![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 7, 3934-3936, February 12, 1999
4 Receptor Subunit Contributes to the Lining of
the Ion Channel Pore When Expressed with the 5-HT3 Receptor
Subunit*
From the Laboratory of Signal Transduction, NIEHS, National Institutes of Health, Research Triangle Park, North Carolina 27709
| |
ABSTRACT |
|---|
|
|
|---|
To understand the wide variation of calcium
permeability seen in native and recombinant 5-HT3
receptor (5-HT3R) channels, we reported previously the
novel hypothesis that the serotonin 5-HT3R subunit can
co-assemble with the The 5-HT3 receptor
(5-HT3R)1 is a
ligand-gated ion channel activated by the endogenous neurotransmitter
serotonin (5-HT) and belongs to the superfamily of ligand-gated ion
channels; this group includes the nicotinic acetylcholine (nACh),
In this study, we tested directly whether the nicotinic RNA Preparation--
mRNA was transcribed in
vitro from plasmids using the mMessage Machine kit (Ambion) under
conditions suggested by the manufacturer. The 5-HT3R
plasmid was provided by D. Julius (4), and the rat nACh receptor Expression in Xenopus Oocytes--
Oocytes were dissected from
mature female Xenopus laevis frogs and defolliculated by
treatment with collagenase (Boehringer Mannheim, 3 mg/ml) for 2-4 h.
The total amount of RNA injected for each subunit was (in ng):
5-HT3R (0.5), Electrophysiological Recording--
Current responses were
obtained by two-electrode voltage clamp recording at a holding
potential of Solutions--
Oocytes were defolliculated in a solution
containing (mM) NaCl (85.2), KCl (2), MgCl2
(1), and HEPES (5). Recordings were performed in a solution containing
(mM) NaCl (96), KCl (2), CaCl2 (1.8),
MgCl2 (1), HEPES (10), and niflumic acid (0.3). Oocytes
were maintained in culture in the same solution, without niflumic acid,
and with the addition of 2.5 mM sodium pyruvate, 0.5 mM theophylline, 50 µg/ml gentamycin, and 5% horse
serum. The methanethiosulfonate (MTS) reagents (Toronto Research
Chemicals) were dissolved in solution immediately prior to application
and used in less than 2 min. A stock solution of 5 mM
AgNO3 was made fresh daily and kept at 4 °C. It was
diluted to the final concentration immediately before application.
Data Analysis--
Data were collected from oocytes that had a
stable base line for at least 15 min. The peak currents were measured
using Clampfit (Axon Instruments), and the percent block was calculated
using the following equation; (1 The substituted cysteine accessibility method (SCAM) has been used
to identify amino acid residues that line the pore of the channel for
the nACh (5-7), NMDA (8), P2X (ATP) (9), and We mutated the leucine at position 285 of the
4 subunit of the nicotinic acetylcholine
receptor (van Hooft, J. A., Spier, A. D., Yakel, J. L.,
Lummis, S. C. R. & Vijverberg, H. P. M. (1998)
Proc. Natl. Acad. Sci. U. S. A. 95, 11456-11461). To
test the hypothesis that the
4 subunit contributes to the lining of
the pore of the resulting 5-HT3R channel, a mutant
nicotinic
4 subunit with a reactive cysteine residue engineered into
the putative pore region was constructed by substituting the leucine at
position 285 (
4-L285C). The sulfhydryl-modifying reagent
[2-(trimethylammonium) ethyl]methanethiosulfonate (MTSET)
reduced the acetylcholine-induced current in oocytes expressing this
mutant nicotinic
4-L285C subunit along with the nicotinic
2
subunit by ~60%. When the
4-L285C subunit was
co-expressed with the 5-HT3R subunit, both MTSET and silver
nitrate (AgNO3), another cysteine-modifying reagent,
significantly reduced the serotonin-induced current. No reduction was
seen when the 5-HT3R was expressed alone or with the
wild-type
4 subunit. These data provide direct molecular evidence
that the nicotinic
4 subunit co-assembles with the
5-HT3R subunit and forms an integral part of the ion
channel pore.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
-aminobutyric acid type A, and glycine receptor channels (2). These
other ligand-gated ion channels are comprised of structurally diverse subunits and are therefore hetero-oligomeric assemblies of receptor proteins. In this way, the same ligand can mediate a variety of cellular responses depending upon the particular subunit composition. Published results have yielded biophysical and pharmacological properties of 5-HT3Rs that vary greatly. Values for single
channel conductances range from 0.36 to 19 picosiemens, and the
permeability ratio of calcium to sodium ions has been reported to range
from virtually undetectable (pCa/pNa < 0.09) (2) to highly calcium-permeable (pCa/pNa = 1.12) (3). So far, there has only
been one 5-HT3R gene cloned, along with one splice variant.
Expression of the 5-HT3R in oocytes and mammalian cell
lines does not reproduce all of the properties seen in native
5-HT3Rs from either neurons or neuroblastoma cell lines.
This suggests that other, as yet unknown, 5-HT3R subunits
may exist. Recently van Hooft et al. (1) reported that
co-expression of the nicotinic
4 subunit with the 5-HT3R
subunit in HEK 293 cells and Xenopus oocytes produced 5-HT-activated channels with an enhanced permeability to calcium. They
also showed that the 5-HT3R and nicotinic
4 subunit
co-immunoprecipitate, suggesting an intimate interaction between these
two subunits. However, it has not previously been determined whether or
not the nicotinic
4 subunit actually formed part of the pore along with the 5-HT3R subunit.
4 subunit
can form part of the 5-HT3R ion channel pore. To do this we
used a mutant form of the nicotinic
4 subunit with a reactive cysteine engineered into the presumed pore region. This mutant nicotinic
4 subunit was co-expressed along with the
5-HT3R in Xenopus oocytes, and we probed for the
presence of a cysteine residue in the pore of the channels by
covalently modifying it with either a methanethiosulfonate compound or
silver nitrate. We report evidence that strongly suggests that the
nicotinic
4 subunit forms an integral part of a 5-HT-activated channel.
![]()
EXPERIMENTAL PROCEDURES
4
and
2 plasmids were provided by J. Patrick and subcloned into
pcDNA 3.1 (Invitrogen, Carlsbad, CA) before mutagenesis. The
leucine to cysteine point mutation at position 285 was done with the
Stratagene (La Jolla, CA) QuickChange mutation kit. The following
oligonucleotide primers (synthesized by Life Technologies, Inc.) were
used: AGGTCACACTGTGCATCTCGGTGCTGTGTTCTCTCACCG (sense strand) and
CGGTGAGAGAACACAGCACCGAGATGCACAG (antisense strand). All conditions for
the mutagenesis were as suggested by the manufacturer. The TM2 regions
of the resulting plasmids were sequenced to confirm the presence of the
desired mutation.
4 (native and mutant) (25), and
2 nACh
subunits (25). Experiments were performed 1-4 days after injection.
25 mV or
60 mV, using a Geneclamp 500 (Axon
Instruments). Electrodes contained 3 M KCl with 0.4 M BAPTA and had resistances of <0.5 megaohm. ACh (Sigma) and 5-HT (RBI) were freshly prepared in bath solution from a frozen stock and applied via a synthetic quartz perfusion tube (0.7 mm) operated by a computer-controlled valve.
(current before treatment/current after treatment)) × 100.
![]()
RESULTS AND DISCUSSION
-aminobutyric acid
type A (10, 11) receptor channels. In addition, SCAM has
been used to show that the neuronal nicotinic
5 (12) subunit forms
an integral part of the pore region of the ion channel when
co-expressed with other
and
nicotinic subunits.
4 nicotinic subunit to
cysteine (
4-L285C); this position corresponds to the leucine at
position 251 of the nicotinic
1 subunit (6). We then co-expressed
the wild-type or mutant nicotinic
4 subunit along with the wild-type
nicotinic
2 subunit and tested whether ACh-activated responses (5 µM) were sensitive to block by the positively charged MTS
derivative, MTS-ethyltrimethylammonium (MTSET). As shown in Fig.
1, MTSET (5 mM; applied with
5 µM ACh and washed for 15 min) blocked 18 ± 6%
(n = 5 cells) of the response amplitude from oocytes
expressing the wild-type nicotinic
4 subunit (Fig. 1, A
and C) and 60 ± 4% (n = 5 cells) of
the response amplitude from oocytes expressing the mutant nicotinic
4-L285C subunit (Fig. 1, B and C). The modest
block of wild-type
4/
2 by MTSET was comparable with that
previously reported by Ramirez-Latorre et al. (12).

View larger version (9K):
[in a new window]
Fig. 1.
MTSET block of nicotinic
4/
2
receptors. Traces are from oocytes expressing either wild-type
4 and
2 (A) or the mutant nicotinic
4-L285C subunit
and
2 (B) in response to the application of 5 µM ACh (applied duration is indicated by the
horizontal bar). MTSET (5 mM) was applied for 5 min along with 5 µM ACh. The second trace was recorded 15 min after the wash out of MTSET. The holding potential was
60 mV for
both A and B. The average block by MTSET is shown
in C (mean ± S.E.).
When the 5-HT3R was expressed either alone or with the
wild-type nicotinic
4 subunit, MTSET did not block
serotonin-activated responses (percent block was 2.7 ± 3, n = 10 for 5-HT3R, and
5.0 ± 4, n = 3 for wild-type
4/5-HT3R; Fig.
2, A and B).
However, when the 5-HT3R was co-expressed with the mutant
nicotinic
4-L285C subunit, MTSET significantly reduced the
serotonin-activated response amplitude by 22 ± 5%
(n = 16 cells) (Fig. 2C). These data are summarized in Fig. 3 and strongly suggest
that the nicotinic
4 subunit participates in lining the pore of the
ion channel along with the 5-HT3R subunit. Furthermore,
these data provide additional evidence that the 5-HT3 and
nicotinic
4 receptor subunits co-assemble to form a heteromeric
ligand-gated ion channel activated by serotonin.
|
|
The fact that MTSET blocks only 22% of the response amplitude for the
5-HT3/
4-L285C channels whereas it blocks 60% of the
4-L285C/
2 current may be because of several factors. Even though we have injected a 50-fold excess amount of nicotinic
4
versus 5-HT3R subunit RNA, it is likely that
most of the current activated by serotonin is carried through
homo-oligomeric assemblies of the 5-HT3R subunit; these are
unaffected by MTSET (see Fig. 2). Previously it was reported that when
a 3-fold excess amount of nicotinic
4 versus
5-HT3R subunit DNA was injected in Xenopus oocytes, only up to 11% of the functional 5-HT3R channels
appeared to contain the nicotinic
4 subunit (1). It is possible that a similar situation exists in the present study where a majority of the
functional channels activated by serotonin are homo-oligomeric 5-HT3 receptors. Second, we do not know the precise
stoichiometry of the 5-HT3/
4 receptor channels. If a
5-HT3/
4 channel contained only a single nicotinic
4
subunit, whereas two nicotinic
4 subunits are expected when
co-expressed with the nicotinic
2 subunit, then the predicted block
by MTSET would be smaller. When SCAM was previously used to demonstrate
that the nicotinic
5 subunit formed part of the pore along with the
nicotinic
4 and
2 subunits, MTSET blocked <35% of the response
amplitude when the nicotinic
5-cysteine mutant was co-expressed with
both the mutant
4 and
2 subunits (12).
Another possibility is that the physical dimensions of the pore of the
5-HT3/
4 receptor channels may be quite different from the nicotinic
4/
2 receptor channels. In this case, the
accessibility of MTSET to the reactive cysteine may be reduced. To
study this possibility we repeated the experiments using silver nitrate
(AgNO3). Silver also forms a covalent bond with reactive
sulfur groups and has been used with SCAM to study the pore regions of
channels where the pore diameter may be too small for large organic
cations to enter (9, 13). We found that the percentage of block using silver nitrate (AgNO3) was not significantly different from
MTSET (2.9 ± 4%, n = 5 block for
5-HT3R; and 23 ± 9%, n = 5 for
5-HT3/
4-L285C (Fig. 3)). These data suggest that the
accessibility of cysteine-modifying reagents to the pore of the channel
is not the limiting factor.
Co-assembly of the 5-HT3R subunit and the nicotinic
4
subunit might help to explain some of the diverse functional and
pharmacological properties of native 5-HT3Rs that cannot be
accounted for by the different 5-HT3R splice variants that
have currently been cloned. It is also very likely that other currently
unknown 5-HT3R subunits, or non-5-HT3R subunits
that interact with the 5-HT3R, may exist. For example,
5-HT3Rs purified from porcine brain appear to contain other
non-5-HT3R proteins (14); these proteins are not nicotinic
1,
3,
4,
5,
7, or
2 subunits (14). Although the
co-assembly of 5-HT3R/nicotinic
4 subunits in
vivo has yet to be rigorously proven, we have confirmed that it is
possible in Xenopus oocytes.
Nayak et al. (15) have recently reported that the
5-HT3R and nicotinic
4 subunits co-localize on a subset
of rat striatal and cerebellar synaptosomes. This is particularly
interesting in light of the fact that presynaptic 5-HT3Rs
(e.g. those located on isolated nerve terminals) are thought
to be significantly more calcium-permeant than somal
5-HT3Rs (16, 17) and that the nicotinic
4 subunit was
reported to enhance the calcium permeability of the 5-HT3R
(1). Our demonstration that the nicotinic
4 subunit lines the pore
of the channel is consistent with the idea that it could modify the
single channel conductance and calcium permeability of the
5-HT3R. This may be a general strategy used in neurons to
produce the wide range of properties reported.
| |
ACKNOWLEDGEMENTS |
|---|
We thank D. Armstrong and D. Pettit for advice in preparing the manuscript and D. Julius and J. Patrick for providing the plasmid DNA.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: NIEHS, F2-08, P. O.
Box 12233, 111 T.W. Alexander Dr., Research Triangle Park, NC 27709. Tel.: 919-541-1407; Fax: 919-541-1898; E-mail:
yakel{at}niehs.nih.gov.
The abbreviations used are: 5-HT3R, 5-HT3 receptor; nACh, nicotinic acetylcholine; ACh, acetylcholine; MTS, methanethiosulfonate; SCAM, substituted cysteine accessibility method; MTSET, MTS-ethyltrimethylammonium.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. M. Angevine and R. H. Fillingame Aqueous Access Channels in Subunit a of Rotary ATP Synthase J. Biol. Chem., February 14, 2003; 278(8): 6066 - 6074. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ferezou, B. Cauli, E. L. Hill, J. Rossier, E. Hamel, and B. Lambolez 5-HT3 Receptors Mediate Serotonergic Fast Synaptic Excitation of Neocortical Vasoactive Intestinal Peptide/Cholecystokinin Interneurons J. Neurosci., September 1, 2002; 22(17): 7389 - 7397. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Haines, M. M. Voigt, K. Migita, G. E. Torres, and T. M. Egan On the Contribution of the First Transmembrane Domain to Whole-Cell Current through an ATP-Gated Ionotropic P2X Receptor J. Neurosci., August 15, 2001; 21(16): 5885 - 5892. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sun, E. A. McCardy, T. K. Machu, and M. P. Blanton Characterization of Interaction of 3,4,5-Trimethoxybenzoic Acid 8-(Diethylamino)octyl Ester with Torpedo californica Nicotinic Acetylcholine Receptor and 5-Hydroxytryptamine3 Receptor J. Pharmacol. Exp. Ther., July 1, 1999; 290(1): 129 - 135. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |