JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kriegler, S.
Right arrow Articles by Yakel, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kriegler, S.
Right arrow Articles by Yakel, J. L.

J Biol Chem, Vol. 274, Issue 7, 3934-3936, February 12, 1999

COMMUNICATION
The Nicotinic alpha 4 Receptor Subunit Contributes to the Lining of the Ion Channel Pore When Expressed with the 5-HT3 Receptor Subunit*

Steve Kriegler, Sterling Sudweeks, and Jerrel L. YakelDagger

From the Laboratory of Signal Transduction, NIEHS, National Institutes of Health, Research Triangle Park, North Carolina 27709

    ABSTRACT
Top
Abstract
Introduction
References

To understand the wide variation of calcium permeability seen in native and recombinant 5-HT3 receptor (5-HT3R) channels, we reported previously the novel hypothesis that the serotonin 5-HT3R subunit can co-assemble with the alpha 4 subunit of the nicotinic acetylcholine receptor (van Hooft, J. A., Spier, A. D., Yakel, J. L., Lummis, S. C. R. & Vijverberg, H. P. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11456-11461). To test the hypothesis that the alpha 4 subunit contributes to the lining of the pore of the resulting 5-HT3R channel, a mutant nicotinic alpha 4 subunit with a reactive cysteine residue engineered into the putative pore region was constructed by substituting the leucine at position 285 (alpha 4-L285C). The sulfhydryl-modifying reagent [2-(trimethylammonium) ethyl]methanethiosulfonate (MTSET) reduced the acetylcholine-induced current in oocytes expressing this mutant nicotinic alpha 4-L285C subunit along with the nicotinic beta 2 subunit by ~60%. When the alpha 4-L285C subunit was co-expressed with the 5-HT3R subunit, both MTSET and silver nitrate (AgNO3), another cysteine-modifying reagent, significantly reduced the serotonin-induced current. No reduction was seen when the 5-HT3R was expressed alone or with the wild-type alpha 4 subunit. These data provide direct molecular evidence that the nicotinic alpha 4 subunit co-assembles with the 5-HT3R subunit and forms an integral part of the ion channel pore.

    INTRODUCTION
Top
Abstract
Introduction
References

The 5-HT3 receptor (5-HT3R)1 is a ligand-gated ion channel activated by the endogenous neurotransmitter serotonin (5-HT) and belongs to the superfamily of ligand-gated ion channels; this group includes the nicotinic acetylcholine (nACh), gamma -aminobutyric acid type A, and glycine receptor channels (2). These other ligand-gated ion channels are comprised of structurally diverse subunits and are therefore hetero-oligomeric assemblies of receptor proteins. In this way, the same ligand can mediate a variety of cellular responses depending upon the particular subunit composition. Published results have yielded biophysical and pharmacological properties of 5-HT3Rs that vary greatly. Values for single channel conductances range from 0.36 to 19 picosiemens, and the permeability ratio of calcium to sodium ions has been reported to range from virtually undetectable (pCa/pNa < 0.09) (2) to highly calcium-permeable (pCa/pNa = 1.12) (3). So far, there has only been one 5-HT3R gene cloned, along with one splice variant. Expression of the 5-HT3R in oocytes and mammalian cell lines does not reproduce all of the properties seen in native 5-HT3Rs from either neurons or neuroblastoma cell lines. This suggests that other, as yet unknown, 5-HT3R subunits may exist. Recently van Hooft et al. (1) reported that co-expression of the nicotinic alpha 4 subunit with the 5-HT3R subunit in HEK 293 cells and Xenopus oocytes produced 5-HT-activated channels with an enhanced permeability to calcium. They also showed that the 5-HT3R and nicotinic alpha 4 subunit co-immunoprecipitate, suggesting an intimate interaction between these two subunits. However, it has not previously been determined whether or not the nicotinic alpha 4 subunit actually formed part of the pore along with the 5-HT3R subunit.

In this study, we tested directly whether the nicotinic alpha 4 subunit can form part of the 5-HT3R ion channel pore. To do this we used a mutant form of the nicotinic alpha 4 subunit with a reactive cysteine engineered into the presumed pore region. This mutant nicotinic alpha 4 subunit was co-expressed along with the 5-HT3R in Xenopus oocytes, and we probed for the presence of a cysteine residue in the pore of the channels by covalently modifying it with either a methanethiosulfonate compound or silver nitrate. We report evidence that strongly suggests that the nicotinic alpha 4 subunit forms an integral part of a 5-HT-activated channel.

    EXPERIMENTAL PROCEDURES

RNA Preparation-- mRNA was transcribed in vitro from plasmids using the mMessage Machine kit (Ambion) under conditions suggested by the manufacturer. The 5-HT3R plasmid was provided by D. Julius (4), and the rat nACh receptor alpha 4 and beta 2 plasmids were provided by J. Patrick and subcloned into pcDNA 3.1 (Invitrogen, Carlsbad, CA) before mutagenesis. The leucine to cysteine point mutation at position 285 was done with the Stratagene (La Jolla, CA) QuickChange mutation kit. The following oligonucleotide primers (synthesized by Life Technologies, Inc.) were used: AGGTCACACTGTGCATCTCGGTGCTGTGTTCTCTCACCG (sense strand) and CGGTGAGAGAACACAGCACCGAGATGCACAG (antisense strand). All conditions for the mutagenesis were as suggested by the manufacturer. The TM2 regions of the resulting plasmids were sequenced to confirm the presence of the desired mutation.

Expression in Xenopus Oocytes-- Oocytes were dissected from mature female Xenopus laevis frogs and defolliculated by treatment with collagenase (Boehringer Mannheim, 3 mg/ml) for 2-4 h. The total amount of RNA injected for each subunit was (in ng): 5-HT3R (0.5), alpha 4 (native and mutant) (25), and beta 2 nACh subunits (25). Experiments were performed 1-4 days after injection.

Electrophysiological Recording-- Current responses were obtained by two-electrode voltage clamp recording at a holding potential of -25 mV or -60 mV, using a Geneclamp 500 (Axon Instruments). Electrodes contained 3 M KCl with 0.4 M BAPTA and had resistances of <0.5 megaohm. ACh (Sigma) and 5-HT (RBI) were freshly prepared in bath solution from a frozen stock and applied via a synthetic quartz perfusion tube (0.7 mm) operated by a computer-controlled valve.

Solutions-- Oocytes were defolliculated in a solution containing (mM) NaCl (85.2), KCl (2), MgCl2 (1), and HEPES (5). Recordings were performed in a solution containing (mM) NaCl (96), KCl (2), CaCl2 (1.8), MgCl2 (1), HEPES (10), and niflumic acid (0.3). Oocytes were maintained in culture in the same solution, without niflumic acid, and with the addition of 2.5 mM sodium pyruvate, 0.5 mM theophylline, 50 µg/ml gentamycin, and 5% horse serum. The methanethiosulfonate (MTS) reagents (Toronto Research Chemicals) were dissolved in solution immediately prior to application and used in less than 2 min. A stock solution of 5 mM AgNO3 was made fresh daily and kept at 4 °C. It was diluted to the final concentration immediately before application.

Data Analysis-- Data were collected from oocytes that had a stable base line for at least 15 min. The peak currents were measured using Clampfit (Axon Instruments), and the percent block was calculated using the following equation; (1 - (current before treatment/current after treatment)) × 100.

    RESULTS AND DISCUSSION

The substituted cysteine accessibility method (SCAM) has been used to identify amino acid residues that line the pore of the channel for the nACh (5-7), NMDA (8), P2X (ATP) (9), and gamma -aminobutyric acid type A (10, 11) receptor channels. In addition, SCAM has been used to show that the neuronal nicotinic alpha 5 (12) subunit forms an integral part of the pore region of the ion channel when co-expressed with other alpha  and beta  nicotinic subunits.

We mutated the leucine at position 285 of the alpha 4 nicotinic subunit to cysteine (alpha 4-L285C); this position corresponds to the leucine at position 251 of the nicotinic alpha 1 subunit (6). We then co-expressed the wild-type or mutant nicotinic alpha 4 subunit along with the wild-type nicotinic beta 2 subunit and tested whether ACh-activated responses (5 µM) were sensitive to block by the positively charged MTS derivative, MTS-ethyltrimethylammonium (MTSET). As shown in Fig. 1, MTSET (5 mM; applied with 5 µM ACh and washed for 15 min) blocked 18 ± 6% (n = 5 cells) of the response amplitude from oocytes expressing the wild-type nicotinic alpha 4 subunit (Fig. 1, A and C) and 60 ± 4% (n = 5 cells) of the response amplitude from oocytes expressing the mutant nicotinic alpha 4-L285C subunit (Fig. 1, B and C). The modest block of wild-type alpha 4/beta 2 by MTSET was comparable with that previously reported by Ramirez-Latorre et al. (12).


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.   MTSET block of nicotinic alpha 4/beta 2 receptors. Traces are from oocytes expressing either wild-type alpha 4 and beta 2 (A) or the mutant nicotinic alpha 4-L285C subunit and beta 2 (B) in response to the application of 5 µM ACh (applied duration is indicated by the horizontal bar). MTSET (5 mM) was applied for 5 min along with 5 µM ACh. The second trace was recorded 15 min after the wash out of MTSET. The holding potential was -60 mV for both A and B. The average block by MTSET is shown in C (mean ± S.E.).

When the 5-HT3R was expressed either alone or with the wild-type nicotinic alpha 4 subunit, MTSET did not block serotonin-activated responses (percent block was 2.7 ± 3, n = 10 for 5-HT3R, and -5.0 ± 4, n = 3 for wild-type alpha 4/5-HT3R; Fig. 2, A and B). However, when the 5-HT3R was co-expressed with the mutant nicotinic alpha 4-L285C subunit, MTSET significantly reduced the serotonin-activated response amplitude by 22 ± 5% (n = 16 cells) (Fig. 2C). These data are summarized in Fig. 3 and strongly suggest that the nicotinic alpha 4 subunit participates in lining the pore of the ion channel along with the 5-HT3R subunit. Furthermore, these data provide additional evidence that the 5-HT3 and nicotinic alpha 4 receptor subunits co-assemble to form a heteromeric ligand-gated ion channel activated by serotonin.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 2.   MTSET block of 5-HT3 and nicotinic alpha 4/5-HT3 receptors. Traces are from oocytes expressing either the 5-HT3R subunit alone (A) or with the wild-type alpha 4 subunit (B) or the mutant nicotinic alpha 4-L285C subunit (C). The concentration of 5-HT was 50 µM. MTSET (5 mM) was applied for 5 min with 50 µM 5-HT. The second traces were recorded 15 min after the wash out of MTSET. The holding potential was -25 mV, and the calibration bar is the same for A and B.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   Irreversible inhibition of 5-HT3 and nicotinic alpha 4/5-HT3 receptors by MTSET and AgNO3. Results are from 5-HT-induced currents from cells expressing the 5-HT3R subunit alone or with the wild-type nicotinic alpha 4 subunit (MTSET only) or the mutant alpha 4-L285C subunits. The concentration of MTSET was 5 mM and the concentration of AgNO3 was 500 nM; both were co-applied with 5-HT. 5-HT was used at a concentration of 10 or 50 µM and the results were pooled.

The fact that MTSET blocks only 22% of the response amplitude for the 5-HT3/alpha 4-L285C channels whereas it blocks 60% of the alpha 4-L285C/beta 2 current may be because of several factors. Even though we have injected a 50-fold excess amount of nicotinic alpha 4 versus 5-HT3R subunit RNA, it is likely that most of the current activated by serotonin is carried through homo-oligomeric assemblies of the 5-HT3R subunit; these are unaffected by MTSET (see Fig. 2). Previously it was reported that when a 3-fold excess amount of nicotinic alpha 4 versus 5-HT3R subunit DNA was injected in Xenopus oocytes, only up to 11% of the functional 5-HT3R channels appeared to contain the nicotinic alpha 4 subunit (1). It is possible that a similar situation exists in the present study where a majority of the functional channels activated by serotonin are homo-oligomeric 5-HT3 receptors. Second, we do not know the precise stoichiometry of the 5-HT3/alpha 4 receptor channels. If a 5-HT3/alpha 4 channel contained only a single nicotinic alpha 4 subunit, whereas two nicotinic alpha 4 subunits are expected when co-expressed with the nicotinic beta 2 subunit, then the predicted block by MTSET would be smaller. When SCAM was previously used to demonstrate that the nicotinic alpha 5 subunit formed part of the pore along with the nicotinic alpha 4 and beta 2 subunits, MTSET blocked <35% of the response amplitude when the nicotinic alpha 5-cysteine mutant was co-expressed with both the mutant alpha 4 and beta 2 subunits (12).

Another possibility is that the physical dimensions of the pore of the 5-HT3/alpha 4 receptor channels may be quite different from the nicotinic alpha 4/beta 2 receptor channels. In this case, the accessibility of MTSET to the reactive cysteine may be reduced. To study this possibility we repeated the experiments using silver nitrate (AgNO3). Silver also forms a covalent bond with reactive sulfur groups and has been used with SCAM to study the pore regions of channels where the pore diameter may be too small for large organic cations to enter (9, 13). We found that the percentage of block using silver nitrate (AgNO3) was not significantly different from MTSET (2.9 ± 4%, n = 5 block for 5-HT3R; and 23 ± 9%, n = 5 for 5-HT3/alpha 4-L285C (Fig. 3)). These data suggest that the accessibility of cysteine-modifying reagents to the pore of the channel is not the limiting factor.

Co-assembly of the 5-HT3R subunit and the nicotinic alpha 4 subunit might help to explain some of the diverse functional and pharmacological properties of native 5-HT3Rs that cannot be accounted for by the different 5-HT3R splice variants that have currently been cloned. It is also very likely that other currently unknown 5-HT3R subunits, or non-5-HT3R subunits that interact with the 5-HT3R, may exist. For example, 5-HT3Rs purified from porcine brain appear to contain other non-5-HT3R proteins (14); these proteins are not nicotinic alpha 1, alpha 3, alpha 4, alpha 5, alpha 7, or beta 2 subunits (14). Although the co-assembly of 5-HT3R/nicotinic alpha 4 subunits in vivo has yet to be rigorously proven, we have confirmed that it is possible in Xenopus oocytes.

Nayak et al. (15) have recently reported that the 5-HT3R and nicotinic alpha 4 subunits co-localize on a subset of rat striatal and cerebellar synaptosomes. This is particularly interesting in light of the fact that presynaptic 5-HT3Rs (e.g. those located on isolated nerve terminals) are thought to be significantly more calcium-permeant than somal 5-HT3Rs (16, 17) and that the nicotinic alpha 4 subunit was reported to enhance the calcium permeability of the 5-HT3R (1). Our demonstration that the nicotinic alpha 4 subunit lines the pore of the channel is consistent with the idea that it could modify the single channel conductance and calcium permeability of the 5-HT3R. This may be a general strategy used in neurons to produce the wide range of properties reported.

    ACKNOWLEDGEMENTS

We thank D. Armstrong and D. Pettit for advice in preparing the manuscript and D. Julius and J. Patrick for providing the plasmid DNA.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: NIEHS, F2-08, P. O. Box 12233, 111 T.W. Alexander Dr., Research Triangle Park, NC 27709. Tel.: 919-541-1407; Fax: 919-541-1898; E-mail: yakel{at}niehs.nih.gov.

The abbreviations used are: 5-HT3R, 5-HT3 receptor; nACh, nicotinic acetylcholine; ACh, acetylcholine; MTS, methanethiosulfonate; SCAM, substituted cysteine accessibility method; MTSET, MTS-ethyltrimethylammonium.
    REFERENCES
Top
Abstract
Introduction
References

  1. van Hooft, J. A., Spier, A. D., Yakel, J. L., Lummis, S. C. R., and Vijverberg, H. P. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11456-11461[Abstract/Free Full Text]
  2. Jackson, M. B., and Yakel, J. L. (1995) Annu. Rev. Physiol. 57, 447-468[CrossRef][Medline] [Order article via Infotrieve]
  3. Yang, J. (1990) J. Gen. Physiol. 96, 1177-1198[Abstract/Free Full Text]
  4. Maricq, A. V., Peterson, A. S., Brake, A. J., Myers, R. M., and Julius, D. (1991) Science 254, 432-437[Abstract/Free Full Text]
  5. Akabas, M. H., Stauffer, D. A., Xu, M., and Karlin, A. (1992) Science 258, 307-310[Abstract/Free Full Text]
  6. Akabas, M. H., Kaufmann, C., Archdecon, P., and Karlin, A. (1994) Neuron 13, 919-927[CrossRef][Medline] [Order article via Infotrieve]
  7. Akabas, M. H., and Karlin, A. (1995) Biochemistry 34, 12496-12500[CrossRef][Medline] [Order article via Infotrieve]
  8. Kuner, T., Wollmuth, L. P., Karlin, A., Seeburg, P. H., and Sakmann, B. (1996) Neuron 17, 343-352[CrossRef][Medline] [Order article via Infotrieve]
  9. Eagan, T. M., Haines, W. R., and Voigt, M. M. (1998) J. Neurosci. 18, 2350-2359[Abstract/Free Full Text]
  10. Xu, M., and Akabas, M. H. (1993) J. Biol. Chem. 268, 21505-21508[Abstract/Free Full Text]
  11. Xu, M., Covey, D. F., and Akabas, M. H. (1995) Biophys. J. 69, 1858-1867[Abstract/Free Full Text]
  12. Ramirez-Latorre, J., Yu, C. R., Qu, X., Perin, F., Karlin, A., and Role, L. (1996) Science 380, 347-351[CrossRef]
  13. Lu, Q., and Miller, C. (1995) Science 268, 304-307[Abstract/Free Full Text]
  14. Fletcher, S., Lindstom, J. M., Ruth, M. M., and Barnes, N. M. (1998) Neuropharmacology 37, 397-399[CrossRef][Medline] [Order article via Infotrieve]
  15. Nayak, S. V., Ronde, P., Spier, A. D., Lummis, S. C. R., and Nichols, R. A. (1998) Soc. Neurosci. Abstr. 24, 1819
  16. Ronde, P., and Nichols, R. A. (1997) Cell Calcium 22, 357-365[CrossRef][Medline] [Order article via Infotrieve]
  17. Ronde, P., and Nichols, R. A. (1998) J. Neurochem. 70, 1094-1103[Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. M. Angevine and R. H. Fillingame
Aqueous Access Channels in Subunit a of Rotary ATP Synthase
J. Biol. Chem., February 14, 2003; 278(8): 6066 - 6074.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
I. Ferezou, B. Cauli, E. L. Hill, J. Rossier, E. Hamel, and B. Lambolez
5-HT3 Receptors Mediate Serotonergic Fast Synaptic Excitation of Neocortical Vasoactive Intestinal Peptide/Cholecystokinin Interneurons
J. Neurosci., September 1, 2002; 22(17): 7389 - 7397.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
W. R. Haines, M. M. Voigt, K. Migita, G. E. Torres, and T. M. Egan
On the Contribution of the First Transmembrane Domain to Whole-Cell Current through an ATP-Gated Ionotropic P2X Receptor
J. Neurosci., August 15, 2001; 21(16): 5885 - 5892.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Sun, E. A. McCardy, T. K. Machu, and M. P. Blanton
Characterization of Interaction of 3,4,5-Trimethoxybenzoic Acid 8-(Diethylamino)octyl Ester with Torpedo californica Nicotinic Acetylcholine Receptor and 5-Hydroxytryptamine3 Receptor
J. Pharmacol. Exp. Ther., July 1, 1999; 290(1): 129 - 135.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kriegler, S.
Right arrow Articles by Yakel, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kriegler, S.
Right arrow Articles by Yakel, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.