![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 7, 3923-3926, February 12, 1999
From New England Biolabs, Inc., Beverly, Massachusetts 01915-5599
| |
ABSTRACT |
|---|
|
|
|---|
The smallest known intein, found in the
ribonucleoside diphosphate reductase gene of Methanobacterium
thermoautotrophicum (Mth RIR1 intein), was found to
splice poorly in Escherichia coli with the naturally
occurring proline residue adjacent to the N-terminal cysteine of the
intein. Splicing proficiency increased when this proline was replaced
with an alanine residue. However, constructs that displayed efficient
N- and C-terminal cleavage were created by replacing either the
C-terminal asparagine or N-terminal cysteine of the intein,
respectively, with an alanine. Furthermore, these constructs were used
to specifically generate complementary reactive groups on protein
sequences for use in ligation reactions. Reaction between an
intein-generated C-terminal thioester on E. coli
maltose-binding protein (43 kDa) and an intein-generated cysteine at
the N terminus of either T4 DNA ligase (56 kDa) or thioredoxin (12 kDa)
resulted in the ligation of the proteins through a native peptide bond. Thus the smallest of the known inteins is capable of splicing and its
unique properties extend the utility of intein-mediated protein
ligation to include the in vitro fusion of large,
bacterially expressed proteins.
Inteins (1), the protein equivalent of the self-splicing RNA
introns, catalyze their own excision from a precursor protein with the
concomitant fusion of the flanking protein sequences, known as exteins
(reviewed in Refs. 2-4). Almost 100 inteins have been identified
(5)1 and can be grouped into three classes: 1)
the inteins containing a homing endonuclease between the two splicing
domains, 2) the mini-inteins, which lack the homing endonuclease, and
3) a newly described trans-splicing intein (6).
Of the mini-inteins, the smallest is the 134-amino acid intein found in
the ribonucleoside diphosphate reductase gene of Methanobacterium thermoautotrophicum (Mth RIR1 intein; Ref. 7). This
intein may be close to the minimum amino acid sequence needed to
promote splicing, and interestingly, it has a proline residue
N-terminal to the first amino acid of the intein, Pro Studies into the mechanism of splicing led to the development of a
protein purification system that utilized thiol-induced cleavage of the
peptide bond at the N terminus of the Sce VMA intein (9).
Purification with this system generated a bacterially expressed protein
with a C-terminal thioester (9). Two research groups then applied the
chemistry described for native chemical ligation (10) to fuse a
synthetic peptide with an N-terminal cysteine to a bacterially
expressed protein possessing a C-terminal thioester (11, 12). This
technique, known as intein-mediated protein ligation
(IPL)2 or also as expressed protein ligation,
represented an important advance in protein semi-synthetic techniques
(reviewed in Refs. 13 and 14). However, the generality of IPL was
limited by the use of a synthetic peptide as a ligation partner.
We describe the next major advance in intein-mediated protein ligation,
which is the modulation of the Mth RIR1 intein for the
facile isolation of a protein with an N-terminal cysteine for use in
the in vitro fusion of two bacterially expressed proteins. Furthermore, the Mth RIR1 mini-intein, the smallest known
protein splicing element, was found to be capable of splicing. These
results significantly expand the utility of IPL to include the labeling of extensive portions of a protein for NMR analysis and the isolation of a greater variety of cytotoxic proteins. In addition, this advance
opens the possibility of labeling the central portion of a protein by
ligating three fragments in succession.
Mth RIR1 Synthetic Gene Construction--
The gene encoding the
Mth RIR1 intein along with 5 native N- and C-extein residues
(Fig. 1; Ref. 7) was constructed using 10 oligonucleotides (New England Biolabs, Beverly, MA) comprising both
strands of the gene and overlapping by at least 20 base pairs. 1)
5'-TCGAGGCAACCAACCCCTGCGTATCCGGTGACACCATTGTAATGACTAGTGGCGGTCCGCGCACTGTGGC TGAACTGGAGGGCAAACCGTTCACCGCAC-3'. 2)
5'-CCGGTTGGCTGCTCGCCACAGTTGTGTACAATGAAGCCATTAGCAGTGAA TGCGCTAGCACCGTAAACAGTAGCGTCATAAACATCCTGGCGG-3'. 3)
5'-pTGATTCGCGGCTCTGGCTACCCATGCCCCTCAGGTTTCTTCCGCACCTGTGAACGTGACGTATATGATCTGCGTACACGT GAGGGTCATTGCTTACGTTT-3'. 4)
5'-pGACCCATGATCACCGTGTTCTGGTGATGGATGGTGGCCTGGAATGGCGTGCCGCGGGTGAACTGGAACGCGGCGACCGCCTGGTGATGGATGATGCAGCT-3'. 5)
5'-pGGCGAGTTTCCGGCACTGGCAACCTTCCGTGGCCTGCGTGGCGCTGGCCGCCAGGATGTTTATGACGCTACTGTTTACGGTGCTAGC-3'. 6) 5'-pGCATTCACTGCTAATGGCTTCATTGTACACAACTGTGGCGAGCAGCCAA-3'. 7) 5'-pCCAGCGCCACGCAGGCCACGGAAGGTTGCCAGTGCCGGAAACTCGCCAGCTGCATCATCCATCACCAGGCGGTCGCCGCGTTCCAGTTCACCCGCGGCAC-3'. 8)
5'-pGCCATTCCAGGCCACCATCCATCACCAGAACACGGTGATCATGGGTCAAACGTAAGCAATGACCCTCACGTGTACGCAGATCATATACGT-3'. 9)
5'-pCACGTTCACAGGTGCGGAAGAAACCTGAGGGGCATGGGTAGCCAGAGCCGCGAATCAGTGCGGTGAACGGTTTGCCCTCCAGTTCAGCCACAGTGCG-3'. 10) 5'-pCGGACCGCCACTAGTCATTACAATGGTGTCACCGGATACGCAGGGGTTGGTTGCC-3'. To ensure maximal Escherichia coli expression, the
coding region of the synthetic Mth RIR1 intein incorporates
61 silent base mutations in 48 of the 134 codons. The oligonucleotides
were annealed by mixing at equimolar ratios (400 nM) in a
ligation buffer (50 mM Tris-HCl, pH 7.5, containing 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP, and 25 µg of bovine serum albumin) followed by
heating to 95 °C. After cooling to room temperature, the annealed
and ligated oligonucleotides were inserted into the XhoI and
AgeI sites of pMYB5 (New England Biolabs), replacing the
Sce VMA intein and creating the plasmid pMRB8P.
Mutagenesis of the Mth RIR1 Intein--
The unique
XhoI and SpeI sites flanking the N-terminal
splice junction and the unique BsrGI and AgeI
sites flanking the C-terminal splice junction allowed substitution of
amino acid residues by linker replacement. Pro Protein Splicing Studies--
ER2566 cells (11) containing the
appropriate plasmid were grown in LB broth containing 100 µg/ml
ampicillin at 37 °C to an A600 of 0.5-0.8.
Protein synthesis was induced by addition of 0.5 mM IPTG
and proceeded at 15 °C overnight or at 37 °C for 2 h. Cell
extracts were visualized on 12% Tris-glycine gels (Novex Experimental
Technology, San Diego, CA) stained with Coomassie Brilliant Blue.
Protein Purification with the N-terminal Cleavage
Construct--
Purification was as described previously for the
Sce VMA and Mxe GyrA inteins (9, 11). Briefly,
ER2566 cells (11) containing the appropriate plasmid were grown at
37 °C in LB broth containing 100 µg/ml ampicillin to an
A600 of 0.5-0.6 followed by induction with IPTG
(0.5 mM). Induction was either overnight at 15 °C or for
3 h at 30 °C. The cells were pelleted by centrifugation at 3,000 × g for 30 min followed by resuspension in
buffer A (20 mM Tris-HCl, pH 7.5, containing 500 mM NaCl). The cell contents were released by sonication.
Cell debris was removed by centrifugation at 23,000 × g for 30 min, and the supernatant was applied to a column
packed with chitin resin (bed volume, 10 ml) equilibrated in buffer A. Unbound protein was washed from the column with 10 column volumes of
buffer A. Thiol reagent-induced cleavage was initiated by rapidly
equilibrating the chitin resin in buffer B (20 mM Tris-HCl,
pH 8, containing 500 mM NaCl and 100 mM
2-mercaptoethanesulfonic acid (MESNA)). The cleavage reaction proceeded
overnight at 4 °C, after which the protein was eluted from the column.
Protein Purification with the C-terminal Cleavage
Construct--
Protein purification was performed as described above
with buffer A replaced by buffer C (20 mM Tris-HCl, pH 8.5, containing 500 mM NaCl) and buffer B replaced by buffer D
(20 mM Tris-HCl, pH 7.0, containing 500 mM
NaCl). Also, following equilibration of the column in buffer D the
cleavage reaction proceeded overnight at room temperature. Protein
concentrations were determined using the Bio-Rad protein assay.
Protein-Protein Ligation Using IPL--
Freshly isolated
thioester-tagged protein was mixed with freshly isolated protein
containing an N-terminal cysteine residue (starting concentration,
1-200 µM). The solution was concentrated with a
Centriprep 3 or Centriprep 30 apparatus (Millipore Corporation, Bedford, MA) then with a Centricon 3 or Centricon 10 apparatus to a
final concentration of 0.15-1.2 mM for each protein.
Ligation reactions proceeded overnight at 4 °C and were visualized
using SDS-PAGE with 12% Tris-glycine gels (Novex Experimental
Technology, San Diego, CA) stained with Coomassie Brilliant Blue.
Factor Xa Cleavage of MBP-T4 Ligase Fusion Protein and Protein
Sequencing--
2 mg of ligation reaction involving MBP and T4 DNA
ligase was bound to 3 ml of amylose resin (New England Biolabs)
equilibrated in buffer A (see above). Unreacted T4 DNA ligase was
rinsed from the column with 10 column volumes of buffer A. Unligated
MBP and the MBP-T4 DNA ligase fusion protein were eluted from the
amylose resin using buffer E (20 mM Tris-HCl, pH 7.5, containing 500 mM NaCl and 10 mM maltose).
Overnight incubation of the eluted protein with a 200:1 protein:bovine
factor Xa (New England Biolabs) ratio (w/w) at 4 °C resulted in the
proteolysis of the fusion protein and regeneration of a band on
SDS-PAGE gels that ran at a molecular weight similar to T4 DNA ligase.
N-terminal amino acid sequencing of the proteolyzed fusion protein was
performed on a Procise 494 protein sequencer (PE Applied Biosystems,
Foster City, CA).
Splicing and Cleavage Activity of the Mth RIR1 Intein--
The
splicing activity of the Mth RIR1 intein with its 5 native
N- and C-extein residues was investigated by expressing it as an
in-frame fusion between E. coli maltose-binding protein (15)
and the chitin-binding domain (16) from Bacillus circulans. In this protein context splicing products were detected (Fig. 2, lane 1), although the
majority of the protein remained in the precursor form (M-R-B).
Splicing proficiency was increased by mutating the Pro
The cleavage and/or splicing activity of the M-R-B precursor was more
proficient when protein synthesis was induced at 15 °C than when the
induction temperature was raised to 37 °C (Fig. 2). Replacement of
Pro Purification Using C- and N-terminal Cleavage Activity--
The C-
and N-terminal cleavage constructs of the Mth RIR1 intein
were used to purify T4 DNA ligase or thioredoxin with an N-terminal
cysteine or MBP with a C-terminal thioester. Two C-terminal cleavage
constructs, pBRL-A and pBRT (Fig. 3, data
not shown for pBRT), resulted in the isolation of 4-6 mg/liter cell
culture and 5-10 mg/liter cell culture of T4 DNA ligase and
thioredoxin, respectively. These proteins possessed N-terminal cysteine
residues based on amino acid sequencing following the ligation reaction (see below under "Intein-mediated Protein Ligation").
Conversely, an intein with only N-terminal cleavage activity was
generated by changing Pro Intein-mediated Protein Ligation--
IPL reactions consisted of
mixing freshly purified MBP with T4 DNA ligase or thioredoxin (Fig.
4 and "Experimental Procedures"). Ligation was monitored by the appearance of an extra band on SDS-PAGE (Fig. 3 and data not shown for thioredoxin) corresponding to the predicted molecular weight of the ligation product. Typical ligation efficiencies ranged from 20-60%.
A factor Xa site in MBP that exists 5 amino acids N-terminal from the
site of fusion (17) allowed amino acid sequencing through the ligation
junction (see "Experimental Procedures"). The sequence obtained was
NH2-TLEGCGEQPTGXLK-COOH, which matched the last
4 residues of MBP (TLEG) followed by a linker sequence (CGEQPTG) and
the start of T4 DNA ligase (ILK). During amino acid sequencing, the
cycle expected to yield an isoleucine did not have a strong enough
signal to assign it to a specific residue, so it was represented as an
X. The cysteine was identified as the acrylamide alkylation product.
The C-terminal cleavage activity of the mutated Mth
RIR1 intein advanced IPL technology by providing a means to isolate
proteins possessing an N-terminal cysteine to act as substrates in the in vitro fusion of large, bacterially expressed proteins.
Initially, an intein that cleaves in vivo was tested for the
ability to generate a protein with an N-terminal cysteine. However, the
side chain of the N-terminal cysteine residue appeared to be modified
in vivo by an unidentified pathway (data not shown).
Although this problem could be circumvented using a protease to cut on
the N-terminal side of a cysteine residue, concern over nonspecific
proteolysis and the need to remove the protease after cleavage limited
its usefulness. Interestingly, C-terminal cleavage using the
Mth RIR1 intein appeared to protect the cysteine residue
until it could be released in vitro. A recently developed
Sce VMA intein with thiol-inducible C-terminal cleavage
activity could not be used because it would undergo splicing instead of
cleavage with an N-terminal cysteine on the target protein (18).
The concentration dependence of the ligation reaction was probably due
to the need to increase the ligation reaction rate to effectively
compete with thioester hydrolysis, which would prevent ligation.
Protein fusion occurred at 20-40% efficiency at 6.5-8.5 mg/ml of
each reactant (data not shown), although greater extents of reaction
(50-60%, Fig. 3) were observed at higher protein concentrations. Many
proteins can exist in solution at the lower concentrations, indicating
that IPL will be useful for a wide range of applications. However,
these conditions are problematic for some proteins, and future work may
determine procedures that will lower this concentration requirement.
N-terminal amino acid sequencing through the ligation junction
demonstrated that the two proteins were fused tail-to-head in a
continuous polypeptide chain and had not fused to form an unusual
branched structure. Furthermore, these data reinforce past studies
reporting that a native peptide bond is formed using native chemical
ligation chemistry (10) because the polypeptide sequencing reaction
requires a peptide bond between amino acid residues.
Previously, studies with the Sce VMA intein reported that
splicing was inhibited when a proline replaced the naturally occurring glycine at the The Mth RIR1 intein primary sequence was compared with the
amino acid sequence and crystal structure of another mini-intein, the
Mxe GyrA intein (19, 20). Most of the amino acids that form
two The mechanism of the induction temperature-dependent
splicing and cleavage activity has yet to be determined, but it may be due to reactions occurring at the C terminus of the intein. C-terminal cleavage was more severely affected by induction temperature than N-terminal cleavage activity (Fig. 2). It is also possible that the
Mth RIR1 intein could be misfolding in E. coli
when induced at the higher temperature, an interesting possibility
considering that M. thermoautotrophicum is a thermophilic bacteria.
In conclusion, this report demonstrated that the smallest known intein,
the Mth RIR1 intein, along with its 5 native extein residues
was capable of splicing. Furthermore, this intein was capable of
generating both thioester-tagged proteins and proteins with an
N-terminal cysteine. The latter was of particular importance because it
facilitated the next major advance in intein-mediated protein ligation,
which is the fusion of two large, bacterially expressed proteins. This
paves the way for greater freedom in the labeling of proteins for NMR
analysis, the isolation of cytotoxic proteins, and in the future the
controlled fusion of three bacterially expressed proteins.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
1
(see Fig. 1), which was shown to inhibit splicing in an intein found in
the 69-kDa vacuolar ATPase subunit of Saccharomyces
cerevisiae (Sce VMA intein; Ref. 8).
![]()
EXPERIMENTAL PROCEDURES

View larger version (15K):
[in a new window]
Fig. 1.
Mth RIR1 intein amino acid
sequence. Amino acid sequence of the Mth RIR1 intein
with 5 native N- and C-extein residues (in bold type).
Conserved regions of the splicing domains, N1, N2, N3, N4, C1, and C2
(22), are underlined and enclosed by vertical bars. The
N-extein residue adjacent to the first amino acid of the intein is
labeled
1 and numbering proceeds toward the N terminus of the protein
(i.e.
N
2P
1-intein). The
intein residues are numbered sequentially starting with the N-terminal
amino acid (C+1). C-extein amino acids are numbered
beginning with the residue immediately following the intein
(i.e.
intein-C+1G+2).
1, the
proline residue preceding the intein in pMRB8P, was substituted with
alanine or glycine to yield pMRB8A and pMRB8G1, respectively. Substitution of Pro
1-Cys1 with Gly-Ser or
Gly-Ala yielded pMRB9GS and pMRB9GA, respectively. Replacing
Asn134 with Ala in pMRB8G1 resulted in pMRB10G. The
following linkers were used for substitution of the native amino acids
at the splice junctions. Each linker was formed by annealing two
synthetic oligonucleotides as described above.
Pro
1-Ala linker:
5'-TCGAGGCAACCAACGCATGCGTATCCGGTGACACCATTGTAATGA-3' and
5'-CTAGTCATTACAATGGTGTCACCGGATACG CATGCGTTGGTTGCC-3'.
Pro
1-Gly linker:
5'-TCGAGGGCTGCGTATCCGGTGACACCATTGTAATGA-3' and
5'-CTAGTCATTACAATGGTGTCACCGGATACGCAGCCC-3'. Pro
1
Gly/Cys1
Ser linker:
5'-TCGAGGGCATCGAGGCAACCAACGGATCCGTATCCGGTGA CACCATTGTAATGA-3' and
5'-CTAGTCATTACAATGGTGTCACCGGATACGGATCCGTTGGTTGCCTCGATGCCC-3'. Pro
1
Gly/Cys1
Ala linker:
5'-TCGAGGGCATCGAGGCAACCAACGGCGCCGTATCCGGTGACACCATTGTAATGA-3' and
5'-CTAGTCATTACAATGGTGTCACCGGATACGGCGCCGTTGGTTGCCTCGATGCCC-3'. Asn134
Ala linker: 5'-GTACACGCATGCGGCGAGCAGCCCGGGA-3'
and 5'-CCGGTCCCGGGCTGCTCGCCGCATGCGT-3'. pBRL-A was constructed by
substituting the MBP and the CBD coding regions in pMRB9GA with the CBD
and the T4 DNA ligase coding regions, respectively, subcloned from the
pBYT4 plasmid.3
![]()
RESULTS
1
to an Ala (Fig. 2, lane 3). Furthermore, the
Pro
1
Ala or Pro
1
Gly mutants also
displayed cleavage at the N- and C-terminal junctions of the intein
(Fig. 2, lanes 3 and 5). The identity of splicing
and cleavage products were confirmed by Western blot analysis using
anti-MBP and anti-CBD polyclonal antibodies (data not shown).

View larger version (34K):
[in a new window]
Fig. 2.
Splicing and cleavage activity of the
Mth RIR1 intein. Mutants of the Mth
RIR1 intein with 5 native N- and C-terminal extein residues were
induced at either 15 or 37 °C. The intein was expressed as a fusion
protein (M-R-B, 63 kDa) consisting of N-terminal maltose-binding
protein (M, 43 kDa), the Mth RIR1 intein
(R, 15 kDa), and at its C terminus was the chitin-binding
domain (B, 5 kDa). Lanes 1 and 2,
M-R-B with the unmodified Mth RIR1 intein. Note the small
amount of spliced product (M-B, 48 kDa). Lanes 3 and 4, Mth intein with Pro
1
replaced with Ala. Both spliced product (M-B) and N-terminal
cleavage product (M) are visible. Lanes 5 and
6, replacement of Pro
1 with Gly showed some
splicing as well as N- and C-terminal cleavage (M and
M-R, respectively). Lanes 7 and 8, the
Pro
1 to Gly and Cys1 to Ser double mutant
(P
1G/C1S) displayed
induction temperature-dependent C-terminal cleavage
(M-R) activity. Lanes 9 and 10, the
Pro
1 to Gly and Asn134 to Ala double mutant
(P
1G/N134A)
possessed only N-terminal cleavage activity producing M. The
Mth intein or Mth intein-CBD fusion is not
visible in this figure.
1 with a Gly and Cys1 with a Ser resulted
in a double mutant, M-R-B (Pro
1
Gly/Cys1
Ser), which showed only in vivo C-terminal cleavage
activity when protein synthesis was induced at 15 °C but not at
37 °C (Fig. 2, lanes 7 and 8). Another double
mutant, M-R-B (Pro
1
Gly/Cys1
Ala)
displayed slow cleavage, even at 15 °C, which allowed the
accumulation of substantial amounts of the precursor protein (data not
shown) and showed potential for use as a C-terminal cleavage construct
for protein purification.

View larger version (34K):
[in a new window]
Fig. 3.
Protein purification and ligation.
A, thiol-inducible Mth intein construct
(R(N)) for purification of MBP (M, 43 kDa) with a
C-terminal thioester. Lane 1, ER2566 cells transformed with
pMRB10G following IPTG induction. Lane 2, cell extract after
passage over a chitin resin. Note that M-R(N)-B binds to the
resin. Lane 3, fraction 3 of the elution from the chitin
resin following overnight incubation at 4 °C in the presence of 100 mM MESNA. T4 DNA ligase (L, 56 kDa) purification
using the C-terminal cleavage Mth intein construct
(R(C)). Lane 4, IPTG induced ER2566 cells
containing pBRL-A. Lane 5, cell extract after application to
a chitin resin. B-R(C)-L binds to the resin. Lane
6, elution of T4 DNA ligase with an N-terminal cysteine after
overnight incubation at room temperature in pH 7 buffer. B,
ligation of MBP to T4 DNA ligase. Lane 1, thioester-tagged
MBP. Lane 2, T4 DNA ligase with an N-terminal cysteine.
Lane 3, ligation reaction of MBP (0.8 mM) with
T4 DNA ligase (0.8 mM), generating M-L, after
overnight incubation at 4 °C.
1 to Gly and the C-terminal
Asn134 to an Ala creating M-R-B (Pro
1
Gly, Cys1
Ser). N-terminal cleavage products were
detected when protein synthesis was induced at both 15 and 37 °C
(Fig. 2, lanes 9 and 10). However, more precursor
accumulated at the higher induction temperature. The remaining
precursor protein could undergo thiol-mediated cleavage with reagents
such as dithiothreitol or MESNA and could be used to purify
thioester-tagged proteins as described previously (Fig. 3 and Refs. 11
and 12).

View larger version (31K):
[in a new window]
Fig. 4.
IPL pathway. The modified Mth
RIR1 intein was used to purify both MBP with a C-terminal thioester and
T4 DNA ligase with an N-terminal cysteine. The Mth intein
for N-terminal cleavage, intein(N), carried the Pro
1
Gly/Asn134
Ala double mutation. The full-length fusion
protein consisting of MBP-intein(N)-CBD was separated from cell extract
by binding the CBD portion of the protein to a chitin resin. Overnight
incubation in the presence of 100 mM MESNA induced cleavage
of the peptide bond prior to the N terminus of the intein and created a
thioester on the C terminus of MBP. The C-terminal cleavage vector,
intein(C), had the Pro
1
Gly/Cys1
Ala
double mutation. The precursor CBD-intein(C)-T4 DNA ligase was isolated
from induced E. coli cell extract by binding to a chitin
resin as described for N-terminal cleavage. Fission of the peptide bond
following the C-terminal residue of the intein resulted in the
production of T4 DNA ligase with an N-terminal cysteine. Ligation
occurred when the proteins containing the complementary reactive groups
were mixed and concentrated, resulting in a native peptide bond between
the two reacting species.
![]()
DISCUSSION
1 position (8). However, the Mth RIR1
intein has a naturally occurring proline at this position and was
thought to be able to splice with this unique amino acid. The low
splicing activity of the Mth RIR1 intein shows that it is
capable of splicing but that it may not be folding properly when
expressed in E. coli. Alternatively, this intein may require
more native extein sequence than provided or require a cofactor such as
a prolyl isomerase to promote proficient splicing activity.
-helices and a disordered region in the Mxe GyrA
intein appeared to be missing in the Mth RIR1 intein. The
-helical and disordered regions were previously found not to be
required for splicing of the Ssp DnaB intein (21), and this
portion of the protein may only serve as a linker. The small size of
this region in the Mth RIR1 intein may decrease its
stability and may account for some of its induction
temperature-dependent activity.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Bill Jack, Inca Ghosh, Francine Perler, Eric Adam, Lixin Chen, Maurice Southworth, Shoarong Chong, Eric Cantor, Chudi Guan, Richard Whitaker, Marilena Hall, and Fana Mersha for valuable discussions and assistance; Shaorong Chong for the gift of the pBYT4 plasmid; Eric Adam and Sanjay Kumar for assistance in amino acid alignments of the Mth RIR1 intein; and Don Comb for support and encouragement.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 978-927-5054;
Fax: 978-921-1350; E-mail: xum{at}neb.com.
The abbreviations used are:
IPL, intein-mediated
protein ligation; MESNA, the sodium salt of 2-mercaptoethanesulfonic
acid; MBP, maltose-binding protein; CBD, chitin-binding domain; M-R-B, a fusion protein consisting of maltose-binding protein-Mth
RIR1 intein-chitin-binding domain; IPTG, isopropyl-
-D-thiogalactopyranoside; PAGE, poly-acrylamide gel electrophoresis.
1 See also the InBase website: http://www.neb.com/neb/inteins/intein_intro.html.
3 R. Chong, unpublished data.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. E. Grant, L.-W. Guo, M. M. Vestling, K. A. Martemyanov, V. Y. Arshavsky, and A. E. Ruoho The N Terminus of GTP{gamma}S-activated Transducin {alpha}-Subunit Interacts with the C Terminus of the cGMP Phosphodiesterase {gamma}-Subunit J. Biol. Chem., March 10, 2006; 281(10): 6194 - 6202. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eichler and M. W. W. Adams Posttranslational Protein Modification in Archaea Microbiol. Mol. Biol. Rev., September 1, 2005; 69(3): 393 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. V. Mills, D. M. Dorval, and K. T. Lewandowski Kinetic Analysis of the Individual Steps of Protein Splicing for the Pyrococcus abyssi PolII Intein J. Biol. Chem., January 28, 2005; 280(4): 2714 - 2720. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. V. Mills, J. S. Manning, A. M. Garcia, and L. A. Wuerdeman Protein Splicing of a Pyrococcus abyssi Intein with a C-terminal Glutamine J. Biol. Chem., May 14, 2004; 279(20): 20685 - 20691. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Walters, P. J. Lech, A. M. Goh, Q. Wang, and P. M. Howley DNA-repair protein hHR23a alters its protein structure upon binding proteasomal subunit S5a PNAS, October 28, 2003; 100(22): 12694 - 12699. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wu, D. W. Wood, G. Belfort, V. Derbyshire, and M. Belfort Intein-mediated purification of cytotoxic endonuclease I-TevI by insertional inactivation and pH-controllable splicing Nucleic Acids Res., November 15, 2002; 30(22): 4864 - 4871. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Poland, M.-Q. Xu, and F. A. Quiocho Structural Insights into the Protein Splicing Mechanism of PI-SceI J. Biol. Chem., May 26, 2000; 275(22): 16408 - 16413. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Evans Jr., D. Martin, R. Kolly, D. Panne, L. Sun, I. Ghosh, L. Chen, J. Benner, X.-Q. Liu, and M.-Q. Xu Protein trans-Splicing and Cyclization by a Naturally Split Intein from the dnaE Gene of Synechocystis Species PCC6803 J. Biol. Chem., March 24, 2000; 275(13): 9091 - 9094. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. Perler InBase, the Intein Database Nucleic Acids Res., January 1, 2000; 28(1): 344 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Evans Jr., J. Benner, and M.-Q. Xu The Cyclization and Polymerization of Bacterially Expressed Proteins Using Modified Self-splicing Inteins J. Biol. Chem., June 25, 1999; 274(26): 18359 - 18363. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |