsP3 receptor (Delta InsP3R), respectively, were constructed by subcloning the cDNA inserts of pBactS-C1 and pBactS-C1Delta 316-352 (5, 23) into pcDNA3; full-length cDNA inserts with an EcoRI terminus at the 5'-end and an XbaI terminus at the 3'-end were prepared and ligated to EcoRI/XbaI double-digested pcDNA3 as described (24).

Epitope Tagging of InsP3 Receptors-- In order to tag InsP3 receptors at their C termini with an epitope (YPYDVPDYA) derived from influenza virus hemagglutinin (HA) (25), a 27-base pair nucleotide sequence encoding the epitope was introduced immediately preceding the stop codon using fusion polymerase chain reaction (26). Two pairs of primers were used: one pair consisted of P1 (5'- CACCCGCAATGGACGGTCCATCATC -3') and P2 (5'-GTCTGGGACGTCGTATGGGTAGGCCGGCTGCTGTGG-3'), and the other pair consisted of P3 (5'-TACGACGTCCCAGACTACGCTTAGGCAAATGAGGCA-3') and P4 (5'-GAATGACACCTACTCAGACAATGCG-3'). Amplifying the 9071-base pair InsP3R cDNA insert from nucleotides 7627 to 8575 with P1/P2 generated a fragment carrying the HA epitope sequence at its 3'-end. Another fragment, with the HA epitope sequence at its 5'-end, was produced by amplifying the region between nucleotides 8576 of the insert and 1177 of the vector with P3/P4. The two DNA fragments are complementary to each other over the HA epitope sequence and were joined through denaturing, annealing, and DNA synthesis, yielding a 1669-base pair DNA fragment with an in-frame HA epitope coding sequence. After amplification with P1/P4, this fragment was used to replace the sequence between the Sse8387I and XbaI sites within pcWI and pcWI316, respectively. The resultant plasmids were designated as pcWIHA and pcWI316HA and encode HA epitope-tagged InsP3R (InsP3RHA) and Delta InsP3R (Delta InsP3RHA). Nucleotide sequencing was performed throughout to validate all manipulations.

Cell Culture and Transfection-- SH-SY5Y human neuroblastoma cells and HEK293 cells were grown as monolayers as described (14). Culture medium (14) was routinely changed every 3 days and replaced 1 day before experiments. For stable transfection (27), cells (~80% confluent) in 3.5-cm-diameter dishes received a mixture of plasmid DNA (1 µg) and LipofectAMINE (8 µl) in 1.2 ml of serum- and antibiotic-free medium. Following 10 h of incubation, the mixture was removed by three washes with 2 ml of culture medium before the culture was resumed in 2 ml of the same medium. 38 h later, cells were 1:40 to 1:80 subcultured, and Geneticin (500 µg/ml for SH-SY5Y cells and 1000 µg/ml for HEK293 cells) was added to the culture medium. Geneticin-resistant colonies were then screened for elevated InsP3 receptor expression or expression of HA-tagged InsP3 receptors by immunoblotting and were maintained in Geneticin (250 µg/ml for SH-SY5Y cells or 500 µg/ml for HEK293 cells). For transient transfection (27), SH-SY5Y cells (~80% confluent) in 6-cm-diameter dishes were incubated with DNA (2 µg) and LipofectAMINE (16 µl) in 2.4 ml of serum- and antibiotic-free medium for 8 h followed by three 2-ml washes and resumption of culture in 2.4 ml of culture medium. Because exogenous InsP3 receptor expression was constant 24-36 h after starting the transfection,2 all experiments were carried out within this period.

Measurement of Ca2+ Mobilization in Permeabilized and Intact Cells-- Ca2+ release from intracellular stores in permeabilized cells was measured as described previously (28). In brief, cells in a 15-cm-diameter dish were harvested in 155 mM NaCl, 10 mM HEPES, 1 mM EDTA, pH 7.4 (HBSE), washed, and finally resuspended in 2 ml ice-cold cytosol buffer (120 mM KCl, 2 mM KH2PO4, 20 mM HEPES, 2 mM MgCl2, 10 µM EGTA, 5 mM ATP, pH 7.3). After permeabilization with digitonin (100 µg/ml), the cell suspension (1 mg protein/ml) was incubated with 45Ca2+ (~0.3 µCi/ml) for 20 min at room temperature, aliquots were challenged with stimuli for 2 min at 4 °C, and incubations were terminated by filtration through Whatman GF/B filters. The radioactivity bound to the filters (45Ca2+ remaining sequestered within the cells) was determined after 48 h extraction with scintillant.

For examination of Ca2+ mobilization in intact cells (29), cells in a 15-cm-diameter dish were harvested with HBSE and were then washed with and finally resuspended in 1 ml of Krebs-Hepes buffer (25 mM NaHCO3, 118 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 1.3 mM CaCl2, 10 mM D-glucose, 10 mM HEPES, pH 7.4). After equalizing protein concentrations, the cell suspensions were incubated with 3 mM Fura-2 AM (30) for 50 min at 37 °C and excited at 340 or 380 nm, and emission intensity at 510 nm was recorded with a computerized LS-50B luminescence spectrometer (Perkin-Elmer). [Ca2+]i was calculated by installed software as described (29, 30), using 2 µM ionomycin and 10 mM EGTA as calibrating agents.

Purification of InsP3 Receptors and Measurement of InsP3 Binding-- Cells (~90% confluent) in 15-cm-diameter dishes were lysed with 10 ml of ice-cold lysis buffer (150 mM NaCl, 50 mM Tris-base, 1 mM EDTA, 1% Triton X-100, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 10 µM leupeptin, 10 µM pepstatin, 0.2 µM soybean trypsin inhibitor, pH 8.0) and after 20 min on ice were centrifuged (20,000 × g for 20 min at 4 °C). The supernatant was collected and then incubated with antibodies (either CT1 or HA11) for 1 h at 4 °C and subsequently mixed with protein A-Sepharose CL-4B. After incubation for 1 h at 4 °C, the beads were washed three times with lysis buffer, and either resuspended in 50 µl of gel loading buffer (100 mM Tris-HCl, 200 mM dithiothreitol, 4% SDS, 0.2% bromphenol blue, 20% glycerol, pH 6.8) for immunoblotting or washed once more and then resuspended in 1.5 ml of 20 mM Tris-base (pH 8.0), 1 mM EDTA for measurement of InsP3 binding as described (28). Briefly, 100 µl of the bead-receptor complexes were mixed with 50 µl of [3H]InsP3 and 50 µl of 100 mM Tris-base (pH 8.0), 4 mM EDTA. After incubation for 20 min at 4 °C, bound InsP3 was separated from free InsP3 by filtration through Whatman GF/B filters, and radioactivity of bound InsP3 was determined (28). 10 µM InsP3 was used to define nonspecific binding activity.

Preparation of Cells for Immunoblotting-- Cells in 6-cm-diameter dishes were harvested in 1.5 ml of HBSE and collected into 1.5-ml centrifuge tubes. After a centrifugation (400 × g for 2 min), cell pellets were resuspended in 300 µl of ice-cold homogenization buffer (10 mM Tris-base, 1 mM EGTA, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 10 µM leupeptin, 10 µM pepstatin, 0.2 µM soybean trypsin inhibitor, pH 7.4), and were disrupted by 30 passages through a 25 gauge needle. Homogenates were then centrifuged at 16,000 × g for 10 min at 4 °C and pellets were resuspended in 100 µl homogenization buffer, assessed for protein concentration, and then mixed with equal volume of gel loading buffer.

Immunoblot Analysis of InsP3 Receptors-- Immunoprecipitates, membrane preparations, and prestained molecular mass markers were separated in 4 or 5% polyacrylamide gels and then transferred to nitrocellulose membranes (14). Following two sequential 1-h incubations with primary and secondary antibodies at room temperature, immunoreactivity was detected with chemiluminescence and x-ray film as described previously (14).

Measurement of InsP3 Formation-- Cells from a 15-cm-diameter dish were harvested with HBSE, washed, and finally resuspended in 1 ml of Krebs-Hepes buffer. Aliquots of cell suspension (~100 µg of protein) were then stimulated with 1 mM CCh, incubations were terminated, and InsP3 mass was determined using a radioreceptor assay as described previously (29).

Statistical Test-- Unpaired Student's t test was used to examine statistical significance.

Materials-- Sources of materials for cell culture, Ca2+ mobilization studies, immunoprecipitation, immunoblotting, and InsP3 mass measurement have been defined previously (14, 28, 29). Other material sources were as follows: HA11, Babco; pcDNA3, Invitrogen; primers, Genosys; LipofectAMINE and Geneticin, Life Technologies, Inc.; T4 DNA ligase, DeepVent DNA polymerase, EcoRI, and XbaI, New England Biolabs; Sse8387I, Amersham Pharmacia Biotech; and deoxynucleotides, Boehringer Mannheim.

    RESULTS

Stable Expression of Exogenous InsP3 Receptors in SH-SY5Y Cells-- To define the role of InsP3 binding in InsP3 receptor down-regulation, we decided to analyze the characteristics of wild-type and InsP3 binding-defective mutant mouse type I InsP3 receptors and chose SH-SY5Y human neuroblastoma cells for transfection, because InsP3 receptor down-regulation has been characterized in detail in this cell line (12-14). However, we anticipated difficulty in identifying the "exogenous" mouse receptors, as the endogenous InsP3 receptors of SH-SY5Y cells are predominantly (>= 99%) type I (14), and mouse and human type I InsP3 receptors are impossible to discriminate with currently available antisera because they are 99% identical (31). Thus, to facilitate the unequivocal detection of exogenous receptors, we tagged them with a sequence derived from HA (Fig. 1), making them immunoreactive with a monoclonal anti-HA antibody, HA11 (32). Note that the HA epitope was inserted immediately after last amino acid residue of the InsP3 receptor (Fig. 1) and thus should not disrupt the epitope for CT1, a type I receptor-specific rabbit polyclonal antiserum raised against the C-terminal 19 amino acids of the mammalian type I InsP3 receptor (13, 14). Cell lines stably expressing InsP3R (SInsP3R), InsP3RHA (SInsP3RHA), and Delta InsP3RHA (SDelta InsP3RHA), and a control cell line Svec, obtained by transfecting with vector alone, were established (Fig. 1). Surprisingly, however, we were unable to obtain Delta InsP3R-expressing cell lines because cells expressing this mutant grew slowly and, ultimately, died.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic structures of exogenous InsP3 receptors. Wild-type mouse SI+/SII+ type I InsP3R contains 2749 amino acid residues. Deleting 37 amino acids (316-352) yields an InsP3 binding-defective mutant receptor (Delta InsP3R). Both InsP3R and Delta InsP3R were tagged at their C termini with a sequence (YPYDVPDYA) (solid bars) derived from HA, yielding InsP3RHA and Delta InsP3RHA, respectively. The plasmids encoding these proteins are shown in parentheses. The open bars represent the sequence from InsP3R carried by each construct, and the hatched bars represent the CT1 epitope.

Immunochemical analysis of the four transfected cell lines and untransfected SH-SY5Y cells is shown in Fig. 2. A CT1-immunoreactive protein with a molecular mass of ~260 kDa (type I InsP3 receptor) was observed in each cell line (Fig. 2A), and clearly, more of this protein was present in SInsP3R, SInsP3RHA, and SDelta InsP3RHA (lanes 3-5) than in control cells (lanes 1 and 2), indicating that the former cell lines are expressing exogenous type I InsP3 receptors. The faint bands of immunoreactivity migrating at <260 kDa in lanes 3-5 are likely to be degradation products of exogenous receptors. The extent of InsP3 receptor overexpression was 2-4-fold as determined by comparing the signals from serially declining amounts of SInsP3R, SInsP3RHA, and SDelta InsP3RHA membranes with that of membranes prepared from Svec.2 In agreement with previous cDNA transfection studies on other cell types (5, 33, 34), the exogenous receptor in SInsP3R (Fig. 2A, lane 3) exhibited a slightly slower migration rate than endogenous type I InsP3 receptor (lanes 1 and 2). This is most likely because the endogenous and exogenous receptors are different splice variants (3, 4, 35); although the exogenous receptor is expressed from cDNA that contains both of the regions (SI and SII) that can be deleted through alternative splicing (3, 4, 35), the presence or absence of these regions in endogenous receptor of SH-SY5Y cells has not been defined, and it appears that one or both of these regions may be lacking.3 The HA tag further retarded migration of InsP3RHA (Fig. 2A, lane 4), leading, in some analyses (see, for example, Fig. 6c), to the appearance of a double band, the upper of which is InsP3RHA (see Fig. 7A). In contrast, endogenous InsP3 receptor and Delta InsP3RHA co-migrated (Fig. 2A, lanes 1, 2 and 5), indicating that the deletion of amino acids 316-352 compensates for the retardation seen with InsP3RHA.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of exogenous InsP3 receptors in SH-SY5Y cells. Membranes (10 µg/lane) prepared from SH-SY5Y cells (lane 1), Svec (lane 2), SInsP3R(lane 3), SInsP3RHA (lane 4), and SDelta InsP3RHA (lane 5) were electrophoresed and probed in immunoblots with CT1 (A) or HA11 (B). The migration positions of molecular mass markers (in kDa) and endogenous type I InsP3 receptors are indicated by lines and arrows, respectively.

When the same samples were probed with HA11 (Fig. 2B), immunoreactivity was found only in SInsP3RHA and SDelta InsP3RHA (lanes 4 and 5), and the migration differences between InsP3RHA and Delta InsP3RHA that were apparent in Fig. 2A were confirmed. These findings show that HA epitope-tagged InsP3 receptors can be expressed and that no cross-reaction occurs between HA11 and nontagged InsP3 receptors (lanes 1-3). In addition, the increase in CT1 immunoreactivity in SInsP3RHA and SDelta InsP3RHA (Fig. 2A, lanes 4 and 5) shows that the HA tag does not interfere with the CT1 epitope.

A variety of clones with different levels of receptor expression were obtained and were classified as high expressers (showing a distinct (>2-fold) increase in CT1 immunoreactivity) and low expressers (showing little change in CT1 immunoreactivity but clear immunoreactivity against HA11). Thus, only cell lines expressing HA-tagged InsP3 receptor could be clearly classified as being low expressers. The expression of InsP3R, InsP3RHA and Delta InsP3RHA remained constant over at least 50 passages and immunolocalization of the exogenous InsP3 receptors2 showed that they assumed the same subcellular localization as endogenous receptors (20).

InsP3 Binding to InsP3R, Delta InsP3R, InsP3RHA, and Delta InsP3RHA-- Before proceeding with analysis of receptor down-regulation, we needed to define the InsP3 binding characteristics of the exogenous receptors. We wished to determine (i) whether the endogenous InsP3 receptors of SH-SY5Y cells and exogenous wild-type InsP3 receptors have the same binding affinity, (ii) the extent to which the 316-352 deletion blocks InsP3 binding, and (iii) whether the HA tag affects InsP3 binding. To facilitate these studies, we chose to immunopurify the exogenous InsP3 receptors using CT1, and because the endogenous type I receptors of SH-SY5Y cells would hinder the purification, we utilized HEK293 cells, which contain negligible amount of type I InsP3 receptor (14).

HEK293 cell lines stably expressing InsP3R (HInsP3R), Delta InsP3R (HDelta InsP3R), InsP3RHA (HInsP3RHA), and Delta InsP3RHA (HDelta InsP3RHA), as well as a pcDNA3-transfected control cell line (Hvec), were established, and InsP3 binding was assessed. Fig. 3A shows that the Kd values of InsP3R, InsP3RHA and endogenous type I receptor from Svec were not significantly different from each other, indicating that InsP3R has the same binding affinity as endogenous SH-SY5Y type I receptor and that HA tag has no effect on binding. Fig. 3A also shows that Delta InsP3R and Delta InsP3RHA are devoid of specific binding, confirming that the deletion totally abolishes InsP3 binding. Fig. 3B reveals the amount of receptors that were included in the analysis shown in Fig. 3A and indicates that the differences in maximal binding between receptors purified from Svec, HInsP3R, and HInsP3RHA correlate well with differences in the amount of receptors present (Fig. 3B, lanes 1, 3 and 5). In total, these results show that InsP3R, InsP3RHA and endogenous receptors bind InsP3 with very similar characteristics and that the 316-352 deletion totally abolishes InsP3 binding.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   InsP3 binding activity of exogenous InsP3 receptors. InsP3 receptors were immunopurified with CT1. A, immunoprecipitates from Svec (bullet ), Hvec (open circle ), HInsP3R (black-down-triangle ), HDelta InsP3R (down-triangle), HInsP3RHA(black-square), and HDelta InsP3RHA () were incubated with a range of [3H]InsP3 concentrations. Specific [3H]InsP3 binding was then determined and plotted against free InsP3 concentration, and Kd values were calculated for those preparations in which binding was significant. Curves shown are representative of four independent experiments, and Kd values cited are mean ± S.E. of values from those four experiments. B, immunoprecipitates from Svec (lane 1), Hvec (lane 2), HInsP3R (lane 3), HDelta InsP3R (lane 4), HInsP3RHA (lane 5), and HDelta InsP3RHA (lane 6) were probed in an immunoblot with CT1. The migration position of endogenous type I InsP3 receptor is marked by an arrow.

Effects of InsP3R, InsP3RHA, and Delta InsP3RHA on Ca2+ Mobilization and InsP3 Formation-- We next examined the effects of exogenous InsP3 receptors on Ca2+ mobilization to determine (i) whether they are capable of forming functional Ca2+ channels and (ii) whether they modify [Ca2+]i responses, because major effects on this parameter might confound interpretation of data on the down-regulation of exogenous receptors.

First, InsP3-induced Ca2+ release was measured in permeabilized cells. In comparison to Svec, Ca2+ stores in SInsP3R were more sensitive to InsP3, displaying a significantly decreased EC50 and increased maximal response (Fig. 4A). A similar but even greater enhancement was observed in high expresser SInsP3RHA, and this effect correlated with expression level, as low expresser SInsP3RHA exhibited less enhancement (Fig. 4A). These results show that the potency and efficacy of InsP3 are enhanced by expression of exogenous InsP3R and InsP3RHA, indicating that these receptors are localized appropriately within the cell and increase the number of functional InsP3-sensitive Ca2+ channels. Surprisingly, sensitivity to InsP3 was also enhanced in high expresser SDelta InsP3RHA, although only the increase in maximal response was significant (Fig. 4A). Again, this effect correlated with receptor expression level, because a less pronounced enhancement was seen with low expresser SDelta InsP3RHA (Fig. 4A). Thus, despite its inability to bind InsP3, Delta InsP3RHA can also increase the number of functional InsP3-sensitive Ca2+ channels. This appears to be because it can heteromerize with endogenous type I InsP3 receptors (see Fig. 7B) and because not all of the subunits of a tetrameric complex have to be liganded for channel opening to occur (36). Finally, these effects were not due to a change in the general characteristics of Ca2+ stores, as neither Ca2+ uptake nor ionomycin-induced Ca2+ release was altered by the exogenous receptors (Fig. 4A).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of exogenous InsP3 receptors on Ca2+ mobilization. A, suspensions of permeabilized cells (1 mg of protein/ml) were incubated with 45Ca2+ and then challenged with a range of InsP3 concentrations (filled symbols) or with 1 µM ionomycin (open symbols). The amount of 45Ca2+ remaining sequestered (45Ca2+ content) was then determined. Curves, EC50 values, and Rmax (maximal release) shown are mean ± S.E. of 5-9 independent determinations on Svec (bullet  and open circle ), SInsP3R (black-triangle and triangle ), SInsP3RHA (black-square and ), and SDelta InsP3RHA (black-down-triangle  and down-triangle). 45Ca2+ uptake into SInsP3R, SInsP3RHA, and SDelta InsP3RHA was 108 ± 2, 97 ± 3, and 105 ± 4%, respectively, of the Svec value. The numbers in parentheses are EC50 and Rmax values for low expresser SInsP3RHA and SDelta InsP3RHA. B, suspensions of intact Svec (bullet ), SInsP3R (black-triangle), SInsP3RHA (black-square), and SDelta InsP3RHA (black-down-triangle ) were stimulated with 1 mM CCh at the point indicated by the arrow, and peak and plateau [Ca2+]i values were determined. Data shown are mean (traces) or mean ± S.E. (numerical data) of 8-12 independent experiments. Asterisks denote significance (p < 0.01) of differences from Svec values.

Second, Ca2+ mobilization was examined in intact cells. In response to a maximal dose of CCh (1 mM), SInsP3R, SInsP3RHA, and SDelta InsP3RHA, like control cells (Svec), exhibited biphasic increases in [Ca2+ ]i, consisting of a peak and then a plateau (Fig. 4B). We found no difference in plateau [Ca2+]i between Svec and other cell lines, even though they express 2-4 times more InsP3 receptor (Fig. 2) and exhibited enhanced responses to InsP3 when permeabilized (Fig. 4A). Interestingly, peak [Ca2+]i was affected in a subtle way with no change in SInsP3R, a slight and significant increase in SInsP3RHA, and a slight and significant decrease in SDelta InsP3RHA. In addition, responses nearly identical to that of Svec were obtained when low expresser SInsP3RHA and SDelta InsP3RHA were examined, and the minor differences seen in Fig. 4B were not accentuated when a submaximal dose of CCh (10 µM) was used.2 Thus, expression of exogenous receptors does not substantially alter Ca2+ signaling in intact cells, despite the fact that the sensitivity of Ca2+ stores to InsP3 is markedly enhanced in permeabilized cells.

Finally, we examined InsP3 formation in the cell lines, because knowledge of this parameter might explain the apparent discrepancy between the data shown in Fig. 4A and that shown in Fig. 4B and may bear upon the analysis of down-regulation, as a persistent increase in InsP3 concentration appears to be required for down-regulation (12, 14, 21). Time courses of CCh-stimulated InsP3 formation in Svec, SInsP3R, and high expresser SInsP3RHA and SDelta InsP3RHA (Fig. 5) were biphasic and similar to that seen in SH-SY5Y cells (29), consisting of a peak within 20 s of stimulation and a subsequent plateau. Although peak InsP3 concentration was identical in Svec, SInsP3RHA, and SInsP3R and somewhat suppressed in SDelta InsP3RHA, plateau InsP3 concentration did not differ among the four cell lines and, importantly, remained persistently elevated for at least 300 s. Thus, InsP3 formation is not markedly perturbed by the presence of exogenous receptors. However, these data do not explain the findings shown in Fig. 4, A and B; other factors must account for the fact that an increase in the InsP3 sensitivity of Ca2+ stores in permeabilized cells is not reflected as enhanced Ca2+ mobilization in intact cells.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of expression of exogenous InsP3 receptors on InsP3 formation. Suspensions of Svec (bullet ), SInsP3R (black-triangle), SInsP3RHA (black-square), and SDelta InsP3RHA (black-down-triangle ) were exposed to 1 mM CCh for 0-300 s at 37 °C, and InsP3 mass was determined. Data shown are mean ± S.E. of three independent determinations. Asterisks denote significance (p < 0.05) of differences from Svec values.

Analysis of InsP3 Receptor Down-regulation in Stably Transfected SH-SY5Y Cell Lines-- The ability of CCh to down-regulate endogenous and exogenous InsP3 receptors in the transfected cells is shown in Fig. 6. In these studies, cells were stimulated for 0, 4, 8, or 12 h, and InsP3 receptor content was assessed with either CT1 (Fig. 6, a-e) or HA11 (f-j). Note that CT1 recognizes both endogenous and exogenous InsP3 receptors, whereas HA11 recognizes only HA-tagged InsP3 receptors. Stimulation of Svec with CCh caused InsP3 receptor down-regulation identical to that seen in SH-SY5Y cells (13, 14, 20), with maximal effect at ~4 h (Fig. 6, a and e). The same response was observed in SInsP3R (Fig. 6, b and e), indicating that InsP3R is down-regulated identically to endogenous receptor and that the down-regulatory process is not overwhelmed by the burden of additional substrates.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 6.   Down-regulation of InsP3 receptors in the transfected cell lines. Duplicate dishes of cell monolayers were exposed to 1 mM CCh for 0 h (lanes 1 and 2), 4 h (lanes 3 and 4), 8 h (lanes 5 and 6), or 12 h (lanes 7 and 8) and harvested, and membrane fractions were prepared. Samples (10 µg of protein/lane) from Svec (a and f), SInsP3R (b and g), SInsP3RHA (c and h), and SDelta InsP3RHA (d and i) were then electrophoresed and probed with CT1 or HA11 to assess total InsP3 receptor content (endogenous plus exogenous receptors) or the content of HA-tagged receptors, respectively. Densitometrically quantitated InsP3 receptor immunoreactivity in Svec (bullet ), SInsP3R (black-triangle), SInsP3RHA (black-square and ), and SDelta InsP3RHA (black-down-triangle  and down-triangle) is shown in e and j; closed and open symbols denote CT1 and HA11 immunoreactivity, respectively. Asterisks denote significance (p < 0.05) of differences from Svec in panel e and between SInsP3RHA and SDelta InsP3RHA in panel j. Data shown are representative images or mean ± S.E. of six independent determinations.

We next examined down-regulation in SInsP3RHA and SDelta InsP3RHA, in which HA11 can be used to monitor exogenous receptors independently of endogenous receptors. In our preliminary experiments on SInsP3RHA, we found that CCh reduced CT1 and HA11 immunoreactivity in both low and high expressers and that in CT1 immunoblots, endogenous receptor and InsP3RHA could be most clearly resolved in low expresser SInsP3RHA.2 Because we considered it advantageous to be able to simultaneously monitor both endogenous and exogenous receptors with CT1, we chose to analyze down-regulation in low expresser SInsP3RHA. Probing of SInsP3RHA with CT1 showed that immunoreactivity declined in response to CCh in a manner similar to that seen in Svec and SInsP3R, albeit slightly less rapidly, and that the doublet of immunoreactivity, the upper band of which is InsP3RHA (Fig. 7A), was most clearly evident at 4 h (Fig. 6, c and e). Probing with HA11, which exclusively reacts with InsP3RHA, showed that InsP3RHA levels changed in a unique manner, increasing slightly at 4 h, followed by down-regulation at 8 h and beyond (Fig. 6, h and j). This time course appears to explain the relatively slow down-regulation detected by CT1 and why the doublet was clearest at 4 h (Fig. 6c); at this point, InsP3RHA levels had slightly increased and much of the endogenous receptor had been degraded. Note that CT1 immunoreactivity did not increase at 4 h (Fig. 6c), because low expresser SInsP3RHA was analyzed, and thus, the contribution of InsP3RHA to CT1 immunoreactivity is relatively small. Finally, the retardation of InsP3RHA down-regulation was not due to receptor overexpression, as endogenous receptor in SInsP3RHA was degraded normally (Fig. 6c) and InsP3R followed the same down-regulation pattern as endogenous receptor in SInsP3R (Fig. 6b). Rather, the retardation appears to be due to the presence of the HA epitope tag.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Exogenous and endogenous InsP3 receptors co-immunoprecipitate. A, low expresser SInsP3RHA lysates were immunoprecipitated with HA11 without (lanes 3 and 4) or with (lanes 5 and 6) added Svec lysate. The immunoprecipitates were then probed in immunoblots with CT1 or HA11. The migration position of endogenous InsP3 receptor (indicated by arrows) is defined by analysis of CT1-immunopurified Svec InsP3 receptor (lanes 1 and 2). Images shown are representative of four independent experiments. B, low expresser SDelta InsP3RHA monolayers were treated with (+) or without (-) 1 mM CCh for 4 h. Cell lysates were then immunoprecipitated with either CT1 or HA11. InsP3 receptor content in these immunoprecipitates was then assessed in immunoblots with CT1 or HA11 (lanes 1-4) and specific [3H]InsP3 binding was also determined (columns 1-4). Data shown are representative images or mean ± S.E. of three independent determinations. Asterisks denote significance (p < 0.05) of differences between InsP3 binding in control and CCh-stimulated cells.

Probing of low expresser SDelta InsP3RHA with CT1, which again recognizes both endogenous and exogenous InsP3 receptors, showed again that immunoreactivity declined slightly more slowly than that in the control cells (Fig. 6, d and e). Strikingly, however, when the same samples were probed with HA11 to exclusively detect Delta InsP3RHA, immunoreactivity did not decline, but rather increased and was significantly different from SInsP3RHA levels at all time points (Fig. 6, i and j). Again, this had only a slight effect on CT1 immunoreactivity (Fig. 6d), as endogenous receptor is down-regulated normally and the amount of exogenous receptor expressed is relatively small. These data show that Delta InsP3RHA is resistant to down-regulation during muscarinic stimulation even though the down-regulatory process is efficiently operating in SDelta InsP3RHA (Fig. 6d).

In total, the difference in the down-regulation of InsP3RHA and Delta InsP3RHA indicates that ligand binding is required for activation of InsP3 receptor down-regulation. However, interpretation of these data is complicated by the fact that carbachol causes a slight and transient increase in InsP3RHA levels and a persistent increase in Delta InsP3RHA levels. These findings suggest that the HA tag retards receptor degradation and that, in addition to activating the down-regulatory process, carbachol also transiently stimulates InsP3 receptor synthesis; evidence for the latter proposal is provided by the observation that cycloheximide (5 µg/ml) blocked the increases seen in Fig.6j.2 Thus, it appears that carbachol simultaneously stimulates both InsP3 receptor synthesis and degradation in SH-SY5Y cells and that the HA tag allows the effect on receptor synthesis to become significant. This explains why InsP3RHA, which is subject to degradation, increases slightly and transiently, whereas Delta InsP3RHA, which is not subject to degradation, increases more profoundly and persistently. Furthermore, evidence of effects on the synthesis of untagged receptors would not be expected and, indeed, was not seen (Fig. 6, a and b) because for these proteins, the acceleration of degradation is profound (13) and should overwhelm any effect on receptor synthesis.

Heteromerization of Exogenous and Endogenous InsP3 Receptors-- If it could be demonstrated that endogenous and exogenous receptors heteromerize, then it would be certain that exogenous receptors are appropriately located within the cell and that the difference between InsP3RHA and Delta InsP3RHA shown in Fig. 6 is truly due to differential ligand binding. Heteromerization would also explain the surprising increase in sensitivity of SDelta InsP3RHA Ca2+ stores to InsP3 (Fig. 4A) and, importantly, would show that Delta InsP3RHA is present in functional InsP3-gated channels.

Evidence that InsP3RHA and endogenous InsP3 receptors form heteromers is given in Fig. 7A. Probing HA11-derived immunoprecipitates of low expresser SInsP3RHA with HA11 revealed, as expected, a single band that represents InsP3RHA (Fig. 7A, lanes 3 and 4, lower panel). Probing the same samples with CT1 revealed two distinct bands (Fig. 7A, lanes 3 and 4, upper panel), the lower of which is the endogenous InsP3 receptor, because it co-migrated with InsP3 receptor immunopurified with CT1 from Svec (lanes 1 and 2, upper panel), and thus the upper of which is InsP3RHA. The presence of endogenous InsP3 receptors in HA11-derived immunoprecipitates indicates that they have formed heteromers with InsP3RHA. This association was not due to nonspecific protein interactions that might occur during the immunoprecipitation procedure, because introducing more endogenous InsP3 receptors (via Svec lysates) did not increase the recovery of the endogenous receptors (compare lanes 3 and 4 with lanes 5 and 6, upper panel).

This procedure could not be applied to Delta InsP3RHA, as this mutant co-migrates with endogenous InsP3 receptor (Fig. 2, lanes 2 and 5). Instead, lysates of control and CCh-treated SDelta InsP3RHA were immunoprecipitated with CT1 or HA11 and InsP3 binding to the immunocomplexes was determined (Fig. 7B). Binding to the CT1-derived immunoprecipitates, which contain both endogenous receptors and Delta InsP3RHA (Fig. 7B, lanes 1 and 2), was substantially reduced by CCh (columns 1 and 2) because of down-regulation of endogenous receptors; total receptor content, measured with CT1, was reduced by CCh, whereas Delta InsP3RHA levels, measured with HA11, remained unchanged (Fig. 7B, lanes 1 and 2). Importantly, CCh also significantly reduced InsP3 binding in the HA11-derived precipitates (Fig. 7B, columns 3 and 4). As Delta InsP3RHA is unable to bind InsP3 (Fig. 3A) and is not degraded (Fig. 6i), this reduction must be due to the down-regulation of endogenous InsP3 receptor that co-immunoprecipitates with Delta InsP3RHA. This decline in co-immunoprecipitation of endogenous receptors is confirmed by immunochemical analysis with CT1 (Fig. 7B, lanes 3 and 4). This analysis also shows that InsP3 binding in HA11-derived precipitates was relatively low because relatively little endogenous receptor was immunoprecipitated (Fig. 7B, lanes and 4). In total, Fig. 7 shows that InsP3RHA and Delta InsP3RHA can heteromerize with endogenous InsP3 receptors, indicating that exogenous receptors are located appropriately. This explains their ability to enhance Ca2+ mobilization. It is also important to note that the endogenous InsP3 receptors that are associated with Delta InsP3RHA are still liable to down-regulation (Fig. 7B, lanes 3 and 4 and columns 3 and 4). Taken together with results shown in Fig. 6, this indicates that individual subunits in a tetrameric channel are differentially targeted for degradation.

Analysis of InsP3 Receptor Down-regulation in Transiently Transfected Cells-- Finally, because the HA tag could, in principle, alter Delta InsP3R in such a way as to account for the resistance of Delta InsP3RHA to degradation, we sought to analyze the down-regulation of untagged Delta InsP3R. Thus, because we were unable to obtain an SH-SY5Y cell line that produced Delta InsP3R, we analyzed down-regulation in cells transiently expressing this mutant.

Transient transfection of SH-SY5Y cells with pcWI or pcWI316 elevated InsP3 receptor immunoreactivity to approximately twice the level seen in control pcDNA3-transfected cells (Fig. 8A, lanes 1, 4, and 7) and in agreement with Fig. 2, InsP3R migrated slightly less rapidly than endogenous InsP3 receptor (Fig. 8A, lane 4), whereas Delta InsP3R and endogenous receptor co-migrated (lane 7). Stimulation with 1 mM CCh for 2 and 4 h produced an equivalent reduction in InsP3 receptor immunoreactivity in pcWI- and pcDNA3-transfected cells (Fig. 8A, lanes 1-3 and lanes 4-6, respectively, and Fig. 8B). In contrast, this marked decline in InsP3 receptor immunoreactivity was not seen in cells expressing Delta InsP3R (Fig. 8A, lanes 7-9, and Fig. 8B), showing that Delta InsP3R, like Delta InsP3RHA, is resistant to degradation. This finding confirms that the 316-352 deletion renders the InsP3 receptor resistant to down-regulation.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 8.   Delta InsP3R is resistant to down-regulation. A, SH-SY5Y cells were transiently transfected with pcDNA3 (lanes 1-3), pcWI (lanes 4-6), or pcWI316 (lanes 7-9) and were then exposed to 1 mM CCh for 0 h (lanes 1, 4, and 7), 2 h (lanes 2, 5, and 8), or 4 h (lanes 3, 6, and 9). InsP3 receptor content was then determined in immunoblots with CT1. The image shown is representative of six independent experiments. B, densitometrically quantitated CT1 immunoreactivity in pcDNA3-transfected (bullet ), pcWI-transfected(black-triangle), and pcWI316-transfected (black-down-triangle ) SH-SY5Y cells (mean ± S.E. of six independent experiments). Asterisks denote significance (p < 0.05) of differences from pcDNA3-transfected cells.


    DISCUSSION

The data presented show (i) that deletion of 37 amino acids within the ligand-binding domain of the type I InsP3 receptor renders it unable to bind InsP3 and blocks its down-regulation, (ii) that introduction of exogenous InsP3 receptors into SH-SY5Y cells does not adversely affect signaling via PIC-linked receptors, and (iii) that exogenous receptors are appropriately located within the cell and form heteromers and functional Ca2+ channels with endogenous receptors. Thus, we conclude that InsP3 binding directly activates InsP3 receptor degradation.

Importantly, our studies on the effects of exogenous InsP3 receptors on signaling in intact SH-SY5Y cells are the first in a mammalian cell type in which both the complement of endogenous InsP3 receptors is known (SH-SY5Y cells contain >99% type I receptor (14)), and an appreciable overexpression of InsP3 receptor has been achieved. To date, the effects of exogenous InsP3 receptors on intracellular signaling have been examined in only three other mammalian cell types (33, 34, 37, 38), the most comprehensive of these analyses being performed on 3T3 fibroblasts (37). However, in that study, only very limited overexpression of exogenous type I receptor was achieved (15-30% above endogenous values) and possible interaction with endogenous type II and III receptors, which make up ~90% of the total receptor complement in this cell type (39), was not assessed (37). Interestingly, however, whereas wild-type receptors had no effect on Ca2+ signaling or InsP3 formation in intact cells, a deletion mutant lacking the N-terminal InsP3-binding domain, which is analogous to the Delta InsP3RHA mutant used in the present study, enhanced the sensitivity of Ca2+ stores to InsP3 in permeabilized cells and inhibited agonist-stimulated InsP3 production and [Ca2+]i increases in intact cells (37). These results parallel our findings in SDelta InsP3RHA and indicate that the effects of exogenous binding-defective mutants are complex. In the other study in which Ca2+ signaling was analyzed in intact cells (38), severalfold overexpression of type III receptor in beta TC-3 insulin-producing cells doubled peak [Ca2+]i in intact cells, but other parameters were not monitored. Finally, in L-cell fibroblasts, a much higher (~8-fold) overexpression of wild-type type I receptor was achieved, and this substantially enhanced Ca2+ store sensitivity to InsP3 in permeabilized cells; however, Ca2+ signaling in intact cells was not examined (33, 34). Thus, our findings are broadly in agreement with these studies, in that overexpression of either wild-type or InsP3 binding-defective mutant receptors enhances the sensitivity of Ca2+ stores to InsP3. Surprisingly, however, this enhancement was not translated into increases in [Ca2+ ]i in intact cells in response to cell surface receptor stimulation. Although in the previous study on 3T3 cells (37) this apparent paradox was attributed to a substantial decrease in InsP3 production in response to cell surface receptor activation, such an explanation can not be applied to the present study, in which InsP3 production in response to CCh was not consistently or substantially affected by the presence of exogenous receptors. Thus, other, perhaps more subtle, mechanisms may serve to control [Ca2+]i in the transfected SH-SY5Y cells. Indeed, given the spatial and temporal complexity of Ca2+ release in intact cells (1, 2) and, in particular, the ability of mobilized Ca2+ to suppress further InsP3 receptor-mediated Ca2+ release (1, 2, 40), it is perhaps naive to think that an enhancement of InsP3-induced Ca2+ release in permeabilized cells will be translated into changes in [Ca2+ ]i in intact cells.

The surprising ability of Delta InsP3RHA to enhance the sensitivity of Ca2+ stores to InsP3 indicates that this mutant increases the number of InsP3-sensitive Ca2+ channels, presumably by forming heterotetramers with endogenous receptors. The existence of these complexes is supported directly by the observed co-immunoprecipitation of exogenous and endogenous receptors and is important to the interpretation of our down-regulation data; the presence of Delta InsP3RHA in channels that are mediating Ca2+ release from the endoplasmic reticulum and the fact that only endogenous receptors are down-regulated from these channels indicate that Ca2+ flux alone does not activate receptor degradation. This argues against the proposal that activation of Ca2+-dependent proteases in the vicinity of the InsP3 receptor complex might be the sole mediator of receptor degradation (20). Rather, InsP3 binding appears to be the critical signal for degradation, because only this could account for the selective degradation of endogenous receptors in Delta InsP3RHA-containing channels.

Given this conclusion, it is tempting to speculate upon what it is about InsP3 binding that activates receptor degradation. InsP3 binding induces a substantial but as yet undefined conformational change in the ligand-binding domain of the type I receptor (8), which obviously will not occur in the binding-defective mutant. This appears to be the primary consequence of InsP3 binding, and it can be envisaged that such a conformational change might expose regions of the receptor that either are cleavage sites for proteases (20) or are sites that facilitate ubiquitin conjugation (15). Intriguingly, preliminary analysis of CCh-stimulated ubiquitination in the transfected cells suggest that the latter possibility may be correct, as endogenous receptors and InsP3RHA are ubiquitinated, but Delta InsP3RHA is not.2

Finally, it is important to consider the effects of the HA tag on InsP3 receptor function and down-regulation. First, the HA tag did not appear to impair InsP3 receptor function, as expression of similar levels of InsP3R and InsP3RHA had similar effects on Ca2+ mobilization in permeabilized and intact cells. However, given our inability to stably express Delta InsP3R in SH-SY5Y cells,4 it is possible that the tag has a subtle effect that is not detected in these assays. Perhaps Delta InsP3R is too disruptive to be stably expressed in SH-SY5Y cells, and addition of the HA tag to this mutant compensates for its disruptive effect. This speculation has a basis in studies showing that interference with the InsP3 receptor C-terminal modifies receptor function (41, 42). It is also intriguing that the HA tag retards receptor down-regulation, indicating that interference with the C terminus inhibits the down-regulatory process. Thus, the C terminus may play a role in the events that lead to receptor degradation.

In summary, our data show that the InsP3 receptor degradation that occurs in response to stimulation of PIC-linked cell surface receptors is activated directly by the interaction of InsP3 with its receptor. It will be intriguing to define how InsP3 binding stimulates receptor proteolysis.

    ACKNOWLEDGEMENTS

We thank Drs. Jon Oberdorf, Mary Lou Vallano, and Barry Knox for many helpful discussions.

    FOOTNOTES

* This work was supported by Grant DK49194 from the National Institutes of Health and by a grant-in-aid from the American Heart Association (NY State Affiliate, Inc.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Pharmacology, College of Medicine, State University of New York Health Science Center at Syracuse, 750 E. Adams St., Syracuse, NY 13210-2339. Tel.: 315-464-7956; Fax: 315-464-8014; E-mail: wojcikir{at}vax.cs.hscsyr.edu.

The abbreviations used are: PIC, phosphoinositidase C; CCh, carbachol; HA, hemagglutinin; InsP3, inositol 1,4,5-trisphosphate; InsP3R, wild-type mouse type I InsP3 receptor; Delta InsP3R, InsP3 binding-defective mouse type I InsP3 receptor; InsP3RHA, HA epitope-tagged InsP3R; Delta InsP3RHA, HA epitope-tagged Delta InsP3R.

2 C.-C. Zhu and R. J. H. Wojcikiewicz, unpublished data.

3 Surprisingly, it appears most likely that the SII region is absent from the endogenous receptor, as the migration rates of SI+ and SI- receptors appear to be identical (28, 43), and cerebellar receptor, which is predominantly SI- (35, 43), co-migrates with receptor expressed from the cDNA used in the present study (5). This conclusion is surprising because central nervous system tissue expresses predominantly SII+ variants (3, 4, 35), and it suggests that the InsP3 receptor mRNA splicing that occurs in SH-SY5Y cells may be different from that which occurs in the central nervous system.

4 Although Delta InsP3R could not be expressed stably in SH-SY5Y cells, stable expression of this mutant was possible in HEK293 cells (Fig. 3), and an analogous mutant can be expressed in 3T3 cells (37). Thus, some cell types can tolerate Delta InsP3R. Differential tolerance may relate to differential InsP3 receptor expression; SH-SY5Y cells express almost exclusively type I receptor, whereas HEK293 and 3T3 cells express 3 and 12% type I receptor, respectively (14, 39).

    REFERENCES
Top
Abstract
Introduction
References

  1. Berridge, M. J. (1993) Nature 361, 315-325[CrossRef][Medline] [Order article via Infotrieve]
  2. Clapham, D. E. (1995) Cell 80, 259-268[CrossRef][Medline] [Order article via Infotrieve]
  3. Joseph, S. K. (1996) Cell. Signal. 8, 1-7[CrossRef][Medline] [Order article via Infotrieve]
  4. Yoshida, Y., and Imai, S. (1997) Jpn. J. Pharmacol. 74, 125-137[Medline] [Order article via Infotrieve]
  5. Furuichi, T., Yoshikawa, S., Miyawaki, A., Wada, K., Maeda, N., and Mikoshiba, K. (1989) Nature 342, 32-38[CrossRef][Medline] [Order article via Infotrieve]
  6. Sudhof, T. C., Newton, C. L., Archer, B. T., III, Ushkaryov, Y. A., and Mignery, G. A. (1991) EMBO J. 10, 3199-3206[Medline] [Order article via Infotrieve]
  7. Blondel, O., Takeda, J., Janssen, H., Seino, S., and Bell, G. I. (1993) J. Biol. Chem. 268, 11356-11363[Abstract/Free Full Text]
  8. Mignery, G. A., and Sudhof, T. C. (1990) EMBO J. 9, 3893-3898[Medline] [Order article via Infotrieve]
  9. Lohse, M. J. (1993) Biochim. Biophys. Acta 1179, 171-188[Medline] [Order article via Infotrieve]
  10. Wojcikiewicz, R. J. H., Tobin, A. B., and Nahorski, S. R. (1993) Trends Pharmacol. Sci. 14, 279-285[CrossRef][Medline] [Order article via Infotrieve]
  11. Fisher, S. K. (1995) Eur. J. Pharmacol. 288, 231-250[CrossRef][Medline] [Order article via Infotrieve]
  12. Wojcikiewicz, R. J. H., and Nahorski, S. R. (1991) J. Biol. Chem. 266, 22234-22241[Abstract/Free Full Text]
  13. Wojcikiewicz, R. J. H., Furuichi, T., Nakade, S., Mikoshiba, K., and Nahorski, S. R. (1994) J. Biol. Chem. 269, 7963-7969[Abstract/Free Full Text]
  14. Wojcikiewicz, R. J. H. (1995) J. Biol. Chem. 270, 11678-11683[Abstract/Free Full Text]
  15. Bokkala, S., and Joseph, S. K. (1997) J. Biol. Chem. 272, 12454-12461[Abstract/Free Full Text]
  16. Sipma, H., Deelman, L., Smedt, H. D., Missiaen, L., Parys, J. B., Vanlingen, S., Henning, R. H., and Casteels, R. (1998) Cell Calcium 23, 11-21[CrossRef][Medline] [Order article via Infotrieve]
  17. Honda, Z., Takano, T., Hirose, N., Suzuki, T., Muto, A., Kume, S., Mikoshiba, K., Itoh, K., and Shimizu, T. (1995) J. Biol. Chem. 270, 4840-4844[Abstract/Free Full Text]
  18. Lobaugh, L. A., Eisfelder, B., Gibson, K., Johnson, G. L., and Putney, J. W., Jr. (1996) Mol. Pharmacol. 50, 493-500[Abstract]
  19. Quick, M. W., Lester, H. A., Davidson, N., Simon, M. I., and Aragay, A. M. (1996) J. Biol. Chem. 271, 32021-32027[Abstract/Free Full Text]
  20. Wojcikiewicz, R. J. H., and Oberdorf, J. A. (1996) J. Biol. Chem. 271, 16652-16655[Abstract/Free Full Text]
  21. Wojcikiewicz, R. J. H., Nakade, S., Mikoshiba, K., and Nahorski, S. R. (1992) J. Neurochem. 59, 383-386[CrossRef][Medline] [Order article via Infotrieve]
  22. Gutkind, J. S. (1998) J. Biol. Chem. 273, 1839-1842[Free Full Text]
  23. Miyawaki, A., Furuichi, T., Ryou, Y., Yoshikawa, S., Nakagawa, T., Saitoh, T., and Mikoshiba, K. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4911-4915[Abstract/Free Full Text]
  24. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, pp. 1.68-1.69, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  25. Kolodziej, P. A., and Young, R. A. (1991) Methods Enzymol. 194, 508-519[Medline] [Order article via Infotrieve]
  26. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 51-59[CrossRef][Medline] [Order article via Infotrieve]
  27. Kingston, R. E. (1987) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., and Moore, D. D., eds), pp. 9.4.1-9.4.3, John Wiley & Sons, Inc., New York
  28. Wojcikiewicz, R. J. H., and Luo, S. G. (1998) Mol. Pharmacol. 53, 656-662[Abstract/Free Full Text]
  29. Wojcikiewicz, R. J. H., Tobin, A. B., and Nahorski, S. R. (1994) J. Neurochem. 63, 177-185[Medline] [Order article via Infotrieve]
  30. Grynkiewicz, G., Poenie, M., and Tsien, R. Y. (1985) J. Biol. Chem. 260, 3440-3450[Abstract/Free Full Text]
  31. Yamada, N., Makino, Y., Clark, R. A., Pearson, D. W., Mattei, M. G., Guenet, J. L., Ohama, E., Fujino, I., Miyawaki, A., Furuichi, T., and Mikoshiba, K. (1994) Biochem J. 302, 781-790
  32. Kaplan, K. B., Hyman, A. A., and Sorger, P. K. (1997) Cell 91, 491-500[CrossRef][Medline] [Order article via Infotrieve]
  33. Miyawaki, A., Furuichi, T., Maeda, N., and Mikoshiba, K. (1990) Neuron 5, 11-18[CrossRef][Medline] [Order article via Infotrieve]
  34. Mackrill, J. J., Wilcox