![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 6, 3590-3596, February 5, 1999
-Latrotoxin Binding and
-Latrotoxin-stimulated Secretion
-LATROTOXIN
(CIRL) DELETION MUTANTS*
,
, and
¶
From the
Departments of Pharmacology,
¶ Physiology and Neuroscience, and ¶ Environmental Medicine,
New York University Medical Center, New York, New York 10016 and the
§ Department of Pharmacology, University of Michigan Medical
School, Ann Arbor, Michigan 48109
| |
ABSTRACT |
|---|
|
|
|---|
Stimulation of neurotransmitter release by
The CIRL receptors have an unusual structure for GPCRs. First, they are
significantly larger (about 200 kDa) than most of the GPCRs. Second,
they consist of two heterologous subunits because of endogenous
proteolytic processing of the precursor protein. The site of this
cleavage is located 18 residues upstream from the first transmembrane
segment. As a result, mature CIRL consists of two noncovalently bound
subunits, p120 and p85. p120 is a hydrophilic protein that is soluble
and secreted if expressed separately from p85, whereas p85 has
structural features typical of a generic GPCR although with an
unusually large cytoplasmic tail (9, 11).
There is ample evidence that To analyze the structural requirements for Soluble Deletion Mutants of the Extracellular Region of
CIRL--
The pCDR7N construct encoding the extracellular region of
CIRL (residues 1-856) with COOH-terminal His6 tag was
described previously (9). The pCDR120 construct encoding the p120
subunit of CIRL precisely was prepared by ligating the
AgeI/XbaI-digested PCR product obtained with
primers ACATCTAGAGGTGGCTGCAGGCACATGTGGTA and
ACAGGCCCAGCCGGCCAACACCATCAAGCAGAACAGCC on the 87-7 CIRL cDNA clone as a template into pCDR7 plasmid cut
with AgeI/XbaI. The structure of the PCR-derived
region of the final plasmid was verified by sequencing. The recombinant
DNA fragments encoding other deletion mutants were prepared by high
fidelity PCR with Pfu polymerase and synthetic
oligonucleotide primers containing SfiI (sense) or
XbaI (antisense) restriction sites. The expression
constructs were prepared by ligating the
SfiI/XbaI-digested PCR products into
SfiI/XbaI-digested pSecTag plasmid (Invitrogen)
in frame with the His6 tag. Thus prepared constructs
encoded the following residues of CIRL: pSTR7-1, residues 25-598;
pSTR7-2, residues 25-856; pSTR7-3, residues 25-631; pSTR7-4, residues
25-705; pSTR7-5, residues 25-770; pSTR7-6, residues 128-856;
pSTR7-9, residues 538-856; pSTR7-16, residues 467-705; pSTR7-20,
residues 185-856. The plasmids were transfected into COS-7 cells using
the LipofectAMINE method according to Life Technologies, Inc. protocol.
After 3 days, the conditioned media and cells were harvested and
analyzed for the presence of the recombinant protein by precipitation
with nickel-agarose followed by Western blotting with anti-p120 antibody.
N-terminal Deletion Mutants of CIRL--
To generate the
N-terminal deletion mutants anchored to the membrane-bound fragment of
CIRL, AgeI/XbaI-digested pSTR7-6, -7, -8, and -9 plasmids were ligated with a DNA fragment of 3,060 base pairs obtained
by digesting pCDR7 with AgeI/XbaI. This insert encoded a short COOH-terminal region of p120 and the entire p85 subunit. These constructs encoded the following residues of CIRL: pSTR7-6M, residues 128-1471; pSTR7-7M, residues 394-1471; pSTR7-8M, residues 467-1471; pSTR7-9M, residues 538-1471. COS cells were transfected with these plasmids, harvested in 3 days, and analyzed for
Purification of the Recombinant Extracellular Domain of CIRL and
the Analysis of Its Affinity to COOH-terminal Deletion Mutants of CIRL--
Two COOH-terminal
deletion mutants of CIRL were prepared. The first one, pCDR-7TMR,
included the p120 subunit, the seven transmembrane region, and 49 N-terminal amino acid residues of the COOH-terminal cytoplasmic tail
(residues 1-1149 of CIRL). The second one, pCDR-1TMR, included p120,
the first transmembrane region, and the first intracellular loop of p85
(residues 1-891). To generate a pCDR-7TMR expression vector, two
complementary 5'-phosphorylated oligonucleotides, 5'-pCCGGAGCGGCCGCTGAT and 5'-pCTAGATCAGCGGCCGCT, were used
in the ligation reaction with the
BspEI/XbaI-digested pCDR7 (9) vector. To generate
a pCDR-1TMR expression vector, the 7313-base pair product of
AgeI/XbaI digestion of pCDR7 was ligated with a
421-base pair fragment obtained by AgeI/XbaI
digestion of a 1267-base pair PCR product where pCDR7 was used as a
template and the primers ACAGGCCCAGCCGGCCAATCTGCATGTGTCCCCTGAGCT and
TTTCTAGATCAGCGGTCGGTCTGCAG were used.
Chromaffin cell and HEK293 cell transfections and functional analysis
of CIRL mutants were performed as described previously (9, 14).
Domain Structure of CIRL--
Computer-assisted analysis of the
CIRL protein sequence reveals a number of distinct structural domains
(Fig. 1). A central region of CIRL
(residues 850-1100) shows significant homology to the members of the
secretin family of GPCRs (9). According to the hydrophobicity plot of
CIRL, this region contains seven long hydrophobic stretches, a hallmark
of GPCRs. In GPCRs, these hydrophobic sequences are
The intracellular COOH-terminal region of CIRL (residues 1100-1471) is
unusually large for an average GPCR. It contains a pair of vicinal Cys
residues typical for the GPCR palmitoylation site and several proline
reach clusters. It has no significant homology to any known protein
except for two other members of the CIRL family, CIRL-2 and -3 (11).
In contrast, several domains of the extracellular N-terminal region of
CIRL show significant homology with various receptor and nonreceptor
proteins. The signal peptide sequence is followed by a cysteine-rich
domain (residues 30-120) homologous to sea urchin egg
D-galactoside-specific lectin (GenBank number P22031) and
plant
The next structural domain (residues 400-470) is enriched in Ser, Thr,
and Pro residues and shows insignificant homology to mucin and other
Pro-rich proteins. We will therefore refer to this domain as the STP
domain. The STP domain is followed by a short region (residues
470-540) with a Cys-rich motif
CX9-10WX9-12CX10-17CX4-6WX8-16C identified by
The region between residues 541 and 800 has low homology to
brain-specific angiogenesis inhibitor-3 (GenBank number AB005299), another large orphan GPCR that among all known large GPCRs is most
similar to the members of the CIRL family. The recently discovered brain-specific angiogenesis inhibitor family was implicated in tumor
angiogenesis regulation; brain-specific angiogenesis inhibitor-1 expression is regulated by p53 (16, 17).
Finally, in the COOH terminus of p120 immediately adjacent to the
putative site of CIRL proteolysis a novel structural motif is found
that is characteristic for about a dozen large orphan GPCRs of the
secretin receptor family (GenBank numbers U39848, U76764, P48960,
Q61549, Q14246, AC004262, D87469, AB011529, AB011528, AB011536,
AB005297, X81892, AB005298, AF006014, AB011122). We propose to name
this motif GPS for GPCR proteolysis site. The characteristic feature of
the GPS domain is a cysteine signature including CXC, two
additional cysteine residues, and two tryptophan residues at fixed
positions. When conserved residues of the GPS motif were mutated, CIRL
could no longer be proteolyzed
endogenously.2
Mapping the
The resulting constructs were transfected into COS cells. The cells and
media were harvested and analyzed for the presence of recombinant
proteins by the adsorption onto nickel-agarose followed by Western
blotting with anti-p120 antibody. Among tested constructs, pCDR-120,
pCDR7N, and pSTR7-2, -6, -7, and -20 were expressed and secreted in the
medium. Proteins encoded by pSTR7-1, -3, -4, -5, -9, and -16 were
expressed well but accumulated inside the cells (data not shown). It is
interesting to note that most of the secreted proteins were
N-terminally truncated, whereas most of the nonsecreted deletion
mutants were COOH-terminally truncated. This finding raises a
possibility that the extracellular region of CIRL contains in its
COOH-terminal part a signal sequence that regulates intracellular
sorting and trafficking of the protein.
To analyze the Soluble Fragments of the Extracellular Domain of CIRL Are Low
Affinity
Because these same soluble CIRL fragments bound quite well to
immobilized High Affinity Binding of
We further quantitated the
To test the importance of different regions of p85 in the interaction
with Deletion Mutants of CIRL Are Functional in Coupling CIRL to
Exocytosis--
We determined whether deletion constructs that
possessed high affinity
We noted that at higher concentrations of
Transient expression of CIRL in chromaffin cells increases their
sensitivity to To analyze the interaction of High Affinity Binding of Latrotoxin Requires a Short Extracellular
Segment and the First Transmembrane Domain--
CIRL consists of two
noncovalently bound subunits, p120, which is extracellular, and p85,
which contains seven transmembrane segments and the COOH-terminal
cytoplasmic domain. The analysis of a series of soluble recombinant
fragments of CIRL by precipitation with
In contrast, two N-terminally truncated fragments of CIRL, which
contained p85 in addition to the
Therefore we propose that the interaction of Only a Single Transmembrane-spanning Domain Is Required to Support
Latrotoxin-induced Ca2+ Influx and Secretion--
CIRL
deletion mutants that bound
The shape of the dose-effect curves for overexpressed wild-type CIRL
and its N-terminally truncated mutant was significantly different from
those of the COOH-terminal mutants (Fig. 8A). The dose
dependence of the
What may be the physiological importance of CIRL? Because it serves to
target
-latrotoxin requires its binding to the calcium-independent receptor
of
-latrotoxin (CIRL), an orphan neuronal G protein-coupled
receptor. CIRL consists of two noncovalently bound subunits, p85, a
heptahelical integral membrane protein, and p120, a large extracellular
polypeptide with domains homologous to lectin, olfactomedin, mucin, the
secretin receptor family, and a novel structural motif common for large orphan G protein-coupled receptors. The analysis of CIRL deletion mutants indicates that the high affinity
-latrotoxin-binding site is
located within residues 467-891, which comprise the first transmembrane segment of p85 and the C-terminal half of p120. The
N-terminal lectin, olfactomedin, and mucin domains of p120 are not
required for the interaction with
-latrotoxin. Soluble p120 and all
its fragments, which include the 467-770 residues, bind
-latrotoxin
with low affinity suggesting the importance of membrane-embedded p85
for the stabilization of the complex of the toxin with p120. Two
COOH-terminal deletion mutants of CIRL, one with the truncated
cytoplasmic domain and the other with only one transmembrane segment
left of seven, supported both
-latrotoxin-induced calcium uptake in
HEK293 cells and
-latrotoxin-stimulated secretion when expressed in
chromaffin cells, although with a different dose dependence than
wild-type CIRL and its N-terminal deletion mutant. Thus the signaling
domains of CIRL are not critically important for the stimulation of
exocytosis in intact chromaffin cells by
-latrotoxin.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
-Latrotoxin, a potent natural stimulator of secretion from
neurons and secretory cells, has two structurally and pharmacologically distinct classes of high affinity receptors (1). The
calcium-dependent receptor of
-latrotoxin or neurexin
I
is a large (160-220 kDa) cell surface membrane protein existing
in multiple isoforms (2, 3). It has one transmembrane segment and
structurally resembles cell adhesion proteins (4). A second high
affinity receptor is the calcium-independent
receptor of
-latrotoxin
(CIRL)1 (5, 6). CIRL is
thought to be more important for
-latrotoxin effects in neurons than
neurexin I
because
-latrotoxin can stimulate neurotransmitter
release from neurons in Ca2+-free media (7, 8). CIRL, also
called latrophilin, belongs to a family of closely related orphan G
protein-coupled receptors (GPCRs) homologous to the secretin receptor
family (9, 10). In this family of three closely homologous proteins,
CIRL-1 is a brain-enriched high affinity
-latrotoxin receptor,
whereas CIRL-2 is a ubiquitously expressed low affinity receptor of the toxin (11).
-latrotoxin receptors are critically
required for the effects of
-latrotoxin (1, 12, 13). However, the
mechanism of signaling downstream of the receptors is not known. The
heptahelical structure of CIRL suggests its function as a regulator of
a G protein pathway. However, no coupling of CIRL to any G protein has
been convincingly shown. Moreover, no direct data are currently
available to prove that
-latrotoxin acts as an agonist or antagonist
of its receptors.
-latrotoxin binding and
-latrotoxin stimulatory function, we generated three series of CIRL
deletion mutants. Soluble fragments of the extracellular region of CIRL
were used to map the
-latrotoxin-binding site. On the basis of this
information, N-terminally truncated membrane-bound forms of CIRL were
produced, which were shown to retain high affinity
-latrotoxin
binding activity. Finally, deletions in the COOH-terminal region of
CIRL were produced to remove the domains potentially involved in
receptor signaling. The constructs lacking the CIRL cytoplasmic tail
and six of its seven transmembrane segments appeared to be fully
functional in terms of
-latrotoxin binding, Ca2+ influx
in HEK293 cells, and coupling of the toxin to secretion in transfected
chromaffin cells. Our data suggest that G protein-mediated signaling is
not critically important for the
-latrotoxin-stimulated secretion in
chromaffin cells.
![]()
EXPERIMENTAL PROCEDURES
-Latrotoxin was purified from lyophilized black widow spider
glands and radioactively labeled with 125I using the
chloramine T procedure. The toxin was immobilized on BrCN-Sepharose as
described (2).
-latrotoxin binding activity as described below.
-Latrotoxin--
COS cells were
transfected with an expression plasmid pCDR7N encoding the entire
N-terminal extracellular region of CIRL (1-837 residues) with a
His6 tag at the COOH terminus. In 2 days, the cell media
were collected, and 10 ml of media were incubated with 300 µl of
nickel-agarose overnight at 4 °C with gentle agitation. The matrix
was washed 4 times with 50 mM Tris-HCl and 500 mM NaCl, pH 7.5, and eluted with 1 ml of 100 mM
imidazole in the same buffer. The binding activity of the eluted
proteins was measured by a solid-phase method on a 96-well plate (5).
125I-
-Latrotoxin was added to a final concentration of
0.5-60 nM. Specific binding was measured as the difference
between total binding and nonspecific binding in the presence of 900 nM unlabeled
-latrotoxin.
-Latrotoxin Binding Analysis of Soluble Proteins--
0.7 ml
of media from transfected COS cells was cleared by centrifugation and
incubated with 15 µl of
-latrotoxin-Sepharose overnight at
4 °C. The matrices were washed 3 times with 1.25 ml of ice-cold 50 mM Tris-HCl, 150 mM NaCl, 2 mM
EDTA, pH 8.0, and eluted with SDS electrophoresis sample buffer. The
eluates were electrophoresed and analyzed by Western blotting with
anti-p120 antibody.
-Latrotoxin Binding Analysis of Cell Membranes--
Three
days after transfection, the COS cells were harvested on ice in
physiological saline and centrifuged. The pellet was resuspended in a
50 mM Tris-HCl, 150 mM NaCl, 2 mM
EDTA, and 1% bovine serum albumin, pH 8.0, incubation buffer, and 10%
of the cell material harvested from one 100-mm Petri dish was incubated with 5 nM 125I-
-latrotoxin in the final
volume of 200 µl for 15 min. The binding reaction suspensions were
diluted with the ice-cold incubation buffer and immediately centrifuged
at 14,000 rpm in the Eppendorf centrifuge for 10 min. The pellets were
counted for radioactivity in a
-counter. The nonspecific binding was
measured in the presence of 100 nM cold toxin.
![]()
RESULTS
-helical rods
that form a compact oval-shaped integral transmembrane cluster (15).
Similar to other GPCRs, three intracellular and three extracellular
hydrophilic loops in between transmembrane helices can be identified in
CIRL.

View larger version (35K):
[in a new window]
Fig. 1.
Domain structure of CIRL. The domains
with homology to lectin and olfactomedin are labeled as such. The STP
domain is the region weakly homologous to mucin and enriched in Ser,
Thr, and Pro. Cys-rich motif or SR, a signature conserved in
the N-terminal extracellular regions of the secretin receptor family
members. An ellipse indicates the location of GPS
(GPCR proteolysis site), a
structural motif common for large orphan GPCRs homologous to CIRL. An
arrow on the top indicates the cleavage site of the signal
peptide. All cysteine/cysteine residues are numbered and
marked as SH. PM, plasma membrane.
-galactosidase (GenBank number Z99708). The same domain is
found in a Caenorhabditis elegans homolog of CIRL (GenBank number Z54306). The adjacent domain (residues 120-400) is similar to
olfactomedin (GenBank number AF028740), a major structural block in the
extracellular matrix of the olfactory neuroepithelium and several
structurally related proteins including the pancortin family (GenBank
number Q62609, D78264, D78262, Q99784, AB006688, AF049796, AF035301,
Q99972, AF039869). Their physiological role is unclear.
-Blast search in the extracellular domains of GPCRs, which belong to the secretin receptor family. Interestingly, in "normal" receptors of this family (e.g. vasoactive
intestinal peptide receptor, pituitary adenylate cyclase-activating
polypeptide receptor, secretin receptor, calcitonin receptor,
corticotropin-releasing factor receptor, growth hormone-releasing
hormone receptor, glucagon-like peptide receptor, etc.) this motif is
located very close to the transmembrane core. In the CIRL family and in
a number of other large orphan GPCRs (GenBank numbers U39848, Z54306,
D87469, AB011529, AB011528, AB005297, AB011536, AB011122), this motif
is located several hundred amino acid residues from the membrane
segments, and therefore we may assume that the large orphan receptors
represent a separate subfamily within the family of the secretin receptor.
-Latrotoxin-binding Site in CIRL--
We showed
earlier that the recombinant N-terminal extracellular region of CIRL
binds efficiently to immobilized
-latrotoxin (9). To identify the
-latrotoxin binding domain(s) of CIRL more precisely, we have
generated a series of deletion mutants of its extracellular region. The
desired DNA fragments were prepared by high fidelity PCR with synthetic
oligonucleotide primers that were designed according to the putative
domain borders of the extracellular region of CIRL (Fig.
2). The PCR fragments were cloned into a
pSecTag eucaryotic expression plasmid (Invitrogen), which contained a
signal peptide sequence that allowed extracellular secretion of soluble
proteins and a COOH-terminally fused His6 tag that allowed
easy purification of the recombinant protein.

View larger version (26K):
[in a new window]
Fig. 2.
Deletion mutants of CIRL. The structure
of recombinant proteins is shown with domains labeled. The
numbers on the left identify the borders of the
deletion mutants according to the CIRL protein sequence. SR,
sarcoplasmic reticulum; SP, signal peptide.
-latrotoxin binding activity of the recombinant
proteins, the conditioned media or cell extracts were adsorbed onto
-latrotoxin-Sepharose followed by Western blotting with anti-p120
antibody (Fig. 3). The constructs
pCDR-120, pCDR7N, and pSTR7-2, -5, -6, -7, and -20 specifically
interacted with the toxin, whereas pSTR7-1, -3, -4, -9, and -16 did
not. The shortest N-terminally truncated mutant that still bound the
toxin was pSTR7-7. A shorter construct pSTR7-9 (residues 538-856)
failed to interact with the toxin. The analysis of
-latrotoxin
binding activity of COOH-terminally truncated mutants demonstrated that
the downstream border of the toxin-binding site may be located close to
the membrane. The pCDR7N protein, which is the entire extracellular
region of CIRL (residues 1-856) and recombinant p120 (residues 1-837,
construct pCDR-120), bound to the toxin quite well. A shorter protein
pSTR7-5 (residues 25-770) bound to
-latrotoxin much less
efficiently, whereas pSTR7-4 (residues 25-705) did not interact with
the toxin at all. Together, these data suggest that the residues
critical for
-latrotoxin binding are located in the COOH-terminal
half of p120 with a significant site of interaction around residue 770.

View larger version (16K):
[in a new window]
Fig. 3.
Localization of the
-latrotoxin-binding site. 1 ml of conditioned
media of COS cells transfected with CIRL deletion mutants (constructs
pSTR7-2, -6, -7, -16, -20, and pCDR7N) or 50 µl of cells (pSTR7-1,
-3, -4, -5, and -9) extracted with 1 ml of a buffer with 2% Triton
X-100 was incubated with 10 µl of
-latrotoxin-agarose overnight
with gentle agitation. After three washes, the pellets were eluted in
50 µl of SDS-sample buffer/dithiothreitol, boiled for 3 min, and
analyzed by Western blotting with anti-p120 antibody (L). To
verify the expression, 2 µl of transfected cells were analyzed
directly (E).
-Latrotoxin-binding Proteins--
To further analyze the
interaction of
-latrotoxin with the extracellular domain of CIRL and
its fragments, we tested the ability of these soluble proteins to
inhibit the binding of iodinated
-latrotoxin to brain membranes.
Surprisingly, no significant inhibition was detected with any protein
tested including the entire uncleaved extracellular domain encoded by
pCDR7N, p120 (these two constructs were not based on PCR-generated
sequences), and their fragments (data not shown). The concentration of
CIRL fragments in the binding mixtures was typically in the range of 20-60 nM, whereas the concentration of labeled
-latrotoxin was 2 nM.
-latrotoxin, we assumed that they were
-latrotoxin-binding proteins. However, their affinity to the toxin
was lower than the affinity of endogenous CIRL, and therefore they
could not compete effectively in the concentration range tested. To
estimate the affinity of p120 and its deletion mutants to
-latrotoxin, we used the solid-phase assay developed earlier for the
analysis of
-latrotoxin binding activity of detergent-solubilized
CIRL (5). p120 solution was applied to the bottoms of 96-well plates by
drying at ambient temperature. After washing and blocking, solutions
with various concentrations of 125I-
-latrotoxin were
added to the wells. Following multiple washes, the absorbed labeled
toxin was eluted with SDS-containing buffer and counted for
radioactivity. Scatchard plot analysis revealed that the affinity of
-latrotoxin binding to p120 was about 25 nM, which was
approximately 2 orders of magnitude lower than the affinity of CIRL
binding (data not shown).
-Latrotoxin to N-terminally and
COOH-terminally Truncated Membrane-associated CIRL--
Low affinity
interaction of
-latrotoxin with soluble p120 raised the possibility
that the formation of high affinity complex requires participation of
p85. To test this, we recombined DNA fragments encoding soluble
deletion mutants with the sequence of p85 so that the resulting
constructs encoded N-terminally truncated forms of CIRL. In the
5'-region of pSTR7-6, -7, -8, and -9, a fragment of CIRL cDNA was
subcloned, which restored the junction of p120 and p85 identically to
wild-type CIRL. The resulting expression constructs encoded the
following residues of the CIRL protein sequence: pSTR7-6M, residues
128-1471; pSTR7-7M, 394-1471; pSTR7-8M, 467-1471; pSTR7-9M,
538-1471. The analysis of the transfected COS cells demonstrated that
all mutants except pSTR7-9M bound to
-latrotoxin specifically (Fig.
4A). This result was in good agreement with the analysis of soluble deletion mutants of CIRL and
suggests that lectin-like, olfactomedin-like, and STP (mucin-like) domains in the N-terminal half of p120 are not important for
-latrotoxin binding.

View larger version (24K):
[in a new window]
Fig. 4.
High affinity interaction of
-latrotoxin with N-terminal deletion mutants of
CIRL. A, COS cells transfected with pCDR7 (wild-type
CIRL or WT), salmon sperm DNA (SS) as a negative
control, or pSTR7-6M, -7M, -8M, -9M were harvested and incubated with 5 nM 125I-
-latrotoxin. The total binding of
the labeled toxin is shown as black bars. The nonspecific
binding measured in the presence of a 20-fold excess of unlabeled toxin
is shown as white bars. Each experiment was done in
duplicate, and the average is shown (deviation was less than 3% for
each measurement shown). The
-latrotoxin binding affinity of the
deletion mutants pSTR7-7M (B) and pSTR7-8M (C)
was compared with the affinity of CIRL by the Scatchard plot
analysis.
-latrotoxin binding activity of pSTR7-7M
and pSTR7-8M, the two shortest
-latrotoxin-binding mutants, by
Scatchard plot analysis. It appeared that both membrane-bound deletion
mutants interacted with
-latrotoxin with the same high affinity as
wild-type CIRL (Fig. 4, B and C). We can
therefore conclude that the primary
-latrotoxin-binding site is
located in the COOH-terminal half of p120. However, the high affinity interaction requires complexing of p120 with membrane-bound p85. Because the plasmids for membrane-bound mutants were prepared on the
basis of the constructs encoding soluble CIRL fragments, this
experiment also demonstrates that the low affinity of the recombinant
soluble CIRL fragments was not because of a PCR or cloning artifact.
-latrotoxin, we generated two mutants of CIRL with deleted
portions of the p85 subunit by introducing stop codons (Fig.
5). The first mutant pCDR-7TMR did not
contain most of the large COOH-terminal cytoplasmic tail of p85. In the
second mutant pCDR-1TMR, the N-terminal region of p85 with only one
transmembrane segment was preserved. It appeared that both deletion
mutants expressed very well and both showed
-latrotoxin binding
activity (Fig. 6A). The
Scatchard plot analysis of the one transmembrane mutant demonstrated
high affinity binding indistinguishable from the wild-type receptor
(Fig. 6B). These results rule out the involvement of the
extracellular loops and the cytoplasmic tail of p85 in the
stabilization of the
-latrotoxin complex with p120.

View larger version (9K):
[in a new window]
Fig. 5.
Structures of the COOH-terminal deletion
mutants of CIRL. Wild-type CIRL (WT), the mutant with
deleted COOH-terminal cytoplasmic region up to residue 1149 (7TMR) encoded by plasmid pCDR-7TMR, and the mutant with
only one transmembrane segment (1TMR, residues 1-891 of
CIRL) encoded by plasmid pCDR-1TMR are shown schematically.
PM, plasma membrane.

View larger version (17K):
[in a new window]
Fig. 6.
High affinity interaction of
-latrotoxin with COOH-terminal deletion mutants of
CIRL. A, COS cells transfected with pCDR7 (wild-type
CIRL or WT), salmon sperm DNA (SS) as a negative
control, pCDR-7TMR, and pCDR-1TMR on day 3 were harvested and incubated
with 5 nM 125I-
-latrotoxin. The total
binding of the labeled toxin is shown as black bars. The
nonspecific binding measured in the presence of a 20-fold excess of
unlabeled toxin is shown as gray bars. Each experiment was
done in duplicate and the average is shown (deviation was less than 3%
for each measurement shown). B, the
-latrotoxin binding
affinity of the deletion mutant pCDR-1TMR was compared with the
affinity of CIRL by Scatchard plot analysis.
-latrotoxin binding (pCDR-1TMR, pCDR-7TMR,
and pCDR7-8) supported
-latrotoxin-stimulated calcium influx when
expressed in HEK293 cells (Fig. 7). All
three proteins increased the uptake of 45Ca2+,
although the pCDR-1TMR mutant was less effective than pCDR-7TMR, pCDR7-8, or CIRL itself and had little effect at 50 pM
-latrotoxin. The data indicate that the COOH-terminal part of CIRL
is not required in mediating the effects of
-latrotoxin on calcium
permeability and suggest that high affinity
-latrotoxin binding is
sufficient for calcium influx.

View larger version (20K):
[in a new window]
Fig. 7.
Deletion mutants of CIRL support
Ca2+ entry elicited by
-latrotoxin. HEK293 cells were transfected
with plasmids for pCDR7 (filled circle), pCDR-7TMR
(filled square), pCDR-1TMR (open square),
pSTR7-8M (triangle), or pCMVneo (open circle) as
a control by LipofectAMINE. Two days later, the cells were incubated
with various concentrations of
-latrotoxin (
-LTX) in
PSS containing 2.2 mM Ca2+, 0.5 mM
Mg2+, and 3 mCi/ml 45Ca2+. After 5 min, the cells were immediately rinsed 3 times in PSS, and the amount
of 45Ca2+ in the cells was determined by liquid
scintillation spectrometry. n, 4 wells/group.
-latrotoxin cells
transfected with a control plasmid (neo) or nontransfected cells (not
shown) also exhibited some
-latrotoxin-stimulated
45Ca2+ influx. This increase in calcium
permeability is probably because of the
-latrotoxin interaction with
an endogenous HEK293 cell protein, because it is completely blocked by
preincubation of the cells with concanavalin A (data not shown).
-latrotoxin (9). We asked whether the increase in
calcium permeability seen with pCDR-1TMR, pCDR-7TMR, and pCDR7-8 was
coupled to the secretory response in chromaffin cells. Because the
transfection efficiency of primary cultures is low, the various mutants
were co-expressed with human growth hormone, which is stored in
secretory granules and serves as a reporter for secretion from the
transfected cells. Each of the three constructs increased the
sensitivity of transfected cells to low concentrations of
-latrotoxin (2.5 and 10 pM), and the magnitude of the
effect was similar to that of wild-type CIRL (Fig.
8A). Catecholamine release (a
measure of secretion from all the cells, the majority of which were not
successfully transfected) was similar for all the groups (Fig.
8B). We conclude that the COOH-terminal part of CIRL is
unnecessary in mediating
-latrotoxin-stimulated secretion from
intact chromaffin cells. Interestingly, at higher concentrations of
-latrotoxin, some inactivation of the secretory response was seen
with CIRL and pCDR7-8 that did not occur with the COOH-terminal
deletion mutants 1TMR and 7TMR, raising the possibility that the
COOH-terminal cytoplasmic tail of CIRL plays an additional role in
modulating secretion.

View larger version (14K):
[in a new window]
Fig. 8.
Expression of CIRL deletion mutants increases
the sensitivity of intact chromaffin cells to stimulation by
-latrotoxin. Chromaffin cells were transfected
with plasmids for pCDR7 (filled circle), pCDR-7TMR
(filled square), pCDR-1TMR (open square),
pSTR7-8M (triangle), or pCMVneo (open circle) as
a control by calcium phosphate precipitates. Five days later, cells
were incubated with the indicated concentrations of
-latrotoxin in
PSS without Ca2+ or Mg2+ and with 0.2 mM EGTA. After 4 min, the toxin was removed and the cells
were incubated for an additional 5 min in PSS containing 2.2 mM Ca2+ and 0.5 mM
Mg2+. The amounts of human growth hormone (A)
and catecholamine (B) released into the medium and the
amounts remaining in the cells were determined as described.
n, 4 wells/group.
![]()
DISCUSSION
-Latrotoxin acts extracellularly by binding to endogenous
membrane receptors that belong to the neurexin and CIRL families. The
formation of receptor-toxin complexes is followed by cation influx
through
-latrotoxin-induced channels and by as yet unidentified signaling that eventually results in massive spontaneous exocytosis. Part of the effects of
-latrotoxin can be explained by
Ca2+ entry through the toxin-induced pores. However, the
toxin is also active when applied in nominally Ca2+-free
buffers (7, 8, 18) or when cation fluxes are controlled, e.g. in permeabilized cells (14, 19). A possible explanation of the calcium-independent effect of
-latrotoxin is that it
activates its membrane receptors, which results in intracellular
signaling, through a G protein-linked pathway (19, 20).
-latrotoxin with CIRL and subsequent
functional effects, we have generated a set of CIRL deletion mutants
that were examined in binding experiments,
45Ca2+ influx assays in HEK293 cells and
secretion experiments in chromaffin cells. We found that 1) small
segments of the extracellular and membrane domains of CIRL are required
for high affinity binding to latrotoxin and for functional effects of
latrotoxin, and 2) CIRL-coupled G protein signaling is not critically
important for
-latrotoxin-stimulated Ca2+ influx in
HEK293 cells or secretion from chromaffin cells. The evidence in
support of these conclusions is discussed below.
-latrotoxin-agarose showed
that the
-latrotoxin-binding site lies within the COOH-terminal half
of p120. However, none of the recombinant soluble fragments of CIRL
(including p120 and the nonprocessed full-size extracellular region,
pCDR7N) that bound effectively to immobilized
-latrotoxin were able
to compete with the binding of
-latrotoxin to endogenous CIRL in
brain membranes. The Scatchard plot analysis of the
-latrotoxin binding activity of the full-length extracellular region
indicated that its affinity was about 2 orders of magnitude lower than
the affinity of CIRL.
-latrotoxin binding domain of p120,
bound the toxin with the same high affinity as wild-type CIRL. The
extracellular loops of p85 are apparently not important for the
stabilization of the complex with the toxin because a deletion mutant,
which contained only the first transmembrane segment, bound to
-latrotoxin with high affinity.
-latrotoxin with CIRL
consists of two sequential steps. At first,
-latrotoxin binds with
medium affinity to the extracellular region of CIRL. Following this
binding, the toxin interacts with the first transmembrane segment of
CIRL, with the membrane lipids, or with both and penetrates into the
lipid bilayer as a result. This second step increases affinity of the
interaction and may require a longer time, which would explain a known
delay in
-latrotoxin effects within a minute after its application.
-latrotoxin with high affinity were also
effective in coupling
-latrotoxin to calcium influx into HEK293
cells and exocytosis in chromaffin cells, although the 1TMR mutant was
noticeably less effective than wild-type CIRL and other mutants in the
45Ca2+ uptake assay. Most importantly, a mutant
receptor lacking six of seven transmembrane segments was similar to
wild-type CIRL in the secretion experiments. Because this mutant
receptor would be unable to activate G proteins, these experiments
indicate that the receptor does not mediate the stimulatory effect of
-latrotoxin in intact chromaffin cells by direct coupling to G proteins.
-latrotoxin-stimulated exocytosis in chromaffin cells via either endogenous receptors, overexpressed CIRL, or its
N-terminal mutant was bell-shaped (14) (Fig. 8). In contrast, for both
COOH-terminally truncated mutants, the dose dependence did not show
"inactivation" at higher concentrations of
-latrotoxin. It is
therefore possible that
-latrotoxin binding to CIRL results in
multiple effects, one of which is dependent upon the integrity of the
COOH terminus of the p85 subunit.
-latrotoxin, a potent stimulator of secretion, it is likely
that this receptor is positioned appropriately for the regulation of
exocytosis. CIRL has been shown to co-purify with syntaxin, a t-SNARE
(9). In permeabilized chromaffin cells overexpression of CIRL inhibits
Ca2+-stimulated secretion (14). Together, these findings
suggest that CIRL may serve as a physiological regulator of exocytosis. Because of the presence of cell adhesion structural modules in its
extracellular domain, it is possible that direct physical contacts of
cells modulate secretion via CIRL-mediated signaling.
| |
FOOTNOTES |
|---|
* This study was supported by public health service Grants R01NS35098 and R01NS34937 from the NINDS, National Institutes of Health (to A. G. P.) and Grant R01DK27959 from the NIDDK, National Institutes of Health (to R. W. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of
Pharmacology, New York University Medical Center, 550 First Ave.,
MSB-202, New York, NY 10016. Tel.: 212-263-5969; Fax: 212-263-7133;
E-mail: petrea01{at}mcrcr.med.nyu.edu.
The abbreviations used are:
CIRL, calcium-independent receptor of
-latrotoxin; GPCR, G protein-coupled
receptor; PCR, polymerase chain reaction; GPS, GPCR proteolysis site; PSS, physiological salt solution; STP domain, Ser, Thr, and Pro-rich domain.
2 V. Krasnoperov, K. Ichtchenko, and A. G. Petrenko, manuscript in preparation.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Lajus, P. Vacher, D. Huber, M. Dubois, M.-N. Benassy, Y. Ushkaryov, and J. Lang {alpha}-Latrotoxin Induces Exocytosis by Inhibition of Voltage-dependent K+ Channels and by Stimulation of L-type Ca2+ Channels via Latrophilin in beta-Cells J. Biol. Chem., March 3, 2006; 281(9): 5522 - 5531. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-H. Lin, G.-W. Chang, J. Q. Davies, M. Stacey, J. Harris, and S. Gordon Autocatalytic Cleavage of the EMR2 Receptor Occurs at a Conserved G Protein-coupled Receptor Proteolytic Site Motif J. Biol. Chem., July 23, 2004; 279(30): 31823 - 31832. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Volynski, M. Capogna, A. C. Ashton, D. Thomson, E. V. Orlova, C. F. Manser, R. R. Ribchester, and Y. A. Ushkaryov Mutant {alpha}-Latrotoxin (LTXN4C) Does Not Form Pores and Causes Secretion by Receptor Stimulation: THIS ACTION DOES NOT REQUIRE NEUREXINS J. Biol. Chem., August 15, 2003; 278(33): 31058 - 31066. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Perez The Evolutionarily Triumphant G-Protein-Coupled Receptor Mol. Pharmacol., June 1, 2003; 63(6): 1202 - 1205. [Full Text] [PDF] |
||||
![]() |
F. Qian, A. Boletta, A. K. Bhunia, H. Xu, L. Liu, A. K. Ahrabi, T. J. Watnick, F. Zhou, and G. G. Germino Cleavage of polycystin-1 requires the receptor for egg jelly domain and is disrupted by human autosomal-dominant polycystic kidney disease 1-associated mutations PNAS, December 24, 2002; 99(26): 16981 - 16986. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Krasnoperov, Y. Lu, L. Buryanovsky, T. A. Neubert, K. Ichtchenko, and A. G. Petrenko Post-translational Proteolytic Processing of the Calcium-independent Receptor of alpha -Latrotoxin (CIRL), a Natural Chimera of the Cell Adhesion Protein and the G Protein-coupled Receptor. ROLE OF THE G PROTEIN-COUPLED RECEPTOR PROTEOLYSIS SITE (GPS) MOTIF J. Biol. Chem., November 22, 2002; 277(48): 46518 - 46526. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Krasnoperov, M. A. Bittner, W. Mo, L. Buryanovsky, T. A. Neubert, R. W. Holz, K. Ichtchenko, and A. G. Petrenko Protein-tyrosine Phosphatase-sigma Is a Novel Member of the Functional Family of alpha -Latrotoxin Receptors J. Biol. Chem., September 20, 2002; 277(39): 35887 - 35895. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Carson-Walter, D. N. Watkins, A. Nanda, B. Vogelstein, K. W. Kinzler, and B. St. Croix Cell Surface Tumor Endothelial Markers Are Conserved in Mice and Humans Cancer Res., September 1, 2001; 61(18): 6649 - 6655. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Hlubek, E. L. Stuenkel, V. G. Krasnoperov, A. G. Petrenko, and R. W. Holz Calcium-Independent Receptor for alpha -Latrotoxin and Neurexin H Facilitate Toxin-Induced Channel Formation: Evidence That Channel Formation Results from Tethering of Toxin to Membrane Mol. Pharmacol., March 1, 2000; 57(3): 519 - 528. [Abstract] [Full Text] |
||||
![]() |
D. B. Elrick and M. P. Charlton alpha -Latrocrustatoxin Increases Neurotransmitter Release by Activating a Calcium Influx Pathway at Crayfish Neuromuscular Junction J Neurophysiol, December 1, 1999; 82(6): 3550 - 3562. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ichtchenko, M. A. Bittner, V. Krasnoperov, A. R. Little, O. Chepurny, R. W. Holz, and A. G. Petrenko A Novel Ubiquitously Expressed alpha -Latrotoxin Receptor Is a Member of the CIRL Family of G-protein-coupled Receptors J. Biol. Chem., February 26, 1999; 274(9): 5491 - 5498. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Kreienkamp, H. Zitzer, E. D. Gundelfinger, D. Richter, and T. M. Bockers The Calcium-independent Receptor for alpha -Latrotoxin from Human and Rodent Brains Interacts with Members of the ProSAP/SSTRIP/Shank Family of Multidomain Proteins J. Biol. Chem., October 13, 2000; 275(42): 32387 - 32390. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nechiporuk, L. D. Urness, and M. T. Keating ETL, a Novel Seven-transmembrane Receptor That Is Developmentally Regulated in the Heart. ETL IS A MEMBER OF THE SECRETIN FAMILY AND BELONGS TO THE EPIDERMAL GROWTH FACTOR-SEVEN-TRANSMEMBRANE SUBFAMILY J. Biol. Chem., February 2, 2001; 276(6): 4150 - 4157. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Bittner and R. W. Holz Latrotoxin Stimulates Secretion in Permeabilized Cells by Regulating an Intracellular Ca2+- and ATP-dependent Event. A ROLE FOR PROTEIN KINASE C J. Biol. Chem., August 11, 2000; 275(33): 25351 - 25357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Volynski, F. A. Meunier, V. G. Lelianova, E. E. Dudina, T. M. Volkova, M. A. Rahman, C. Manser, E. V. Grishin, J. O. Dolly, R. H. Ashley, et al. Latrophilin, Neurexin, and Their Signaling-deficient Mutants Facilitate alpha -Latrotoxin Insertion into Membranes but Are Not Involved in Pore Formation J. Biol. Chem., December 22, 2000; 275(52): 41175 - 41183. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||