![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 7, 3919-3922, February 12, 1999
§,
,
,
,
,
, and

From the PIP3BP is a
phosphatidylinositol 3,4,5-trisphosphate-binding protein
(PIP3BP) abundant in brain, containing a zinc finger motif
and two pleckstrin homology (PH) domains. Staining of rat brain cells
with anti-PIP3BP antibody and determination of localization of PIP3BP fused to the green fluorescent protein
(GFP-PIP3BP) revealed that PIP3BP was targeted
to the nucleus. Targeting was dependent on a putative nuclear
localization signal in PIP3BP. Generation of
PIP3 in the nucleus was detected in
H2O2-treated 293T cells, nerve growth factor
(NGF)-treated PC12 cells, and platelet-derived growth factor
(PDGF)-treated NIH 3T3 cells. Translocation of phosphatidylinositol
3-kinase (PI 3-kinase) to the nucleus and enhanced activity of PI
3-kinase in the nucleus fraction were observed after
H2O2 treatment of 293T cells, suggesting that
PI 3-kinase can be activated in the nucleus as well as in the membrane after appropriate stimulation of the cells. Co-expression of the constitutively active PI 3-kinase with PIP3BP resulted in
exportation of the protein from the nucleus to the cytoplasm,
suggesting that PIP3BP can function as a
PIP3-binding protein in the intact cells. These results
imply that there may be an unknown function of PI 3-kinase in the nucleus.
Phosphatidylinositol 3-kinase (PI
3-kinase)1 is an enzyme that
is activated immediately after growth factor or differentiation factor
stimulation of the cells (1) and that generates second messengers,
phosphatidylinositol 3,4,5-trisphosphate (PIP3) and phosphatidylinositol 3,4-bisphosphate (PI 3,4-P2) (2-5).
These 3'-phosphorylated phosphoinositides can activate serine,
threonine kinases such as PKB/Akt, PKCs, and PDKs (6-9). They are also suggested to be involved in other events such as rearrangement of
cytoskeleton and vesicle transport because these phenomena are
sensitive to the PI 3-kinase inhibitors and dominant negative mutants
of PI 3-kinase (10). Recently, it was reported that the
3'-phosphorylated phosphoinositides can activate guanine nucleotide exchanging factors of Rac and Arf, small G proteins involved in actin
rearrangement and vesicle transport, respectively (11, 12). Therefore,
G proteins as well as kinases are downstream of PI 3-kinase.
We have identified PIP3BP as a PIP3-binding
protein, using a PIP3 analogue column (13). It is abundant
in brain, implying that it may be involved in the function of nerve
systems. PIP3BP binds to PIP3 but not to PI
3,4-P2 or phosphatidylinositol 4,5-bisphosphate (PI
4,5-P2). It has a zinc finger motif homologous to that of Arf-GTPase activating protein (GAP) and two PH domains. Both PH domains
are shown to be involved in binding to PIP3. Another
PIP3-binding protein, centaurin Cell Lines and Transfection--
COS-7 cells and 293T cells were
cultured in Dulbecco's modified minimal essential medium (DMEM)
supplemented with 10% calf serum. Transfection was done by the calcium
phosphate method as described by Shirai et al. (15) except
that pH of the buffer was 7.00 instead of 7.15.
Primary Culture of Rat Brain--
Pregnant mice were sacrificed
by cervical dislocation on the 18th-day of gestation. After isolation
of the embryos from the uterus, by cutting the outer layer of the
pelvis, the fetal meninges were removed and the cerebral cortices were
placed in DMEM containing 10% fetal bovine serum (Life Technologies,
Inc.). Following the mechanical dissociation, cells were passed through
a #100 mesh, and were suspended in DMEM supplemented with 10% fetal
bovine serum for glial cell culture. For neuronal cell culture, the
cells were suspended in neurobasal medium containing 2% B27 supplement (both from Life Technologies, Inc.), 74 µg/ml L-glutamine
and 25 µM L-glutamate. They were plated in
culture dishes coated with poly-L-lysine (100 µg/ml) and
cultured in an atmosphere of 95% air and 5% CO2 at
36 °C.
Plasmids Used in This Study--
A cDNA fragment encoding
the full-length PIP3BP or mutant PIP3BPs was
subcloned into pEGFP c-1, an expression vector for GFP fusion protein
(CLONTECH), to produce pEGFP-PIP3BP,
pEGFP-PIP3BP( In Situ Hybridization--
In situ hybridization was
carried out as described previously (20). A cDNA fragment encoding
the full-length PIP3BP was subcloned into pBluescript
SK(+), and the transcripts of T7 or T3 RNA polymerase labeled with
digoxigenin were used as antisense or sense probes.
Production of the Monoclonal Antibody and
Histocytochemistry--
A monoclonal antibody, mAb 13-14, was
produced. GST fusion protein of PIP3BP
(GST-PIP3BP) was expressed in Escherichia coli and purified with a glutathione-Sepharose column. Eight-week-old male
mice were injected subcutaneously with the purified protein mixed with
complete Freund's adjuvant. Booster injections were given
subcutaneously with the antigen mixed with incomplete Freund's adjuvant two times with an interval of two weeks. After the final booster injection, which was given intravenously, spleen cells of the
mouse were taken and fused with the SP2/O cells by a polyethylene glycol method (21). Ten days after fusion, culture supernatant of the
hybridomas were examined for the reactivity to purified GST-PIP3BP protein by enzyme-linked immunosorbent assay.
After several cycles of cloning, a hybridoma clone producing mAb 13-14 was established. The epitope for mAb 13-14 was determined to be the
region between amino acid position 42-109, which is within the zinc
finger motif. Immunostaining was carried out as described previously
(22)
Fractionation of the Cells--
The cells were collected by
centrifugation and resuspended in a buffer containing 20 mM
Tris-Cl (pH 7.5), 10 mM CaCl2. After homogenization in a Dounce homogenizer, they were centrifuged at
1,000 × g for 5 min. After removal of the supernatant,
two cycles of the same procedure were done to remove any non-nuclear membranes from the nucleus. The resulting pellet was used as a nuclear
fraction. The supernatant was further ultracentrifugated at
100,000 × g for 30 min. The supernatant and the pellet
were used as cytosolic and membrane fractions, respectively.
In Vivo Labeling of the Cells and Analysis of Lipids--
Cells
were labeled with [32P]orthophosphate (1 mCi/ml) for
4 h in a phosphate-free MEM supplemented with 25 mM
Hepes-NaOH and treated with various stimuli. After fractionation of the
cells, the lipids were extracted as described previously (23) and
analyzed by TLC as described previously (24). High performance liquid chromatography analysis using SAX5 column (Whatman) was done to confirm
the result of TLC (25).
Localization of PIP3BP in Brain--
In
situ hybridization and immunostaining was carried out to determine
the expression of PIP3BP in rat brain with mAb 13-14, anti-PIP3BP monoclonal antibody. In the rat brain section,
roughly two types of the cells are clearly seen: large and round-shaped neuronal cells, and small and sharp-shaped glial cells (Fig.
1A). In situ
hybridization revealed that only the neuronal cells were stained by the
antisense probe in cerebral cortex, whereas the sense probe did not
give clear signals (Fig. 1A, a and b).
Consistent with this, immunostaining analysis suggested the same
expression pattern (Fig. 1A, c and d).
Interestingly, the staining of mAb 13-14 appeared to be restricted
within the hematoxylin-stained areas, suggesting that
PIP3BP might be located in the nucleus. Similar results
were obtained in the hippocampus and the cerebellum (data not
shown).
Primary neuronal and glial cultures were prepared separately from
embryonic day 18 rat brains. Cell fractionation was correctly done
because neuron-specific enolase (NSE) was specifically found in
neuronal fraction, and the glial fiber acidic protein (GFAP) was found
in the glial fraction (Fig. 1B, bottom part).
Expression of PIP3BP was examined by immunoblotting using
mAb 13-14. As shown in Fig. 1B, PIP3BP was
detected exclusively in neuronal cells. No detectable amounts of
PIP3BP were observed in glial cells. These results suggest
that PIP3BP is localized in nucleus of the neuronal cells
in rat brain. Immunostaining using mAb 13-14 showed that native
PIP3BP was also detected in nucleus of neuroblastoma, Neuro2A cells (Fig. 1C).
PIP3BP Is Targeted to the Nucleus--
To confirm the
nuclear localization of PIP3BP, COS-7 cells were
transfected with a construct coding for PIP3BP fused to the green fluorescent protein (GFP-PIP3BP), and the
localization of the protein in the intact cells was analyzed. The
GFP-PIP3BP fusion protein was almost exclusively detected
in the nucleus, supporting the immunostaining data (Fig. 1D,
a). Similar results were obtained using PC12 cells and
neuroblastoma Neuro 2A cells (26, 27) (data not shown). Nuclear
localization signal-like motif, KERRK, was found in the amino terminus
part of PIP3BP. We tested whether or not this sequence
directs the protein to the nucleus. GFP fused to amino-terminal 14 amino acids of PIP3BP, MAKERRKAVLELLQ, localized exclusively in the nucleus (Fig. 1D, c). A
deletion mutant lacking amino acid 1-9 (GFP-PIP3BP( PIP3 Is Generated in the Nucleus--
The above
results suggest that PIP3BP may play a role in the nucleus.
We therefore determined whether or not PIP3 was generated in the nucleus. Various cells were stimulated by agonists and fractionated, and the lipids were analyzed by TLC. PI 3-kinase is
strongly activated to give a strong signal of PIP3 in 293T cells treated with 10 mM
H2O2.2
We first used this system. As shown in Fig.
2A, generation of PIP3 in the nucleus was detected in those cells as well as
in the membrane. The fractionation was confirmed by Western blotting of
Src and Myc, which are membrane and nuclear proteins, respectively (Fig. 2C). When the nuclear fraction of the
H2O2-treated 293T cells was prepared and
incubated with [32P]ATP-MgCl2, generation of
PIP3 was clearly detected; it was not seen in that of the
untreated cells (Fig. 2B). The presence of PIP3
in the samples was confirmed by high performance liquid chromatography analysis of the lipids, using a SAX5 column (data not shown).
In the H2O2-treated 293T cells, tyrosine
phosphorylation of the proteins was extremely elevated, suggesting the
activation of many signaling pathways (28). Fractionation of the cells revealed that the level of p85 in the nuclear fraction was markedly elevated after H2O2 treatment and considerable
tyrosine phosphorylation on nuclear p85 was detected (Fig.
2C), suggesting that the activation of PI 3-kinase activity
in the nucleus may be because of relocalization of the enzyme.
PIP3 was also detected in the nucleus in 293T cells transiently expressed, constitutively active PI 3-kinase, NGF-treated PC12 cells, and PDGF-treated NIH 3T3 cells (Fig. 2A).
Recently, several groups have used PIP3-binding proteins,
such as ARNO and GRP1, fused to GFP, as a means to visualize changes in
cellular PIP3 levels (29, 30). However, they failed to
detect the nuclear PIP3. This may be because of failure of
nuclear localization of these proteins.
PIP3BP Is Exported Out of the Nucleus by the Expression
of Constitutively Active PI 3-Kinase--
To test the effect of PI
3-kinase on the localization of PIP3BP, COS-7 cells were
transfected with the constructs for expression of PIP3BP
and constitutively active PI 3-kinase (BD110), and the cells were
fractionated and distribution of PIP3BP was determined. As
shown in Fig. 3A, both
PIP3BPs fused to GFP and a Myc tag were fractionated in
nucleus in the absence of the activated PI 3-kinase. In contrast, they
were localized in the membrane or cytosolic fractions when the
constitutively active PI 3-kinase was co-expressed. The cells were
observed under the microscope to detect the relocalization of
GFP-PIP3BP. Co-expression of BD110 resulted in exportation out of the protein from the nucleus in more than 75% of the
transfected cells (Fig. 3B), whereas fluorescence was
detected almost exclusively in the nucleus without expression of BD110
(data not shown). The kinase negative version of PI 3-kinase did not
cause this effect (Fig. 3B). Treatment of the cells with
wortmannin resulted in relocation of PIP3BP to the nucleus
within 30 min, suggesting that cells were not damaged by the expression
of the constitutively active PI 3-kinase (Fig. 3B). Point
mutations of PH domains in PIP3BP were suggested to abolish
the binding to PIP3, previously (13). This mutant
PIP3BP was not exported out of the nucleus (Fig.
3B). These results suggest that interaction of the PH
domains and PIP3 is responsible for the relocation of
PIP3BP. These results suggest that PIP3BP can
shuttle between the nucleus and the cytoplasm depending on the activity
of PI 3-kinase.
It is well known that PI 4,5-P2 is present in the nucleus,
probably in the nuclear membrane. It is possible that PI 3-kinase which
is present in the cytosol can approach the nuclear membrane at least
from the cytosolic side to produce PIP3. We found that PI
3-kinase can be targeted after H2O2 treatment
of 293T cells. The condition used here was artificial; however, PI
3-kinase may be a specific protein that is targeted to the nucleus
because Coomassie Blue staining patterns of the proteins in the nuclear fractions from H2O2-treated and -untreated
cells were almost identical. Although a drastic condition may be
required for nuclear localization of a considerable amount of PI
3-kinase, this finding implicates that a small amount of PI 3-kinase,
which is undetectable by the present methods, can be targeted to the
nucleus after appropriate stimulation of the cells. The results in this
paper clearly indicate that PIP3BP can function as a
PIP3-binding protein. Therefore, the fact that
PIP3BP is targeted to the nucleus suggests that there may
be an unknown function of PIP3BP in the nucleus. The exportation of PIP3BP out of the nucleus was resistant to
leptomycin B, an inhibitor of nuclear exportation signal
(NES)-dependent exportation. We are currently examining how
PIP3BP is exported out of the nucleus to understand the
role of the protein.
We thank Dr. Kathy Barker for critical reading
of the paper.
*
This work was supported by Grants-in-Aid from Ministry of
Education, Science, Sports, and Culture of Japan (to Y. F.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present address: Division of Biochemistry and Cellular Biology,
National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigashi, Kodaira,
Tokyo 187-8502, Japan.
The abbreviations used are:
PI 3-kinase, phosphatidylinositol 3-kinase; PIP3, phosphatidylinositol
3,4,5-trisphosphate; PI 3, 4-P2, phosphatidylinositol
3,4-bisphosphate; PI 4, 5-P2, phosphatidylinositol
4,5-bisphosphate; GAP, GTPase activating protein; GFP, green
fluorescent protein; DMEM, Dulbecco's modified minimal essential
medium; BD110, constitutively active PI 3-kinase; BDKN, kinase negative
mutant of PI 3-kinase; GFAP, glial fiber acidic protein; PH, pleckstrin
homology; PIP3BP, PIP3-binding protein; GST, glutathione S-transferase; TLC, thin layer chromatography; NGF, nerve growth factor; PDGF, platelet-derived growth factor.
2
H. Konishi et al., submitted for publication.
Laboratory of Biological Chemistry,
Department of Inflammation Research,
![]()
ABSTRACT
Top
Abstract
Introduction
References
![]()
INTRODUCTION
Top
Abstract
Introduction
References
, is highly homologous
to PIP3BP (14). No GAP activity to Arf has been detected in
either protein. Although the binding of centaurin
and
PIP3BP to PIP3 was specific, the role of the
protein is unclear. To address this question, we determined the
intracellular localization by immunological techniques, using monoclonal antibody to PIP3BP as well as localization of
green fluorescent protein (GFP) fusion proteins. Surprisingly,
PIP3BP was found to localize in the nucleus, where the
generation of PIP3 was detected after stimulation,
suggesting a new pathway of signal transduction through PI 3-kinase to
PIP3BP in nucleus. PIP3BP was exported out of
the nucleus by expression of a constitutively active PI 3-kinase. This
suggests that PIP3BP can shuttle between nucleus and
cytoplasm depending on the activity of PI 3-kinase.
![]()
EXPERIMENTAL PROCEDURES
NLS), pEGFP(+NLS), and
pEGFP-PIP3BP(
PH). PIP3BP-NLS was constructed by deletion of amino acid 1-9 residues using the restriction site, XhoI, in the cDNA. Point mutants in the PH domains in
PIP3BP (PIP3BP-PH) were introduced as described
previously (13) by substituting Cys for Arg (residues 149 and 272) of
PIP3BP by the Kunkel method (16). To obtain Myc-tagged
PIP3BP, an Myc-tag sequence with an initiation codon,
ATGGAACAGAAGCTGATCTCAGAAGAAGATCT, was attached at the 5' end of the
cDNA of the PIP3BP. The resulting gene was expressed
under the control of SR
promoter by an expression vector pMIKNeo
(17). The expression vectors for constitutively active PI 3-kinase
(BD110) and a kinase negative mutant of PI 3-kinase (BDKN) were
described previously (18). The BD110 protein has a structure similar to
that of p110* reported by Hu et al. (19). The protein has an
inter-SH2 domain of p85, which binds to the p110 amino terminus. BDKN
protein is a kinase negative counterpart of the BD110 protein with a
point mutation in the kinase domain.
![]()
RESULTS AND DISCUSSION

View larger version (40K):
[in a new window]
Fig. 1.
PIP3BP is in the
nucleus of neuronal cells. A, in situ
hybridization of PIP3BP gene and immunostaining of rat
brain with mAb 13-14, anti-PIP3BP monoclonal antibody.
In situ hybridization of sagittal cryostat sections (8 µm)
of adult rat cerebral cortex was done using antisense probe
(a) and sense probe (b). The nucleus was stained
with methyl green. Sagittal cryostat sections (8 µm) of adult rat
cerebral cortex were stained with hematoxylin and eosin (c)
or immunostained with mAb 13-14 and stained with hematoxylin
(d). Immunoreactivity were visualized by alkaline
phosphatase and new fuchsin. B, detection of
PIP3BP in neuronal cells in culture. PIP3BP was
detected from cell lysates (15 µg/lane) of neuronal cells (lane
1) and glial cells (lane 2) by immunoblotting using mAb
13-14. The position of PIP3BP is indicated by an
arrowhead. Anti-neuron-specific enolase (
NSE)
and anti-glial fiber acidic protein (
GFAP) were used as
controls for the separation of the cells (bottom part).
C, localization of endogenous PIP3BP in
neuroblastoma, Neuro2A cells. Phase contrast image (a) and
immunostaining of endogenous PIP3BP (b) in
Neuro2A cells with mAb 13-14 are shown. D, nuclear
localization of GFP-PIP3BP. COS-7 cells were transfected
with the expression vectors for GFP-PIP3BP (a),
GFP-PIP3BP(
NLS) (b), GFP(+NLS) (c),
and GFP (d). Cells were observed under fluorescence
microscopy 24 h after transfection.
NLS))
was diffusely distributed all over the cells (Fig. 1D,
b), suggesting that the targeting mechanism of the protein
to the nucleus was absent. GFP alone was detected in all parts of the
cells (Fig. 1D, d). These results suggest that
the amino acid 1-14 of PIP3BP targets the proteins to the nucleus. Fractionation of COS-7 cells transfected with an expression vector for Myc-PIP3BP by homogenizing and centrifugation
revealed that PIP3BP free from GFP was also located in the
nucleus (see below).

View larger version (70K):
[in a new window]
Fig. 2.
Activation of PI 3-kinase in the
nucleus. A, phospholipid analysis of the cells after
treatment with various stimuli. Cells were labeled with
[32P]orthophosphate (1 mCi/ml) for 4 h in
phosphate-free MEM supplemented with 25 mM Hepes-NaOH
treated with various stimuli. The lipids were extracted from each
fraction and analyzed by TLC as described previously. Lipids in
membrane (M) (lanes 1, 2, 5, 6, 9, 10, 13, and
14) and nuclear (N) (lanes 3, 4, 7, 8, 11, 12, 15, and 16) fractions of NIH 3T3 cells treated with
(lanes 2 and 4) or without (lanes 1 and 3) PDGF for 3 min, PC12 cells treated with (lanes
6 and 8) or without (lanes 5 and
7) NGF for 3 min, 293T cells treated with (lanes
10 and 12) or without (lanes 9 and
11) 10 mM H2O2 for 3 min, or 293T cells transfected with (lanes 14 and
16) or without (lanes 13 and 15) the
expression vector for constitutively active PI 3-kinase (BD110) were
analyzed on TLC. B, generation of PIP3 in
membrane (M) and nuclear (N) fractions. Membrane
and nuclear fractions were prepared from 293T cells treated with or
without 10 mM H2O2 for 3 min. They
were then incubated with [32P]ATP and MgCl2
for 5 min at 25 °C. The resulting lipids were analyzed on TLC
(top). Distribution of Src in each fraction was analyzed by
Western blotting with anti-Src antibody, 327 (bottom).
C, distribution of PI 3-kinase. 293T cells treated with or
without 10 mM H2O2 were
fractionated into membrane and nuclear fractions. The distribution of
p85
, Src, Myc, was analyzed by Western blotting. In one experiment,
levels of p85
in anti-phosphotyrosine immunoprecipitates were
analyzed. Cell fractionation was correctly done because Src was
specifically found in the membrane fraction and Myc in the nuclear
fraction.

View larger version (26K):
[in a new window]
Fig. 3.
Exportation of
GFP-PIP3BP from nucleus by the constitutively
active PI 3-kinase. A, Western blotting of the
PIP3BPs. COS-7 cells were transfected with the constructs
coding for GFP-PIP3BP or Myc-PIP3BP with or
without the construct for the BD110 expression. Distribution of
PIP3BPs was analyzed by Western blotting with anti-GFP
polyclonal antibody or with anti-Myc monoclonal antibody, 9E10 (15).
B, distribution of GFP-PIP3BPs in various
conditions. GFP fusion proteins of wild type PIP3BP or
PIP3BP with point mutations in the PH domains were
co-expressed with the BD110 protein or the kinase negative version of
it in COS-7 cells. The cells whose fluorescence is clearly found in the
nucleus were scored. More than 1000 cells were counted, and the
percentages to the total cells expressing PIP3BP are shown.
Control, wild type PIP3BP + BD110;
WT, wild type PIP3BP + BD110, treated with
10
7 M wortmannin for 30 min;
PH(
), PIP3BP with point mutations of the PH
domains + BD110; BDKN, wild type PIP3BP + kinase
negative BD110.
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES

To whom correspondence should be addressed. Tel.:
81-3-3812-2111, ext. 5111; Fax: 81-3-3812-0544; E-mail:
ayfukui{at}hongo.ecc.u-tokyo.ac.jp.
![]()
REFERENCES
Top
Abstract
Introduction
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
J.-L. Liu, Z. Mao, T. A. LaFortune, M. M. Alonso, G. E. Gallick, J. Fueyo, and W.K. A. Yung Cell Cycle Dependent Nuclear Export of Phosphatase and Tensin Homologue Tumor Suppressor Is Regulated by the Phosphoinositide-3-Kinase Signaling Cascade Cancer Res., November 15, 2007; 67(22): 11054 - 11063. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Venkateswarlu, K. G. Brandom, and H. Yun PI-3-kinase-dependent membrane recruitment of centaurin-{alpha}2 is essential for its effect on ARF6-mediated actin cytoskeleton reorganisation J. Cell Sci., March 1, 2007; 120(5): 792 - 801. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Oka, S. Ihara, and Y. Fukui Cooperation of DEF6 with Activated Rac in Regulating Cell Morphology J. Biol. Chem., January 19, 2007; 282(3): 2011 - 2018. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yajima, M. Sato, H. Sorimachi, M. Inomata, M. Maki, and S. Kawashima Calpain System Regulates the Differentiation of Adult Primitive Mesenchymal ST-13 Adipocytes Endocrinology, October 1, 2006; 147(10): 4811 - 4819. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tsuruta, H. Kishimoto, T. Sasaki, Y. Horie, M. Natsui, Y. Shibata, K. Hamada, N. Yajima, K. Kawahara, M. Sasaki, et al. Hyperplasia and Carcinomas in Pten-Deficient Mice and Reduced PTEN Protein in Human Bladder Cancer Patients. Cancer Res., September 1, 2006; 66(17): 8389 - 8396. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Horiguchi, T. Hanada, Y. Fukui, and A. H. Chishti Transport of PIP3 by GAKIN, a kinesin-3 family protein, regulates neuronal cell polarity J. Cell Biol., July 31, 2006; 174(3): 425 - 436. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Irarrazabal, M. B. Burg, S. G. Ward, and J. D. Ferraris Phosphatidylinositol 3-kinase mediates activation of ATM by high NaCl and by ionizing radiation: Role in osmoprotective transcriptional regulation PNAS, June 6, 2006; 103(23): 8882 - 8887. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chen, P. Liu, G. R. Pattar, L. Tackett, P. Bhonagiri, A. B. Strawbridge, and J. S. Elmendorf Chromium Activates Glucose Transporter 4 Trafficking and Enhances Insulin-Stimulated Glucose Transport in 3T3-L1 Adipocytes via a Cholesterol-Dependent Mechanism Mol. Endocrinol., April 1, 2006; 20(4): 857 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ihara, T. Oka, and Y. Fukui Direct binding of SWAP-70 to non-muscle actin is required for membrane ruffling J. Cell Sci., February 1, 2006; 119(3): 500 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hayashi, O. Matsuzaki, S. Muramatsu, Y. Tsuchiya, T. Harada, Y. Suzuki, S. Sugano, A. Matsuda, and E. Nishida Centaurin-{alpha}1 Is a Phosphatidylinositol 3-Kinase-dependent Activator of ERK1/2 Mitogen-activated Protein Kinases J. Biol. Chem., January 20, 2006; 281(3): 1332 - 1337. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ananthanarayanan, Q. Ni, and J. Zhang Signal propagation from membrane messengers to nuclear effectors revealed by reporters of phosphoinositide dynamics and Akt activity PNAS, October 18, 2005; 102(42): 15081 - 15086. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Liu, X. Sheng, Z. K. Hortobagyi, Z. Mao, G. E. Gallick, and W. K. A. Yung Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation Mol. Cell. Biol., July 15, 2005; 25(14): 6211 - 6224. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Venkateswarlu, T. Hanada, and A. H. Chishti Centaurin-{alpha}1 interacts directly with kinesin motor protein KIF13B J. Cell Sci., June 1, 2005; 118(11): 2471 - 2484. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Strawbridge and J. S. Elmendorf Phosphatidylinositol 4,5-Bisphosphate Reverses Endothelin-1-Induced Insulin Resistance via an Actin-Dependent Mechanism Diabetes, June 1, 2005; 54(6): 1698 - 1705. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Seo, Y. Ahn, S.-R. Lee, C. Y. Yeo, and K. C. Hur The Major Target of the Endogenously Generated Reactive Oxygen Species in Response to Insulin Stimulation Is Phosphatase and Tensin Homolog and Not Phosphoinositide-3 Kinase (PI-3 Kinase) in the PI-3 Kinase/Akt Pathway Mol. Biol. Cell, January 1, 2005; 16(1): 348 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ye and S. H. Snyder PIKE GTPase: a novel mediator of phosphoinositide signaling J. Cell Sci., January 15, 2004; 117(2): 155 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Irvine Nuclear Lipid Signaling Sci. Signal., September 17, 2002; 2002(150): re13 - re13. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chen, V. H. Kang, J. Chen, J. C. Shope, J. Torabinejad, D. B. DeWald, and G. D. Prestwich A Monoclonal Antibody to Visualize PtdIns(3,4,5)P3 in Cells J. Histochem. Cytochem., May 1, 2002; 50(5): 697 - 708. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Perez-Villar, K. O'Day, D. H. Hewgill, S. G. Nadler, and S. B. Kanner Nuclear localization of the tyrosine kinase Itk and interaction of its SH3 domain with karyopherin {alpha} (Rch1{alpha}) Int. Immunol., October 1, 2001; 13(10): 1265 - 1274. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Lachyankar, N. Sultana, C. M. Schonhoff, P. Mitra, W. Poluha, S. Lambert, P. J. Quesenberry, N. S. Litofsky, L. D. Recht, R. Nabi, et al. A Role for Nuclear PTEN in Neuronal Differentiation J. Neurosci., February 15, 2000; 20(4): 1404 - 1413. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. R. Rao, M. N. Corradetti, J. Chen, J. Peng, J. Yuan, G. D. Prestwich, and J. S. Brugge Expression Cloning of Protein Targets for 3-Phosphorylated Phosphoinositides J. Biol. Chem., December 31, 1999; 274(53): 37893 - 37900. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Van der Kaay, M. Beck, A. Gray, and C. P. Downes Distinct Phosphatidylinositol 3-Kinase Lipid Products Accumulate upon Oxidative and Osmotic Stress and Lead to Different Cellular Responses J. Biol. Chem., December 10, 1999; 274(50): 35963 - 35968. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. NERI, A. M. MARTELLI, P. BORGATTI, M. L. COLAMUSSI, M. MARCHISIO, and S. CAPITANI Increase in nuclear phosphatidylinositol 3-kinase activity and phosphatidylinositol (3,4,5) trisphosphate synthesis precede PKC-{zeta} translocation to the nucleus of NGF-treated PC12 cells FASEB J, December 1, 1999; 13(15): 2299 - 2310. [Abstract] [Full Text] |
||||
![]() |
A. Metjian, R. L. Roll, A. D. Ma, and C. S. Abrams Agonists Cause Nuclear Translocation of Phosphatidylinositol 3-Kinase gamma . A Gbeta gamma -DEPENDENT PATHWAY THAT REQUIRES THE p110gamma AMINO TERMINUS J. Biol. Chem., September 24, 1999; 274(39): 27943 - 27947. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Perander, G. Bjorkoy, and T. Johansen Nuclear Import and Export Signals Enable Rapid Nucleocytoplasmic Shuttling of the Atypical Protein Kinase C lambda J. Biol. Chem., April 13, 2001; 276(16): 13015 - 13024. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Leng, T. N. Chase, and M. C. Bennett Muscarinic Receptor Stimulation Induces Translocation of an alpha -Synuclein Oligomer from Plasma Membrane to a Light Vesicle Fraction in Cytoplasm J. Biol. Chem., July 20, 2001; 276(30): 28212 - 28218. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bacqueville, P. Deleris, C. Mendre, M.-T. Pieraggi, H. Chap, G. Guillon, B. Perret, and M. Breton-Douillon Characterization of a G Protein-activated Phosphoinositide 3-Kinase in Vascular Smooth Muscle Cell Nuclei J. Biol. Chem., June 15, 2001; 276(25): 22170 - 22176. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huppertz, B. M. Fischer, Y.-B. Kim, K. Kotani, A. Vidal-Puig, L. J. Slieker, K. W. Sloop, B. B. Lowell, and B. B. Kahn Uncoupling Protein 3 (UCP3) Stimulates Glucose Uptake in Muscle Cells through a Phosphoinositide 3-Kinase-dependent Mechanism J. Biol. Chem., April 13, 2001; 276(16): 12520 - 12529. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||