![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 6, 3476-3484, February 5, 1999
,
¶
From the
Department of Pharmacology, College of
Medicine, State University of New York Health Science Center at
Syracuse, New York 13210-2339 and the § Department of
Molecular Neurobiology, Institute of Medical Science, University of
Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan
| |
ABSTRACT |
|---|
|
|
|---|
Activation of certain phosphoinositidase C-linked
cell surface receptors is known to cause an acceleration of the
proteolysis of inositol 1,4,5-trisphosphate (InsP3)
receptors and, thus, lead to InsP3 receptor
down-regulation. To gain insight into this process, we examined whether
or not InsP3 receptor degradation is a direct consequence
of InsP3 binding by analyzing the down-regulation of
exogenous wild-type and binding-defective mutant InsP3
receptors expressed in SH-SY5Y human neuroblastoma cells. Stimulation
of these cells with carbachol showed that wild-type exogenous receptors could be down-regulated but that the binding-defective mutant exogenous
receptors were not. Thus, InsP3 binding appears to mediate down-regulation. To validate this conclusion, a comprehensive analysis
of the effects of the exogenous receptors was undertaken. This showed
that exogenous receptors (i) are localized appropriately within the
cell, (ii) enhance InsP3-induced Ca2+ release
in permeabilized cells, presumably by increasing the number of
InsP3-sensitive Ca2+ channels, (iii) have
minimal effects on Ca2+ mobilization and InsP3
formation in intact cells, (iv) form heteromers with endogenous
receptors, and (v) do not alter the down-regulation of endogenous
receptors. In total, these data show that the introduction of exogenous
receptors into SH-SY5Y cells does not compromise intracellular
signaling or the down-regulatory process. We can thus conclude that
InsP3 binding directly activates InsP3 receptor degradation. Because InsP3 binding induces a conformational
change in the InsP3 receptor, these data suggest that this
change provides the signal for accelerated proteolysis.
When certain types of G-protein-coupled cell surface receptors
(for example, M3 muscarinic receptors) are occupied by their cognate
agonists, phosphoinositidase C
(PIC)1 is activated,
phosphatidylinositol 4,5-bisphosphate is hydrolyzed and inositol
1,4,5-trisphosphate (InsP3) and diacylglycerol are formed
(1). InsP3 is a second messenger that elicits calcium signals within cells that mediate many physiological processes (1, 2).
The primary effect of InsP3 is to trigger calcium release
from the endoplasmic reticulum, thus raising cytoplasmic free calcium
concentration ([Ca2+]i) (1, 2). This is achieved
by interaction of InsP3 with InsP3 receptors,
proteins that form tetrameric complexes in the endoplasmic reticulum
membrane and that act as calcium channels (3, 4).
Three types of InsP3 receptor, namely, types I, II, and
III, have been defined; they have similar sizes (2670-2749 amino
acids) and the same basic structure (3-7). For the type I
InsP3 receptor, which is the predominant type in neuronal
cells (3-5), three domains have been defined: an
InsP3-binding domain within the N-terminal 650 amino acids,
a transmembrane or channel-forming domain close to the C terminus, and
an intervening coupling domain (3, 4, 8). Several lines of evidence
indicate that a conformational change occurs upon InsP3
binding and that this is responsible for channel opening (3, 4, 8).
The waning of cellular responses during persistent activation of cell
surface receptors is a well documented phenomenon (9) and is evident
for PIC-coupled receptors (10, 11). Such "desensitization" is
mediated by several mechanisms, some of which occur acutely (within
minutes), and some of which require long-term exposure to agonists
(9-11). One of the mechanisms by which cells adapt during long-term
agonist exposure is by down-regulation of cell surface receptors, which
is characterized by a decline in the cellular content of these proteins
(9-11). Remarkably, it has recently been found that InsP3
receptors are also subject to down-regulation upon stimulation of
PIC-linked cell surface receptors (12-16), providing a novel locus of
adaptation. It has also been shown that InsP3 receptor
down-regulation can be induced by receptor-independent activation of
PIC (17-19). This phenomenon is seen with types I, II, and III
InsP3 receptors in a range of cell types (12-16). For example, stimulation of M3 muscarinic receptors in SH-SY5Y human neuroblastoma cells with carbachol (CCh), a metabolically stable analogue of acetylcholine, reduces type I InsP3 receptor
immunoreactivity by ~90%, with half maximal effect at 0.5-1 h (13,
20). This reduction in InsP3 receptor content is a specific
process, as the other proteins are not simultaneously down-regulated
(14-16, 20). Moreover, the down-regulation is not related to changes in mRNA levels, but rather, it results from a profound acceleration of InsP3 receptor degradation (13). The responsible
proteolytic mechanism has yet to be defined but has been proposed to
involve either calpain (20) or the ubiquitin/proteasome pathway
(15).
Previous studies have shown that InsP3 receptor
down-regulation correlates with persistent increases in
InsP3 concentration and is not mediated by a
diacylglycerol-dependent pathway (12, 14, 21). As yet,
however, it is not clear whether receptor proteolysis is initiated by
InsP3 binding to its receptor, by Ca2+ signals
generated following activation of InsP3 receptors or by a
more indirect cell surface receptor-mediated mechanism (22). Thus, to
define whether or not InsP3 binding is the signal that initiates InsP3 receptor degradation, we established
SH-SY5Y cell lines stably expressing wild-type and mutant type I
InsP3 receptors and focused on the characteristics of a
binding-defective mutant. We found that this mutant InsP3
receptor was resistant to down-regulation, whereas wild-type
InsP3 receptor was appropriately down-regulated. Thus, our
data indicate that InsP3 binding directly activates InsP3 receptor down-regulation.
Plasmids--
Two mammalian expression plasmids, pcWI and
pcWI316, which encode wild-type mouse SI+/SII+
type I InsP3 receptor (InsP3R) and an
InsP3 binding-defective mouse type I InsP3
receptor ( Epitope Tagging of InsP3 Receptors--
In order to
tag InsP3 receptors at their C termini with an epitope
(YPYDVPDYA) derived from influenza virus hemagglutinin (HA) (25), a
27-base pair nucleotide sequence encoding the epitope was introduced
immediately preceding the stop codon using fusion polymerase chain
reaction (26). Two pairs of primers were used: one pair consisted of P1
(5'- CACCCGCAATGGACGGTCCATCATC -3') and P2
(5'-GTCTGGGACGTCGTATGGGTAGGCCGGCTGCTGTGG-3'), and the other pair
consisted of P3 (5'-TACGACGTCCCAGACTACGCTTAGGCAAATGAGGCA-3') and P4
(5'-GAATGACACCTACTCAGACAATGCG-3'). Amplifying the 9071-base pair
InsP3R cDNA insert from nucleotides 7627 to 8575 with
P1/P2 generated a fragment carrying the HA epitope sequence at its
3'-end. Another fragment, with the HA epitope sequence at its 5'-end, was produced by amplifying the region between nucleotides 8576 of the
insert and 1177 of the vector with P3/P4. The two DNA fragments are
complementary to each other over the HA epitope sequence and were
joined through denaturing, annealing, and DNA synthesis, yielding a
1669-base pair DNA fragment with an in-frame HA epitope coding
sequence. After amplification with P1/P4, this fragment was used to
replace the sequence between the Sse8387I and
XbaI sites within pcWI and pcWI316, respectively. The
resultant plasmids were designated as pcWIHA and pcWI316HA and encode
HA epitope-tagged InsP3R (InsP3RHA) and
Cell Culture and Transfection--
SH-SY5Y human neuroblastoma
cells and HEK293 cells were grown as monolayers as described (14).
Culture medium (14) was routinely changed every 3 days and replaced 1 day before experiments. For stable transfection (27), cells (~80%
confluent) in 3.5-cm-diameter dishes received a mixture of plasmid DNA
(1 µg) and LipofectAMINE (8 µl) in 1.2 ml of serum- and
antibiotic-free medium. Following 10 h of incubation, the mixture
was removed by three washes with 2 ml of culture medium before the
culture was resumed in 2 ml of the same medium. 38 h later, cells
were 1:40 to 1:80 subcultured, and Geneticin (500 µg/ml for SH-SY5Y
cells and 1000 µg/ml for HEK293 cells) was added to the culture
medium. Geneticin-resistant colonies were then screened for elevated
InsP3 receptor expression or expression of HA-tagged
InsP3 receptors by immunoblotting and were maintained in
Geneticin (250 µg/ml for SH-SY5Y cells or 500 µg/ml for HEK293
cells). For transient transfection (27), SH-SY5Y cells (~80%
confluent) in 6-cm-diameter dishes were incubated with DNA (2 µg) and
LipofectAMINE (16 µl) in 2.4 ml of serum- and antibiotic-free medium
for 8 h followed by three 2-ml washes and resumption of culture in
2.4 ml of culture medium. Because exogenous InsP3 receptor
expression was constant 24-36 h after starting the
transfection,2 all
experiments were carried out within this period.
Measurement of Ca2+ Mobilization in Permeabilized and
Intact Cells--
Ca2+ release from intracellular stores
in permeabilized cells was measured as described previously (28). In
brief, cells in a 15-cm-diameter dish were harvested in 155 mM NaCl, 10 mM HEPES, 1 mM EDTA, pH
7.4 (HBSE), washed, and finally resuspended in 2 ml ice-cold cytosol
buffer (120 mM KCl, 2 mM
KH2PO4, 20 mM HEPES, 2 mM MgCl2, 10 µM EGTA, 5 mM ATP, pH 7.3). After permeabilization with digitonin (100 µg/ml), the cell suspension (1 mg protein/ml) was incubated with
45Ca2+ (~0.3 µCi/ml) for 20 min at room
temperature, aliquots were challenged with stimuli for 2 min at
4 °C, and incubations were terminated by filtration through Whatman
GF/B filters. The radioactivity bound to the filters
(45Ca2+ remaining sequestered within the cells)
was determined after 48 h extraction with scintillant.
For examination of Ca2+ mobilization in intact cells (29),
cells in a 15-cm-diameter dish were harvested with HBSE and were then
washed with and finally resuspended in 1 ml of Krebs-Hepes buffer (25 mM NaHCO3, 118 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 1.3 mM
CaCl2, 10 mM D-glucose, 10 mM HEPES, pH 7.4). After equalizing protein concentrations,
the cell suspensions were incubated with 3 mM Fura-2 AM
(30) for 50 min at 37 °C and excited at 340 or 380 nm, and emission
intensity at 510 nm was recorded with a computerized LS-50B
luminescence spectrometer (Perkin-Elmer). [Ca2+]i
was calculated by installed software as described (29, 30), using 2 µM ionomycin and 10 mM EGTA as calibrating agents.
Purification of InsP3 Receptors and Measurement of
InsP3 Binding--
Cells (~90% confluent) in
15-cm-diameter dishes were lysed with 10 ml of ice-cold lysis buffer
(150 mM NaCl, 50 mM Tris-base, 1 mM
EDTA, 1% Triton X-100, 0.2 mM phenylmethylsulfonyl
fluoride, 1 mM dithiothreitol, 10 µM
leupeptin, 10 µM pepstatin, 0.2 µM soybean
trypsin inhibitor, pH 8.0) and after 20 min on ice were centrifuged
(20,000 × g for 20 min at 4 °C). The supernatant
was collected and then incubated with antibodies (either CT1 or HA11) for 1 h at 4 °C and subsequently mixed with protein A-Sepharose CL-4B. After incubation for 1 h at 4 °C, the beads were washed three times with lysis buffer, and either resuspended in 50 µl of gel
loading buffer (100 mM Tris-HCl, 200 mM
dithiothreitol, 4% SDS, 0.2% bromphenol blue, 20% glycerol, pH 6.8)
for immunoblotting or washed once more and then resuspended in 1.5 ml
of 20 mM Tris-base (pH 8.0), 1 mM EDTA for
measurement of InsP3 binding as described (28). Briefly,
100 µl of the bead-receptor complexes were mixed with 50 µl of
[3H]InsP3 and 50 µl of 100 mM
Tris-base (pH 8.0), 4 mM EDTA. After incubation for 20 min
at 4 °C, bound InsP3 was separated from free
InsP3 by filtration through Whatman GF/B filters, and
radioactivity of bound InsP3 was determined (28). 10 µM InsP3 was used to define nonspecific
binding activity.
Preparation of Cells for Immunoblotting--
Cells in
6-cm-diameter dishes were harvested in 1.5 ml of HBSE and collected
into 1.5-ml centrifuge tubes. After a centrifugation (400 × g for 2 min), cell pellets were resuspended in 300 µl of ice-cold homogenization buffer (10 mM Tris-base, 1 mM EGTA, 0.2 mM phenylmethylsulfonyl fluoride,
1 mM dithiothreitol, 10 µM leupeptin, 10 µM pepstatin, 0.2 µM soybean trypsin
inhibitor, pH 7.4), and were disrupted by 30 passages through a 25 gauge needle. Homogenates were then centrifuged at 16,000 × g for 10 min at 4 °C and pellets were resuspended in 100 µl homogenization buffer, assessed for protein concentration, and
then mixed with equal volume of gel loading buffer.
Immunoblot Analysis of InsP3
Receptors--
Immunoprecipitates, membrane preparations, and
prestained molecular mass markers were separated in 4 or 5%
polyacrylamide gels and then transferred to nitrocellulose membranes
(14). Following two sequential 1-h incubations with primary and
secondary antibodies at room temperature, immunoreactivity was detected with chemiluminescence and x-ray film as described previously (14).
Measurement of InsP3 Formation--
Cells from a
15-cm-diameter dish were harvested with HBSE, washed, and finally
resuspended in 1 ml of Krebs-Hepes buffer. Aliquots of cell suspension
(~100 µg of protein) were then stimulated with 1 mM
CCh, incubations were terminated, and InsP3 mass was determined using a radioreceptor assay as described previously (29).
Statistical Test--
Unpaired Student's t test was
used to examine statistical significance.
Materials--
Sources of materials for cell culture,
Ca2+ mobilization studies, immunoprecipitation,
immunoblotting, and InsP3 mass measurement have been
defined previously (14, 28, 29). Other material sources were as
follows: HA11, Babco; pcDNA3, Invitrogen; primers, Genosys;
LipofectAMINE and Geneticin, Life Technologies, Inc.; T4 DNA ligase,
DeepVent DNA polymerase, EcoRI, and XbaI, New
England Biolabs; Sse8387I, Amersham Pharmacia Biotech; and
deoxynucleotides, Boehringer Mannheim.
Stable Expression of Exogenous InsP3 Receptors in
SH-SY5Y Cells--
To define the role of InsP3 binding in
InsP3 receptor down-regulation, we decided to analyze the
characteristics of wild-type and InsP3 binding-defective
mutant mouse type I InsP3 receptors and chose SH-SY5Y human
neuroblastoma cells for transfection, because InsP3
receptor down-regulation has been characterized in detail in this cell
line (12-14). However, we anticipated difficulty in identifying the
"exogenous" mouse receptors, as the endogenous InsP3
receptors of SH-SY5Y cells are predominantly (
Immunochemical analysis of the four transfected cell lines and
untransfected SH-SY5Y cells is shown in Fig.
2. A CT1-immunoreactive protein with a
molecular mass of ~260 kDa (type I InsP3 receptor) was
observed in each cell line (Fig. 2A), and clearly, more of this protein was present in SInsP3R,
SInsP3RHA, and
S
When the same samples were probed with HA11 (Fig. 2B),
immunoreactivity was found only in SInsP3RHA and
S
A variety of clones with different levels of receptor expression were
obtained and were classified as high expressers (showing a distinct
(>2-fold) increase in CT1 immunoreactivity) and low expressers
(showing little change in CT1 immunoreactivity but clear
immunoreactivity against HA11). Thus, only cell lines expressing HA-tagged InsP3 receptor could be clearly classified as
being low expressers. The expression of InsP3R,
InsP3RHA and InsP3 Binding to InsP3R,
HEK293 cell lines stably expressing InsP3R
(HInsP3R), Effects of InsP3R, InsP3RHA, and
First, InsP3-induced Ca2+ release was measured
in permeabilized cells. In comparison to Svec,
Ca2+ stores in SInsP3R were more
sensitive to InsP3, displaying a significantly decreased
EC50 and increased maximal response (Fig.
4A). A similar but even
greater enhancement was observed in high expresser
SInsP3RHA, and this effect correlated with
expression level, as low expresser SInsP3RHA
exhibited less enhancement (Fig. 4A). These results show
that the potency and efficacy of InsP3 are enhanced by
expression of exogenous InsP3R and InsP3RHA,
indicating that these receptors are localized appropriately within the
cell and increase the number of functional InsP3-sensitive
Ca2+ channels. Surprisingly, sensitivity to
InsP3 was also enhanced in high expresser
S
Second, Ca2+ mobilization was examined in intact cells. In
response to a maximal dose of CCh (1 mM),
SInsP3R, SInsP3RHA, and
S
Finally, we examined InsP3 formation in the cell lines,
because knowledge of this parameter might explain the apparent
discrepancy between the data shown in Fig. 4A and that shown
in Fig. 4B and may bear upon the analysis of
down-regulation, as a persistent increase in InsP3
concentration appears to be required for down-regulation (12, 14, 21).
Time courses of CCh-stimulated InsP3 formation in
Svec, SInsP3R, and high
expresser SInsP3RHA and
S Analysis of InsP3 Receptor Down-regulation in Stably
Transfected SH-SY5Y Cell Lines--
The ability of CCh to
down-regulate endogenous and exogenous InsP3 receptors in
the transfected cells is shown in Fig. 6. In these studies, cells were stimulated for 0, 4, 8, or 12 h, and
InsP3 receptor content was assessed with either CT1 (Fig. 6, a-e) or HA11 (f-j). Note that CT1 recognizes
both endogenous and exogenous InsP3 receptors, whereas HA11
recognizes only HA-tagged InsP3 receptors. Stimulation of
Svec with CCh caused InsP3 receptor
down-regulation identical to that seen in SH-SY5Y cells (13, 14, 20),
with maximal effect at ~4 h (Fig. 6, a and e).
The same response was observed in SInsP3R (Fig.
6, b and e), indicating that InsP3R
is down-regulated identically to endogenous receptor and that the
down-regulatory process is not overwhelmed by the burden of additional
substrates.
We next examined down-regulation in SInsP3RHA
and S
Probing of low expresser S
In total, the difference in the down-regulation of InsP3RHA
and Heteromerization of Exogenous and Endogenous InsP3
Receptors--
If it could be demonstrated that endogenous and
exogenous receptors heteromerize, then it would be certain that
exogenous receptors are appropriately located within the cell and that
the difference between InsP3RHA and
Evidence that InsP3RHA and endogenous InsP3
receptors form heteromers is given in Fig. 7A. Probing
HA11-derived immunoprecipitates of low expresser
SInsP3RHA with HA11 revealed, as expected, a
single band that represents InsP3RHA (Fig. 7A, lanes
3 and 4, lower panel). Probing the same
samples with CT1 revealed two distinct bands (Fig. 7A, lanes
3 and 4, upper panel), the lower of which is
the endogenous InsP3 receptor, because it co-migrated with InsP3 receptor immunopurified with CT1 from
Svec (lanes 1 and 2, upper panel), and thus the upper of which is
InsP3RHA. The presence of endogenous InsP3
receptors in HA11-derived immunoprecipitates indicates that they have
formed heteromers with InsP3RHA. This association was not
due to nonspecific protein interactions that might occur during the
immunoprecipitation procedure, because introducing more endogenous
InsP3 receptors (via Svec lysates) did not increase the recovery of the endogenous receptors (compare lanes 3 and 4 with lanes 5 and
6, upper panel).
This procedure could not be applied to Analysis of InsP3 Receptor Down-regulation in
Transiently Transfected Cells--
Finally, because the HA tag could,
in principle, alter
Transient transfection of SH-SY5Y cells with pcWI or pcWI316 elevated
InsP3 receptor immunoreactivity to approximately twice the
level seen in control pcDNA3-transfected cells (Fig.
8A, lanes 1, 4, and
7) and in agreement with Fig. 2, InsP3R migrated
slightly less rapidly than endogenous InsP3 receptor (Fig.
8A, lane 4), whereas The data presented show (i) that deletion of 37 amino acids within
the ligand-binding domain of the type I InsP3 receptor renders it unable to bind InsP3 and blocks its
down-regulation, (ii) that introduction of exogenous InsP3
receptors into SH-SY5Y cells does not adversely affect signaling via
PIC-linked receptors, and (iii) that exogenous receptors are
appropriately located within the cell and form heteromers and
functional Ca2+ channels with endogenous receptors. Thus,
we conclude that InsP3 binding directly activates
InsP3 receptor degradation.
Importantly, our studies on the effects of exogenous InsP3
receptors on signaling in intact SH-SY5Y cells are the first in a
mammalian cell type in which both the complement of endogenous InsP3 receptors is known (SH-SY5Y cells contain >99% type
I receptor (14)), and an appreciable overexpression of
InsP3 receptor has been achieved. To date, the effects of
exogenous InsP3 receptors on intracellular signaling have
been examined in only three other mammalian cell types (33, 34, 37,
38), the most comprehensive of these analyses being performed on 3T3
fibroblasts (37). However, in that study, only very limited
overexpression of exogenous type I receptor was achieved (15-30%
above endogenous values) and possible interaction with endogenous type
II and III receptors, which make up ~90% of the total receptor
complement in this cell type (39), was not assessed (37).
Interestingly, however, whereas wild-type receptors had no effect on
Ca2+ signaling or InsP3 formation in intact
cells, a deletion mutant lacking the N-terminal
InsP3-binding domain, which is analogous to the
The surprising ability of Given this conclusion, it is tempting to speculate upon what it is
about InsP3 binding that activates receptor degradation. InsP3 binding induces a substantial but as yet undefined
conformational change in the ligand-binding domain of the type I
receptor (8), which obviously will not occur in the binding-defective
mutant. This appears to be the primary consequence of InsP3
binding, and it can be envisaged that such a conformational change
might expose regions of the receptor that either are cleavage sites for
proteases (20) or are sites that facilitate ubiquitin conjugation (15). Intriguingly, preliminary analysis of CCh-stimulated ubiquitination in
the transfected cells suggest that the latter possibility may be
correct, as endogenous receptors and InsP3RHA are
ubiquitinated, but Finally, it is important to consider the effects of the HA tag on
InsP3 receptor function and down-regulation. First, the HA
tag did not appear to impair InsP3 receptor function, as
expression of similar levels of InsP3R and
InsP3RHA had similar effects on Ca2+
mobilization in permeabilized and intact cells. However, given our
inability to stably express In summary, our data show that the InsP3 receptor
degradation that occurs in response to stimulation of PIC-linked cell
surface receptors is activated directly by the interaction of
InsP3 with its receptor. It will be intriguing to define
how InsP3 binding stimulates receptor proteolysis.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
![]()
EXPERIMENTAL PROCEDURES
InsP3R), respectively, were constructed by
subcloning the cDNA inserts of pBactS-C1 and pBactS-C1
316-352 (5, 23) into pcDNA3; full-length cDNA inserts with an
EcoRI terminus at the 5'-end and an XbaI terminus
at the 3'-end were prepared and ligated to
EcoRI/XbaI double-digested pcDNA3 as
described (24).
InsP3R (
InsP3RHA). Nucleotide sequencing was performed throughout to validate all manipulations.
![]()
RESULTS
99%) type I (14), and
mouse and human type I InsP3 receptors are impossible to
discriminate with currently available antisera because they are 99%
identical (31). Thus, to facilitate the unequivocal detection of
exogenous receptors, we tagged them with a sequence derived from HA
(Fig. 1), making them immunoreactive with
a monoclonal anti-HA antibody, HA11 (32). Note that the HA epitope was
inserted immediately after last amino acid residue of the
InsP3 receptor (Fig. 1) and thus should not disrupt the
epitope for CT1, a type I receptor-specific rabbit polyclonal antiserum
raised against the C-terminal 19 amino acids of the mammalian type I
InsP3 receptor (13, 14). Cell lines stably expressing
InsP3R (SInsP3R), InsP3RHA (SInsP3RHA), and
InsP3RHA (S
InsP3RHA), and a
control cell line Svec, obtained by transfecting with vector alone, were established (Fig. 1). Surprisingly, however, we
were unable to obtain
InsP3R-expressing cell lines
because cells expressing this mutant grew slowly and, ultimately,
died.

View larger version (10K):
[in a new window]
Fig. 1.
Schematic structures of exogenous
InsP3 receptors. Wild-type mouse
SI+/SII+ type I InsP3R
contains 2749 amino acid residues. Deleting 37 amino acids (316-352)
yields an InsP3 binding-defective mutant receptor
(
InsP3R). Both InsP3R and
InsP3R were tagged at their C termini with a sequence
(YPYDVPDYA) (solid bars) derived from HA, yielding
InsP3RHA and
InsP3RHA, respectively. The
plasmids encoding these proteins are shown in parentheses.
The open bars represent the sequence from InsP3R
carried by each construct, and the hatched bars represent
the CT1 epitope.
InsP3RHA (lanes 3-5) than in
control cells (lanes 1 and 2), indicating that
the former cell lines are expressing exogenous type I InsP3
receptors. The faint bands of immunoreactivity migrating at <260 kDa
in lanes 3-5 are likely to be degradation products of
exogenous receptors. The extent of InsP3 receptor overexpression was 2-4-fold as determined by comparing the signals from serially declining amounts of SInsP3R,
SInsP3RHA, and
S
InsP3RHA membranes with that of membranes
prepared from Svec.2 In agreement
with previous cDNA transfection studies on other cell types (5, 33,
34), the exogenous receptor in SInsP3R (Fig.
2A, lane 3) exhibited a slightly slower migration
rate than endogenous type I InsP3 receptor (lanes
1 and 2). This is most likely because the endogenous
and exogenous receptors are different splice variants (3, 4, 35);
although the exogenous receptor is expressed from cDNA that
contains both of the regions (SI and SII) that can be deleted through
alternative splicing (3, 4, 35), the presence or absence of these
regions in endogenous receptor of SH-SY5Y cells has not been defined,
and it appears that one or both of these regions may be
lacking.3 The HA tag further
retarded migration of InsP3RHA (Fig. 2A, lane 4), leading, in some analyses (see, for example, Fig.
6c), to the appearance of a double band, the upper of which
is InsP3RHA (see Fig. 7A). In contrast,
endogenous InsP3 receptor and
InsP3RHA co-migrated (Fig. 2A, lanes 1, 2 and
5), indicating that the deletion of amino acids 316-352
compensates for the retardation seen with InsP3RHA.

View larger version (34K):
[in a new window]
Fig. 2.
Expression of exogenous InsP3
receptors in SH-SY5Y cells. Membranes (10 µg/lane) prepared from SH-SY5Y cells (lane 1),
Svec (lane 2),
SInsP3R(lane 3),
SInsP3RHA (lane 4), and
S
InsP3RHA (lane 5) were
electrophoresed and probed in immunoblots with CT1 (A) or
HA11 (B). The migration positions of molecular mass markers
(in kDa) and endogenous type I InsP3 receptors are
indicated by lines and arrows,
respectively.
InsP3RHA (lanes 4 and
5), and the migration differences between
InsP3RHA and
InsP3RHA that were apparent in
Fig. 2A were confirmed. These findings show that HA
epitope-tagged InsP3 receptors can be expressed and that no
cross-reaction occurs between HA11 and nontagged InsP3 receptors (lanes 1-3). In addition, the increase in CT1
immunoreactivity in SInsP3RHA and
S
InsP3RHA (Fig. 2A, lanes
4 and 5) shows that the HA tag does not interfere with
the CT1 epitope.
InsP3RHA remained constant over
at least 50 passages and immunolocalization of the exogenous
InsP3 receptors2 showed that they assumed the
same subcellular localization as endogenous receptors (20).
InsP3R, InsP3RHA, and
InsP3RHA--
Before proceeding with analysis of
receptor down-regulation, we needed to define the InsP3
binding characteristics of the exogenous receptors. We wished to
determine (i) whether the endogenous InsP3 receptors of
SH-SY5Y cells and exogenous wild-type InsP3 receptors have
the same binding affinity, (ii) the extent to which the 316-352
deletion blocks InsP3 binding, and (iii) whether the HA tag
affects InsP3 binding. To facilitate these studies, we chose to immunopurify the exogenous InsP3 receptors using
CT1, and because the endogenous type I receptors of SH-SY5Y cells would hinder the purification, we utilized HEK293 cells, which contain negligible amount of type I InsP3 receptor (14).
InsP3R
(H
InsP3R), InsP3RHA
(HInsP3RHA), and
InsP3RHA (H
InsP3RHA), as well as a
pcDNA3-transfected control cell line (Hvec),
were established, and InsP3 binding was assessed. Fig.
3A shows that the
Kd values of InsP3R,
InsP3RHA and endogenous type I receptor from
Svec were not significantly different from each
other, indicating that InsP3R has the same binding affinity
as endogenous SH-SY5Y type I receptor and that HA tag has no effect on
binding. Fig. 3A also shows that
InsP3R and
InsP3RHA are devoid of specific binding, confirming that the deletion totally abolishes InsP3 binding. Fig.
3B reveals the amount of receptors that were included in the
analysis shown in Fig. 3A and indicates that the differences
in maximal binding between receptors purified from
Svec, HInsP3R, and HInsP3RHA correlate well with differences in the
amount of receptors present (Fig. 3B, lanes 1, 3 and
5). In total, these results show that InsP3R,
InsP3RHA and endogenous receptors bind InsP3
with very similar characteristics and that the 316-352 deletion totally abolishes InsP3 binding.

View larger version (23K):
[in a new window]
Fig. 3.
InsP3 binding activity of
exogenous InsP3 receptors. InsP3 receptors
were immunopurified with CT1. A, immunoprecipitates from
Svec (
), Hvec (
),
HInsP3R (
), H
InsP3R
(
), HInsP3RHA(
), and
H
InsP3RHA (
) were incubated with a
range of [3H]InsP3 concentrations. Specific
[3H]InsP3 binding was then determined and
plotted against free InsP3 concentration, and
Kd values were calculated for those preparations in
which binding was significant. Curves shown are representative of four
independent experiments, and Kd values cited are
mean ± S.E. of values from those four experiments. B,
immunoprecipitates from Svec (lane 1),
Hvec (lane 2),
HInsP3R (lane 3),
H
InsP3R (lane 4),
HInsP3RHA (lane 5), and
H
InsP3RHA (lane 6) were
probed in an immunoblot with CT1. The migration position of
endogenous type I InsP3 receptor is marked by an
arrow.
InsP3RHA on Ca2+ Mobilization and
InsP3 Formation--
We next examined the effects of
exogenous InsP3 receptors on Ca2+ mobilization
to determine (i) whether they are capable of forming functional
Ca2+ channels and (ii) whether they modify
[Ca2+]i responses, because major effects on this
parameter might confound interpretation of data on the down-regulation
of exogenous receptors.
InsP3RHA, although only the increase in
maximal response was significant (Fig. 4A). Again, this
effect correlated with receptor expression level, because a less
pronounced enhancement was seen with low expresser
S
InsP3RHA (Fig. 4A). Thus, despite
its inability to bind InsP3,
InsP3RHA can also increase the number of functional InsP3-sensitive
Ca2+ channels. This appears to be because it can
heteromerize with endogenous type I InsP3 receptors (see
Fig. 7B) and because not all of the subunits of a tetrameric
complex have to be liganded for channel opening to occur (36). Finally,
these effects were not due to a change in the general characteristics
of Ca2+ stores, as neither Ca2+ uptake nor
ionomycin-induced Ca2+ release was altered by the exogenous
receptors (Fig. 4A).

View larger version (26K):
[in a new window]
Fig. 4.
Effects of exogenous InsP3
receptors on Ca2+ mobilization. A,
suspensions of permeabilized cells (1 mg of protein/ml) were incubated
with 45Ca2+ and then challenged with a range of
InsP3 concentrations (filled symbols) or with 1 µM ionomycin (open symbols). The amount of
45Ca2+ remaining sequestered
(45Ca2+ content) was then determined. Curves,
EC50 values, and Rmax (maximal
release) shown are mean ± S.E. of 5-9 independent determinations
on Svec (
and
),
SInsP3R (
and
),
SInsP3RHA (
and
), and
S
InsP3RHA (
and
).
45Ca2+ uptake into
SInsP3R, SInsP3RHA, and
S
InsP3RHA was 108 ± 2, 97 ± 3, and 105 ± 4%, respectively, of the Svec
value. The numbers in parentheses are EC50 and
Rmax values for low expresser
SInsP3RHA and
S
InsP3RHA. B, suspensions of
intact Svec (
),
SInsP3R (
), SInsP3RHA
(
), and S
InsP3RHA (
) were stimulated
with 1 mM CCh at the point indicated by the
arrow, and peak and plateau [Ca2+]i
values were determined. Data shown are mean (traces) or
mean ± S.E. (numerical data) of 8-12 independent
experiments. Asterisks denote significance
(p < 0.01) of differences from
Svec values.
InsP3RHA, like control cells
(Svec), exhibited biphasic increases in
[Ca2+ ]i, consisting of a peak and then a plateau
(Fig. 4B). We found no difference in plateau
[Ca2+]i between Svec and
other cell lines, even though they express 2-4 times more
InsP3 receptor (Fig. 2) and exhibited enhanced responses to
InsP3 when permeabilized (Fig. 4A).
Interestingly, peak [Ca2+]i was affected in a
subtle way with no change in SInsP3R, a slight
and significant increase in SInsP3RHA, and a
slight and significant decrease in S
InsP3RHA.
In addition, responses nearly identical to that of
Svec were obtained when low expresser
SInsP3RHA and
S
InsP3RHA were examined, and the minor
differences seen in Fig. 4B were not accentuated when a
submaximal dose of CCh (10 µM) was used.2
Thus, expression of exogenous receptors does not substantially alter
Ca2+ signaling in intact cells, despite the fact that the
sensitivity of Ca2+ stores to InsP3 is markedly
enhanced in permeabilized cells.
InsP3RHA (Fig.
5) were biphasic and similar to that seen
in SH-SY5Y cells (29), consisting of a peak within 20 s of
stimulation and a subsequent plateau. Although peak InsP3
concentration was identical in Svec,
SInsP3RHA, and SInsP3R and somewhat suppressed in S
InsP3RHA, plateau
InsP3 concentration did not differ among the four cell
lines and, importantly, remained persistently elevated for at least
300 s. Thus, InsP3 formation is not markedly perturbed
by the presence of exogenous receptors. However, these data do not
explain the findings shown in Fig. 4, A and B;
other factors must account for the fact that an increase in the
InsP3 sensitivity of Ca2+ stores in
permeabilized cells is not reflected as enhanced Ca2+
mobilization in intact cells.

View larger version (17K):
[in a new window]
Fig. 5.
Effects of expression of exogenous
InsP3 receptors on InsP3 formation.
Suspensions of Svec (
),
SInsP3R (
), SInsP3RHA
(
), and S
InsP3RHA (
) were exposed to 1 mM CCh for 0-300 s at 37 °C, and InsP3 mass
was determined. Data shown are mean ± S.E. of three independent
determinations. Asterisks denote significance
(p < 0.05) of differences from
Svec values.

View larger version (70K):
[in a new window]
Fig. 6.
Down-regulation of InsP3
receptors in the transfected cell lines. Duplicate dishes of cell
monolayers were exposed to 1 mM CCh for 0 h
(lanes 1 and 2), 4 h (lanes 3 and
4), 8 h (lanes 5 and 6), or
12 h (lanes 7 and 8) and harvested, and
membrane fractions were prepared. Samples (10 µg of protein/lane)
from Svec (a and f),
SInsP3R (b and g),
SInsP3RHA (c and h), and
S
InsP3RHA (d and i)
were then electrophoresed and probed with CT1 or HA11 to assess total
InsP3 receptor content (endogenous plus exogenous
receptors) or the content of HA-tagged receptors, respectively.
Densitometrically quantitated InsP3 receptor
immunoreactivity in Svec (
),
SInsP3R (
), SInsP3RHA
(
and
), and S
InsP3RHA (
and
) is
shown in e and j; closed and
open symbols denote CT1 and HA11
immunoreactivity, respectively. Asterisks denote
significance (p < 0.05) of differences from
Svec in panel e and between
SInsP3RHA and
S
InsP3RHA in panel j. Data shown
are representative images or mean ± S.E. of six independent
determinations.
InsP3RHA, in which HA11 can be used to
monitor exogenous receptors independently of endogenous receptors. In
our preliminary experiments on SInsP3RHA, we
found that CCh reduced CT1 and HA11 immunoreactivity in both low and
high expressers and that in CT1 immunoblots, endogenous receptor and
InsP3RHA could be most clearly resolved in low expresser
SInsP3RHA.2 Because we considered it
advantageous to be able to simultaneously monitor both endogenous and
exogenous receptors with CT1, we chose to analyze down-regulation in
low expresser SInsP3RHA. Probing of
SInsP3RHA with CT1 showed that immunoreactivity declined in response to CCh in a manner similar to that seen in Svec and SInsP3R, albeit
slightly less rapidly, and that the doublet of immunoreactivity, the
upper band of which is InsP3RHA (Fig.
7A), was most clearly evident
at 4 h (Fig. 6, c and e). Probing with HA11,
which exclusively reacts with InsP3RHA, showed that
InsP3RHA levels changed in a unique manner, increasing slightly at 4 h, followed by down-regulation at 8 h and
beyond (Fig. 6, h and j). This time course
appears to explain the relatively slow down-regulation detected by CT1
and why the doublet was clearest at 4 h (Fig. 6c); at
this point, InsP3RHA levels had slightly increased and much
of the endogenous receptor had been degraded. Note that CT1
immunoreactivity did not increase at 4 h (Fig. 6c), because low expresser SInsP3RHA was analyzed,
and thus, the contribution of InsP3RHA to CT1
immunoreactivity is relatively small. Finally, the retardation of
InsP3RHA down-regulation was not due to receptor
overexpression, as endogenous receptor in SInsP3RHA was degraded normally (Fig.
6c) and InsP3R followed the same down-regulation
pattern as endogenous receptor in SInsP3R (Fig.
6b). Rather, the retardation appears to be due to the
presence of the HA epitope tag.

View larger version (21K):
[in a new window]
Fig. 7.
Exogenous and endogenous InsP3
receptors co-immunoprecipitate. A, low expresser
SInsP3RHA lysates were immunoprecipitated with
HA11 without (lanes 3 and 4) or with (lanes
5 and 6) added Svec lysate. The
immunoprecipitates were then probed in immunoblots with CT1 or HA11.
The migration position of endogenous InsP3 receptor
(indicated by arrows) is defined by analysis of
CT1-immunopurified Svec InsP3
receptor (lanes 1 and 2). Images shown are
representative of four independent experiments. B, low
expresser S
InsP3RHA monolayers were
treated with (+) or without (-) 1 mM CCh for 4 h.
Cell lysates were then immunoprecipitated with either CT1 or HA11.
InsP3 receptor content in these immunoprecipitates was then
assessed in immunoblots with CT1 or HA11 (lanes 1-4) and
specific [3H]InsP3 binding was also
determined (columns 1-4). Data shown are representative
images or mean ± S.E. of three independent determinations.
Asterisks denote significance (p < 0.05) of
differences between InsP3 binding in control and
CCh-stimulated cells.
InsP3RHA with CT1,
which again recognizes both endogenous and exogenous InsP3
receptors, showed again that immunoreactivity declined slightly more
slowly than that in the control cells (Fig. 6, d and
e). Strikingly, however, when the same samples were probed
with HA11 to exclusively detect
InsP3RHA,
immunoreactivity did not decline, but rather increased and was
significantly different from SInsP3RHA levels at
all time points (Fig. 6, i and j). Again, this
had only a slight effect on CT1 immunoreactivity (Fig. 6d),
as endogenous receptor is down-regulated normally and the amount of
exogenous receptor expressed is relatively small. These data show that
InsP3RHA is resistant to down-regulation during
muscarinic stimulation even though the down-regulatory process is
efficiently operating in S
InsP3RHA (Fig.
6d).
InsP3RHA indicates that ligand binding is required
for activation of InsP3 receptor down-regulation. However,
interpretation of these data is complicated by the fact that carbachol
causes a slight and transient increase in InsP3RHA levels
and a persistent increase in
InsP3RHA levels. These
findings suggest that the HA tag retards receptor degradation and that,
in addition to activating the down-regulatory process, carbachol also
transiently stimulates InsP3 receptor synthesis; evidence
for the latter proposal is provided by the observation that
cycloheximide (5 µg/ml) blocked the increases seen in
Fig.6j.2 Thus, it appears that carbachol
simultaneously stimulates both InsP3 receptor synthesis and
degradation in SH-SY5Y cells and that the HA tag allows the effect on
receptor synthesis to become significant. This explains why
InsP3RHA, which is subject to degradation, increases
slightly and transiently, whereas
InsP3RHA, which is not
subject to degradation, increases more profoundly and persistently. Furthermore, evidence of effects on the synthesis of untagged receptors
would not be expected and, indeed, was not seen (Fig. 6, a
and b) because for these proteins, the acceleration of
degradation is profound (13) and should overwhelm any effect on
receptor synthesis.
InsP3RHA
shown in Fig. 6 is truly due to differential ligand binding.
Heteromerization would also explain the surprising increase in
sensitivity of S
InsP3RHA Ca2+
stores to InsP3 (Fig. 4A) and, importantly,
would show that
InsP3RHA is present in functional
InsP3-gated channels.
InsP3RHA, as this
mutant co-migrates with endogenous InsP3 receptor (Fig. 2,
lanes 2 and 5). Instead, lysates of control and
CCh-treated S
InsP3RHA were immunoprecipitated
with CT1 or HA11 and InsP3 binding to the immunocomplexes
was determined (Fig. 7B). Binding to the CT1-derived immunoprecipitates, which contain both endogenous receptors and
InsP3RHA (Fig. 7B, lanes 1 and
2), was substantially reduced by CCh (columns 1 and 2) because of down-regulation of endogenous receptors;
total receptor content, measured with CT1, was reduced by CCh, whereas
InsP3RHA levels, measured with HA11, remained unchanged
(Fig. 7B, lanes 1 and 2). Importantly, CCh also
significantly reduced InsP3 binding in the HA11-derived
precipitates (Fig. 7B, columns 3 and 4). As
InsP3RHA is unable to bind InsP3 (Fig.
3A) and is not degraded (Fig. 6i), this reduction
must be due to the down-regulation of endogenous InsP3
receptor that co-immunoprecipitates with
InsP3RHA. This
decline in co-immunoprecipitation of endogenous receptors is confirmed
by immunochemical analysis with CT1 (Fig. 7B, lanes 3 and
4). This analysis also shows that InsP3 binding in HA11-derived precipitates was relatively low because
relatively little endogenous receptor was immunoprecipitated
(Fig. 7B, lanes 3 and 4). In total, Fig. 7 shows
that InsP3RHA and
InsP3RHA can heteromerize with endogenous InsP3 receptors, indicating
that exogenous receptors are located appropriately. This explains their ability to enhance Ca2+ mobilization. It is also important
to note that the endogenous InsP3 receptors that are
associated with
InsP3RHA are still liable to
down-regulation (Fig. 7B, lanes 3 and
4 and columns 3 and 4). Taken together
with results shown in Fig. 6, this indicates that individual subunits
in a tetrameric channel are differentially targeted for degradation.
InsP3R in such a way as to account
for the resistance of
InsP3RHA to degradation, we sought
to analyze the down-regulation of untagged
InsP3R. Thus,
because we were unable to obtain an SH-SY5Y cell line that produced
InsP3R, we analyzed down-regulation in cells transiently
expressing this mutant.
InsP3R and
endogenous receptor co-migrated (lane 7). Stimulation with 1 mM CCh for 2 and 4 h produced an equivalent reduction
in InsP3 receptor immunoreactivity in pcWI- and
pcDNA3-transfected cells (Fig. 8A, lanes 1-3
and lanes 4-6, respectively, and Fig. 8B). In
contrast, this marked decline in InsP3 receptor
immunoreactivity was not seen in cells expressing
InsP3R
(Fig. 8A, lanes 7-9, and Fig.
8B), showing that
InsP3R, like
InsP3RHA, is resistant to degradation. This finding
confirms that the 316-352 deletion renders the InsP3
receptor resistant to down-regulation.

View larger version (24K):
[in a new window]
Fig. 8.
InsP3R is resistant
to down-regulation. A, SH-SY5Y cells were transiently
transfected with pcDNA3 (lanes 1-3), pcWI (lanes
4-6), or pcWI316 (lanes 7-9) and were then exposed to
1 mM CCh for 0 h (lanes 1, 4, and
7), 2 h (lanes 2, 5, and 8), or
4 h (lanes 3, 6, and 9). InsP3
receptor content was then determined in immunoblots with CT1. The
image shown is representative of six independent experiments.
B, densitometrically quantitated CT1 immunoreactivity in
pcDNA3-transfected (
), pcWI-transfected(
), and
pcWI316-transfected (
) SH-SY5Y cells (mean ± S.E. of six
independent experiments). Asterisks denote significance
(p < 0.05) of differences from pcDNA3-transfected
cells.
![]()
DISCUSSION
InsP3RHA mutant used in the present study, enhanced the sensitivity of Ca2+ stores to InsP3 in
permeabilized cells and inhibited agonist-stimulated InsP3
production and [Ca2+]i increases in intact cells
(37). These results parallel our findings in
S
InsP3RHA and indicate that the effects of
exogenous binding-defective mutants are complex. In the other study in
which Ca2+ signaling was analyzed in intact cells (38),
severalfold overexpression of type III receptor in
TC-3
insulin-producing cells doubled peak [Ca2+]i in
intact cells, but other parameters were not monitored. Finally, in
L-cell fibroblasts, a much higher (~8-fold)
overexpression of wild-type type I receptor was achieved, and this
substantially enhanced Ca2+ store sensitivity to
InsP3 in permeabilized cells; however, Ca2+
signaling in intact cells was not examined (33, 34). Thus, our findings
are broadly in agreement with these studies, in that overexpression of
either wild-type or InsP3 binding-defective mutant
receptors enhances the sensitivity of Ca2+ stores to
InsP3. Surprisingly, however, this enhancement was not
translated into increases in [Ca2+ ]i in intact
cells in response to cell surface receptor stimulation. Although in the
previous study on 3T3 cells (37) this apparent paradox was attributed
to a substantial decrease in InsP3 production in response
to cell surface receptor activation, such an explanation can not be
applied to the present study, in which InsP3 production in
response to CCh was not consistently or substantially affected by the
presence of exogenous receptors. Thus, other, perhaps more subtle,
mechanisms may serve to control [Ca2+]i in the
transfected SH-SY5Y cells. Indeed, given the spatial and temporal
complexity of Ca2+ release in intact cells (1, 2) and, in
particular, the ability of mobilized Ca2+ to suppress
further InsP3 receptor-mediated Ca2+ release
(1, 2, 40), it is perhaps naive to think that an enhancement of
InsP3-induced Ca2+ release in permeabilized
cells will be translated into changes in [Ca2+ ]i
in intact cells.
InsP3RHA to enhance the
sensitivity of Ca2+ stores to InsP3 indicates
that this mutant increases the number of InsP3-sensitive
Ca2+ channels, presumably by forming heterotetramers with
endogenous receptors. The existence of these complexes is supported
directly by the observed co-immunoprecipitation of exogenous and
endogenous receptors and is important to the interpretation of our
down-regulation data; the presence of
InsP3RHA in
channels that are mediating Ca2+ release from the
endoplasmic reticulum and the fact that only endogenous receptors are
down-regulated from these channels indicate that Ca2+ flux
alone does not activate receptor degradation. This argues against the
proposal that activation of Ca2+-dependent
proteases in the vicinity of the InsP3 receptor complex might be the sole mediator of receptor degradation (20). Rather, InsP3 binding appears to be the critical signal for
degradation, because only this could account for the selective
degradation of endogenous receptors in
InsP3RHA-containing channels.
InsP3RHA is not.2
InsP3R in SH-SY5Y
cells,4 it is possible that
the tag has a subtle effect that is not detected in these assays.
Perhaps
InsP3R is too disruptive to be stably expressed
in SH-SY5Y cells, and addition of the HA tag to this mutant compensates
for its disruptive effect. This speculation has a basis in studies
showing that interference with the InsP3 receptor
C-terminal modifies receptor function (41, 42). It is also intriguing
that the HA tag retards receptor down-regulation, indicating that
interference with the C terminus inhibits the down-regulatory process.
Thus, the C terminus may play a role in the events that lead to
receptor degradation.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Jon Oberdorf, Mary Lou Vallano, and Barry Knox for many helpful discussions.
| |
FOOTNOTES |
|---|
* This work was supported by Grant DK49194 from the National Institutes of Health and by a grant-in-aid from the American Heart Association (NY State Affiliate, Inc.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Dept. of Pharmacology, College of Medicine, State University of New York Health Science Center at Syracuse, 750 E. Adams St., Syracuse, NY 13210-2339. Tel.: 315-464-7956; Fax: 315-464-8014; E-mail: wojcikir{at}vax.cs.hscsyr.edu.
The abbreviations used are:
PIC, phosphoinositidase C; CCh, carbachol; HA, hemagglutinin; InsP3, inositol 1,4,5-trisphosphate; InsP3R, wild-type mouse type I InsP3 receptor;
InsP3R, InsP3 binding-defective mouse type I
InsP3 receptor; InsP3RHA, HA epitope-tagged
InsP3R;
InsP3RHA, HA epitope-tagged
InsP3R.
2 C.-C. Zhu and R. J. H. Wojcikiewicz, unpublished data.
3
Surprisingly, it appears most likely that the
SII region is absent from the endogenous receptor, as the migration
rates of SI+ and SI
receptors appear to be
identical (28, 43), and cerebellar receptor, which is predominantly
SI
(35, 43), co-migrates with receptor expressed from the
cDNA used in the present study (5). This conclusion is surprising because central nervous system tissue expresses predominantly SII+ variants (3, 4, 35), and it suggests that the
InsP3 receptor mRNA splicing that occurs in SH-SY5Y
cells may be different from that which occurs in the central nervous system.
4
Although
InsP3R could not be
expressed stably in SH-SY5Y cells, stable expression of this mutant was
possible in HEK293 cells (Fig. 3), and an analogous mutant can be
expressed in 3T3 cells (37). Thus, some cell types can tolerate
InsP3R. Differential tolerance may relate to
differential InsP3 receptor expression; SH-SY5Y cells
express almost exclusively type I receptor, whereas HEK293 and 3T3
cells express 3 and 12% type I receptor, respectively (14, 39).
| |
REFERENCES |
|---|
|
|
|---|