|
J Biol Chem, Vol. 274, Issue 7, 4017-4026, February 12, 1999
Hormone-dependent Recruitment of NF-Y to the
Uteroglobin Gene Enhancer Associated with Chromatin Remodeling in
Rabbit Endometrial Epithelium*
Axel
Scholz ,
Mathias
Truss, and
Miguel
Beato§
From the Institut für Molekularbiologie und Tumorforschung,
Philipps Universität, Emil-Mannkopff-Strasse 2, D-35037 Marburg, Germany
 |
ABSTRACT |
Expression of the rabbit uteroglobin gene is
hormonally induced in cells of the endometrial epithelium during the
preimplantation phase of pregnancy. Here we show that progesterone
activation of the gene is mediated by two clusters of hormone
responsive elements located between 2.4 and 2.7 kilobase pairs upstream
of the transcriptional start site. Between these two clusters, genomic footprinting studies in the intact endometrial epithelium reveal the
hormone-inducible occupancy of several cis-acting elements. One of the protected elements shows sequence homology to the consensus binding site of the transcription factor NF-Y, which binds to the
element in gel shift experiments. This uteroglobin Y box is essential
for enhancer activity in transient transfection experiments with
endometrial and non-endometrial cell lines, in accordance with the
ubiquitous expression of NF-Y. To understand why binding of this
ubiquitous factor to the uteroglobin Y box in endometrium depends on
hormone induction, we examined the chromatin structure of the relevant
gene region. In the uninduced state, the enhancer region appears to be
organized into positioned nucleosomes. Upon hormone induction, this
nucleosomal pattern is lost and the enhancer region becomes
hypersensitive to nucleases, suggesting that a hormone-induced change
in the local chromatin structure unmasks previously unaccessible
binding sites for transcription factors. Our results emphasize the
limitations of using transient transfection assays for the functional
analysis of cis-acting elements and underline the need for
including the native chromatin organization in this kind of studies.
 |
INTRODUCTION |
Uteroglobin is a small globular protein originally described as
the main protein component in the uterine secretion of rabbits in the
preimplantation phase of pregnancy (1, 2) (for a review, see Refs. 3
and 4). Later, the protein was also found in the oviduct (5), the male
genital tract (6), and the lung (7). Although its general physiological
role remains unclear, in the rabbit uterus the protein might be
involved in implantation of the trophoblast and/or in anti-inflammatory
reactions (4, 8, 9). Expression of the uteroglobin gene in cells of the
endometrial epithelium is transcriptionally regulated by estrogens and
progestins (10-12). The effect of estrogens is mediated by a
regulatory composite unit located around 250 bp1 upstream from the
transcription start site, which comprises a single estrogen responsive
element and an adjacent GC/GT box (13, 14). The potential
cis-acting elements for progesterone activation of the gene
have only been mapped in DNA binding experiments in vitro.
Progesterone receptor-binding sites have been assigned to the first
intron of the gene (15), as well as to a region between 2.4 and 2.7 kb
upstream of the transcription start site, where two clusters of three
imperfect binding sites for glucocorticoid and progesterone receptors
have been found (16, 17). The relevance of these upstream
receptor-binding sites was supported by the appearance of adjacent
progesterone inducible DNase I-hypersensitive sites in chromatin of
isolated nuclei from endometrial epithelium (17).
In order to identify physiologically relevant regulatory elements
within the uteroglobin gene upstream region, we performed gene transfer
and genomic footprinting studies in native endometrial epithelium
following hormonal treatment of female rabbits. We show that the two
clusters of progesterone receptor-binding sites function as bona fide
hormone responsive elements. They flank several sequence motifs that
are protected in vivo following hormone induction. One of
them is a Y-box encompassing a reverse CCAAT motif, which is recognized
by the ubiquitous transcription factor NF-Y. The NF-Y binding element
is an essential part of a short enhancer region which is functional in
various transiently transfected cell lines. Despite its ubiquitous
expression, in vivo NF-Y binds to the uteroglobin enhancer
only in endometrial cells and only after hormonal induction of the
gene. This apparent paradox is likely due to the nucleosomal
organization of the enhancer region. We show here that the relevant
region is packed in positioned nucleosomes in the uninduced state.
Hormonal induction leads to a loss of the regular nucleosomal pattern
and to the appearance of nuclease-hypersensitive sites reflecting a
remodelled chromatin structure. We hypothesize that these changes in
chromatin structure may be the mechanism underlying the progesterone
induced recruitment of the ubiquitously expressed transcription factor
NF-Y, and other factors, to the upstream uteroglobin gene enhancer.
 |
EXPERIMENTAL PROCEDURES |
Animals and Treatments--
Adult 1/2 to 1-year-old female
rabbits (New Zealand White or Chinchilla-Bastard, 3-4 kg) were housed
in individual cages under controlled conditions of temperature and
light (12 h light-dark) and kept separated from male rabbits to prevent
pheromone-triggered ovulation. Pseudopregnancy was induced by two
consecutive intramusculary injections of 200 IU/kg body weight hCG
(Ekluton, Vemie Veterinär Chemie, Germany) at day 0 and 1. Animals were killed at day 4 by injection of T61 (Hoechst, Germany) in
the ear vein. The uterus and liver were rapidly excised and rinsed in
phosphate-buffered saline.
Plasmids--
For CAT reporters the uteroglobin upstream
sequences were inserted into a unique HindIII site located
in front of various deletion constructs of the uteroglobin promoter
( 258 to +14) as described in Ref. 18, but lacking the two copies of
the SV40 enhancer. For the construction of the uteroglobin promoter
driven luciferase reporter plasmid, the HindIII to
XhoI ( 35 to +14) uteroglobin promoter fragment (18) was
inserted into the pXP2 plasmid (19) and uteroglobin upstream sequences
were inserted into the unique HindIII site. Similarly
uteroglobin upstream sequences were inserted into the unique
HindIII site of pT81luc (19), to generate the fusion
constructs with the heterologous herpes simplex virus thymidine kinase
promotor ( 81 to +52). The different upstream DNA fragments were
generated by restriction enzyme cleavage of genomic clones (20),
followed by a filling reaction with Klenow DNA polymerase or
degradation of termini with T4 DNA polymerase, and blunt end ligation
of HindIII linkers (Pharmacia, Uppsala, Sweden). The minimal
activating fragment ( 2523 to 2453) and its mutation were obtained
by oligonucleotide-directed PCR. An expression plasmid for the rabbit
progesterone receptor, pKSV10-rPR, was supplied by E. Milgrom, Paris
(21).
Genomic DNase I and Dimethyl Sulfate Footprinting in
Vivo--
DNase I genomic footprinting was performed as described
(22). For dimethyl sulfate genomic footprinting minor variations of a
published procedure (23) were used. In brief, endometrial epithelium or
liver cells were exposed to 0.2% dimethyl sulfate in Dulbecco's
modification of Eagle's minimal essential medium (DMEM) for 5 min. The
reaction was stopped by washing several times with phosphate-buffered
saline. Epithelial cells were separated and genomic DNA prepared.
Modified DNA was cleaved with piperidine and submitted to
ligation-mediated (LM)-PCR as described (22). The following
gene-specific oligonucleotides were used. For the upper strand: En1,
CTTTGCTTGATTGGCC; En2, CTTGATGTTCACTAAACAGGCACCTTGG; En3,
GCACCTTGGAACGAATCAGTGAACAGGCC; for the lower strand: EAI, GTCTTGTTCTCCCCTCC; EAII, ATGCCTTGTTTTTCACTCTGCAGCC; EAIII, CTCTGCAGCCTGCCTTGGCAATCATCTC.
EMSA and Methylation Protection Analysis in Vitro--
Nuclear
extracts for EMSA were prepared according to Andrews and Faller (24).
The following double-stranded oligonucleotides were used: a E gene
fragment comprising the Y box ( 65 to 44) (25); the uteroglobin gene
enhancer fragment ( 2523 to 2451) comprising the reverse Y box
( 2495 to 2499), or the respective point mutant C to A at 2495
cloned in pBluescript (Stratagene Inc.) by ligation to
HindIII linkers; an unrelated control oligonucleotide with
the upper strand sequence 5'-GAAGATCTGTGGAAAGTCCCACTAGAGC-3'. The
uteroglobin gene fragments were cut from the plasmid, purified by gel
electrophoresis, and 32P-labeled by Klenow filling-in
reaction. Unincorporated nucleotides were removed through gel
filtration. The antiserum against NF-YB, pR YB (26), or
an unrelated control serum, anti-Sp1 (27), were preincubated with
nuclear extracts for 15 min at room temperature. Poly(dI-dC) and calf
thymus DNA were added as nonspecific competitor. Binding buffer were as
described (28). The binding reaction was incubated at room temperature
for 15 min before loading on a 5% nondenaturing polyacrylamide gel.
Gels were run in 0.5-fold Tris borate/EDTA buffer at 7 V/cm and room
temperature for 120 min, dried, and autoradiographed. Methylation
protection in vitro was performed as described previously
(14).
Transient Gene Transfections--
Ishikawa cells (29) were
donated by E. Gurpide (Mount Sinai Hospital, New York). RBE-7 cells
were from A. Mukherjee, National Institutes of Health, Bethesda (30).
The cells were maintained in Dulbecco's modified Eagle's medium (Life
Technologies, Inc.) supplemented with 10% (Ishikawa) or 4% (RBE-7)
fetal calf serum (c.c. pro GmbH, Germany), penicillin (100 IU/ml), and
streptomycin (100 µg/ml) and cultivated at 37 °C (Ishikawa) or
33 °C (RBE-7) and 5% CO2. Transient transfections were
performed by the calcium phosphate DNA co-precipitation method (31). A
90-mm dish received 10 µg of reporter plasmid, different amounts of
co-expression plasmids, and sheared calf thymus DNA to a total of 20 µg of DNA and the precipitate was left on the cells for 10 h.
After 2.5 h of chloroquine treatment (0.1 mM) medium
was changed and hormones were added directly to the culture medium
which was supplemented with 10% fetal calf serum treated with
dextran-coated charcoal (32). RBE-7 cells were then shifted to
39 °C. Anti-estrogen, ICI 164.384 (10 7 M),
was eventually applied to noninduced cells to further reduce estrogen-mediated effects on basal reporter expression (33). Cells were harvested 48 h after transfection and extracts
prepared. CAT, luciferase, and -galactosidase activity were
determined by routine procedures (34).
Details of the method used to isolate, cultivate, and transfect
endometrial epithelium cells will be published
elsewhere.2 Briefly, the
inner luminal surface of the uterus was incubated with collagenase at
37 °C, flushed, and cells were collected by centrifugation. The
suspension of cells was maintained in DMEM on polystyrene culture
dishes. The medium was supplemented with 5% newborn calf serum (Life
Technologies, Inc.), penicillin (100 IU/ml), and streptomycin (100 µg/ml) and the cells were cultivated at 37 °C and 5%
CO2. The purity of the primary cell preparation was
determined by immunocytochemistry employing an antibody against rabbit
uteroglobin (35). Transient transfection was performed by the calcium
phosphate DNA co-precipitation method (31). After transfection the
cells were washed with phosphate-buffered saline and the medium changed
for phenol red-free DMEM (Life Technologies, Inc.) supplemented with
5% fetal calf serum treated with charcoal dextran (32). Hormones were
added to the medium as ethanolic solution immediately after
transfection and incubation was continued for 48 h. R5020 (gift
from Roussel UCLAF, Romainville, France) was used as synthetic
progestin, an equivalent amount of ethanol as solvent control.
Mapping of Nucleosome and Nuclease Hypersensitive
Sites--
Digestion of cell nuclei with
methidiumpropyl-EDTA-FeII (MPE), separation of the DNA
fragments in agarose gels, blotting, and indirect end labeling (36, 37)
were performed as described previously (22). Treatment of cell nuclei
with DNase I was essentially as described (22). 6 µg of genomic DNA
was cleaved with NdeI, resolved on a 1.2% agarose gel, and
blotted on Biodyne A Nylon membrane (Pall, Dreieich, Germany).
Hybridization was carried out with a radioactively labeled
(NdeI-StuI)-uteroglobin gene fragment ( 1843 to
2083) according to Church and Gilbert (38).
Quantitation of Radiolabeled DNA--
Quantitative evaluation
was performed directly from the dried gel using a PhosphorImager and
ImageQuant software (Molecular Dynamics Inc., Sunnyvale, CA) or from
autoradiographs using a laser scanner.
 |
RESULTS |
Tissue-specific and Hormone-dependent Occupancy of an
Upstream Region around 2.5 kb in Vivo--
To identify transcription
factors bound to the uteroglobin enhancer we performed genomic
footprinting analyses with DNase I and dimethyl sulfate in
vivo. We focused on the upstream region of the uteroglobin gene
between 2.7 and 2.4 kb that encompasses two clusters of
non-canonical putative progesterone responsive elements (PRE) and was
previously shown to exhibit characteristic steroid hormone inducible
and tissue-specific DNase I-hypersensitive sites (17) (Fig.
1A).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic diagram of the uteroglobin gene
region. A, the upper scheme shows 8 kb of
the rabbit uteroglobin gene region. The transcriptional start site is
+1 and exons are filled in black. Numbers above
the arrows indicate the location, given in kb, of DNase
I-hypersensitive sites (HS) found in the endometrium of
animals treated with either estradiol (E) or estradiol plus
progesterone (E&P), as well as a constitutive site at +4.1
kb. Other functional elements, such as an estrogen responsive element
(ERE) in the promoter and putative PREs in the enhancer are
indicated. The scheme below shows an expansion of the
upstream enhancer region with the positions of the PREs and the Y box
indicated. Also shown and indicated by a question mark are
the two additional DNase I footprints found in induced endometrium. The
numbers refer to the distance from the transcription
initiation site in bp. B, the nucleotide sequence around the
Y-box is shown, with the guanines contacted by NF-Y indicated by
arrowheads (open, protected; black,
hyper-reactive). The base exchange, G to T at 2495, over the Y box
mutant is indicated. The bona fide NF-Y binding oligonucleotide (25)
used in competition experiments (Fig. 3) is shown at the
bottom. The pentanucleotide CCAAT in the lower strand is
underlined.
|
|
Cell nuclei from the endometrial epithelium and liver were treated with
DNase I and the digested DNA was analyzed by LM-PCR genomic
footprinting (22, 23, 39). Close inspection of the cleavage patterns of
liver nuclei and of naked genomic DNA revealed only small differences
in the reactivity of individual cleavage sites (Fig.
2A). Very likely, these
differences result from the organization of the DNA sequences in
chromatin and not from bound transcription factors (see genomic
footprinting with dimethyl sulfate below). The DNase I cleavage pattern
found in uteroglobin expressing tissue, i.e. induced
endometrial epithelium of pseudopregnant animals (Fig. 2A, lanes
5 and 6), was different from that of free DNA (Fig.
2A, lanes 1 and 2) and from the pattern observed
in non-expressing tissues, such as liver (Fig. 2A, lanes 3 and 4) or endometrial epithelium from estrous animals (data
not shown). In addition to the region with potential PREs (17), three
other regions were strongly protected against DNase I cleavage
(schematically indicated by boxes on the right
margin in Fig. 2A). The DNase I footprints are flanked
by nuclease-hypersensitive sites (indicated by arrows in
Fig. 2A) and were absent in uninduced endometrial epithelium and in other nonexpressing tissues, such as liver. In
addition, the induced endometrial epithelium exhibited a prominent cluster of DNase I-hypersensitivite sites between 2455 and 2450 (indicated by arrowheads in Fig. 2A), a region
which also encompasses potential PREs (17).

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 2.
DNase I and dimethyl sulfate genomic
footprinting over the uteroglobin upstream region. A,
DNase I footprinting in vivo. Nuclei from liver (lanes
3 and 4) and endometrial epithelium from a
pseudopregnant animal (lanes 5 and 6) were
treated with two different amounts of DNase I and the digested DNA was
analyzed by LM-PCR. As a control, genomic DNA was treated with 200-fold
lower amounts of DNase I in vitro (lanes 1 and
2). The scheme on the right margin shows the
protected regions as boxes with the hypothetical Y box labeled. The
numbers refer to the distance from the start of
transcription. DNase I-hypersensitive sites are indicated by
arrows and arrowheads. B, dimethyl
sulfate footprinting in vivo. Cells from liver (lane
2), endometrial epithelium from an estrous animal (lane
3), and from a pseudopregnant animal (lane 4) were
treated with dimethyl sulfate in vivo and analyzed by
LM-PCR. As control, genomic DNA was methylated in vitro
(lane 1). Protected guanine residues over the Y box are
indicated by open triangles; the open circle
denotes a protected guanine residue of unknown significance. The
filled triangle marks a hypermethylated guanine residue. The
nucleotide sequence of the upper DNA strand over the relevant region is
shown on the right margin.
|
|
To specify the DNA contacts of proteins bound to these regions in
vivo we performed genomic footprinting with dimethyl sulfate (22,
23). In cells which do not express the uteroglobin gene, such as liver
cells, no difference in guanine methylation was observed compared with
control DNA methylated in vitro, suggesting that there is no
factor bound to the major groove of the DNA double helix over the
enhancer region. A characteristic pattern of hypermethylated and
protected guanine residues was detectable in epithelial cells of the
endometrium from induced animals, suggesting binding of several
transcription factors to the regions protected against DNase I
digestion. Here we will focus on a region in the upper strand
exhibiting a prominent pattern of two protected guanine residues, at
2495 and 2496, and a characteristic hypermethylation at 2493 in
induced endometrium (Fig. 2B, compare lanes 1 or
2 with lane 4). The corresponding region in the lower strand
encompasses the conserved sequence CCAAT of a Y box and did not show
differences in the cleavage pattern due to the lack of guanine residues
(data not shown). Although the changes in dimethyl sulfate reactivity were particularly prominent in the induced endometrium, a weaker hypermethylation at the guanine residue 2493 was also detectable in
endometrial cells from adult estrous or ovariectomized rabbits (Fig.
2B, compare lanes 1 or 2 with
lane 3, and data not shown), suggesting occupancy of this
site in a subpopulation of cells known to express the uteroglobin gene
under these conditions (11, 40).
Transcription Factor NF-Y Binds to the Y Box of the Uteroglobin
Gene--
To identify potential nuclear proteins that bind to the Y
box in the uteroglobin gene enhancer, we performed in vitro
DNA binding experiments employing nuclear extracts from induced
endometrial epithelium. In EMSA we observed a retarded complex that was
specifically competed by an excess of the corresponding unlabeled
oligonucleotide (Fig. 3A, lanes
4 and 5) but not by an unrelated control
oligonucleotide (Fig. 3A, lanes 2 and 3; B,
lanes 4-6). We also performed competition assays with a series of
consensus oligonucleotides for different transcription factors (data
not shown). Efficient competition was only observed with a Y-box
oligonucleotide comprising the binding site for the heteromeric
transcription factor NF-Y (25) (Fig. 3B, lanes 1-3). We
tested the relevance of this element for complex formation by
introducing a point mutation into the potential NF-Y-binding site of
the uteroglobin enhancer. Substitution of the protected guanine residue
at position 2495 by a thymine (Fig. 1B) considerably
diminished the ability of the mutated oligonucleotide to compete for
NF-Y binding in EMSA (Fig. 3A, compare lanes 6 and 7 to lanes 4 and 5). Thus
the point mutation interferes efficiently with the DNA binding of
the NF-Y complex in accordance with the importance of this guanine for
NF-Y binding observed in binding site selection experiments (25).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 3.
In vitro binding of NF-Y present
in extracts from endometrial epithelium to the Y box of the uteroglobin
gene upstream region. A, mutational analysis of the
uteroglobin Y box by EMSA. Nuclear extracts from induced endometrial
epithelium were incubated with the radioactively labeled uteroglobin
gene fragment ( 2523 to 2451) comprising the Y box. A control band
shift in the absence of competitor oligonucleotide is shown in
lane 1. Competition with increasing amounts of the following
oligonucleotides are shown: an unrelated control oligonucleotide
(lanes 2 and 3), an oligonucleotide encompassing
the uteroglobin Y box (lanes 4 and 5), and an
oligonucleotide with a point-mutated Y-box (lanes 6 and
7). B, identification by EMSA of a Y box binding
activity in nuclear extracts from induced endometrial epithelium.
Nuclear extracts were incubated with a radioactive oligonucleotide
encompassing the putative uteroglobin Y box. Competition assays were
performed with increasing amounts of bona fide Y box oligonucleotide
(lanes 1-3; Ref. 25 and Fig. 1B) and control
oligonucleotide (lanes 4-6). Immunoshift analysis with
increasing amounts of anti-NF-YB antibody (lanes
7 and 8) or an amount of control serum comparable to
that used in lane 8 (lane 9). The positions of
the free oligonucleotide, the specific complex, and the antibody
supershifted complex are shown by arrowheads on the right
margin. The dots point to unspecific bands of unknown
origin. C, dimethyl sulfate reactivity in vitro
of a subfragment of the uteroglobin gene upstream region including the
Y box ( 2523 to 2451) as free DNA or complexed with nuclear extracts
from induced endometrial epithelium (bound). Filled and
open circles denote guanine residues that are
hypermethylated or protected, respectively. The corresponding positions
in the sequence of the upper strand are indicated on the right
margin (symbols are as in Fig. 2B). The
lower strand is not shown as no changes in dimethyl sulfate reactivity
were observed upon binding of nuclear proteins.
|
|
The identity of the specifically shifted protein was further confirmed
using a specific antiserum directed against the subunit B of the
heteromeric NF-Y complex (26). Addition of the antiserum, but not of a
control serum, led to a characteristic supershift of the retarded
complex (Fig. 3B, lanes 7-9). This demonstrates that
transcription factor NF-Y from induced endometrial epithelium specifically binds to the CCAAT box in the uteroglobin gene upstream region in vitro.
To verify that the transcription factor bound in vitro is
identical to the protein that caused the footprint observed in
vivo, we carried out a methylation protection analysis in
vitro. We incubated a binding reaction containing the
radioactively labeled uteroglobin gene fragment and nuclear extract
from induced endometrial epithelium with dimethyl sulfate and separated
bound and free oligonucleotides by EMSA. A guanine-specific cleavage
reaction revealed changes in the methylation pattern of the
factor-bound oligonucleotide (Fig. 3C). A doublet of
protected guanine residues adjacent to a single hypermethylated guanine
residue was detected in the upper strand, whereas no differences were
detectable over the corresponding region in the lower strand (data not
shown). The observed changes in reactivity of distinct guanine residues toward dimethyl sulfate in vitro coincided precisely with
the methylation pattern obtained in vivo, suggesting that
the protein bound in vivo is the nuclear transcription
factor NF-Y (note that the orientation of the sequence in Fig.
3C is opposite to that shown in Fig. 2B).
The Uteroglobin Y Box Functions as a Ubiquitously Active Enhancer
Element--
We analyzed the potential function of the 5'-flanking
region of the uteroglobin gene by measuring its ability to
transcriptionally activate reporter genes in transient transfection
experiments in primary epithelial cells from rabbit endometrium. A
3.9-kb fragment of 5'-flanking sequences fused to a luciferase reporter gene exhibited only moderate activity (Fig.
4, row 1), in accordance with
the low expression level of the gene in the uninduced endometrial epithelium (41). Analysis of a series of 5'- and 3'-deletions (Fig. 4,
rows 3-8) linked to the virtually inactive uteroglobin core
promoter (row 2) delineated a core enhancer region that
spans from 2523 to 2451 and encompasses the reverse Y box (Fig. 4, row 9). The 4-fold increase in transactivation observed
after deletion of the sequences between 2288 and 2451 (compare
rows 4 and 7) could be due to a distance effect
or/and to the removal of negative regulatory elements. The point
mutation at 2495 in the Y box, which was shown to abolish NF-Y
binding (see Fig. 3A), consistently reduced the activity of
the corresponding reporter gene construct (Fig. 4, row 10),
indicating that NF-Y binds to the transiently transfected Y box of the
uteroglobin enhancer and contributes to the transcriptional activation
mediated by the enhancer.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Functional identification and delineation of
a constitutive enhancer fragment in the uteroglobin gene upstream
region. Delineation of a core enhancer region by deletion mapping
and transient transfection in primary cells of the rabbit endometrial
epithelium. Transfections were performed by the calcium phosphate DNA
co-precipitation method. Symbols for factor-binding sites in the region
around 2.5 kb are as in Fig. 1A. The relative luciferase
activity generated by each construct, normalized for co-transfected
-galactosidase, is expressed in arbitrary units. An unspecific
background of luciferase activity as determined by transfection of the
promoter-less reporter plasmid pXP2 was subtracted. The Y box mutant
(row 10) contained the G to T exchange shown in Fig.
1B. The data correspond to a representative experiment
performed several times (see also Table I).
|
|
The uteroglobin core enhancer element was active in combination with
the uteroglobin promoter or the heterologous herpes simplex virus
TK promoter (Table I). It
activated to similar extent in cells of endometrial origin, including
primary cells from rabbit endometrial epithelium, the rabbit
endometrial cell line RBE-7 (30), the human endometrial
adenocarcinoma-derived Ishikawa cell line (29), and in a cell line of
unrelated origin, the African green monkey kidney cell line CV-1 (Table
I). Furthermore, the uteroglobin core enhancer functioned in both
orientations and activated transcription downstream as well as upstream
of the reporter promoter (data not shown). We conclude that in
transient transfections the minimal region containing the NF-Y-binding
site behaves as an enhancer in combination with different promoters and
irrespective of the cellular context.
View this table:
[in this window]
[in a new window]
|
Table I
Enhancer activity of the uteroglobin Y box (UG-Y box, UG gene upstream
fragment 2523 to 2451) on the uteroglobin 35 promoter (UG) or the
herpes simplex virus thymidine kinase promoter (TK).
Reporter constructs were transiently transfected in cells of
endometrial origin (rabbit endometrial primary cells, RBE-7, Ishikawa)
and nonendometrial origin (CV1). The following cell lines were used:
RBE-7, a rabbit endometrial cell line (30); Ishikawa, a human
endometrial carcinoma cell line (29); CV1, a monkey kidney cell line.
The uteroglobin Y box mutant (UG-Y box mut) contains a G to T exchange
at position 2495. To compare the relative activational strength of
the enhancer promoter combination in the different cells an equal
amount of expression plasmid RSV/ -galactosidase was cotransfected
and the luciferase values were normalized with this internal standard.
The numbers represent the result of a representative experiment that
was performed several times.
|
|
The Progesterone Receptor-binding Sites Are Functional and
Independent of the Y Box in Transient Transfections--
As the
binding of NF-Y in vivo was observed only in hormonally
induced endometrial epithelium and binding sites for the progesterone receptor flank the Y box, we performed transient gene transfer experiments in endometrial cells to test the function of the putative PREs. The results showed that the upstream uteroglobin gene region mediates hormone responsiveness in cells expressing the progesterone receptor either endogeneously or after transfection of an appropriate expression vector. A representative result obtained with the human endometrial cell line Ishikawa (29) is shown in Fig.
5. In this particular experiment a
fragment of the uteroglobin promoter extending up to position 258 was
used to drive transcription of the CAT reporter. The promoter itself
was not stimulated by addition of the synthetic progestin R5020 (Fig.
5, row 1). A DNA fragment encompassing the two clusters of
receptor-binding sites as defined in vitro (17) conferred a
4-fold induction to the uteroglobin promoter in the presence of R5020
(Fig. 5, row 2), in agreement with the level of progesterone
activation of the endogenous uteroglobin gene, as measured by nuclear
run off analysis (10, 11). We also tested various subfragments of the
relevant region although no systematic analysis was performed. Each
cluster of receptor-binding sites was functional independently (Fig. 5,
rows 3-6), and the enhancer activity in the absence of
hormone depended on the presence of adjacent transcription
factor-binding sites, including the Y box (compare rows 2 and 5 with rows 3, 4, and 6). As a
control, a small fragment just downstream of the PREs did not affect
basal expression nor conferred homone induction (row 7). The
minimal enhancer ( 2523 to 2451) did not respond to hormone
treatment either, although it included one of the three
receptor-binding sites found in the proximal cluster (row
8). These results confirm the functionality of the two clusters of
receptor-binding sites previously identified in vitro, and
are compatible with the notion that the hormone independent activity of
the enhancer is determined by the core enhancer sequence. Since the
extent of hormonal induction is not increased in the presence of the Y
box, the results do not provide evidence for a functional synergism
between hormone receptors and NF-Y in transient transfection
experiments. The question remains of why the uteroglobin Y box is
occupied in vivo only after hormonal stimulation.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
The receptor-binding sites function as PREs
in transient transfection experiments. Ishikawa cells were
transfected with CAT reporter plasmids and the expression plasmid
pKSV10-rPR for the rabbit progesterone receptor (21) using the calcium
phosphate DNA co-precipitation method. The indicated fragments of the
uteroglobin gene enhancer region were inserted upstream of its
truncated promoter ( 258 to +14). A RSV-lacZ reporter was
co-transfected for normalization of the data. Cells were treated with
10 nM R5020 (black bars) or with the ethanol
solvent (shadowed bars). The numbers indicate the
normalized CAT activity and are the result of a representative
experiment performed several times.
|
|
The Regular Nucleosomal Organization of the Upstream Enhancer
Region Changes upon Hormone Induction--
One explanation for the
lack of binding of the ubiquitous transcription factor NF-Y to the
uteroglobin Y box in the uninduced endometrial epithelium could be the
organization of the DNA in chromatin. In this scenario, hormonal
induction would remodel the chromatin structure and unmask a previously
unaccessible site (42). To test this hypothesis we examined the
chromatin organization of the uteroglobin gene enhancer region in
nuclei from different tissues, by digestion with MPE, a reagent that
preferentially cleaves nucleosomally organized DNA in the
internucleosomal linker (43). In liver (data not shown) and in the
non-induced endometrial epithelium we observed a pattern of regularly
spaced preferential cleavage sites with a characteristic repeat length
of 180 to 200 bp (Fig. 6A, lanes
2 and 3), indicating that the uteroglobin enhancer is
covered by regularly spaced nucleosomes. The amount of of DNA applied
to each lane and the extent of digestion were the same for uninduced
and induced endometrium, as judged by ethidium bromide staining (data
not shown). Since the signal corresponding to the uteroglobin enhancer
is weaker after induction (Fig. 6A, compare lanes
1-3 and 5-7), we assume that this chromatin region
becomes more sensitive to MPE cleavage upon induction. The samples of hormone-induced endometrial cells display a classical nucleosomal ladder in ethidium bromide-stained gels (Fig. 6B), but this
pattern is not detectable after hybridization with a probe specific for the uteroglobin enhancer region (Fig. 6A, lanes 6 and
7), confirming that the chromatin organization of the
enhancer region is altered after induction.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 6.
Analysis of the nucleosomal organization in
the uteroglobin upstream region by MPE-FeII cleavage.
Nuclei of endometrial epithelium from uninduced (End unind.)
or hCG-induced (End. (hCG))animals were treated with
MPE-FeII for increasing times. A, the spacing of
nucleosomes over the uteroglobin upstream enhancer region was analyzed
by electrophoresis of the MPE-FeII cleavage products from 6 µg of genomic DNA through a 1.2% native agarose gel, followed by
blotting onto Nylon membrane and hybridizing with a probe which spans
the enhancer region ( 2606 to 2288). Lanes 1-3
correspond to uninduced; lanes 4-7, to induced endometrial
epithelium. The arrowheads on the left margin
point to the cleavage maxima, and the numbers indicate the
size of the fragments in base pairs. As size markers we used genomic
DNA restricted with NdeI (C) or with
PstI (M), and a radioactively labeled 100-bp
ladder (M100). Numbers indicate the size of the
fragments in base pairs. B, the degree of cleavage and the
loading of the lanes was estimated by ethidium bromide staining of an
aliquot of the MPE-FeII cleavage products after separation
by electrophoresis on a 1.2% native agarose gel. Lanes 1-4
correspond to lanes 4-7 of A. The position of
the mono-, di,- tri-, and tetranucleosome bands are indicated on the
right margin (1N, 2N, 3N, and 4N,
respectively).
|
|
We tested the uteroglobin gene enhancer region for the presence of
translationally positioned nucleosomes by indirect end-labeling analysis of the MPE-digested samples (36, 37). In the uninduced endometrial epithelium we found a diffuse but regular pattern of
cleavage sites over the uteroglobin enhancer indicative of preferentially positioned nucleosomes (Fig.
7A, left panel, lanes 1-3).
The unsharp nucleosomal pattern could reflect a certain heterogeneity
of chromatin structure, with nucleosomes positioned only in a
subpopulation of cells. A densitometric scan of the autoradiogram
confirmed the periodical spacing of the cleaved fragments with an
internucleosomal repeat length of about 200 bp (Fig. 7A, right
panel, scan of lane 3). Upon hormone induction the MPE
cleavage pattern over the upstream enhancer changed dramatically in the
endometrial epithelium, where a new less regular distribution of
cleavage sites appeared, including several hypersensitive sites (Fig.
7A, lanes 4-7). Mapping the regions of MPE cleavage by
PhosphorImager analysis showed three types of changes. First, the
cleavage sites found prior to induction became broader and more
diffuse. Second, new hypersensitive cleavage sites appeared over the
enhancer region between 2580 and 2180. Third, two additional
clusters of MPE-hypersensitive regions appeared after induction: one
made of a doublet of strong sites at 3.7 kb and a second one at 5.1
kb. These findings are compatible with a hormone-dependent
long range rearrangement of the chromatin organization over the
uteroglobin gene upstream region.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Mapping of MPE-FeII and DNase
I-hypersensitive sites in the uteroglobin gene upstream region by
indirect end-labeling analysis. A, autoradiograph of
methidiumpropyl-EDTA-FeII cleavage in nuclei of endometrial
epithelium under different hormonal conditions (left panel)
and the densitometric scans corresponding to lanes 2, 3, 6,
and 5 (right panel). Genomic DNA was restricted
with NdeI and equal amounts (6 µg) were analyzed by
indirect end labeling. Lanes 1-3, uninduced endometrium;
lanes 4-7, induced endometrium. Lane 8 (C) correponds to a control reaction in which nuclei were
treated as in lane 7 but omitting MPE. Lane 9 (S) corresponds to genomic DNA isolated from untreated
rabbit cells and restricted with NdeI and PstI to
serve as internal size marker and control for specific hybridization.
Lane 10 (M), 100 bp size markers. The black
arrows on the right margin point to the positions of
the main cleavage maxima in uninduced endometrium, and the gray
arrows to the maxima in induced endometrium. On the left
margin is shown a schematic interpretation of the results based on
the internucleosomal cleavage pattern of uninduced endometrium.
B, comparison of methidiumpropyl-EDTA-FeII
(lanes 1-4) and DNase I cleavage (lane 6) in
nuclei of endometrial epithelium from a pseudopregnant animal. The
DNase I cleavage pattern obtained with liver nuclei is shown in
lane 5. The position of the hypersensitive regions is
indicated on the left margin; the numbers refer
to the distance from the transcription start site in kb. The marker
lanes C and M are as described in the legend to
Fig. 6A. The position of the fragments obtained with the
restriction enzymes are indicated on the right margin.
|
|
In addition to the MPE cleavage experiments we carried out DNase I
digestion of nuclei from the different tissues of hormone-induced animals, and compared the chemical and enzymatic cleavage patterns. In
agreement with previous results (17), we observed several DNase
I-hypersensitive sites which were specific for the hormonally induced
endometrial epithelium (Fig. 7B, compare lanes 6 and 5). In particular, we observed three tissue-specific
DNase I-hypersensitive regions located around 2.5, 3.7, and 5.1
kb. The first two cover a broad zone and comprise distinct cleavage
sites. Interestingly, the DNase I-hypersensitive zones map to similar
positions as the MPE-hypersensitive sites (Fig. 7B, compare
lanes 3 and 4 to lane 6). These
results show that hormone induction in the endometrial epithelium is
followed by a broad change in the regular nucleosomal organization of
DNA in the 5'-flanking region of the uteroglobin gene leading to better
accessibility of the double helix to chemical cleavage reagents and nucleases.
 |
DISCUSSION |
The Experimental in Situ Approach--
To understand
transcriptional regulation of the uteroglobin gene we have applied
in vivo DNase I and dimethyl sulfate footprinting to living
cells within the intact rabbit uterus. Earlier approaches using
in vitro DNA binding assays and transient transfection of immortalized cells have been largely unsuccessful, because cell lines
established from uteroglobin-positive epithelia loose significant expression of the uteroglobin gene in culture (Ref. 44 and references therein). In the few available cell lines that maintain expression of
the gene (30, 45), the levels of uteroglobin mRNA are very low and
significant hormonal induction cannot be reproduced even when
expression vectors for the corresponding hormone receptors were stably
transfected.2 This lack of transcriptional competence in
cell lines leaves primary cells or native tissue in situ as
the only options to study the regulation of uteroglobin gene expression
in vivo. Preliminary experiments showed that epithelial
cells from the endometrium of hormonally induced rabbits expressed
uteroglobin and uteroglobin mRNA at high levels (Refs.
46-48).2 Thus, these cells provide an appropriate
experimental system to study the protein-DNA interactions taking place
in the potentially relevant regions of the uteroglobin gene. In this
study we have focused on the induction of the uteroglobin gene by
progestins, mediated by the upstream enhancer region encompassing two
clusters of receptor-binding sites (17).
Hormone-dependent Occupancy of a Y Box in the
Uteroglobin Gene Enhancer--
The results summarized here demonstrate
that a DNA fragment between 2.7 and 2.3 kb upstream of the start of
transcription of the uteroglobin gene, which encompasses two clusters
of binding sites for glucocorticoid and progesterone receptors (16,
17), can function as a progesterone-responsive enhancer in transient transfections. Moreover, deletion analysis identified a short core
enhancer located between the two clusters of PREs, which is able to
activate heterologous promoters in various cell lines independently of
the tissue origin and of hormone treatment. Thus, the corresponding
trans-acting factors must be widely expressed and operate
independently of progesterone receptor. Sequence analysis revealed a
reverse Y box with the consensus CCAAT (26), between 2499 and 2495
within the core enhancer region. A single base mutation of this site,
which eliminates binding of NF-Y in vitro, also abolished
the enhancer activity, suggesting that NF-Y, or a related factor,
participates in uteroglobin enhancer function.
DNase I genomic footprinting over the uteroglobin upstream enhancer in
the hormonally stimulated animals reveals three protected regions, one
of them covering the putative Y box. The identity of the factor
protecting the Y box was further explored in dimethyl sulfate
footprinting experiments with intact endometrial cells. We found a
pattern of protected and hypermethylated guanine residues corresponding
to that previously reported for binding of NF-Y (49) and
indistinguishable from the pattern observed in in vitro dimethyl sulfate footprinting experiments with the NF-Y protein complex
present in nuclear extracts. The strong DNase I-hypersensitive sites
flanking the Y box in genomic footprinting experiments with induced
endometrium could reflect the known deformation of the DNA helix
accompanying NF-Y binding (49). The binding of NF-Y in vivo
strictly followed hormone induction, despite the constitutive expression of NF-Y in various tissues and under different hormonal conditions. Although we have not formally excluded that hormone treatments selectively increase the NF-Y levels in endometrial cells,
our gel shift experiments with nuclear extracts from different tissues
support ubiquitous and constitutive expression of NF-Y.2
These results seem to contradict results from transient gene
transfection experiments in which the NF-Y-binding site of the uteroglobin enhancer mediates constitutive transactivation independent of the hormone receptor-binding sites. This indicates that NF-Y binds
efficiently to the Y box in the transiently transfected uteroglobin
enhancer sequences, whereas it does not access this site in the
endogenous uteroglobin gene. A similar behavior has been described for
binding of NF1 to the MMTV promoter. Whereas NF1 is unable to bind to
the nucleosomally organized MMTV promoter (50-53), the NF1-binding
site of transiently transfected MMTV promoters was found to be
constitutively occupied by NF1, probably reflecting the poor chromatin
organization of transfected DNA (54). These observations suggest that
while transient transfection experiments are adequate for identifying
potential cis-regulatory elements, their usefulness in the
functional characterization of such elements is questionable. Moreover,
our findings underline the significance of analyzing endogenous genes
in their natural chromatin context.
Recruitment of NF-Y Is Accompanied by Remodeling of Nucleosomal
Organization of the Enhancer Region--
The structural organization
of the enhancer sequences in chromatin may explain the inability of
NF-Y to bind to the uteroglobin enhancer in uninduced endometrial
cells. We have previously detected the appearance of DNase
I-hypersensitive sites over the uteroglobin enhancer region in the
endometrium of progesterone-treated rabbits, which indicates a change
in chromatin structure accompanying hormone induction (17). A detailed
analysis of the MPE cleavage pattern over the enhancer region prior to
hormone induction reveals a regular nucleosomal organization with a
significant population of genes exhibiting at least five preferentially
positioned nucleosomes. Within the range of resolution of our analysis
(±20 bp), the results locate the core enhancer sequence, and in
particular the Y box, in the linker DNA flanked by two nucleosomes,
each containing one of the two PRE clusters. Following hormonal
stimulation the regular nucleosomal organization is no longer
recognizable over the whole region of the enhancer and several clusters
of MPE and DNase I-hypersensitive sites appear. One of these
nuclease-sensitive clusters covers the core enhancer region and the
PREs. Here, in addition to a higher nuclease sensitivity and broadening
of the cleavage over the linker DNA, we observe cleavage by MPE over the central region of the two positioned nucleosomes, suggesting a
remodeling of their structure. These findings are compatible with the
notion that progesterone receptor binding initiates a process of
chromatin remodeling which makes the uteroglobin enhancer more
accessible for nucleases as well as for transcription factor, and could
explain the hormone dependent recruitment of NF-Y. The tissue
specificity could in part result from the high concentration of
progesterone receptor in epithelial cells of the endometrium.
Further upstream in the uteroglobin 5'-flanking region, two additional
regions of nuclease hypersensitivity are detected, at 3.7 and 5.1
kb, whose functional significance is unknown. The region at 3.7
coincides with a DNase I-hypersensitive region found in the endometrium
of rabbits treated with estrogen and progesterone, and contains a
putative PRE, able to bind glucocorticoid and progesterone receptor
in vitro (17). This region could, therefore, contribute to
the hormonal induction of the gene. The sequence of the 5.1-kb
nuclease-hypersensitive region is unknown and its function has not been
investigated. It is possible that, as in the rat tyrosine
aminotransferase gene (55), several widely spaced enhancer elements
exist in the uteroglobin gene. As the gene is differentially regulated
in various tissues (3, 4), the different enhancers could selectively
participate in the physiological regulation of the uteroglobin gene in
different epithelial cells.
The situation in the uteroglobin enhancer is reminiscent of that found
in the MMTV promoter, but there are significant differences. In the
MMTV promoter, as in the uteroglobin enhancer, hormone receptor-dependent chromatin remodeling is required for
binding of a ubiquitous transcription factor, namely NF1 (22, 42). It
is known that steroid hormone receptors can bind to positioned nucleosomes provided the rotational orientation of the major groove over the hormone-responsive elements is appropriate (50, 56). Although
the orientation of the receptor-binding sites in the uteroglobin
enhancer is not known, we assume that at least part of the sites are
properly oriented and accessible, as this is a prerequisite for
receptor binding and initiation of the hormone-dependent chromatin remodeling. There is biochemical and genetic evidence suggesting that receptor binding to the MMTV promoter does not lead to
removal or disruption of the positioned nucleosome but rather to a more
subtle and localized remodeling of a single nucleosome that enables NF1
to bind (22, 57). In contrast, the changes induced by hormonal
stimulation within the uteroglobin gene enhancer are more extensive,
affecting at least five nucleosomes and leading to the loss of regular
nucleosomal spacing over the enhancer region. These changes may result
from the presence of two clusters of receptor-binding sites and may be
required for binding of NF-Y and other factors to the linker DNA. NF-Y
appears to be unable to bind at the linker between two positioned
nucleosomes within a regular nucleosomal array, likely because it binds
as an heterotrimer that bends DNA rather dramatically upon binding
(49). Therefore, changes in the higher order structure of chromatin,
determined by changes in the linker histones or in the interactions
between nucleosomes, may be required for facilitating access to the
NF-Y-binding site (58). Similar changes affecting a large nucleosomal
region are induced by binding of an heterodimer of thyroid hormone
receptor and retinoic acid X receptor to the Xenopus TR A
gene (59).
How steroid hormones contribute to nucleosome remodeling is not known,
but several possibilities can be envisaged. Remodeling could be
mediated by co-activators, such as CBP/p300, which are known to
interact with nuclear receptors (60, 61) and have been shown to exhibit
histone acetylating activity (62, 63). CBP could be recruited directly
by the nuclear receptors or via other co-activators, such as SRC-1/ACTR
(64, 65), which interact on the one side with hormone receptors and on
the other with CBP (66) and are themselves histone acetyltransferases
(65, 67). CBP/p300 itself can recruit an additional histone
acetyltransferase, P/CAF (68), and, thus, contribute to further
acetylation of core histones or other transcription factors (69). In
that respect, it is interesting to note that the MMTV and the HIV-1
promoters can be activated by a moderate increase in histone
acetylation, which also leads to remodeling of the positioned
nucleosome (70, 71). There are also indications for a participation in
hormonal induction of the ATP-dependent SWI·SNF complex
(72, 73), which has the capacity to remodel nucleosomes (74). A direct
interaction between the hormone receptors and members of the SWI·SNF
complex has been reported (72, 75, 76), suggesting that binding of the
receptors to chromatin could target the SWI·SNF complex to hormone
responsive promoters and initiate the remodeling process.
The biochemical nature of the hormone-induced chromatin remodeling is
not known, but in vitro data suggest that a dissociation of
H2A/H2B dimers from the remodeled nucleosome could facilitate transcription factor access to nucleosomal sequences (77). Since NF-YB and NF-YC are homologous to histone H2B
and H2A, respectively (78, 79), and form a heterodimer in the
heterotrimeric NF-Y (80), it is possible that these two subunits of
NF-Y replace one histone H2A/H2B dimer and generate a chromatin
structure that enables the NF-Y heterotrimer to interact with the Y box
(81). Thus, NF-Y could assume the role of an architectural factor, as reported for HNF3 in organizing the chromatin structure of the rat
albumin enhancer element in the liver (82).
As for the interaction between the enhancer and the promoter region of
the uteroglobin gene, it has been shown that a fraction of
NF-YB and NF-YC interact with TBP (83), and
therefore could provide a link to the general transcriptional machinery
on the promoter. Another interesting possibility is suggested by the recent finding that activated progesterone receptor interacts with Sp1,
directly or indirectly via CBP (84). We have previously shown that
estrogen induction of the uteroglobin gene depends on a functional
interaction between estrogen receptor and Sp1 bound to adjacent sites
in the promoter region (14), and a ligand-dependent interaction of the estrogen receptor with CBP has been reported. One
could envision a bridging role of Sp1 and the coregulator CBP (85)
between DNA bound progesterone and estrogen receptors which will
establish a chromatin loop between the enhancer region and the promoter
(86). This model will be consistent with the observation that both the
enhancer and the promoter regions become hypersensitive to DNase I
during physiological induction of the uteroglobin gene in rabbit
endometrium (17).
 |
ACKNOWLEDGEMENTS |
We are grateful to J. Neulen for
suggestions in the preparation of endometrial primary cells. We thank
R. Mantovani (University of Milan, Milan, Italy) for the generous gift
of an antibody against NF-YB and helpful discussion, and
Jörg Klug (IMT, Marburg, Germany) for help in preparing the manuscript.
 |
FOOTNOTES |
*
This work was supported by the Deutsche
Forschungsgemeinschaft and Fonds der Chemischen Industrie.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: University of California, San Diego, Dept. of
Medicine, 9500 Gilman Dr., La Jolla, CA 92093-0648.
§
To whom correspondence should be addressed. Tel.: 49-6421-28-62-86;
Fax: 49-6421-28-53-98; E-mail: beato{at}imt.uni-marburg.de.
The abbreviations used are:
bp, base pair(s); kb, kilobase pair(s); CBP, cAMP-binding protein; CAT, chloramphenicol
acetyltransferase; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; MPE, methidiumpropyl-EDTA-FeII; PRE, progesterone responsive
elements; MMTV, murine mammary tumor virus; hCG, human chorionic gonadotropin.
2
A. Scholz and M. Beato, unpublished data.
 |
REFERENCES |
-
Krishnan, R. S.,
and Daniel, J. C., Jr.
(1967)
Science
158,
490-492[Abstract/Free Full Text]
-
Beier, H. M.
(1968)
Biochim. Biophys. Acta
160,
289-291[Medline]
[Order article via Infotrieve]
-
Beato, M.,
Arnemann, J.,
Menne, C.,
Müller, H.,
Suske, G.,
and Wenz, M.
(1983)
in
Regulation of Gene Expression by Hormones (McKerns, K. W., ed), pp. 151-175, Plenum, New York
-
Miele, L.,
Cordella-Miele, E.,
Mantile, G.,
Peri, A.,
and Mukherjee, A. B.
(1994)
J. Endocrinol. Invest.
17,
679-692[Medline]
[Order article via Infotrieve]
-
Kay, E.,
and Feigelson, M.
(1972)
Biochim. Biophys. Acta
271,
436-441[Medline]
[Order article via Infotrieve]
-
Beier, H. M.,
Bohn, H.,
and Müller, W.
(1975)
Cell Tissue Res.
165,
1-11[Medline]
[Order article via Infotrieve]
-
Noske, I. G.,
and Feigelson, M.
(1976)
Biol. Reprod.
15,
704-713[Abstract]
-
Levin, S.,
Butler, J.,
Schumacher, U.,
Wightman, P.,
and Mukherjee, A.
(1986)
Life Sci.
38,
1813-1819[CrossRef][Medline]
[Order article via Infotrieve]
-
Kundu, G. C.,
Mantile, G.,
Miele, L.,
Cordella-Miele, E.,
and Mukherjee, A. B.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2915-2919[Abstract/Free Full Text]
-
Müller, H.,
and Beato, M.
(1980)
Eur. J. Biochem.
112,
235-241[Medline]
[Order article via Infotrieve]
-
Shen, X.-Z.,
Tsai, M.-J.,
Bullock, D. W.,
and Woo, S. L. C.
(1983)
Endocrinology
112,
871-876[Abstract/Free Full Text]
-
Savouret, J. F.,
Loosfelt, H.,
Atger, M.,
and Milgrom, E.
(1980)
J. Biol. Chem.
255,
4131-4136[Free Full Text]
-
Slater, E. P.,
Redeuilh, G.,
Theis, K.,
Suske, G.,
and Beato, M.
(1990)
Mol. Endocrinol.
4,
604-610[Abstract/Free Full Text]
-
Scholz, A.,
Truss, M.,
and Beato, M.
(1998)
J. Biol. Chem.
273,
4360-4366[Abstract/Free Full Text]
-
Bailly, A.,
Le, P.,
Rauch, M.,
and Milgrom, E.
(1986)
EMBO J.
5,
3235-3241[Medline]
[Order article via Infotrieve]
-
Cato, A. C. B.,
Geisse, S.,
Wenz, M.,
Westphal, H.,
and Beato, M.
(1984)
EMBO J.
3,
2771-2778[Medline]
[Order article via Infotrieve]
-
Jantzen, C.,
Fritton, H. P.,
Igo-Kemenes, T.,
Espel, E.,
Janich, S.,
Cato, A. C. B.,
Mugele, K.,
and Beato, M.
(1987)
Nucleic Acids Res.
15,
4535-4552[Abstract/Free Full Text]
-
Misseyanni, A.,
Klug, J.,
Suske, G.,
and Beato, M.
(1991)
Nucleic Acids Res.
11,
2849-2859
-
Nordeen, S. K.
(1988)
BioTechniques
6,
454-457[Medline]
[Order article via Infotrieve]
-
Menne, C.,
Suske, G.,
Arnemann, J.,
Cato, A. C. B.,
and Beato, M.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
4853-4857[Abstract/Free Full Text]
-
Loosfelt, H.,
Atger, M.,
Misrahi, M.,
Guiochon-Mantel, A.,
Meriel, C.,
Logeat, F.,
Benarous, R.,
and Milgrom, E.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
9045-9049[Abstract/Free Full Text]
-
Truss, M.,
Bartsch, J.,
Schelbert, A.,
Haché, R. J. G.,
and Beato, M.
(1995)
EMBO J.
14,
1737-1751[Medline]
[Order article via Infotrieve]
-
Pfeifer, G. P.,
Steigerwald, S. D.,
Mueller, P. R.,
Wold, B.,
and Riggs, A. D.
(1989)
Science
246,
810-813[Abstract/Free Full Text]
-
Andrews, N. C.,
and Faller, D. V.
(1991)
Nucleic Acids Res.
19,
2499[Free Full Text]
-
Dorn, A.,
Bollekens, J.,
Staub, A.,
Benoist, C.,
and Mathis, D.
(1987)
Cell
50,
863-872[CrossRef][Medline]
[Order article via Infotrieve]
-
Mantovani, R.,
Pessara, U.,
Tronche, F.,
Li, X.-Y.,
Knapp, A.-M.,
Pasquali, J.-L.,
Benoist, C.,
and Mathis, D.
(1992)
EMBO J.
11,
3315-3322[Medline]
[Order article via Infotrieve]
-
Hagen, G.,
Müller, S.,
Beato, M.,
and Suske, G.
(1994)
EMBO J.
13,
3843-3851[Medline]
[Order article via Infotrieve]
-
Schauer, M.,
Chalepakis, G.,
Willmann, T.,
and Beato, M.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
1123-1127[Abstract/Free Full Text]
-
Nishida, M.,
Kasahara, K.,
Kaneko, M.,
and Iwasaki, H.
(1985)
Acta Obstet. Gynaecol. Jpn
37,
1103-1111
-
Mukherjee, A. B.,
Murty, L. C.,
and Chou, J. Y.
(1993)
Mol. Cell. Endocrinol.
94,
R15-R22[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752[Abstract/Free Full Text]
-
Lippman, M.,
Bolan, G.,
and Huff, K.
(1976)
Cancer Res.
36,
4595-4601[Abstract/Free Full Text]
-
Bondy, K. L.,
and Zacharewski, T. R.
(1993)
Nucleic Acids Res.
21,
5277-5278[Free Full Text]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Beato, M.,
and Nieto, A.
(1976)
Eur. J. Biochem.
64,
15-21[Medline]
[Order article via Infotrieve]
-
Nedospasov, S. A.,
and Georgiev, G. P.
(1980)
Biochem. Biophys. Res. Commun.
92,
532-539[CrossRef][Medline]
[Order article via Infotrieve]
-
Wu, C.
(1980)
Nature
286,
854-860[CrossRef][Medline]
[Order article via Infotrieve]
-
Church, G. M.,
and Gilbert, W. C.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
1991-1995[Abstract/Free Full Text]
-
Mueller, P.,
and Wold, B.
(1989)
Science
246,
780-786[Abstract/Free Full Text]
-
Warembourg, M.,
Tranchant, O.,
Atger, M.,
and Milgrom, E.
(1986)
Endocrinology
119,
1632-1640[Abstract/Free Full Text]
-
Heins, B.,
and Beato, M.
(1981)
Mol. Cell. Endocrinol.
21,
139-150[CrossRef][Medline]
[Order article via Infotrieve]
-
Cordingley, M. G.,
Riegel, A. T.,
and Hager, G. L.
(1987)
Cell
48,
261-270[CrossRef][Medline]
[Order article via Infotrieve]
-
Cartwright, I. L.,
Hertzberg, R. P.,
Dervan, P. B.,
and Elgin, S. C. R.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
3213-3217[Abstract/Free Full Text]
-
Helftenbein, G.,
Misseyanni, A.,
Hagen, G.,
Peter, W.,
Slater, E. P.,
Wiehle, R. D.,
Suske, G.,
and Beato, M.
(1991)
Ann. N. Y. Acad. Sci.
622,
69-79[CrossRef][Medline]
[Order article via Infotrieve]
-
Helftenbein, G.,
Alvarez, C. V.,
Tuohimaa, P.,
and Beato, M.
(1993)
Oncogene
8,
2075-2085[Medline]
[Order article via Infotrieve]
-
Whitson, G. L.,
and Murray, F. A.
(1974)
Science
183,
668-670[Abstract/Free Full Text]
-
Neulen, J.,
Beato, M.,
and Beier, M.
(1982)
Mol. Cell. Endocrinol.
25,
183-191[CrossRef][Medline]
[Order article via Infotrieve]
-
Rajkumar, K.,
Bigsby, R.,
Lieberman, R.,
and Gerschenson, L. E.
(1983)
Endocrinology
112,
1490-1498[Abstract/Free Full Text]
-
Ronchi, A.,
Bellorini, M.,
Mongelli, N.,
and Mantovani, R.
(1995)
Nucleic Acids Res.
23,
4565-4572[Abstract/Free Full Text]
-
Piña, B.,
Brüggemeier, U.,
and Beato, M.
(1990)
Cell
60,
719-731[CrossRef][Medline]
[Order article via Infotrieve]
-
Archer, T. K.,
Cordingley, M. G.,
Wolford, R. G.,
and Hager, G. L.
(1991)
Mol. Cell. Biol.
11,
688-698[Abstract/Free Full Text]
-
Blomquist, P.,
Li, Q.,
and Wrange, Ö.
(1996)
J. Biol. Chem.
271,
153-159[Abstract/Free Full Text]
-
Eisfeld, K.,
Candau, R.,
Truss, M.,
and Beato, M.
(1997)
Nucleic Acids Res.
25,
3733-3742[Abstract/Free Full Text]
-
Archer, T. K.,
Lefebvre, P.,
Wolford, R. G.,
and Hager, G. L.
(1992)
Science
255,
1573-1576[Abstract/Free Full Text]
-
Blendy, J. A.,
Cole, T. J.,
Montoliu, L.,
Hummler, E.,
Ganss, R.,
Aguzzi, A.,
Schmid, W.,
and Schütz, G.
(1995)
in
Recent Progress in Hormone Research (Bardin, C. W., ed), Vol. 50, pp. 97-108, Academic Press
-
Perlmann, T.,
and Wrange, Ö.
(1988)
EMBO J.
7,
3073-3079[Medline]
[Order article via Infotrieve]
-
Chávez, S.,
and Beato, M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2885-2890[Abstract/Free Full Text]
-
Bresnick, E. H.,
Bustin, M.,
Marsaud, V.,
Richard-Foy, H.,
and Hager, G. L.
(1992)
Nucleic Acids Res.
20,
273-278[Abstract/Free Full Text]
-
Wong, J. M.,
Shi, Y. B.,
and Wolffe, A. P.
(1997)
EMBO J.
16,
3158-3171[CrossRef][Medline]
[Order article via Infotrieve]
-
Chakravarti, D.,
LaMorte, V. J.,
Nelson, M. C.,
Nakajima, T.,
Schulman, I. G.,
Juguilon, H.,
Montminy, M.,
and Evans, R. M.
(1996)
Nature
383,
99-103[CrossRef][Medline]
[Order article via Infotrieve]
-
Hanstein, B.,
Eckner, R.,
DiRenzo, J.,
Halachmi, S.,
Liu, H.,
Searcy, B.,
Kurokawa, R.,
and Brown, M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
11540-11545[Abstract/Free Full Text]
-
Ogryzko, V. V.,
Schiltz, R. L.,
Russanova, V.,
Howard, B. H.,
and Nakatani, Y.
(1996)
Cell
87,
953-959[CrossRef][Medline]
[Order article via Infotrieve]
-
Bannister, A. J.,
and Kouzarides, T.
(1996)
Nature
384,
641-643[CrossRef][Medline]
[Order article via Infotrieve]
-
Oñate, S. A.,
Tsai, S. Y.,
Tsai, M.-J.,
and O'Malley, B. W.
(1995)
Science
270,
1354-1357[Abstract/Free Full Text]
-
Chen, H.,
Lin, R. J.,
Schiltz, R. L.,
Chakravarti, D.,
Nash, A.,
Nagy, L.,
Privalsky, M. L.,
Nakatani, Y.,
and Evans, R. M.
(1997)
Cell
90,
569-580[CrossRef][Medline]
[Order article via Infotrieve]
-
Yao, T. P.,
Ku, G.,
Zhou, N. D.,
Scully, R.,
and Livingston, D. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10626-10631[Abstract/Free Full Text]
-
Spencer, T. E.,
Jenster, G.,
Burcin, M. M.,
Allis, C. D.,
Zhou, J.,
Mizzen, C. A.,
McKenna, N. J.,
Oñate, S. A.,
Tsai, S. Y.,
Tsai, M. J.,
and O'Malley, B. W.
(1997)
Nature
389,
194-198[CrossRef][Medline]
[Order article via Infotrieve]
-
Yang, X. J.,
Ogryzko, V. V.,
Nishikawa, J.,
Howard, B. H.,
and Nakatani, Y.
(1996)
Nature
382,
319-324[CrossRef][Medline]
[Order article via Infotrieve]
-
Gu, W.,
Shi, X. L.,
and Roeder, R. G.
(1997)
Nature
387,
819-823[CrossRef][Medline]
[Order article via Infotrieve]
-
Bartsch, J.,
Truss, M.,
Bode, J.,
and Beato, M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10741-10746[Abstract/Free Full Text]
-
Van Lint, C.,
Emiliani, S.,
Ott, M.,
and Verdin, E.
(1996)
EMBO J.
15,
1112-1120[Medline]
[Order article via Infotrieve]
-
Yoshinaga, S. K.,
Peterson, C. L.,
Herskowitz, I.,
and Yamamoto, K. R.
(1992)
Science
258,
1598-1604[Abstract/Free Full Text]
-
Muchardt, C.,
and Yaniv, M.
(1993)
EMBO J.
12,
4279-4290[Medline]
[Order article via Infotrieve]
-
Peterson, C. L.,
and Tamkun, J. W.
(1995)
Trends Biochem. Sci.
20,
143-146[CrossRef][Medline]
[Order article via Infotrieve]
-
Cairns, B. R.,
Levinson, R. S.,
Yamamoto, K. R.,
and Kornberg, R. D.
(1996)
Genes Dev.
10,
2131-2144[Abstract/Free Full Text]
-
Ichinose, H.,
Garnier, J. M.,
Chambon, P.,
and Losson, R.
(1997)
Gene (Amst.)
188,
95-100[CrossRef][Medline]
[Order article via Infotrieve]
-
Spangenberg, C.,
Eisfeld, K.,
Stünkel, W.,
Luger, K.,
Flaus, A.,
Richmonds, T. J.,
Truss, M.,
and Beato, M.
(1998)
J. Mol. Biol.
278,
725-739[CrossRef][Medline]
[Order article via Infotrieve]
-
Baxevanis, A. D.,
Arents, G.,
Moudrianakis, E. N.,
and Landsman, D.
(1995)
Nucleic Acids Res.
23,
2685-2691[Abstract/Free Full Text]
-
Sinha, S.,
Kim, I. S.,
Sohn, K. Y.,
de Crombrugghe, B.,
and Maity, S. N.
(1996)
Mol. Cell. Biol.
16,
328-337[Abstract]
-
Kim, I. S.,
Sinha, S.,
de Crombrugghe, B.,
and Maity, S. N.
(1996)
Mol. Cell. Biol.
16,
4003-4013[Abstract]
-
Sinha, S.,
Maity, S. N.,
Lu, J. F.,
and de Crombrugghe, B.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
1624-1628[Abstract/Free Full Text]
-
McPherson, C. E.,
Shim, E. Y.,
Friedman, D. S.,
and Zaret, K. S.
(1993)
Cell
75,
387-398[CrossRef][Medline]
[Order article via Infotrieve]
-
Bellorini, M.,
Lee, D. K.,
Dantonel, J. C.,
Zemzoumi, K.,
Roeder, R. G.,
Tora, L.,
and Mantovani, R.
(1997)
Nucleic Acids Res.
25,
2174-2181[Abstract/Free Full Text]
-
Owen, G. I.,
Richer, J. K.,
Tung, L.,
Takimoto, G.,
and Horwitz, K. B.
(1998)
J. Biol. Chem.
273,
10696-10701[Abstract/Free Full Text]
-
Kamei, Y.,
Xu, L.,
Heinzel, T.,
Torchia, J.,
Kurokawa, R.,
Gloss, B.,
Lin, S. C.,
Heyman, R. A.,
Rose, D. N.,
Glass, C. K.,
and Rosenfeld, M. G.
(1996)
Cell
85,
403-414[CrossRef][Medline]
[Order article via Infotrieve]
-
Seyfred, M.,
and Gorski, J.
(1990)
Mol. Endocrin.
4,
1226-1234[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Krikun and C. J. Lockwood
Steroid Hormones, Endometrial Gene Regulation and the Sp1 Family of Proteins
Reproductive Sciences,
November 1, 2002;
9(6):
329 - 334.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Misiti, S. Nanni, G. Fontemaggi, Y.-S. Cong, J. Wen, H. W. Hirte, G. Piaggio, A. Sacchi, A. Pontecorvi, S. Bacchetti, et al.
Induction of hTERT Expression and Telomerase Activity by Estrogens in Human Ovary Epithelium Cells
Mol. Cell. Biol.,
June 1, 2000;
20(11):
3764 - 3771.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Caretti, M. C. Motta, and R. Mantovani
NF-Y Associates with H3-H4 Tetramers and Octamers by Multiple Mechanisms
Mol. Cell. Biol.,
December 1, 1999;
19(12):
8591 - 8603.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|