![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 7, 4067-4073, February 12, 1999
,From the Laboratoire de Biologie Moléculaire et de Génie Génétique, Institut de Chimie, Batiment B6, Université de Liège, B-4000 Sart-Tilman, Belgium
| |
ABSTRACT |
|---|
|
|
|---|
Expression of the somatostatin gene in endocrine
pancreatic cells is controlled by several regulatory
cis-elements located in the promoter region. Among these,
the adjacent UE-A and TSEI elements, located from Somatostatins are peptides of 14 and 28 amino acid residues that
regulate the secretion of various hormones, including growth hormone,
thyrotropin, glucagon, and insulin (1). The gene encoding the
preprosomatostatin is strongly expressed in the Previous studies have shown that transcription of the somatostatin gene
is controlled by several cis-elements present in its 5'
flanking sequence (see Fig. 1). A crucial activating sequence is the
CRE element located between Full expression of the somatostatin gene in pancreatic cells results
from the synergistic actions of the different cis-elements present in the promoter. Indeed, previous reports have shown that the
activity of the TSEI element is dependent of the
immediately adjacent sequence UE-A (located from In the present study, we have identified the factors binding the UE-A
element. This sequence recognizes a heterodimeric complex containing a
Pbx factor and the Prep1/pKnox protein (36, 40) (referred to here as
Prep1). Although these two factors cannot bind separately the UE-A
element, they bind strongly when added together. Furthermore,
transfection experiments show that full activation of the intact
somatostatin promoter is only obtained when the three transcription
factors PDX1, Pbx1, and Prep1 are coexpressed. Thus, we have been able
to reconstitute the strong pancreatic-specific enhancer complex of the
somatostatin gene by using the two ubiquitous factors Pbx1 and Prep1
and the pancreatic homeodomain factor PDX1.
Electrophoretic Mobility Shift Assay (EMSA)--
EMSAs were
carried out exactly as described previously (26). Briefly, 2 µg of
nuclear extract prepared as described by Shreiber et al.
(27) or 1 µl of in vitro translated protein was incubated with 0.1 ng of a double-stranded oligonucleotide
(32P-labeled using Klenow polymerase) in presence of 1 µg
of poly(dI-dC). In supershift experiments, the nuclear cell extracts
were preincubated with 1 µl of antiserum for 15 min at room
temperature before adding the probe. In competition experiments, the
cold oligonucleotides were mixed with the probe before addition of the
nuclear extract. Competitions with the Hoxa5 peptide (QPQIYPWMRKLH)
were carried out by preincubating the peptide with the protein extract
for 15 min and subsequent addition to the DNA probe. The sequences of
the oligonucleotides (Eurogentec, Liège, Belgium) are
GATCTTCTTTGATTGATTTTGC for the UE-A element,
GATCTTCTTTCCTTCCTTTTGC for UE-Amut,
GATCTCAGTAATTAATCATGCAGATC for TSEII.
Plamid Construction and Expression of Proteins--
The
cDNAs coding for Meis1 (28) (generous gift of Dr. Neal Copeland)
and Pbx1a tagged with the Flag epitope (29) (generous gift of Dr. C. Murre) were inserted in the pcDNA3 eukaryotic expression vector.
The Prep1 cDNA was amplified by PCR from human placental cDNA
using the primers GGCTCGAGATGATGGCTACACAGACAT and
GCGTCTAGACCTGCCCCTACTGCAGGG, and cloned in the pCS2 expression vector
that contains the bacteriophage SP6 and eukaryotic CMV promoters. The
Pbx1a, Flag-Pbx1a, Meis1, and Prep1 proteins were produced in
vitro using the Promega TNT transcription-translation system,
according to the protocol of the manufacturer. PDX1 protein was
expressed in Escherichia coli using the pGEX3X
vector as described previously (26).
The reporter plasmids UE-A-Luc and UE-Amut-Luc each contain one copy of
the wild type and mutated UE-A element (see above for the sequences),
respectively, inserted in the BamHI site of the GH32Luc
plasmid. This GH32Luc vector contains the minimal growth hormone
promoter (from Cell Transfection--
Transient transfection experiments were
performed in the colon carcinoma cells HCT116 using the calcium
phosphate coprecipitation method. HCT116 were grown in Dulbecco's
modified Eagle's medium supplemented with 10% of fetal calf serum in
4 cm dishes. DNA precipitates, containing with 10 µg for reporter
plasmid, 1 µg of expression vector, and 1 µg of Rous sarcoma
virus- The UE-A Element Is Recognized by a Cellular Complex Containing
Members of the Pbx Factor Family--
Comparison of the nucleotide
sequence of all known somatostatin promoters shows that the UE-A
element is well conserved (see Fig. 1).
The core of the UE-A element, previously identified by linker scanning
mutagenesis (4), contains a TGATTGATT motif corresponding exactly to
the consensus binding site of the Pbx1 homeodomain (30-32). This
prompted us to investigate whether the cellular factor binding the UE-A
element is Pbx1 or a member of the Pbx protein family. EMSAs were
performed on the UE-A probe using nuclear extract from the
somatostatin-producing TU6 cell line. Two closely migrating complexes
(Fig. 2, S and L)
were observed. Both complexes were easily displaced by adding a
100-fold molar excess of unlabeled UE-A element but were not affected
by addition of a UE-A element mutated in the Pbx consensus motif (Fig.
2, lanes 2-6). Preincubation of the nuclear extract with a
polyclonal anti-Pbx antiserum (recognizing all Pbx members) produced a
supershifted band and affected the formation of these two complexes,
whereas an anti-PDX1 antiserum or the preimmune serum had no effect
(Fig. 2, lanes 7-9). To confirm the presence of Pbx factors
in these two complexes, we also used another antibody reacting
specifically with the long Pbx isoforms (Pbx1a, Pbx2, and Pbx3a) but
not with the short isoforms, Pbx1b and Pbx3b, resulting from
differential splicing of the 3'-end of the Pbx RNA (11). This antibody
blocked the formation of the slower migrating complex L only (see Fig. 2, lane 16). When the mutated UE-A element was used as
probe, no complexes could be observed (Fig. 2, lanes
10-14). These results indicate that the cellular complexes
binding specifically the UE-A sequence contain Pbx factors. The
slower-migrating complex L contains the long Pbx isoforms, whereas the
S complex is probably due to the short Pbx isoforms. Furthermore, as
the anti-PDX1 antiserum had no effect, we conclude that these complexes
are completely different from the PDX1-Pbx heterodimeric complex
observed on the somatostatin TSEII element (10).
To investigate the cell type distribution of complexes S and L, nuclear
extracts were prepared from different pancreatic and nonpancreatic cell
lines and tested by EMSA (Fig. 3,
lanes 1-11) Complex L was detected with extracts of all
tested cell lines, and complex S was less abundant in some cell lines,
such as COS, Jurkat, or HT29. The presence of Pbx proteins in these
complexes was confirmed in all extracts by supershift with the Pbx
antibodies (data not shown). These results are consistent with previous
reports showing the expression of Pbx factors in all cell lines tested so far (11).
We next investigated whether a recombinant Pbx protein could bind the
UE-A element. Pbx1a protein was produced in vitro using wheat germ extract and tested in EMSA. No protein-DNA complexes could
be reconstituted on the UE-A element with Pbx1a (see Fig. 3, lane
12), whereas a heterodimeric complex with PDX1 was formed on the
TSEII element (Fig. 3, lane 16). Identical
results were obtained using recombinant Pbx1a produced in E. coli (data not shown), suggesting that binding of Pbx
factors to UE-A requires a co-factor present in cell extracts. As Hox
factors are known to bind cooperatively with Pbx proteins on some
target elements, various Hox proteins were produced in vitro
and tested in the presence of Pbx1 by EMSA; however, no heterodimeric
complexes could be generated on UE-A (data not shown). Formation of
Hox-Pbx complexes requires the pentapeptide motif YPWMK present in
many homeodomain proteins, and previous experiments have shown that Hox-Pbx complexes can be disrupted by adding high concentrations of
synthetic peptide containing this conserved motif (29, 33). Thus, in
order to test whether the complexes S and L are Hox-Pbx type complexes,
we incubated increasing amount of this synthetic peptide with TU6 cell
extract and then performed EMSA. Fig. 4 shows that the two complexes L and S are not substantially affected by
the pentapeptide motif in contrast to the complete destabilization of
the PDX1-Pbx complex on the TSEII element.
As the Pbx1a protein produced in vitro or in bacteria is not
able to bind UE-A, we decided to test whether it could reconstitute a
protein-DNA complex when expressed in eukaryotic cells. Thus, COS cells
were transfected by the expression vector pFlag-Pbx1 containing the
coding sequence for Pbx1a protein tagged at its N terminus with the
FLAG epitope (29). Nuclear extract from transfected cells were tested
by EMSA on the UE-A probe (Fig. 5). As
expected, the complexes S and L were observed with extract of
transfected cells; addition of an anti-FLAG monoclonal antibody produced a supershifted band only in extracts of COS cells transfected with the pFlag-Pbx1 expression vector. No supershift was observed when
the control expression vector pcDNA3 was used. These results prove
that Pbx1a protein can bind the UE-A sequence, but only when it is
expressed in eukaryotic cells. This suggests that binding of Pbx1 to
UE-A requires either a posttranslational modification of Pbx1 or a
cellular co-factor present in cell extracts.
The Prep-1 Factor Binds Cooperatively with Pbx1a to the UE-A
Element--
Recently, Pbx factors have been found to associated with
a specific subclass of three-amino acid loop extension homeodomain proteins that lack the YPWMK motif: the Meis/Prep1 protein family. Indeed, Meis1 and the related factor Prep-1 (also named pKnox1) stably
interact in solution with the Pbx proteins (34-37). This observation
prompted us to investigate whether one of these two factors could bind
the UE-A element together with Pbx1. Meis1 and Prep-1 proteins were
translated in vitro using reticulocyte lysate and tested by
EMSA in the presence or absence of Pbx1a. Fig.
6 shows that a very strong cooperative
binding occurs using Pbx1a and Prep-1 (lane 6), whereas
formation of a Pbx1-Meis1 complex was also detectable, but much less
efficient (lane 5). This difference was not due to a lower
amount of Meis1 protein as comparable amount of 35S-labeled
Meis1 and Prep-1 proteins were detected on SDS-polyacrylamide gel
electrophoresis (data not shown).
To determine whether Prep-1 is the co-factor in the cell extracts
binding with Pbx factors to the somatostatin UE-A element, we used two
antisera raised specifically against Prep1 (Fig.
7). Addition of these two antisera to Tu6
or HeLa cell extracts completely abolished the formation of the two
complexes S and L, whereas the preimmune or the PDX1 antiserum had no
effect (Fig. 7, lanes 2-13). Furthermore, the cellular
complex L, which was specifically blocked by the long isoform Pbx
antibody (Fig. 7, lanes 3 and 9), co-migrated
with the heteromeric complex obtained with the recombinant Prep-1 and
Pbx1a proteins (lane 14). In contrast, an anti-Meis1
antibody did not affect the complexes S and L (data not shown). As the
Prep1 antibodies do not cross-react with the recombinant Meis1 protein
(data not shown), these results clearly indicate that Prep1 is the
major cellular factor binding UE-A in combination with Pbx
proteins.
Synergistic Activation of the UE-A Element by Pbx and Prep1
Factors--
By transient transfection experiments, we next
investigated whether Pbx and Prep1 factors could stimulate the
transcriptional activity of the UE-A element. To that end, we generated
reporter plasmid in which the UE-A element was inserted in a single
copy directly upstream from a TATA box followed by the luciferase gene. Fig. 8 shows that the activity of the
UE-A element was not affected by co-transfection of Pbx1a or Prep1
expression vectors when tested separately. In contrast, when both
expression vectors were combined, a strong synergistic stimulation was
observed. This activation is mediated through the binding of Pbx-Prep1
heteromeric complex to the UE-A element, as the mutation in the
TGATTGATT motif of UE-A preventing the binding of these factors
completely blocked this synergistic stimulation. Thus, the Pbx-Prep1
complex displays a strong transcriptional activation potential on an
isolated UE-A element.
PDX1, Pbx, and Prep1 Factors Synergistically Activate the
Mini-enhancer and the Intact Promoter of the Somatostatin
Gene--
Previous reports have shown that the sequence
Similarly, when the intact somatostatin promoter was tested as a
reporter (Fig. 9, plasmid pSRIF-Luc), co-transfection of both Pbx1a and
Prep1 again had no significant effect, similar to the mini-enhancer.
Also, the modest activation generated by expression of PDX1 was
strongly increased by additional expression of both Pbx1a and Prep1.
The UE-A element is a well conserved regulatory element of the
somatostatin gene and is required for the optimal function of the
promoter in pancreatic cells. Whereas the UE-A site is part of a
pancreas-specific mini-enhancer, it has no intrinsic transactivating
capacity (data not shown and Ref. 4). This element acts by potentiating
the transcriptional activation of the nearby TSEI element.
In the present study, we demonstrated that the UE-A site is recognized
by heterodimers composed of a Pbx family member and the Prep1 protein.
The two protein-DNA complexes L and S formed on UE-A with the cell
extracts correspond to Pbx-Prep1 heterodimers containing, respectively,
the long and short isoforms of Pbx proteins. This is demonstrated by
the supershift obtained using the specific Pbx and Prep1 antibodies and
the comigration of the L complex with the in vitro
translated Pbx1a and Prep1 proteins. In transient transfection
experiments, we observed that the somatostatin enhancer was strongly
stimulated by the co-expression of the three factors, PDX1, Prep1, and
Pbx1a. Similar stimulations were obtained by replacing the Pbx1a
expression vector by a Pbx1b or Pbx2 expression plasmid (data not
shown). Taken together, these results indicate that somatostatin gene
expression is under the control of Pbx-Prep1 heterodimers.
In addition to the somatostatin gene, the only known target of the
Prep1 factor is the urokinase plasminogen activator gene (36). Similar
to the somatostatin UE-A element, Prep1 binds the COM element of the
urokinase plasminogen activator enhancer as a heterodimer with Pbx
factors, and the COM element is not able to activate transcription on
its own. In fact, COM seems to act by increasing the transcriptional
activation produced by the transcription factors bound to neighboring
sites (i.e. Jun, ATF, and Ets factors) (38). In the present
study, we also observed that the Pbx-Prep1 heterodimer, bound on the
UE-A element, strongly synergizes with the PDX1 factor bound to the
nearby TSEI site, producing a full activation of the
somatostatin mini-enhancer. EMSA failed to show that this synergism is
due to a cooperative binding of Pbx-Prep1 heterodimer and PDX1 to the
bipartite UE-A/TSEI element (data not shown). However, we
cannot completely rule out the possibility that DNA binding
cooperativity might occur within the cell, perhaps requiring the
presence of an unknown cellular factor or eventually requiring the
natural context of chromatin.
In this study, we show for the first time that the UE-A element can
generate a transcriptional activation, but only when Pbx and Prep1 are
overexpressed and if the UE-A sequence is inserted immediately upstream
the TATA box. Increasing the distance between the UE-A site and the
TATA box strongly reduces (see Fig. 9, UE-A/TSEI reporter
plasmid) or completely abolishes the activation (see Fig. 9, pSRIF-Luc
reporter). These observations suggest that the Pbx-Prep1 heterodimers
possesses an activation capacity that is highly dependent on spatial
organization. We can also postulate that in the context of the
somatostatin promoter, one function of PDX1 is to promote functional
interactions between the basal machinery and the Pbx-Prep1 heterodimer.
However, further experiments are required to determine the mechanism of
the transactivation mediated by the Pbx-Prep1 heterodimers.
The protein Prep1 shares sequence similarity with the Meis proteins
(Meis1, Meis2, Meis3, mrg1, and mrg2) not only in the homeodomain, but
also in the two N-terminal domains involved in dimerization with Pbx
factors (36, 39-41). Despite this sequence similarity, the Pbx1-Meis1
heterodimer binds much less efficiently to UE-A than the Pbx1-Prep1
heterodimer. Furthermore, we were unable to detect binding of Pbx-Meis
heterodimers on UE-A using cell extracts, and all protein complexes
observed were Pbx-Prep1 heterodimers. This indicates that Pbx-Prep1 and
Pbx-Meis1 heterodimers could have different DNA binding specificity and
could regulate distinct target genes. Actually, it has been shown that
the Pbx1-Meis complex preferentially recognizes the TGATTGACAG motif
(34). We are currently investigating in more detail this DNA binding specificity.
The mechanism of action of the Pbx factors has been remarkably
maintained through animal evolution. Indeed, both in mammals and in
Drosophila, Pbx/EXD factors interact and cooperate with the
Hox/HOM-C-like factors (reviewed in Ref. 19), and the interaction between mammalian Pbx and the Meis/Prep1 related factors also occurs in
Drosophila as EXD interacts with the homothorax protein, which seems to be the ortholog of the murine Meis factors (42-45). Homothorax was shown to be necessary for the nuclear localization of
EXD and for its function. Remarkably, the murine Meis1 was able to
rescue the homothorax mutant phenotype (42) and to induce nuclear
translocation of EXD. Therefore, it is probable that the nuclear
translocation of Pbx factors in mammals is controlled by the Meis
factors. Thus, it will be interesting to test whether Prep1 could have
such a role. As Rieckhof et al. (42) observed nuclear EXD
without homothorax expression in some cells of Drosophila embryo (42), it is possible that another factor, similar to homothorax,
exists in these cells. This factor could eventually correspond to the
ortholog of Prep1. A sequence comparison of homothorax, Meis, and Prep1
reveals that Meis1 is much more related to homothorax than to Prep1,
suggesting that before the divergence of vertebrates and invertebrates,
an ancestral gene duplicated and generated the Prep1 and the
Meis/homothorax genes. Thus, this is consistent with the hypothesis
that a Prep1-like gene could exist in Drosophila.
The somatostatin promoter is a good model to study the regulation of
gene expression by the Pbx factors. This promoter contains two distinct
Pbx binding sites, the TSEII and the UE-A element. Pbx
binds TSEII cooperatively with the pancreatic factor PDX1, and the formation of this heterodimer requires the FPMWK motif of PDX1
(10). On the UE-A element, Pbx binds as a heterodimer with the Prep1
factor. This Pbx-Prep1 heterodimer functionally cooperates with the
PDX1 factor bound to the adjacent TSEI site. The
somatostatin promoter is the only regulatory sequence shown to bind the
three factors Pbx, Prep1, and PDX1 (Hox-like) with a high affinity;
this gene is thus a good model in order to investigate, at the
molecular level, the mechanisms of action of the Pbx/EXD, Meis/Prep/homothorax and Hox-like homeodomain factors.
113 to
85 relative to the transcription initiation site, function in
combination and act as a pancreas-specific mini-enhancer. The
TSEI element is recognized by the pancreatic homeodomain
factor PDX1. In the present study, we show that the UE-A element binds
a heterodimeric complex composed of a Pbx factor and the Prep1 protein,
both belonging to the atypical three-amino acid loop extension
homeodomain family. Recombinant Pbx1 and Prep1 proteins bind
cooperatively to the UE-A site, whereas neither protein can bind this
site alone. Transient transfection experiments reveal that both Pbx1
and Prep1 are required to generate a strong transcriptional activation
from the UE-A element when this element is inserted close to the TATA
box. In contrast, in the context of the intact somatostatin promoter or
mini-enhancer, Pbx1 and Prep1 alone have no effect, but they produce a
drastic activation when the pancreatic homeodomain factor PDX1 is also
coexpressed. Thus, the activity of the somatostatin mini-enhancer is
mediated by a cooperative interaction between the Pbx-Prep1
heterodimeric complex and the pancreatic factor PDX1.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
endocrine cells of
the pancreas and in neurons of the hypothalamus, but its expression is
also detected in other cell types, such as the D-cells of the digestive
tract, the C-cells of the thyroid gland, and sensory neurons (1).
35 and
55 relative to the transcription
start site, which is recognized by the factor CREB and other related
nuclear proteins (2, 3). In addition, the activity of the somatostatin
promoter in pancreatic cell lines is stimulated by two tissue-specific
elements, TSEI and TSEII, located respectively
at
85/
99 and at
280/
300 (4-6) (see Fig. 1). These TSEs are
both recognized by the pancreatic-specific homeodomain factor PDX1
(also named STF1, IDX1, and IPF1) (6-8), which plays an important role
in pancreas organogenesis (9). Whereas PDX1 binds the TSEI
element as a monomer, it recognizes the TSEII element
mainly as a heterodimer with the Pbx factors (6, 10). The Pbx proteins,
including the proto-oncogene Pbx1 and the closely related
factors Pbx2 and Pbx3, contain an atypical three-amino acid loop
extension-class homeodomain and share extensive sequence homology with
the Drosophila protein extradenticle
(EXD)1 (11-13). Genetic and
biochemical studies in Drosophila have shown that EXD acts
as a co-factor for the homeotic selector proteins (HOM-C) to regulate
their target genes (14-17). EXD binds cooperatively with HOM-C
proteins to DNA target sites, thereby increasing their DNA binding
specificity (18, 19). Similarly, in mammals, the Pbx proteins interact
with the Hox factors (mammalian homologs of HOM-C factors) and modulate
their DNA binding activity (20-24). The conserved pentapeptide motif
YPWMK present in many metazoan Hox/HOM-C proteins is necessary for the
interaction with the Pbx/EXD factors (21-23). The pancreatic factor
PDX1, which is very similar to the Antennapedia class of
homeodomain proteins, also contains this pentapeptide motif, and this
motif is absolutely required for the cooperative binding of PDX1 and
Pbx to the somatostatin TSEII element (10). All of these
results show that the function of the Pbx/EXD proteins is to act as
co-factors for the Hox/HOM-C proteins but also for orphan homeodomain
proteins, such as PDX1.
100 to
113; see
Fig. 1) (4). The bipartite element UE-A/TSEI acts as a
pancreatic
-cell-specific mini-enhancer. The UE-A site, although
devoid of intrinsic activation capacity, is required for optimal
mini-enhancer activity (4). The bipartite UE-A/TSEI element
acts also in synergy with the nearby CRE sequence to generate high
somatostatin expression levels in pancreatic cells (4, 5). The protein
binding the TSEI element was identified as a monomer of the
pancreatic factor PDX1 (6, 7). However, characterization of the
cellular factor(s) recognizing the UE-A element has not been reported
to date (25).
![]()
EXPERIMENTAL PROCEDURES
35 to +8 relative to the transcription initiation
site) fused to the luciferase gene. The UE-A/TSEI-Luc plasmid contains one copy of the somatostatin mini-enhancer (from
120
to
80) in the BamHI site of the GH32Luc vector. The
pSRIF-Luc plasmid contains the somatostatin promoter sequence (from
192 to +50) directly linked to the luciferase gene.
-galactosidase plasmid, used as an internal control, were
added to the cells. 24 h after the glycerol shock, the cells were
harvested, lysed, and assayed for the luciferase and
-galactosidase
activities. Luciferase activities were normalized to
-galactosidase
activity in each cell extract.
![]()
RESULTS

View larger version (16K):
[in a new window]
Fig. 1.
Sequence of the somatostatin UE-A
element. The position of the UE-A element within the somatostatin
gene promoter is shown with the other identified regulatory sequences.
Below the diagram presents a sequence comparison of the UE-A
element from the bovine, mouse, human, and rat somatostatin genes
together with the Pbx consensus binding site.

View larger version (65K):
[in a new window]
Fig. 2.
A member of the Pbx homeodomain family binds
to the somatostatin UE-A element. EMSAs were performed on wild
type or mutated UE-A element (sequences depicted below the
lanes) using nuclear extract of pancreatic TU6 cells. 1 or 10 ng of
unlabeled oligonucleotides UE-A or mutated UE-A were added as
competitor, as indicated above the lanes. PI,
preimmune serum; Pbx Ab, antibody raised against PBX1
protein and recognizing all Pbx family members (generous gift of M. Kamps); PDX1 Ab, PDX1 antiserum; PbxL Ab,
antiserum recognizing specifically the long Pbx isoforms (Pbx1a, Pbx2,
and Pbx3a) (Santa Cruz Biotechnology)

View larger version (52K):
[in a new window]
Fig. 3.
Formation of the protein-DNA complexes S and
L on the UE-A element with nuclear extract of various cell lines.
EMSAs were performed on UE-A probe with extracts from TU6, Rin,
TC
cells (pancreatic endocrine type), GH3 cells (pituitary type), STC1
cells (intestinal type), Jurkat cells (T lymphocyte type), HCT116, HT29
cells (colon carcinoma type), Hela, or COS cells. Positions of
complexes L and S are indicated by the arrows.
Nsp, nonspecific complex. Pbx1a, recombinant
Pbx1a protein produced in vitro in a wheat germ extract
(WGE) tested on the UE-A probe (lane 12) and on
TSEII probe in absence (lane 14) and presence
(lane 15) of recombinant PDX1 protein.

View larger version (25K):
[in a new window]
Fig. 4.
The protein complexes bound on the UE-A
element are not destabilized by the conserved Hox pentapeptide in
contrast to the PDX1-Pbx complex bound on the TSEII
element. EMSAs were performed with increasing
concentration of the Hox-B5 peptide QPQIYPWMRKLH (from 1 µM to a final concentration of 1 mM), as
indicated by the crescendo above the lanes. The complexes L
and S formed with UE-A probe are indicated, as well as the PDX1 and
PDX1-Pbx complexes formed on TSEII probe. The free probes
are not shown in the figure.

View larger version (30K):
[in a new window]
Fig. 5.
Pbx1a protein binds the UE-A element when
expressed in eukaryotic COS cells. EMSAs were performed on UE-A
probe with extracts of COS cells transfected with (+) or without (
)
the expression vector containing the coding region of the Flag-tagged
Pbx1a (pFlagPBX1) or cDNA insert
(pcDNA3). 1 µl of monoclonal antiflag antibody
(Flag Ab) was added as indicated.

View larger version (47K):
[in a new window]
Fig. 6.
Prep1 and Pbx1a cooperatively bind the
somatostatin UE-A element. Meis1, Prep1, and Pbx1a were translated
in vitro in reticulocyte lysate and were tested by EMSA as
indicated above each lane using the probe UE-A. Ret.
lysate, control reaction containing the unprogrammed reticulocyte
lysate. Roughly equal efficiency of protein translation was obtained
for Meis1 and Prep1, as demonstrated by [35S]methionine
labeling (data not shown).

View larger version (72K):
[in a new window]
Fig. 7.
Prep1 is the major partner of Pbx factors for
the cooperative binding of the somatostatin UE-A element. EMSAs
were performed on the UE-A probe using TU6 or HeLa cell extract as
indicated. Various antibody were preincubated with the extracts as
depicted above each lane. PbxL Ab, antiserum
recognizing the long isoforms of Pbx factors. Prep1 Ab1 and
Prep1 Ab2, antisera raised specifically against Prep1
protein (generous gift of Prof. F. Blasi). In vitro
translated Prep1 and Pbx1a were tested in lanes 14 and
15. nsp, nonspecific complex.

View larger version (33K):
[in a new window]
Fig. 8.
Synergistic activation of the UE-A element by
Pbx1a and Prep1 factors. HCT116 cells were transfected by the
UE-A-Luc and UE-Amut-Luc reporter plasmids. These vectors contain the
luciferase gene under the control of a minimal growth hormone promoter
(
32 to +8) and one copy of the wild type UE-A sequence (for the
UE-A-Luc plasmid) or mutated UE-A sequence (for the UE-Amut-Luc
plasmid) (see Fig. 2 for the sequences). These reporter plasmids were
cotransfected with an expression vector for Pbx1a and/or Prep1 as
indicated. Luciferase activities were normalized to
-galactosidase
activity generated by the internal control plasmid Rous sarcoma
virus-
-galactosidase. Normalized Luc activity obtained in the cell
transfected without expression vector was arbitrarily set at 1. The
data are means ± S.D. of four transfection experiments, each
performed in duplicate.
120 to
80
of the somatostatin promoter acts as a pancreatic-specific
mini-enhancer (25). This mini-enhancer is actually a bipartite element
composed of the UE-A domain (
113 to
100) and the TSEI
domain (
85 to
99) binding the PDX1 homeodomain factor as a monomer
(6, 7) (see Fig. 1). As both sites are required for the enhancer
function and act synergistically, we decided to test the effect of the three factors, PDX1, Pbx1a, and Prep1, on the somatostatin
mini-enhancer. The reporter plasmid UE-A/TSEI-Luc,
containing one copy of the mini-enhancer (sequence from -120 to -80)
directly upstream from the TATA box-luciferase fusion construct, was
transfected either alone or with various combination of expression
vectors for PDX1, Pbx1a, or Prep1 in carcinoma HCT116 cells (see Fig.
9). In contrast to the effect on the UE-A
element alone, co-transfection of both Prep1 and Pbx1a vectors did not
produce a strong activation of the mini-enhancer. PDX1 alone caused a
stimulation that was slightly increased in the presence of Pbx1a.
However, expression of all three factors (PDX1, Pbx1a, and Prep1) gave
a very strong synergistic activation of the mini-enhancer (about
230-fold).

View larger version (32K):
[in a new window]
Fig. 9.
Synergistic activation of the somatostatin
mini-enhancer and the intact somatostatin promoter by Prep1, Pbx1a, and
PDX1. The reporter plasmid UE-A/TSEI-Luc contains one
copy of the somatostatin mini-enhancer sequence (from
120 to
80)
inserted upstream from the minimal growth hormone promoter (
32 to +8)
fused to the luciferase gene. The reporter plasmid pSRIF-Luc contains
the somatostatin promoter sequence (from
195 to +52) fused to the
luciferase gene. These reporter vectors were co-transfected in HCT116
cells together with the internal control plasmid Rous sarcoma
virus-
-galactosidase and the expression vectors coding for PDX1,
Pbx1a, and/or Prep1 factors. Normalized luciferase activity obtained in
the cells transfected without expression vector was arbitrarily set at
1. The data presented are the results of nine transfection experiments
for the UE-A/TSEI-Luc plasmid and four transfection
experiments for the pSRIF-Luc plasmid.
![]()
DISCUSSION
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. C. Murre and S. Neuteboom for the Flag-Pbx1a cDNA and Dr. N. Copeland for the Meis1 cDNA. We are grateful to Dr. M. Kamps for the Pbx antiserum, to Dr. M. Cleary for the Meis1 antiserum, and to Dr. F Blasi and J. Berthelsen for the Prep1 antibodies. We thank Dr. M. Montminy, M. Muller, and M. Alvarez for discussions and comments.
| |
FOOTNOTES |
|---|
* This work was supported by Grant 1.5.076.98 from the National Foundation for Scientific Research (Belgium), Grant 95/00-103 from the Actions de Recherche concertée, and Grant P4-30 from the Poles d'Attraction Interuniversitaires.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by a fellowship from Ligue Contre le Cancer.
§ Present address: Institut für Biologie I, Abt. Entwicklungsbiologie, Universität Freiburg, Hauptstrasse 1, 19104 Freiburg, Germany.
¶ Chercheur Qualifié from National Foundation for Scientific Research. To whom correspondence should be addressed. Tel.: 32-4-366-33-74; Fax: 32-4-366-29-68; E-mail: Bpeers{at}ulg.ac.be.
The abbreviations used are: EXD, extradenticle; EMSA, electrophoretic mobility shift assay.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
X. Lampe, O. A. Samad, A. Guiguen, C. Matis, S. Remacle, J. J. Picard, F. M. Rijli, and R. Rezsohazy An ultraconserved Hox-Pbx responsive element resides in the coding sequence of Hoxa2 and is active in rhombomere 4 Nucleic Acids Res., June 1, 2008; 36(10): 3214 - 3225. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Diaz, S. Mori, E. Longobardi, G. Menendez, C. Ferrai, R. A. Keough, A. Bachi, and F. Blasi p160 Myb-Binding Protein Interacts with Prep1 and Inhibits Its Transcriptional Activity Mol. Cell. Biol., November 15, 2007; 27(22): 7981 - 7990. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. D. Lichtenauer, M. Duchniewicz, M. Kolanczyk, A. Hoeflich, S. Hahner, T. Else, A. B. Bicknell, T. Zemojtel, N. R. Stallings, D. M. Schulte, et al. Pre-B-Cell Transcription Factor 1 and Steroidogenic Factor 1 Synergistically Regulate Adrenocortical Growth and Steroidogenesis Endocrinology, February 1, 2007; 148(2): 693 - 704. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Z. Cao, D.-Q. Tang, M. E. Horb, S.-W. Li, and L.-J. Yang High Glucose Is Necessary for Complete Maturation of Pdx1-VP16-Expressing Hepatic Cells into Functional Insulin-Producing Cells Diabetes, December 1, 2004; 53(12): 3168 - 3178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Bailey, N. Rave-Harel, S. M. McGillivray, D. Coss, and P. L. Mellon Activin Regulation of the Follicle-Stimulating Hormone {beta}-Subunit Gene Involves Smads and the TALE Homeodomain Proteins Pbx1 and Prep1 Mol. Endocrinol., May 1, 2004; 18(5): 1158 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Chao, J. N. Harada, F. Hyndman, X. Gao, C. G. Nelson, S. K. Chanda, and J. S. Caldwell PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter J. Biol. Chem., April 16, 2004; 279(16): 16111 - 16120. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Schwitzgebel, A. Mamin, T. Brun, B. Ritz-Laser, M. Zaiko, A. Maret, F. R. Jornayvaz, G. E. Theintz, O. Michielin, D. Melloul, et al. Agenesis of Human Pancreas due to Decreased Half-Life of Insulin Promoter Factor 1 J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4398 - 4406. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Sanchez-Font, A. Bosch-Comas, R. Gonzalez-Duarte, and G. Marfany Overexpression of FABP7 in Down syndrome fetal brains is associated with PKNOX1 gene-dosage imbalance Nucleic Acids Res., June 1, 2003; 31(11): 2769 - 2777. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Gregory and P. I. Mackenzie The Homeodomain Pbx2-Prep1 Complex Modulates Hepatocyte Nuclear Factor 1alpha -Mediated Activation of the UDP-Glucuronosyltransferase 2B17 Gene Mol. Pharmacol., July 1, 2002; 62(1): 154 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Remacle, C. Shaw-Jackson, C. Matis, X. Lampe, J. Picard, and R. Rezsohazy Changing homeodomain residues 2 and 3 of Hoxa1 alters its activity in a cell-type and enhancer dependent manner Nucleic Acids Res., June 15, 2002; 30(12): 2663 - 2668. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kurant, D. Eytan, and A. Salzberg Mutational Analysis of the Drosophila homothorax Gene Genetics, February 1, 2001; 157(2): 689 - 698. [Abstract] [Full Text] |
||||
![]() |
M. Peshavaria, M. A. Cissell, E. Henderson, H. V. Petersen, and R. Stein The PDX-1 Activation Domain Provides Specific Functions Necessary for Transcriptional Stimulation in Pancreatic {beta}-Cells Mol. Endocrinol., December 1, 2000; 14(12): 1907 - 1917. [Abstract] [Full Text] |
||||
![]() |
S. B. Nelson, M. A. Lawson, C. G. Kelley, and P. L. Mellon Neuron-Specific Expression of the Rat Gonadotropin-Releasing Hormone Gene Is Conferred by Interactions of a Defined Promoter Element with the Enhancer in GT1-7 Cells Mol. Endocrinol., September 1, 2000; 14(9): 1509 - 1522. [Abstract] [Full Text] |
||||
![]() |
P. Itkin-Ansari, C. Demeterco, S. Bossie, D. Dufayet de la Tour, G. M. Beattie, J. Movassat, M. I. Mally, A. Hayek, and F. Levine PDX-1 and Cell-Cell Contact Act in Synergy to Promote {delta}-Cell Development in a Human Pancreatic Endocrine Precursor Cell Line Mol. Endocrinol., June 1, 2000; 14(6): 814 - 822. [Abstract] [Full Text] |
||||
![]() |
D. Prevot, T. Voeltzel, A.-M. Birot, A.-P. Morel, M.-C. Rostan, J.-P. Magaud, and L. Corbo The Leukemia-associated Protein Btg1 and the p53-regulated Protein Btg2 Interact with the Homeoprotein Hoxb9 and Enhance Its Transcriptional Activation J. Biol. Chem., January 7, 2000; 275(1): 147 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |