JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krasnoperov, V.
Right arrow Articles by Petrenko, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krasnoperov, V.
Right arrow Articles by Petrenko, A. G.

J Biol Chem, Vol. 274, Issue 6, 3590-3596, February 5, 1999


Structural Requirements for alpha -Latrotoxin Binding and alpha -Latrotoxin-stimulated Secretion
A STUDY WITH CALCIUM-INDEPENDENT RECEPTOR OF alpha -LATROTOXIN (CIRL) DELETION MUTANTS*

Valery KrasnoperovDagger , Mary A. Bittner§, Ronald W. Holz§, Oleg ChepurnyDagger , and Alexander G. PetrenkoDagger parallel

From the Dagger  Departments of Pharmacology,  Physiology and Neuroscience, and  Environmental Medicine, New York University Medical Center, New York, New York 10016 and the § Department of Pharmacology, University of Michigan Medical School, Ann Arbor, Michigan 48109

    ABSTRACT
Top
Abstract
Introduction
References

Stimulation of neurotransmitter release by alpha -latrotoxin requires its binding to the calcium-independent receptor of alpha -latrotoxin (CIRL), an orphan neuronal G protein-coupled receptor. CIRL consists of two noncovalently bound subunits, p85, a heptahelical integral membrane protein, and p120, a large extracellular polypeptide with domains homologous to lectin, olfactomedin, mucin, the secretin receptor family, and a novel structural motif common for large orphan G protein-coupled receptors. The analysis of CIRL deletion mutants indicates that the high affinity alpha -latrotoxin-binding site is located within residues 467-891, which comprise the first transmembrane segment of p85 and the C-terminal half of p120. The N-terminal lectin, olfactomedin, and mucin domains of p120 are not required for the interaction with alpha -latrotoxin. Soluble p120 and all its fragments, which include the 467-770 residues, bind alpha -latrotoxin with low affinity suggesting the importance of membrane-embedded p85 for the stabilization of the complex of the toxin with p120. Two COOH-terminal deletion mutants of CIRL, one with the truncated cytoplasmic domain and the other with only one transmembrane segment left of seven, supported both alpha -latrotoxin-induced calcium uptake in HEK293 cells and alpha -latrotoxin-stimulated secretion when expressed in chromaffin cells, although with a different dose dependence than wild-type CIRL and its N-terminal deletion mutant. Thus the signaling domains of CIRL are not critically important for the stimulation of exocytosis in intact chromaffin cells by alpha -latrotoxin.

    INTRODUCTION
Top
Abstract
Introduction
References

alpha -Latrotoxin, a potent natural stimulator of secretion from neurons and secretory cells, has two structurally and pharmacologically distinct classes of high affinity receptors (1). The calcium-dependent receptor of alpha -latrotoxin or neurexin Ialpha is a large (160-220 kDa) cell surface membrane protein existing in multiple isoforms (2, 3). It has one transmembrane segment and structurally resembles cell adhesion proteins (4). A second high affinity receptor is the calcium-independent receptor of alpha -latrotoxin (CIRL)1 (5, 6). CIRL is thought to be more important for alpha -latrotoxin effects in neurons than neurexin Ialpha because alpha -latrotoxin can stimulate neurotransmitter release from neurons in Ca2+-free media (7, 8). CIRL, also called latrophilin, belongs to a family of closely related orphan G protein-coupled receptors (GPCRs) homologous to the secretin receptor family (9, 10). In this family of three closely homologous proteins, CIRL-1 is a brain-enriched high affinity alpha -latrotoxin receptor, whereas CIRL-2 is a ubiquitously expressed low affinity receptor of the toxin (11).

The CIRL receptors have an unusual structure for GPCRs. First, they are significantly larger (about 200 kDa) than most of the GPCRs. Second, they consist of two heterologous subunits because of endogenous proteolytic processing of the precursor protein. The site of this cleavage is located 18 residues upstream from the first transmembrane segment. As a result, mature CIRL consists of two noncovalently bound subunits, p120 and p85. p120 is a hydrophilic protein that is soluble and secreted if expressed separately from p85, whereas p85 has structural features typical of a generic GPCR although with an unusually large cytoplasmic tail (9, 11).

There is ample evidence that alpha -latrotoxin receptors are critically required for the effects of alpha -latrotoxin (1, 12, 13). However, the mechanism of signaling downstream of the receptors is not known. The heptahelical structure of CIRL suggests its function as a regulator of a G protein pathway. However, no coupling of CIRL to any G protein has been convincingly shown. Moreover, no direct data are currently available to prove that alpha -latrotoxin acts as an agonist or antagonist of its receptors.

To analyze the structural requirements for alpha -latrotoxin binding and alpha -latrotoxin stimulatory function, we generated three series of CIRL deletion mutants. Soluble fragments of the extracellular region of CIRL were used to map the alpha -latrotoxin-binding site. On the basis of this information, N-terminally truncated membrane-bound forms of CIRL were produced, which were shown to retain high affinity alpha -latrotoxin binding activity. Finally, deletions in the COOH-terminal region of CIRL were produced to remove the domains potentially involved in receptor signaling. The constructs lacking the CIRL cytoplasmic tail and six of its seven transmembrane segments appeared to be fully functional in terms of alpha -latrotoxin binding, Ca2+ influx in HEK293 cells, and coupling of the toxin to secretion in transfected chromaffin cells. Our data suggest that G protein-mediated signaling is not critically important for the alpha -latrotoxin-stimulated secretion in chromaffin cells.

    EXPERIMENTAL PROCEDURES

alpha -Latrotoxin was purified from lyophilized black widow spider glands and radioactively labeled with 125I using the chloramine T procedure. The toxin was immobilized on BrCN-Sepharose as described (2).

Soluble Deletion Mutants of the Extracellular Region of CIRL-- The pCDR7N construct encoding the extracellular region of CIRL (residues 1-856) with COOH-terminal His6 tag was described previously (9). The pCDR120 construct encoding the p120 subunit of CIRL precisely was prepared by ligating the AgeI/XbaI-digested PCR product obtained with primers ACATCTAGAGGTGGCTGCAGGCACATGTGGTA and ACAGGCCCAGCCGGCCAACACCATCAAGCAGAACAGCC on the 87-7 CIRL cDNA clone as a template into pCDR7 plasmid cut with AgeI/XbaI. The structure of the PCR-derived region of the final plasmid was verified by sequencing. The recombinant DNA fragments encoding other deletion mutants were prepared by high fidelity PCR with Pfu polymerase and synthetic oligonucleotide primers containing SfiI (sense) or XbaI (antisense) restriction sites. The expression constructs were prepared by ligating the SfiI/XbaI-digested PCR products into SfiI/XbaI-digested pSecTag plasmid (Invitrogen) in frame with the His6 tag. Thus prepared constructs encoded the following residues of CIRL: pSTR7-1, residues 25-598; pSTR7-2, residues 25-856; pSTR7-3, residues 25-631; pSTR7-4, residues 25-705; pSTR7-5, residues 25-770; pSTR7-6, residues 128-856; pSTR7-9, residues 538-856; pSTR7-16, residues 467-705; pSTR7-20, residues 185-856. The plasmids were transfected into COS-7 cells using the LipofectAMINE method according to Life Technologies, Inc. protocol. After 3 days, the conditioned media and cells were harvested and analyzed for the presence of the recombinant protein by precipitation with nickel-agarose followed by Western blotting with anti-p120 antibody.

N-terminal Deletion Mutants of CIRL-- To generate the N-terminal deletion mutants anchored to the membrane-bound fragment of CIRL, AgeI/XbaI-digested pSTR7-6, -7, -8, and -9 plasmids were ligated with a DNA fragment of 3,060 base pairs obtained by digesting pCDR7 with AgeI/XbaI. This insert encoded a short COOH-terminal region of p120 and the entire p85 subunit. These constructs encoded the following residues of CIRL: pSTR7-6M, residues 128-1471; pSTR7-7M, residues 394-1471; pSTR7-8M, residues 467-1471; pSTR7-9M, residues 538-1471. COS cells were transfected with these plasmids, harvested in 3 days, and analyzed for alpha -latrotoxin binding activity as described below.

Purification of the Recombinant Extracellular Domain of CIRL and the Analysis of Its Affinity to alpha -Latrotoxin-- COS cells were transfected with an expression plasmid pCDR7N encoding the entire N-terminal extracellular region of CIRL (1-837 residues) with a His6 tag at the COOH terminus. In 2 days, the cell media were collected, and 10 ml of media were incubated with 300 µl of nickel-agarose overnight at 4 °C with gentle agitation. The matrix was washed 4 times with 50 mM Tris-HCl and 500 mM NaCl, pH 7.5, and eluted with 1 ml of 100 mM imidazole in the same buffer. The binding activity of the eluted proteins was measured by a solid-phase method on a 96-well plate (5). 125I-alpha -Latrotoxin was added to a final concentration of 0.5-60 nM. Specific binding was measured as the difference between total binding and nonspecific binding in the presence of 900 nM unlabeled alpha -latrotoxin.

COOH-terminal Deletion Mutants of CIRL-- Two COOH-terminal deletion mutants of CIRL were prepared. The first one, pCDR-7TMR, included the p120 subunit, the seven transmembrane region, and 49 N-terminal amino acid residues of the COOH-terminal cytoplasmic tail (residues 1-1149 of CIRL). The second one, pCDR-1TMR, included p120, the first transmembrane region, and the first intracellular loop of p85 (residues 1-891). To generate a pCDR-7TMR expression vector, two complementary 5'-phosphorylated oligonucleotides, 5'-pCCGGAGCGGCCGCTGAT and 5'-pCTAGATCAGCGGCCGCT, were used in the ligation reaction with the BspEI/XbaI-digested pCDR7 (9) vector. To generate a pCDR-1TMR expression vector, the 7313-base pair product of AgeI/XbaI digestion of pCDR7 was ligated with a 421-base pair fragment obtained by AgeI/XbaI digestion of a 1267-base pair PCR product where pCDR7 was used as a template and the primers ACAGGCCCAGCCGGCCAATCTGCATGTGTCCCCTGAGCT and TTTCTAGATCAGCGGTCGGTCTGCAG were used.

alpha -Latrotoxin Binding Analysis of Soluble Proteins-- 0.7 ml of media from transfected COS cells was cleared by centrifugation and incubated with 15 µl of alpha -latrotoxin-Sepharose overnight at 4 °C. The matrices were washed 3 times with 1.25 ml of ice-cold 50 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, pH 8.0, and eluted with SDS electrophoresis sample buffer. The eluates were electrophoresed and analyzed by Western blotting with anti-p120 antibody.

alpha -Latrotoxin Binding Analysis of Cell Membranes-- Three days after transfection, the COS cells were harvested on ice in physiological saline and centrifuged. The pellet was resuspended in a 50 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, and 1% bovine serum albumin, pH 8.0, incubation buffer, and 10% of the cell material harvested from one 100-mm Petri dish was incubated with 5 nM 125I-alpha -latrotoxin in the final volume of 200 µl for 15 min. The binding reaction suspensions were diluted with the ice-cold incubation buffer and immediately centrifuged at 14,000 rpm in the Eppendorf centrifuge for 10 min. The pellets were counted for radioactivity in a gamma -counter. The nonspecific binding was measured in the presence of 100 nM cold toxin.

Chromaffin cell and HEK293 cell transfections and functional analysis of CIRL mutants were performed as described previously (9, 14).

    RESULTS

Domain Structure of CIRL-- Computer-assisted analysis of the CIRL protein sequence reveals a number of distinct structural domains (Fig. 1). A central region of CIRL (residues 850-1100) shows significant homology to the members of the secretin family of GPCRs (9). According to the hydrophobicity plot of CIRL, this region contains seven long hydrophobic stretches, a hallmark of GPCRs. In GPCRs, these hydrophobic sequences are alpha -helical rods that form a compact oval-shaped integral transmembrane cluster (15). Similar to other GPCRs, three intracellular and three extracellular hydrophilic loops in between transmembrane helices can be identified in CIRL.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1.   Domain structure of CIRL. The domains with homology to lectin and olfactomedin are labeled as such. The STP domain is the region weakly homologous to mucin and enriched in Ser, Thr, and Pro. Cys-rich motif or SR, a signature conserved in the N-terminal extracellular regions of the secretin receptor family members. An ellipse indicates the location of GPS (GPCR proteolysis site), a structural motif common for large orphan GPCRs homologous to CIRL. An arrow on the top indicates the cleavage site of the signal peptide. All cysteine/cysteine residues are numbered and marked as SH. PM, plasma membrane.

The intracellular COOH-terminal region of CIRL (residues 1100-1471) is unusually large for an average GPCR. It contains a pair of vicinal Cys residues typical for the GPCR palmitoylation site and several proline reach clusters. It has no significant homology to any known protein except for two other members of the CIRL family, CIRL-2 and -3 (11).

In contrast, several domains of the extracellular N-terminal region of CIRL show significant homology with various receptor and nonreceptor proteins. The signal peptide sequence is followed by a cysteine-rich domain (residues 30-120) homologous to sea urchin egg D-galactoside-specific lectin (GenBank number P22031) and plant beta -galactosidase (GenBank number Z99708). The same domain is found in a Caenorhabditis elegans homolog of CIRL (GenBank number Z54306). The adjacent domain (residues 120-400) is similar to olfactomedin (GenBank number AF028740), a major structural block in the extracellular matrix of the olfactory neuroepithelium and several structurally related proteins including the pancortin family (GenBank number Q62609, D78264, D78262, Q99784, AB006688, AF049796, AF035301, Q99972, AF039869). Their physiological role is unclear.

The next structural domain (residues 400-470) is enriched in Ser, Thr, and Pro residues and shows insignificant homology to mucin and other Pro-rich proteins. We will therefore refer to this domain as the STP domain. The STP domain is followed by a short region (residues 470-540) with a Cys-rich motif CX9-10WX9-12CX10-17CX4-6WX8-16C identified by Psi -Blast search in the extracellular domains of GPCRs, which belong to the secretin receptor family. Interestingly, in "normal" receptors of this family (e.g. vasoactive intestinal peptide receptor, pituitary adenylate cyclase-activating polypeptide receptor, secretin receptor, calcitonin receptor, corticotropin-releasing factor receptor, growth hormone-releasing hormone receptor, glucagon-like peptide receptor, etc.) this motif is located very close to the transmembrane core. In the CIRL family and in a number of other large orphan GPCRs (GenBank numbers U39848, Z54306, D87469, AB011529, AB011528, AB005297, AB011536, AB011122), this motif is located several hundred amino acid residues from the membrane segments, and therefore we may assume that the large orphan receptors represent a separate subfamily within the family of the secretin receptor.

The region between residues 541 and 800 has low homology to brain-specific angiogenesis inhibitor-3 (GenBank number AB005299), another large orphan GPCR that among all known large GPCRs is most similar to the members of the CIRL family. The recently discovered brain-specific angiogenesis inhibitor family was implicated in tumor angiogenesis regulation; brain-specific angiogenesis inhibitor-1 expression is regulated by p53 (16, 17).

Finally, in the COOH terminus of p120 immediately adjacent to the putative site of CIRL proteolysis a novel structural motif is found that is characteristic for about a dozen large orphan GPCRs of the secretin receptor family (GenBank numbers U39848, U76764, P48960, Q61549, Q14246, AC004262, D87469, AB011529, AB011528, AB011536, AB005297, X81892, AB005298, AF006014, AB011122). We propose to name this motif GPS for GPCR proteolysis site. The characteristic feature of the GPS domain is a cysteine signature including CXC, two additional cysteine residues, and two tryptophan residues at fixed positions. When conserved residues of the GPS motif were mutated, CIRL could no longer be proteolyzed endogenously.2

Mapping the alpha -Latrotoxin-binding Site in CIRL-- We showed earlier that the recombinant N-terminal extracellular region of CIRL binds efficiently to immobilized alpha -latrotoxin (9). To identify the alpha -latrotoxin binding domain(s) of CIRL more precisely, we have generated a series of deletion mutants of its extracellular region. The desired DNA fragments were prepared by high fidelity PCR with synthetic oligonucleotide primers that were designed according to the putative domain borders of the extracellular region of CIRL (Fig. 2). The PCR fragments were cloned into a pSecTag eucaryotic expression plasmid (Invitrogen), which contained a signal peptide sequence that allowed extracellular secretion of soluble proteins and a COOH-terminally fused His6 tag that allowed easy purification of the recombinant protein.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   Deletion mutants of CIRL. The structure of recombinant proteins is shown with domains labeled. The numbers on the left identify the borders of the deletion mutants according to the CIRL protein sequence. SR, sarcoplasmic reticulum; SP, signal peptide.

The resulting constructs were transfected into COS cells. The cells and media were harvested and analyzed for the presence of recombinant proteins by the adsorption onto nickel-agarose followed by Western blotting with anti-p120 antibody. Among tested constructs, pCDR-120, pCDR7N, and pSTR7-2, -6, -7, and -20 were expressed and secreted in the medium. Proteins encoded by pSTR7-1, -3, -4, -5, -9, and -16 were expressed well but accumulated inside the cells (data not shown). It is interesting to note that most of the secreted proteins were N-terminally truncated, whereas most of the nonsecreted deletion mutants were COOH-terminally truncated. This finding raises a possibility that the extracellular region of CIRL contains in its COOH-terminal part a signal sequence that regulates intracellular sorting and trafficking of the protein.

To analyze the alpha -latrotoxin binding activity of the recombinant proteins, the conditioned media or cell extracts were adsorbed onto alpha -latrotoxin-Sepharose followed by Western blotting with anti-p120 antibody (Fig. 3). The constructs pCDR-120, pCDR7N, and pSTR7-2, -5, -6, -7, and -20 specifically interacted with the toxin, whereas pSTR7-1, -3, -4, -9, and -16 did not. The shortest N-terminally truncated mutant that still bound the toxin was pSTR7-7. A shorter construct pSTR7-9 (residues 538-856) failed to interact with the toxin. The analysis of alpha -latrotoxin binding activity of COOH-terminally truncated mutants demonstrated that the downstream border of the toxin-binding site may be located close to the membrane. The pCDR7N protein, which is the entire extracellular region of CIRL (residues 1-856) and recombinant p120 (residues 1-837, construct pCDR-120), bound to the toxin quite well. A shorter protein pSTR7-5 (residues 25-770) bound to alpha -latrotoxin much less efficiently, whereas pSTR7-4 (residues 25-705) did not interact with the toxin at all. Together, these data suggest that the residues critical for alpha -latrotoxin binding are located in the COOH-terminal half of p120 with a significant site of interaction around residue 770. 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Localization of the alpha -latrotoxin-binding site. 1 ml of conditioned media of COS cells transfected with CIRL deletion mutants (constructs pSTR7-2, -6, -7, -16, -20, and pCDR7N) or 50 µl of cells (pSTR7-1, -3, -4, -5, and -9) extracted with 1 ml of a buffer with 2% Triton X-100 was incubated with 10 µl of alpha -latrotoxin-agarose overnight with gentle agitation. After three washes, the pellets were eluted in 50 µl of SDS-sample buffer/dithiothreitol, boiled for 3 min, and analyzed by Western blotting with anti-p120 antibody (L). To verify the expression, 2 µl of transfected cells were analyzed directly (E).

Soluble Fragments of the Extracellular Domain of CIRL Are Low Affinity alpha -Latrotoxin-binding Proteins-- To further analyze the interaction of alpha -latrotoxin with the extracellular domain of CIRL and its fragments, we tested the ability of these soluble proteins to inhibit the binding of iodinated alpha -latrotoxin to brain membranes. Surprisingly, no significant inhibition was detected with any protein tested including the entire uncleaved extracellular domain encoded by pCDR7N, p120 (these two constructs were not based on PCR-generated sequences), and their fragments (data not shown). The concentration of CIRL fragments in the binding mixtures was typically in the range of 20-60 nM, whereas the concentration of labeled alpha -latrotoxin was 2 nM.

Because these same soluble CIRL fragments bound quite well to immobilized alpha -latrotoxin, we assumed that they were alpha -latrotoxin-binding proteins. However, their affinity to the toxin was lower than the affinity of endogenous CIRL, and therefore they could not compete effectively in the concentration range tested. To estimate the affinity of p120 and its deletion mutants to alpha -latrotoxin, we used the solid-phase assay developed earlier for the analysis of alpha -latrotoxin binding activity of detergent-solubilized CIRL (5). p120 solution was applied to the bottoms of 96-well plates by drying at ambient temperature. After washing and blocking, solutions with various concentrations of 125I-alpha -latrotoxin were added to the wells. Following multiple washes, the absorbed labeled toxin was eluted with SDS-containing buffer and counted for radioactivity. Scatchard plot analysis revealed that the affinity of alpha -latrotoxin binding to p120 was about 25 nM, which was approximately 2 orders of magnitude lower than the affinity of CIRL binding (data not shown).

High Affinity Binding of alpha -Latrotoxin to N-terminally and COOH-terminally Truncated Membrane-associated CIRL-- Low affinity interaction of alpha -latrotoxin with soluble p120 raised the possibility that the formation of high affinity complex requires participation of p85. To test this, we recombined DNA fragments encoding soluble deletion mutants with the sequence of p85 so that the resulting constructs encoded N-terminally truncated forms of CIRL. In the 5'-region of pSTR7-6, -7, -8, and -9, a fragment of CIRL cDNA was subcloned, which restored the junction of p120 and p85 identically to wild-type CIRL. The resulting expression constructs encoded the following residues of the CIRL protein sequence: pSTR7-6M, residues 128-1471; pSTR7-7M, 394-1471; pSTR7-8M, 467-1471; pSTR7-9M, 538-1471. The analysis of the transfected COS cells demonstrated that all mutants except pSTR7-9M bound to alpha -latrotoxin specifically (Fig. 4A). This result was in good agreement with the analysis of soluble deletion mutants of CIRL and suggests that lectin-like, olfactomedin-like, and STP (mucin-like) domains in the N-terminal half of p120 are not important for alpha -latrotoxin binding.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   High affinity interaction of alpha -latrotoxin with N-terminal deletion mutants of CIRL. A, COS cells transfected with pCDR7 (wild-type CIRL or WT), salmon sperm DNA (SS) as a negative control, or pSTR7-6M, -7M, -8M, -9M were harvested and incubated with 5 nM 125I-alpha -latrotoxin. The total binding of the labeled toxin is shown as black bars. The nonspecific binding measured in the presence of a 20-fold excess of unlabeled toxin is shown as white bars. Each experiment was done in duplicate, and the average is shown (deviation was less than 3% for each measurement shown). The alpha -latrotoxin binding affinity of the deletion mutants pSTR7-7M (B) and pSTR7-8M (C) was compared with the affinity of CIRL by the Scatchard plot analysis.

We further quantitated the alpha -latrotoxin binding activity of pSTR7-7M and pSTR7-8M, the two shortest alpha -latrotoxin-binding mutants, by Scatchard plot analysis. It appeared that both membrane-bound deletion mutants interacted with alpha -latrotoxin with the same high affinity as wild-type CIRL (Fig. 4, B and C). We can therefore conclude that the primary alpha -latrotoxin-binding site is located in the COOH-terminal half of p120. However, the high affinity interaction requires complexing of p120 with membrane-bound p85. Because the plasmids for membrane-bound mutants were prepared on the basis of the constructs encoding soluble CIRL fragments, this experiment also demonstrates that the low affinity of the recombinant soluble CIRL fragments was not because of a PCR or cloning artifact.

To test the importance of different regions of p85 in the interaction with alpha -latrotoxin, we generated two mutants of CIRL with deleted portions of the p85 subunit by introducing stop codons (Fig. 5). The first mutant pCDR-7TMR did not contain most of the large COOH-terminal cytoplasmic tail of p85. In the second mutant pCDR-1TMR, the N-terminal region of p85 with only one transmembrane segment was preserved. It appeared that both deletion mutants expressed very well and both showed alpha -latrotoxin binding activity (Fig. 6A). The Scatchard plot analysis of the one transmembrane mutant demonstrated high affinity binding indistinguishable from the wild-type receptor (Fig. 6B). These results rule out the involvement of the extracellular loops and the cytoplasmic tail of p85 in the stabilization of the alpha -latrotoxin complex with p120.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 5.   Structures of the COOH-terminal deletion mutants of CIRL. Wild-type CIRL (WT), the mutant with deleted COOH-terminal cytoplasmic region up to residue 1149 (7TMR) encoded by plasmid pCDR-7TMR, and the mutant with only one transmembrane segment (1TMR, residues 1-891 of CIRL) encoded by plasmid pCDR-1TMR are shown schematically. PM, plasma membrane.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   High affinity interaction of alpha -latrotoxin with COOH-terminal deletion mutants of CIRL. A, COS cells transfected with pCDR7 (wild-type CIRL or WT), salmon sperm DNA (SS) as a negative control, pCDR-7TMR, and pCDR-1TMR on day 3 were harvested and incubated with 5 nM 125I-alpha -latrotoxin. The total binding of the labeled toxin is shown as black bars. The nonspecific binding measured in the presence of a 20-fold excess of unlabeled toxin is shown as gray bars. Each experiment was done in duplicate and the average is shown (deviation was less than 3% for each measurement shown). B, the alpha -latrotoxin binding affinity of the deletion mutant pCDR-1TMR was compared with the affinity of CIRL by Scatchard plot analysis.

Deletion Mutants of CIRL Are Functional in Coupling CIRL to Exocytosis-- We determined whether deletion constructs that possessed high affinity alpha -latrotoxin binding (pCDR-1TMR, pCDR-7TMR, and pCDR7-8) supported alpha -latrotoxin-stimulated calcium influx when expressed in HEK293 cells (Fig. 7). All three proteins increased the uptake of 45Ca2+, although the pCDR-1TMR mutant was less effective than pCDR-7TMR, pCDR7-8, or CIRL itself and had little effect at 50 pM alpha -latrotoxin. The data indicate that the COOH-terminal part of CIRL is not required in mediating the effects of alpha -latrotoxin on calcium permeability and suggest that high affinity alpha -latrotoxin binding is sufficient for calcium influx.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   Deletion mutants of CIRL support Ca2+ entry elicited by alpha -latrotoxin. HEK293 cells were transfected with plasmids for pCDR7 (filled circle), pCDR-7TMR (filled square), pCDR-1TMR (open square), pSTR7-8M (triangle), or pCMVneo (open circle) as a control by LipofectAMINE. Two days later, the cells were incubated with various concentrations of alpha -latrotoxin (alpha -LTX) in PSS containing 2.2 mM Ca2+, 0.5 mM Mg2+, and 3 mCi/ml 45Ca2+. After 5 min, the cells were immediately rinsed 3 times in PSS, and the amount of 45Ca2+ in the cells was determined by liquid scintillation spectrometry. n, 4 wells/group.

We noted that at higher concentrations of alpha -latrotoxin cells transfected with a control plasmid (neo) or nontransfected cells (not shown) also exhibited some alpha -latrotoxin-stimulated 45Ca2+ influx. This increase in calcium permeability is probably because of the alpha -latrotoxin interaction with an endogenous HEK293 cell protein, because it is completely blocked by preincubation of the cells with concanavalin A (data not shown).

Transient expression of CIRL in chromaffin cells increases their sensitivity to alpha -latrotoxin (9). We asked whether the increase in calcium permeability seen with pCDR-1TMR, pCDR-7TMR, and pCDR7-8 was coupled to the secretory response in chromaffin cells. Because the transfection efficiency of primary cultures is low, the various mutants were co-expressed with human growth hormone, which is stored in secretory granules and serves as a reporter for secretion from the transfected cells. Each of the three constructs increased the sensitivity of transfected cells to low concentrations of alpha -latrotoxin (2.5 and 10 pM), and the magnitude of the effect was similar to that of wild-type CIRL (Fig. 8A). Catecholamine release (a measure of secretion from all the cells, the majority of which were not successfully transfected) was similar for all the groups (Fig. 8B). We conclude that the COOH-terminal part of CIRL is unnecessary in mediating alpha -latrotoxin-stimulated secretion from intact chromaffin cells. Interestingly, at higher concentrations of alpha -latrotoxin, some inactivation of the secretory response was seen with CIRL and pCDR7-8 that did not occur with the COOH-terminal deletion mutants 1TMR and 7TMR, raising the possibility that the COOH-terminal cytoplasmic tail of CIRL plays an additional role in modulating secretion.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8.   Expression of CIRL deletion mutants increases the sensitivity of intact chromaffin cells to stimulation by alpha -latrotoxin. Chromaffin cells were transfected with plasmids for pCDR7 (filled circle), pCDR-7TMR (filled square), pCDR-1TMR (open square), pSTR7-8M (triangle), or pCMVneo (open circle) as a control by calcium phosphate precipitates. Five days later, cells were incubated with the indicated concentrations of alpha -latrotoxin in PSS without Ca2+ or Mg2+ and with 0.2 mM EGTA. After 4 min, the toxin was removed and the cells were incubated for an additional 5 min in PSS containing 2.2 mM Ca2+ and 0.5 mM Mg2+. The amounts of human growth hormone (A) and catecholamine (B) released into the medium and the amounts remaining in the cells were determined as described. n, 4 wells/group.


    DISCUSSION

alpha -Latrotoxin acts extracellularly by binding to endogenous membrane receptors that belong to the neurexin and CIRL families. The formation of receptor-toxin complexes is followed by cation influx through alpha -latrotoxin-induced channels and by as yet unidentified signaling that eventually results in massive spontaneous exocytosis. Part of the effects of alpha -latrotoxin can be explained by Ca2+ entry through the toxin-induced pores. However, the toxin is also active when applied in nominally Ca2+-free buffers (7, 8, 18) or when cation fluxes are controlled, e.g. in permeabilized cells (14, 19). A possible explanation of the calcium-independent effect of alpha -latrotoxin is that it activates its membrane receptors, which results in intracellular signaling, through a G protein-linked pathway (19, 20).

To analyze the interaction of alpha -latrotoxin with CIRL and subsequent functional effects, we have generated a set of CIRL deletion mutants that were examined in binding experiments, 45Ca2+ influx assays in HEK293 cells and secretion experiments in chromaffin cells. We found that 1) small segments of the extracellular and membrane domains of CIRL are required for high affinity binding to latrotoxin and for functional effects of latrotoxin, and 2) CIRL-coupled G protein signaling is not critically important for alpha -latrotoxin-stimulated Ca2+ influx in HEK293 cells or secretion from chromaffin cells. The evidence in support of these conclusions is discussed below.

High Affinity Binding of Latrotoxin Requires a Short Extracellular Segment and the First Transmembrane Domain-- CIRL consists of two noncovalently bound subunits, p120, which is extracellular, and p85, which contains seven transmembrane segments and the COOH-terminal cytoplasmic domain. The analysis of a series of soluble recombinant fragments of CIRL by precipitation with alpha -latrotoxin-agarose showed that the alpha -latrotoxin-binding site lies within the COOH-terminal half of p120. However, none of the recombinant soluble fragments of CIRL (including p120 and the nonprocessed full-size extracellular region, pCDR7N) that bound effectively to immobilized alpha -latrotoxin were able to compete with the binding of alpha -latrotoxin to endogenous CIRL in brain membranes. The Scatchard plot analysis of the alpha -latrotoxin binding activity of the full-length extracellular region indicated that its affinity was about 2 orders of magnitude lower than the affinity of CIRL.

In contrast, two N-terminally truncated fragments of CIRL, which contained p85 in addition to the alpha -latrotoxin binding domain of p120, bound the toxin with the same high affinity as wild-type CIRL. The extracellular loops of p85 are apparently not important for the stabilization of the complex with the toxin because a deletion mutant, which contained only the first transmembrane segment, bound to alpha -latrotoxin with high affinity.

Therefore we propose that the interaction of alpha -latrotoxin with CIRL consists of two sequential steps. At first, alpha -latrotoxin binds with medium affinity to the extracellular region of CIRL. Following this binding, the toxin interacts with the first transmembrane segment of CIRL, with the membrane lipids, or with both and penetrates into the lipid bilayer as a result. This second step increases affinity of the interaction and may require a longer time, which would explain a known delay in alpha -latrotoxin effects within a minute after its application.

Only a Single Transmembrane-spanning Domain Is Required to Support Latrotoxin-induced Ca2+ Influx and Secretion-- CIRL deletion mutants that bound alpha -latrotoxin with high affinity were also effective in coupling alpha -latrotoxin to calcium influx into HEK293 cells and exocytosis in chromaffin cells, although the 1TMR mutant was noticeably less effective than wild-type CIRL and other mutants in the 45Ca2+ uptake assay. Most importantly, a mutant receptor lacking six of seven transmembrane segments was similar to wild-type CIRL in the secretion experiments. Because this mutant receptor would be unable to activate G proteins, these experiments indicate that the receptor does not mediate the stimulatory effect of alpha -latrotoxin in intact chromaffin cells by direct coupling to G proteins.

The shape of the dose-effect curves for overexpressed wild-type CIRL and its N-terminally truncated mutant was significantly different from those of the COOH-terminal mutants (Fig. 8A). The dose dependence of the alpha -latrotoxin-stimulated exocytosis in chromaffin cells via either endogenous receptors, overexpressed CIRL, or its N-terminal mutant was bell-shaped (14) (Fig. 8). In contrast, for both COOH-terminally truncated mutants, the dose dependence did not show "inactivation" at higher concentrations of alpha -latrotoxin. It is therefore possible that alpha -latrotoxin binding to CIRL results in multiple effects, one of which is dependent upon the integrity of the COOH terminus of the p85 subunit.

What may be the physiological importance of CIRL? Because it serves to target alpha -latrotoxin, a potent stimulator of secretion, it is likely that this receptor is positioned appropriately for the regulation of exocytosis. CIRL has been shown to co-purify with syntaxin, a t-SNARE (9). In permeabilized chromaffin cells overexpression of CIRL inhibits Ca2+-stimulated secretion (14). Together, these findings suggest that CIRL may serve as a physiological regulator of exocytosis. Because of the presence of cell adhesion structural modules in its extracellular domain, it is possible that direct physical contacts of cells modulate secretion via CIRL-mediated signaling.

    FOOTNOTES

* This study was supported by public health service Grants R01NS35098 and R01NS34937 from the NINDS, National Institutes of Health (to A. G. P.) and Grant R01DK27959 from the NIDDK, National Institutes of Health (to R. W. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

parallel To whom correspondence should be addressed: Dept. of Pharmacology, New York University Medical Center, 550 First Ave., MSB-202, New York, NY 10016. Tel.: 212-263-5969; Fax: 212-263-7133; E-mail: petrea01{at}mcrcr.med.nyu.edu.

The abbreviations used are: CIRL, calcium-independent receptor of alpha -latrotoxin; GPCR, G protein-coupled receptor; PCR, polymerase chain reaction; GPS, GPCR proteolysis site; PSS, physiological salt solution; STP domain, Ser, Thr, and Pro-rich domain.

2 V. Krasnoperov, K. Ichtchenko, and A. G. Petrenko, manuscript in preparation.

    REFERENCES
Top
Abstract
Introduction
References

  1. Petrenko, A. G., and Krasnoperov, V. G. (1998) in Cellular and Molecular Mechanisms of Toxin Action Secretory Systems (Linial, M., and Grasso, A., eds), pp. 185-214, Harwood Academic Publishers, Amsterdam
  2. Petrenko, A. G., Kovalenko, V. A., Shamotienko, O. G., Surkova, I. N., Tarasyuk, T. A., Ushkaryov, Y. A., and Grishin, E. V. (1990) EMBO J. 9, 2023-2027[Medline] [Order article via Infotrieve]
  3. Petrenko, A. G., Lazaryeva, V. D., Geppert, M., Tarasyuk, T. A., Moomaw, C., Khokhlatchev, A. V., Ushkaryov, Y. A., Slaughter, C., Nasimov, I. V., and Sudhof, T. C. (1993) J. Biol. Chem. 268, 1860-1867[Abstract/Free Full Text]
  4. Ushkaryov, Y. A., Petrenko, A. G., Geppert, M., and Sudhof, T. C. (1992) Science 257, 50-56[Abstract/Free Full Text]
  5. Krasnoperov, V. G., Beavis, R., Chepurny, O. G., Little, A. R., Plotnikov, A. N., and Petrenko, A. G. (1996) Biochem. Biophys. Res. Commun. 227, 868-875[CrossRef][Medline] [Order article via Infotrieve]
  6. Davletov, B. A., Shamotienko, O. G., Lelianova, V. G., Grishin, E. V., and Ushkaryov, Y. A. (1996) J. Biol. Chem. 271, 23239-23245[Abstract/Free Full Text]
  7. Misler, S., and Falke, L. C. (1987) Am. J. Physiol. 253, C469-C476[Abstract/Free Full Text]
  8. Capogna, M., Gahwiler, B. H., and Thompson, S. M. (1996) J. Neurophysiol. 76, 3149-3158[Abstract/Free Full Text]
  9. Krasnoperov, V. G., Bittner, M. A., Beavis, R., Kuang, Y., Salnikow, K. V., Chepurny, O. G., Little, A. R., Plotnikov, A. N., Wu, D., Holz, R. W., and Petrenko, A. G. (1997) Neuron 18, 925-937[CrossRef][Medline] [Order article via Infotrieve]
  10. Lelianova, V. G., Davletov, B. A., Sterling, A., Rahman, M. A., Grishin, E. V., Totty, N. F., and Ushkaryov, Y. A. (1997) J. Biol. Chem. 272, 21504-21508[Abstract/Free Full Text]
  11. Ichtchenko, K., Bittner, M. A., Krasnoperov, V., Little, A. R., Chepurny, O., Holz, R. W., and Petrenko, A. G. (1999) J. Biol. Chem., in press
  12. Rosenthal, L., and Meldolesi, J. (1989) Pharmacol. Ther. 42, 115-134[CrossRef][Medline] [Order article via Infotrieve]
  13. Geppert, M., Khvotchev, M., Krasnoperov, V., Goda, Y., Missler, M., Hammer, R. E., Ichtchenko, K., Petrenko, A. G., and Sudhof, T. C. (1998) J. Biol. Chem. 273, 1705-1710[Abstract/Free Full Text]
  14. Bittner, M. A., Krasnoperov, V. G., Stuenkel, E. L., Petrenko, A. G., and Holz, R. W. (1998) J. Neurosci. 18, 2914-2922[Abstract/Free Full Text]
  15. Dohlman, H. G., Thorner, J., Caron, M. G., and Lefkowitz, R. J. (1991) Annu. Rev. Biochem. 60, 653-688[CrossRef][Medline] [Order article via Infotrieve]
  16. Nishimori, H., Shiratsuchi, T., Urano, T., Kimura, Y., Kiyono, K., Tatsumi, K., Yoshida, S., Ono, M., Kuwano, M., Nakamura, Y., and Tokino, T. (1997) Oncogene 15, 2145-2150[CrossRef][Medline] [Order article via Infotrieve]
  17. Shiratsuchi, T., Nishimori, H., Ichise, H., Nakamura, Y., and Tokino, T. (1997) Cytogenet. Cell Genet. 79, 103-108[Medline] [Order article via Infotrieve]
  18. Rosenthal, L., Zacchetti, D., Madeddu, L., and Meldolesi, J. (1990) Mol. Pharmacol. 38, 917-923[Abstract]
  19. Lang, J., Ushkaryov, Y., Grasso, A., and Wollheim, C. B. (1998) EMBO J. 17, 648-657[CrossRef][Medline] [Order article via Infotrieve]
  20. Davletov, B. A., Meunier, F. A., Ashton, A. C., Matsushita, H., Hirst, W. D., Lelianova, V. G., Wilkin, G. P., Dolly, J. O., and Ushkaryov, Y. A. (1998) EMBO J. 17, 3909-3920[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Lajus, P. Vacher, D. Huber, M. Dubois, M.-N. Benassy, Y. Ushkaryov, and J. Lang
{alpha}-Latrotoxin Induces Exocytosis by Inhibition of Voltage-dependent K+ Channels and by Stimulation of L-type Ca2+ Channels via Latrophilin in beta-Cells
J. Biol. Chem., March 3, 2006; 281(9): 5522 - 5531.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-H. Lin, G.-W. Chang, J. Q. Davies, M. Stacey, J. Harris, and S. Gordon
Autocatalytic Cleavage of the EMR2 Receptor Occurs at a Conserved G Protein-coupled Receptor Proteolytic Site Motif
J. Biol. Chem., July 23, 2004; 279(30): 31823 - 31832.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. E. Volynski, M. Capogna, A. C. Ashton, D. Thomson, E. V. Orlova, C. F. Manser, R. R. Ribchester, and Y. A. Ushkaryov
Mutant {alpha}-Latrotoxin (LTXN4C) Does Not Form Pores and Causes Secretion by Receptor Stimulation: THIS ACTION DOES NOT REQUIRE NEUREXINS
J. Biol. Chem., August 15, 2003; 278(33): 31058 - 31066.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. M. Perez
The Evolutionarily Triumphant G-Protein-Coupled Receptor
Mol. Pharmacol., June 1, 2003; 63(6): 1202 - 1205.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Qian, A. Boletta, A. K. Bhunia, H. Xu, L. Liu, A. K. Ahrabi, T. J. Watnick, F. Zhou, and G. G. Germino
Cleavage of polycystin-1 requires the receptor for egg jelly domain and is disrupted by human autosomal-dominant polycystic kidney disease 1-associated mutations
PNAS, December 24, 2002; 99(26): 16981 - 16986.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Krasnoperov, Y. Lu, L. Buryanovsky, T. A. Neubert, K. Ichtchenko, and A. G. Petrenko
Post-translational Proteolytic Processing of the Calcium-independent Receptor of alpha -Latrotoxin (CIRL), a Natural Chimera of the Cell Adhesion Protein and the G Protein-coupled Receptor. ROLE OF THE G PROTEIN-COUPLED RECEPTOR PROTEOLYSIS SITE (GPS) MOTIF
J. Biol. Chem., November 22, 2002; 277(48): 46518 - 46526.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Krasnoperov, M. A. Bittner, W. Mo, L. Buryanovsky, T. A. Neubert, R. W. Holz, K. Ichtchenko, and A. G. Petrenko
Protein-tyrosine Phosphatase-sigma Is a Novel Member of the Functional Family of alpha -Latrotoxin Receptors
J. Biol. Chem., September 20, 2002; 277(39): 35887 - 35895.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. B. Carson-Walter, D. N. Watkins, A. Nanda, B. Vogelstein, K. W. Kinzler, and B. St. Croix
Cell Surface Tumor Endothelial Markers Are Conserved in Mice and Humans
Cancer Res., September 1, 2001; 61(18): 6649 - 6655.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. D. Hlubek, E. L. Stuenkel, V. G. Krasnoperov, A. G. Petrenko, and R. W. Holz
Calcium-Independent Receptor for alpha -Latrotoxin and Neurexin H Facilitate Toxin-Induced Channel Formation: Evidence That Channel Formation Results from Tethering of Toxin to Membrane
Mol. Pharmacol., March 1, 2000; 57(3): 519 - 528.
[Abstract] [Full Text]


Home page
J. Neurophysiol.Home page
D. B. Elrick and M. P. Charlton
alpha -Latrocrustatoxin Increases Neurotransmitter Release by Activating a Calcium Influx Pathway at Crayfish Neuromuscular Junction
J Neurophysiol, December 1, 1999; 82(6): 3550 - 3562.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Ichtchenko, M. A. Bittner, V. Krasnoperov, A. R. Little, O. Chepurny, R. W. Holz, and A. G. Petrenko
A Novel Ubiquitously Expressed alpha -Latrotoxin Receptor Is a Member of the CIRL Family of G-protein-coupled Receptors
J. Biol. Chem., February 26, 1999; 274(9): 5491 - 5498.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-J. Kreienkamp, H. Zitzer, E. D. Gundelfinger, D. Richter, and T. M. Bockers
The Calcium-independent Receptor for alpha -Latrotoxin from Human and Rodent Brains Interacts with Members of the ProSAP/SSTRIP/Shank Family of Multidomain Proteins
J. Biol. Chem., October 13, 2000; 275(42): 32387 - 32390.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nechiporuk, L. D. Urness, and M. T. Keating
ETL, a Novel Seven-transmembrane Receptor That Is Developmentally Regulated in the Heart. ETL IS A MEMBER OF THE SECRETIN FAMILY AND BELONGS TO THE EPIDERMAL GROWTH FACTOR-SEVEN-TRANSMEMBRANE SUBFAMILY
J. Biol. Chem., February 2, 2001; 276(6): 4150 - 4157.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Bittner and R. W. Holz
Latrotoxin Stimulates Secretion in Permeabilized Cells by Regulating an Intracellular Ca2+- and ATP-dependent Event. A ROLE FOR PROTEIN KINASE C
J. Biol. Chem., August 11, 2000; 275(33): 25351 - 25357.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. E. Volynski, F. A. Meunier, V. G. Lelianova, E. E. Dudina, T. M. Volkova, M. A. Rahman, C. Manser, E. V. Grishin, J. O. Dolly, R. H. Ashley, et al.
Latrophilin, Neurexin, and Their Signaling-deficient Mutants Facilitate alpha -Latrotoxin Insertion into Membranes but Are Not Involved in Pore Formation
J. Biol. Chem., December 22, 2000; 275(52): 41175 - 41183.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow