JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, K.
Right arrow Articles by Fukui, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, K.
Right arrow Articles by Fukui, Y.

J Biol Chem, Vol. 274, Issue 7, 3919-3922, February 12, 1999

COMMUNICATION
Evidence That a Phosphatidylinositol 3,4,5-Trisphosphate-binding Protein Can Function in Nucleus*

Kenichi TanakaDagger §, Kaori HoriguchiDagger , Toshinori Yoshida, Makio Takeda, Hideki Fujisawa, Kenichi Takeuchiparallel , Masato Umedaparallel , Sigeaki Kato**, Sayoko IharaDagger , Satoshi NagataDagger , and Yasuhisa FukuiDagger Dagger Dagger

From the Dagger  Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the  Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the parallel  Department of Inflammation Research, The Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo, 113-8613, and the ** Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan

    ABSTRACT
Top
Abstract
Introduction
References

PIP3BP is a phosphatidylinositol 3,4,5-trisphosphate-binding protein (PIP3BP) abundant in brain, containing a zinc finger motif and two pleckstrin homology (PH) domains. Staining of rat brain cells with anti-PIP3BP antibody and determination of localization of PIP3BP fused to the green fluorescent protein (GFP-PIP3BP) revealed that PIP3BP was targeted to the nucleus. Targeting was dependent on a putative nuclear localization signal in PIP3BP. Generation of PIP3 in the nucleus was detected in H2O2-treated 293T cells, nerve growth factor (NGF)-treated PC12 cells, and platelet-derived growth factor (PDGF)-treated NIH 3T3 cells. Translocation of phosphatidylinositol 3-kinase (PI 3-kinase) to the nucleus and enhanced activity of PI 3-kinase in the nucleus fraction were observed after H2O2 treatment of 293T cells, suggesting that PI 3-kinase can be activated in the nucleus as well as in the membrane after appropriate stimulation of the cells. Co-expression of the constitutively active PI 3-kinase with PIP3BP resulted in exportation of the protein from the nucleus to the cytoplasm, suggesting that PIP3BP can function as a PIP3-binding protein in the intact cells. These results imply that there may be an unknown function of PI 3-kinase in the nucleus.

    INTRODUCTION
Top
Abstract
Introduction
References

Phosphatidylinositol 3-kinase (PI 3-kinase)1 is an enzyme that is activated immediately after growth factor or differentiation factor stimulation of the cells (1) and that generates second messengers, phosphatidylinositol 3,4,5-trisphosphate (PIP3) and phosphatidylinositol 3,4-bisphosphate (PI 3,4-P2) (2-5). These 3'-phosphorylated phosphoinositides can activate serine, threonine kinases such as PKB/Akt, PKCs, and PDKs (6-9). They are also suggested to be involved in other events such as rearrangement of cytoskeleton and vesicle transport because these phenomena are sensitive to the PI 3-kinase inhibitors and dominant negative mutants of PI 3-kinase (10). Recently, it was reported that the 3'-phosphorylated phosphoinositides can activate guanine nucleotide exchanging factors of Rac and Arf, small G proteins involved in actin rearrangement and vesicle transport, respectively (11, 12). Therefore, G proteins as well as kinases are downstream of PI 3-kinase.

We have identified PIP3BP as a PIP3-binding protein, using a PIP3 analogue column (13). It is abundant in brain, implying that it may be involved in the function of nerve systems. PIP3BP binds to PIP3 but not to PI 3,4-P2 or phosphatidylinositol 4,5-bisphosphate (PI 4,5-P2). It has a zinc finger motif homologous to that of Arf-GTPase activating protein (GAP) and two PH domains. Both PH domains are shown to be involved in binding to PIP3. Another PIP3-binding protein, centaurin alpha , is highly homologous to PIP3BP (14). No GAP activity to Arf has been detected in either protein. Although the binding of centaurin alpha  and PIP3BP to PIP3 was specific, the role of the protein is unclear. To address this question, we determined the intracellular localization by immunological techniques, using monoclonal antibody to PIP3BP as well as localization of green fluorescent protein (GFP) fusion proteins. Surprisingly, PIP3BP was found to localize in the nucleus, where the generation of PIP3 was detected after stimulation, suggesting a new pathway of signal transduction through PI 3-kinase to PIP3BP in nucleus. PIP3BP was exported out of the nucleus by expression of a constitutively active PI 3-kinase. This suggests that PIP3BP can shuttle between nucleus and cytoplasm depending on the activity of PI 3-kinase.

    EXPERIMENTAL PROCEDURES

Cell Lines and Transfection-- COS-7 cells and 293T cells were cultured in Dulbecco's modified minimal essential medium (DMEM) supplemented with 10% calf serum. Transfection was done by the calcium phosphate method as described by Shirai et al. (15) except that pH of the buffer was 7.00 instead of 7.15.

Primary Culture of Rat Brain-- Pregnant mice were sacrificed by cervical dislocation on the 18th-day of gestation. After isolation of the embryos from the uterus, by cutting the outer layer of the pelvis, the fetal meninges were removed and the cerebral cortices were placed in DMEM containing 10% fetal bovine serum (Life Technologies, Inc.). Following the mechanical dissociation, cells were passed through a #100 mesh, and were suspended in DMEM supplemented with 10% fetal bovine serum for glial cell culture. For neuronal cell culture, the cells were suspended in neurobasal medium containing 2% B27 supplement (both from Life Technologies, Inc.), 74 µg/ml L-glutamine and 25 µM L-glutamate. They were plated in culture dishes coated with poly-L-lysine (100 µg/ml) and cultured in an atmosphere of 95% air and 5% CO2 at 36 °C.

Plasmids Used in This Study-- A cDNA fragment encoding the full-length PIP3BP or mutant PIP3BPs was subcloned into pEGFP c-1, an expression vector for GFP fusion protein (CLONTECH), to produce pEGFP-PIP3BP, pEGFP-PIP3BP(-NLS), pEGFP(+NLS), and pEGFP-PIP3BP(-PH). PIP3BP-NLS was constructed by deletion of amino acid 1-9 residues using the restriction site, XhoI, in the cDNA. Point mutants in the PH domains in PIP3BP (PIP3BP-PH) were introduced as described previously (13) by substituting Cys for Arg (residues 149 and 272) of PIP3BP by the Kunkel method (16). To obtain Myc-tagged PIP3BP, an Myc-tag sequence with an initiation codon, ATGGAACAGAAGCTGATCTCAGAAGAAGATCT, was attached at the 5' end of the cDNA of the PIP3BP. The resulting gene was expressed under the control of SRalpha promoter by an expression vector pMIKNeo (17). The expression vectors for constitutively active PI 3-kinase (BD110) and a kinase negative mutant of PI 3-kinase (BDKN) were described previously (18). The BD110 protein has a structure similar to that of p110* reported by Hu et al. (19). The protein has an inter-SH2 domain of p85, which binds to the p110 amino terminus. BDKN protein is a kinase negative counterpart of the BD110 protein with a point mutation in the kinase domain.

In Situ Hybridization-- In situ hybridization was carried out as described previously (20). A cDNA fragment encoding the full-length PIP3BP was subcloned into pBluescript SK(+), and the transcripts of T7 or T3 RNA polymerase labeled with digoxigenin were used as antisense or sense probes.

Production of the Monoclonal Antibody and Histocytochemistry-- A monoclonal antibody, mAb 13-14, was produced. GST fusion protein of PIP3BP (GST-PIP3BP) was expressed in Escherichia coli and purified with a glutathione-Sepharose column. Eight-week-old male mice were injected subcutaneously with the purified protein mixed with complete Freund's adjuvant. Booster injections were given subcutaneously with the antigen mixed with incomplete Freund's adjuvant two times with an interval of two weeks. After the final booster injection, which was given intravenously, spleen cells of the mouse were taken and fused with the SP2/O cells by a polyethylene glycol method (21). Ten days after fusion, culture supernatant of the hybridomas were examined for the reactivity to purified GST-PIP3BP protein by enzyme-linked immunosorbent assay. After several cycles of cloning, a hybridoma clone producing mAb 13-14 was established. The epitope for mAb 13-14 was determined to be the region between amino acid position 42-109, which is within the zinc finger motif. Immunostaining was carried out as described previously (22)

Fractionation of the Cells-- The cells were collected by centrifugation and resuspended in a buffer containing 20 mM Tris-Cl (pH 7.5), 10 mM CaCl2. After homogenization in a Dounce homogenizer, they were centrifuged at 1,000 × g for 5 min. After removal of the supernatant, two cycles of the same procedure were done to remove any non-nuclear membranes from the nucleus. The resulting pellet was used as a nuclear fraction. The supernatant was further ultracentrifugated at 100,000 × g for 30 min. The supernatant and the pellet were used as cytosolic and membrane fractions, respectively.

In Vivo Labeling of the Cells and Analysis of Lipids-- Cells were labeled with [32P]orthophosphate (1 mCi/ml) for 4 h in a phosphate-free MEM supplemented with 25 mM Hepes-NaOH and treated with various stimuli. After fractionation of the cells, the lipids were extracted as described previously (23) and analyzed by TLC as described previously (24). High performance liquid chromatography analysis using SAX5 column (Whatman) was done to confirm the result of TLC (25).

    RESULTS AND DISCUSSION

Localization of PIP3BP in Brain-- In situ hybridization and immunostaining was carried out to determine the expression of PIP3BP in rat brain with mAb 13-14, anti-PIP3BP monoclonal antibody. In the rat brain section, roughly two types of the cells are clearly seen: large and round-shaped neuronal cells, and small and sharp-shaped glial cells (Fig. 1A). In situ hybridization revealed that only the neuronal cells were stained by the antisense probe in cerebral cortex, whereas the sense probe did not give clear signals (Fig. 1A, a and b). Consistent with this, immunostaining analysis suggested the same expression pattern (Fig. 1A, c and d). Interestingly, the staining of mAb 13-14 appeared to be restricted within the hematoxylin-stained areas, suggesting that PIP3BP might be located in the nucleus. Similar results were obtained in the hippocampus and the cerebellum (data not shown).


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1.   PIP3BP is in the nucleus of neuronal cells. A, in situ hybridization of PIP3BP gene and immunostaining of rat brain with mAb 13-14, anti-PIP3BP monoclonal antibody. In situ hybridization of sagittal cryostat sections (8 µm) of adult rat cerebral cortex was done using antisense probe (a) and sense probe (b). The nucleus was stained with methyl green. Sagittal cryostat sections (8 µm) of adult rat cerebral cortex were stained with hematoxylin and eosin (c) or immunostained with mAb 13-14 and stained with hematoxylin (d). Immunoreactivity were visualized by alkaline phosphatase and new fuchsin. B, detection of PIP3BP in neuronal cells in culture. PIP3BP was detected from cell lysates (15 µg/lane) of neuronal cells (lane 1) and glial cells (lane 2) by immunoblotting using mAb 13-14. The position of PIP3BP is indicated by an arrowhead. Anti-neuron-specific enolase (alpha NSE) and anti-glial fiber acidic protein (alpha GFAP) were used as controls for the separation of the cells (bottom part). C, localization of endogenous PIP3BP in neuroblastoma, Neuro2A cells. Phase contrast image (a) and immunostaining of endogenous PIP3BP (b) in Neuro2A cells with mAb 13-14 are shown. D, nuclear localization of GFP-PIP3BP. COS-7 cells were transfected with the expression vectors for GFP-PIP3BP (a), GFP-PIP3BP(-NLS) (b), GFP(+NLS) (c), and GFP (d). Cells were observed under fluorescence microscopy 24 h after transfection.

Primary neuronal and glial cultures were prepared separately from embryonic day 18 rat brains. Cell fractionation was correctly done because neuron-specific enolase (NSE) was specifically found in neuronal fraction, and the glial fiber acidic protein (GFAP) was found in the glial fraction (Fig. 1B, bottom part). Expression of PIP3BP was examined by immunoblotting using mAb 13-14. As shown in Fig. 1B, PIP3BP was detected exclusively in neuronal cells. No detectable amounts of PIP3BP were observed in glial cells. These results suggest that PIP3BP is localized in nucleus of the neuronal cells in rat brain. Immunostaining using mAb 13-14 showed that native PIP3BP was also detected in nucleus of neuroblastoma, Neuro2A cells (Fig. 1C).

PIP3BP Is Targeted to the Nucleus-- To confirm the nuclear localization of PIP3BP, COS-7 cells were transfected with a construct coding for PIP3BP fused to the green fluorescent protein (GFP-PIP3BP), and the localization of the protein in the intact cells was analyzed. The GFP-PIP3BP fusion protein was almost exclusively detected in the nucleus, supporting the immunostaining data (Fig. 1D, a). Similar results were obtained using PC12 cells and neuroblastoma Neuro 2A cells (26, 27) (data not shown). Nuclear localization signal-like motif, KERRK, was found in the amino terminus part of PIP3BP. We tested whether or not this sequence directs the protein to the nucleus. GFP fused to amino-terminal 14 amino acids of PIP3BP, MAKERRKAVLELLQ, localized exclusively in the nucleus (Fig. 1D, c). A deletion mutant lacking amino acid 1-9 (GFP-PIP3BP(-NLS)) was diffusely distributed all over the cells (Fig. 1D, b), suggesting that the targeting mechanism of the protein to the nucleus was absent. GFP alone was detected in all parts of the cells (Fig. 1D, d). These results suggest that the amino acid 1-14 of PIP3BP targets the proteins to the nucleus. Fractionation of COS-7 cells transfected with an expression vector for Myc-PIP3BP by homogenizing and centrifugation revealed that PIP3BP free from GFP was also located in the nucleus (see below).

PIP3 Is Generated in the Nucleus-- The above results suggest that PIP3BP may play a role in the nucleus. We therefore determined whether or not PIP3 was generated in the nucleus. Various cells were stimulated by agonists and fractionated, and the lipids were analyzed by TLC. PI 3-kinase is strongly activated to give a strong signal of PIP3 in 293T cells treated with 10 mM H2O2.2 We first used this system. As shown in Fig. 2A, generation of PIP3 in the nucleus was detected in those cells as well as in the membrane. The fractionation was confirmed by Western blotting of Src and Myc, which are membrane and nuclear proteins, respectively (Fig. 2C). When the nuclear fraction of the H2O2-treated 293T cells was prepared and incubated with [32P]ATP-MgCl2, generation of PIP3 was clearly detected; it was not seen in that of the untreated cells (Fig. 2B). The presence of PIP3 in the samples was confirmed by high performance liquid chromatography analysis of the lipids, using a SAX5 column (data not shown).


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2.   Activation of PI 3-kinase in the nucleus. A, phospholipid analysis of the cells after treatment with various stimuli. Cells were labeled with [32P]orthophosphate (1 mCi/ml) for 4 h in phosphate-free MEM supplemented with 25 mM Hepes-NaOH treated with various stimuli. The lipids were extracted from each fraction and analyzed by TLC as described previously. Lipids in membrane (M) (lanes 1, 2, 5, 6, 9, 10, 13, and 14) and nuclear (N) (lanes 3, 4, 7, 8, 11, 12, 15, and 16) fractions of NIH 3T3 cells treated with (lanes 2 and 4) or without (lanes 1 and 3) PDGF for 3 min, PC12 cells treated with (lanes 6 and 8) or without (lanes 5 and 7) NGF for 3 min, 293T cells treated with (lanes 10 and 12) or without (lanes 9 and 11) 10 mM H2O2 for 3 min, or 293T cells transfected with (lanes 14 and 16) or without (lanes 13 and 15) the expression vector for constitutively active PI 3-kinase (BD110) were analyzed on TLC. B, generation of PIP3 in membrane (M) and nuclear (N) fractions. Membrane and nuclear fractions were prepared from 293T cells treated with or without 10 mM H2O2 for 3 min. They were then incubated with [32P]ATP and MgCl2 for 5 min at 25 °C. The resulting lipids were analyzed on TLC (top). Distribution of Src in each fraction was analyzed by Western blotting with anti-Src antibody, 327 (bottom). C, distribution of PI 3-kinase. 293T cells treated with or without 10 mM H2O2 were fractionated into membrane and nuclear fractions. The distribution of p85alpha , Src, Myc, was analyzed by Western blotting. In one experiment, levels of p85alpha in anti-phosphotyrosine immunoprecipitates were analyzed. Cell fractionation was correctly done because Src was specifically found in the membrane fraction and Myc in the nuclear fraction.

In the H2O2-treated 293T cells, tyrosine phosphorylation of the proteins was extremely elevated, suggesting the activation of many signaling pathways (28). Fractionation of the cells revealed that the level of p85 in the nuclear fraction was markedly elevated after H2O2 treatment and considerable tyrosine phosphorylation on nuclear p85 was detected (Fig. 2C), suggesting that the activation of PI 3-kinase activity in the nucleus may be because of relocalization of the enzyme. PIP3 was also detected in the nucleus in 293T cells transiently expressed, constitutively active PI 3-kinase, NGF-treated PC12 cells, and PDGF-treated NIH 3T3 cells (Fig. 2A). Recently, several groups have used PIP3-binding proteins, such as ARNO and GRP1, fused to GFP, as a means to visualize changes in cellular PIP3 levels (29, 30). However, they failed to detect the nuclear PIP3. This may be because of failure of nuclear localization of these proteins.

PIP3BP Is Exported Out of the Nucleus by the Expression of Constitutively Active PI 3-Kinase-- To test the effect of PI 3-kinase on the localization of PIP3BP, COS-7 cells were transfected with the constructs for expression of PIP3BP and constitutively active PI 3-kinase (BD110), and the cells were fractionated and distribution of PIP3BP was determined. As shown in Fig. 3A, both PIP3BPs fused to GFP and a Myc tag were fractionated in nucleus in the absence of the activated PI 3-kinase. In contrast, they were localized in the membrane or cytosolic fractions when the constitutively active PI 3-kinase was co-expressed. The cells were observed under the microscope to detect the relocalization of GFP-PIP3BP. Co-expression of BD110 resulted in exportation out of the protein from the nucleus in more than 75% of the transfected cells (Fig. 3B), whereas fluorescence was detected almost exclusively in the nucleus without expression of BD110 (data not shown). The kinase negative version of PI 3-kinase did not cause this effect (Fig. 3B). Treatment of the cells with wortmannin resulted in relocation of PIP3BP to the nucleus within 30 min, suggesting that cells were not damaged by the expression of the constitutively active PI 3-kinase (Fig. 3B). Point mutations of PH domains in PIP3BP were suggested to abolish the binding to PIP3, previously (13). This mutant PIP3BP was not exported out of the nucleus (Fig. 3B). These results suggest that interaction of the PH domains and PIP3 is responsible for the relocation of PIP3BP. These results suggest that PIP3BP can shuttle between the nucleus and the cytoplasm depending on the activity of PI 3-kinase.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   Exportation of GFP-PIP3BP from nucleus by the constitutively active PI 3-kinase. A, Western blotting of the PIP3BPs. COS-7 cells were transfected with the constructs coding for GFP-PIP3BP or Myc-PIP3BP with or without the construct for the BD110 expression. Distribution of PIP3BPs was analyzed by Western blotting with anti-GFP polyclonal antibody or with anti-Myc monoclonal antibody, 9E10 (15). B, distribution of GFP-PIP3BPs in various conditions. GFP fusion proteins of wild type PIP3BP or PIP3BP with point mutations in the PH domains were co-expressed with the BD110 protein or the kinase negative version of it in COS-7 cells. The cells whose fluorescence is clearly found in the nucleus were scored. More than 1000 cells were counted, and the percentages to the total cells expressing PIP3BP are shown. Control, wild type PIP3BP + BD110; WT, wild type PIP3BP + BD110, treated with 10-7 M wortmannin for 30 min; PH(-), PIP3BP with point mutations of the PH domains + BD110; BDKN, wild type PIP3BP + kinase negative BD110.

It is well known that PI 4,5-P2 is present in the nucleus, probably in the nuclear membrane. It is possible that PI 3-kinase which is present in the cytosol can approach the nuclear membrane at least from the cytosolic side to produce PIP3. We found that PI 3-kinase can be targeted after H2O2 treatment of 293T cells. The condition used here was artificial; however, PI 3-kinase may be a specific protein that is targeted to the nucleus because Coomassie Blue staining patterns of the proteins in the nuclear fractions from H2O2-treated and -untreated cells were almost identical. Although a drastic condition may be required for nuclear localization of a considerable amount of PI 3-kinase, this finding implicates that a small amount of PI 3-kinase, which is undetectable by the present methods, can be targeted to the nucleus after appropriate stimulation of the cells. The results in this paper clearly indicate that PIP3BP can function as a PIP3-binding protein. Therefore, the fact that PIP3BP is targeted to the nucleus suggests that there may be an unknown function of PIP3BP in the nucleus. The exportation of PIP3BP out of the nucleus was resistant to leptomycin B, an inhibitor of nuclear exportation signal (NES)-dependent exportation. We are currently examining how PIP3BP is exported out of the nucleus to understand the role of the protein.

    ACKNOWLEDGEMENT

We thank Dr. Kathy Barker for critical reading of the paper.

    FOOTNOTES

* This work was supported by Grants-in-Aid from Ministry of Education, Science, Sports, and Culture of Japan (to Y. F.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Present address: Division of Biochemistry and Cellular Biology, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan.

Dagger Dagger To whom correspondence should be addressed. Tel.: 81-3-3812-2111, ext. 5111; Fax: 81-3-3812-0544; E-mail: ayfukui{at}hongo.ecc.u-tokyo.ac.jp.

The abbreviations used are: PI 3-kinase, phosphatidylinositol 3-kinase; PIP3, phosphatidylinositol 3,4,5-trisphosphate; PI 3, 4-P2, phosphatidylinositol 3,4-bisphosphate; PI 4, 5-P2, phosphatidylinositol 4,5-bisphosphate; GAP, GTPase activating protein; GFP, green fluorescent protein; DMEM, Dulbecco's modified minimal essential medium; BD110, constitutively active PI 3-kinase; BDKN, kinase negative mutant of PI 3-kinase; GFAP, glial fiber acidic protein; PH, pleckstrin homology; PIP3BP, PIP3-binding protein; GST, glutathione S-transferase; TLC, thin layer chromatography; NGF, nerve growth factor; PDGF, platelet-derived growth factor.

2 H. Konishi et al., submitted for publication.

    REFERENCES
Top
Abstract
Introduction
References

  1. Stephens, L. R., Jackson, T. R., and Hawkins, P. T. (1993) Biochim. Biophys. Acta 1179, 27-75[Medline] [Order article via Infotrieve]
  2. Shibasaki, F., Homma, Y., and Takenawa, T. (1991) J. Biol. Chem. 266, 8108-8114[Abstract/Free Full Text]
  3. Auger, K. R., Serunian, L. A., Soltoff, S. P., Libby, P., and Cantley, L. C. (1989) Cell 57, 167-175[CrossRef][Medline] [Order article via Infotrieve]
  4. Carpenter, C. L., Duckworth, B. C., Auger, K. R., Cohen, B., Schaffhausen, B. S., and Cantley, L. C. (1990) J. Biol. Chem. 265, 19704-19711[Abstract/Free Full Text]
  5. Whitman, M., Downes, C. P., Keeler, M., Keller, T., and Cantley, L. (1988) Nature 332, 644-646[CrossRef][Medline] [Order article via Infotrieve]
  6. Nakanishi, H., Brewer, K. A., and Exton, J. H. (1993) J. Biol. Chem. 268, 13-16[Abstract/Free Full Text]
  7. Akimoto, K., Takahashi, R., Moriya, S., Nishioka, N., Takayanagi, J., Kimura, K., Fukui, Y., Osada, S., Mizuno, K., Hirai, S., Kazlauskas, A., and Ohno, S. (1996) EMBO J. 15, 788-798[Medline] [Order article via Infotrieve]
  8. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R. J., Reese, C. B., and Cohen, P. (1997) Curr. Biol. 7, 261-269[CrossRef][Medline] [Order article via Infotrieve]
  9. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R. J., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Science 277, 567-570[Abstract/Free Full Text]
  10. Fukui, Y., Ihara, S., and Nagata, S. (1998) J. Biochem. 124, 1-7[Abstract/Free Full Text]
  11. Han, J., Luby-Phelps, K., Das, B., Shu, X., Xia, Y., Mosteller, R. D., Krishna, U. M., Falck, J. R., White, M. A., and Broek, D. (1998) Science 279, 558-560[Abstract/Free Full Text]
  12. Klarlund, J. K., Remeh, L. E., Cantley, L. C., Buxton, J. M., Holik, J. J., Sakelis, C., Patki, V., Corvera, S., and MP, C. (1998) J. Biol. Chem. 273, 1859-1862[Abstract/Free Full Text]
  13. Tanaka, K., Imajoh-Ohmi, S., Swada, T., Shirai, R., Hashimoto, Y., Iwasaki, S., Kaibuchi, K., Kanaho, Y., Shirai, T., Terada, Y., Kimura, K., Nagata, S., and Fukui, Y. (1997) Eur. J. Biochem. 245, 512-519[Medline] [Order article via Infotrieve]
  14. Hammonds-Odie, L. P., Jackson, T. R., A., Profit, A., Blader, I. J., Turck, C. W., Prestwich, G. D., and Teibert, A. B. (1996) J. Biol. Chem. 271, 18859-18868[Abstract/Free Full Text]
  15. Shirai, T., Tanaka, K., Terada, Y., Sawada, T., Shirai, R., Hashimoto, Y., Nagata, S., Iwamatsu, A., Okawa, K., Li, S., Hattori, S., Mano, H., and Fukui, Y. (1998) Biochim. Biophys. Acta 1402, 292-302[Medline] [Order article via Infotrieve]
  16. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492[Abstract/Free Full Text]
  17. Hayashi, H., Nishioka, Y., Kamohara, S., Kanai, F., Ishii, K., Fukui, Y., Shibasaki, F., Takenawa, T., Kido, H., and Katsunuma, N. (1993) J. Biol. Chem. 268, 7107-7117[Abstract/Free Full Text]
  18. Kita, Y., Kimura, K., Kobayashi, M., Ihara, S., Kaibuchi, K., Kuroda, S., Ui, M., Iba, H., Konishi, H., Kikkawa, U., Nagata, S., and Fukui, Y. (1998) J. Cell Sci. 111, 907-915[Abstract]
  19. Hu, Q. J., Klippel, A., Muslin, A. J., Fantl, W. J., and Williams, L. T. (1995) Science 268, 100-102[Abstract/Free Full Text]
  20. Hirota, S., Ito, A., Morii, E., Wanaka, A., Tohyama, M., Kitamura, Y., and Nomura, S. (1992) Mol. Brain Res. 15, 47-54[Medline] [Order article via Infotrieve]
  21. Nagata, S., Yamamoto, K., Ueno, Y., Kurata, T., and Chiba, J. (1991) Hybridoma 10, 317-322[Medline] [Order article via Infotrieve]
  22. Yoshida, Y., Tsutsumi, T., Makita, T., Nagata, S., Tashiro, F., Yoshida, F., Sekijima, M., Shin-ichi, T., Harada, T., Keizo, M., and Ueno, Y. (1998) Toxicol. Pathol. 26, 411-418[Medline] [Order article via Infotrieve]
  23. Fukui, Y., Saltiel, A. R., and Hanafusa, H. (1991) Oncogene 6, 407-411[Medline] [Order article via Infotrieve]
  24. Kabuyama, Y., Nakatsu, N., Homma, Y., and Fukui, Y. (1996) Eur. J. Biochem. 238, 350-356[Medline] [Order article via Infotrieve]
  25. Kobayashi, M., Nagata, S., Kita, Y., Nakatsu, N., Ihara, S., Kaibuchi, K., Kuroda, S., Ui, M., Iba, H., Konishi, H., Kikkawa, U., Saitoh, I., and Fukui, Y. (1997) J. Biol. Chem. 272, 16089-16092[Abstract/Free Full Text]
  26. Greene, L. A., and Tischler, A. S. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 2424-2428[Abstract/Free Full Text]
  27. Olmsted, J. B., Carlson, K., Klebe, R., Ruddle, F., and Rosenbaum, J. (1970) Proc. Natl. Acad. Sci. U. S. A. 65, 129-136[Abstract/Free Full Text]
  28. Konishi, H., Matsuzaki, H., Tanaka, M., Ono, Y., Tokunaga, C., Kuroda, S., and Kikkawa, U. (1996) Proc. Natl. Acad. Sci. 93, 7639-7643[Abstract/Free Full Text]
  29. Venkateswarlu, K., Oatey, P. B., Tavare, J. M., and Cullen, P. J. (1998) Curr. Biol. 8, 463-466[CrossRef][Medline] [Order article via Infotrieve]
  30. Venkateswarlu, K., Gunn-Moore, F., Oatey, P. B., Tavare, J. M., and Cullen, P. J. (1998) Biochem. J. 335, 139-146


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
Cancer Res.Home page
J.-L. Liu, Z. Mao, T. A. LaFortune, M. M. Alonso, G. E. Gallick, J. Fueyo, and W.K. A. Yung
Cell Cycle Dependent Nuclear Export of Phosphatase and Tensin Homologue Tumor Suppressor Is Regulated by the Phosphoinositide-3-Kinase Signaling Cascade
Cancer Res., November 15, 2007; 67(22): 11054 - 11063.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. Venkateswarlu, K. G. Brandom, and H. Yun
PI-3-kinase-dependent membrane recruitment of centaurin-{alpha}2 is essential for its effect on ARF6-mediated actin cytoskeleton reorganisation
J. Cell Sci., March 1, 2007; 120(5): 792 - 801.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Oka, S. Ihara, and Y. Fukui
Cooperation of DEF6 with Activated Rac in Regulating Cell Morphology
J. Biol. Chem., January 19, 2007; 282(3): 2011 - 2018.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Yajima, M. Sato, H. Sorimachi, M. Inomata, M. Maki, and S. Kawashima
Calpain System Regulates the Differentiation of Adult Primitive Mesenchymal ST-13 Adipocytes
Endocrinology, October 1, 2006; 147(10): 4811 - 4819.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Tsuruta, H. Kishimoto, T. Sasaki, Y. Horie, M. Natsui, Y. Shibata, K. Hamada, N. Yajima, K. Kawahara, M. Sasaki, et al.
Hyperplasia and Carcinomas in Pten-Deficient Mice and Reduced PTEN Protein in Human Bladder Cancer Patients.
Cancer Res., September 1, 2006; 66(17): 8389 - 8396.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
K. Horiguchi, T. Hanada, Y. Fukui, and A. H. Chishti
Transport of PIP3 by GAKIN, a kinesin-3 family protein, regulates neuronal cell polarity
J. Cell Biol., July 31, 2006; 174(3): 425 - 436.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. E. Irarrazabal, M. B. Burg, S. G. Ward, and J. D. Ferraris
Phosphatidylinositol 3-kinase mediates activation of ATM by high NaCl and by ionizing radiation: Role in osmoprotective transcriptional regulation
PNAS, June 6, 2006; 103(23): 8882 - 8887.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Chen, P. Liu, G. R. Pattar, L. Tackett, P. Bhonagiri, A. B. Strawbridge, and J. S. Elmendorf
Chromium Activates Glucose Transporter 4 Trafficking and Enhances Insulin-Stimulated Glucose Transport in 3T3-L1 Adipocytes via a Cholesterol-Dependent Mechanism
Mol. Endocrinol., April 1, 2006; 20(4): 857 - 870.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Ihara, T. Oka, and Y. Fukui
Direct binding of SWAP-70 to non-muscle actin is required for membrane ruffling
J. Cell Sci., February 1, 2006; 119(3): 500 - 507.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Hayashi, O. Matsuzaki, S. Muramatsu, Y. Tsuchiya, T. Harada, Y. Suzuki, S. Sugano, A. Matsuda, and E. Nishida
Centaurin-{alpha}1 Is a Phosphatidylinositol 3-Kinase-dependent Activator of ERK1/2 Mitogen-activated Protein Kinases
J. Biol. Chem., January 20, 2006; 281(3): 1332 - 1337.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Ananthanarayanan, Q. Ni, and J. Zhang
Signal propagation from membrane messengers to nuclear effectors revealed by reporters of phosphoinositide dynamics and Akt activity
PNAS, October 18, 2005; 102(42): 15081 - 15086.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-L. Liu, X. Sheng, Z. K. Hortobagyi, Z. Mao, G. E. Gallick, and W. K. A. Yung
Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation
Mol. Cell. Biol., July 15, 2005; 25(14): 6211 - 6224.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. Venkateswarlu, T. Hanada, and A. H. Chishti
Centaurin-{alpha}1 interacts directly with kinesin motor protein KIF13B
J. Cell Sci., June 1, 2005; 118(11): 2471 - 2484.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. B. Strawbridge and J. S. Elmendorf
Phosphatidylinositol 4,5-Bisphosphate Reverses Endothelin-1-Induced Insulin Resistance via an Actin-Dependent Mechanism
Diabetes, June 1, 2005; 54(6): 1698 - 1705.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. H. Seo, Y. Ahn, S.-R. Lee, C. Y. Yeo, and K. C. Hur
The Major Target of the Endogenously Generated Reactive Oxygen Species in Response to Insulin Stimulation Is Phosphatase and Tensin Homolog and Not Phosphoinositide-3 Kinase (PI-3 Kinase) in the PI-3 Kinase/Akt Pathway
Mol. Biol. Cell, January 1, 2005; 16(1): 348 - 357.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. Ye and S. H. Snyder
PIKE GTPase: a novel mediator of phosphoinositide signaling
J. Cell Sci., January 15, 2004; 117(2): 155 - 161.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
R. F. Irvine
Nuclear Lipid Signaling
Sci. Signal., September 17, 2002; 2002(150): re13 - re13.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
R. Chen, V. H. Kang, J. Chen, J. C. Shope, J. Torabinejad, D. B. DeWald, and G. D. Prestwich
A Monoclonal Antibody to Visualize PtdIns(3,4,5)P3 in Cells
J. Histochem. Cytochem., May 1, 2002; 50(5): 697 - 708.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
J. J. Perez-Villar, K. O'Day, D. H. Hewgill, S. G. Nadler, and S. B. Kanner
Nuclear localization of the tyrosine kinase Itk and interaction of its SH3 domain with karyopherin {alpha} (Rch1{alpha})
Int. Immunol., October 1, 2001; 13(10): 1265 - 1274.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. B. Lachyankar, N. Sultana, C. M. Schonhoff, P. Mitra, W. Poluha, S. Lambert, P. J. Quesenberry, N. S. Litofsky, L. D. Recht, R. Nabi, et al.
A Role for Nuclear PTEN in Neuronal Differentiation
J. Neurosci., February 15, 2000; 20(4): 1404 - 1413.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. R. Rao, M. N. Corradetti, J. Chen, J. Peng, J. Yuan, G. D. Prestwich, and J. S. Brugge
Expression Cloning of Protein Targets for 3-Phosphorylated Phosphoinositides
J. Biol. Chem., December 31, 1999; 274(53): 37893 - 37900.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Van der Kaay, M. Beck, A. Gray, and C. P. Downes
Distinct Phosphatidylinositol 3-Kinase Lipid Products Accumulate upon Oxidative and Osmotic Stress and Lead to Different Cellular Responses
J. Biol. Chem., December 10, 1999; 274(50): 35963 - 35968.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
L. M. NERI, A. M. MARTELLI, P. BORGATTI, M. L. COLAMUSSI, M. MARCHISIO, and S. CAPITANI
Increase in nuclear phosphatidylinositol 3-kinase activity and phosphatidylinositol (3,4,5) trisphosphate synthesis precede PKC-{zeta} translocation to the nucleus of NGF-treated PC12 cells
FASEB J, December 1, 1999; 13(15): 2299 - 2310.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Metjian, R. L. Roll, A. D. Ma, and C. S. Abrams
Agonists Cause Nuclear Translocation of Phosphatidylinositol 3-Kinase gamma . A Gbeta gamma -DEPENDENT PATHWAY THAT REQUIRES THE p110gamma AMINO TERMINUS
J. Biol. Chem., September 24, 1999; 274(39): 27943 - 27947.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Perander, G. Bjorkoy, and T. Johansen
Nuclear Import and Export Signals Enable Rapid Nucleocytoplasmic Shuttling of the Atypical Protein Kinase C lambda
J. Biol. Chem., April 13, 2001; 276(16): 13015 - 13024.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Leng, T. N. Chase, and M. C. Bennett
Muscarinic Receptor Stimulation Induces Translocation of an alpha -Synuclein Oligomer from Plasma Membrane to a Light Vesicle Fraction in Cytoplasm
J. Biol. Chem., July 20, 2001; 276(30): 28212 - 28218.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Bacqueville, P. Deleris, C. Mendre, M.-T. Pieraggi, H. Chap, G. Guillon, B. Perret, and M. Breton-Douillon
Characterization of a G Protein-activated Phosphoinositide 3-Kinase in Vascular Smooth Muscle Cell Nuclei
J. Biol. Chem., June 15, 2001; 276(25): 22170 - 22176.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Huppertz, B. M. Fischer, Y.-B. Kim, K. Kotani, A. Vidal-Puig, L. J. Slieker, K. W. Sloop, B. B. Lowell, and B. B. Kahn
Uncoupling Protein 3 (UCP3) Stimulates Glucose Uptake in Muscle Cells through a Phosphoinositide 3-Kinase-dependent Mechanism
J. Biol. Chem., April 13, 2001; 276(16): 12520 - 12529.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow