![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 8, 4794-4800, February 19, 1999
From Développement, Vieillissement et Pathologie de la Rétine, U450, INSERM, Paris 75016, France
| |
ABSTRACT |
|---|
|
|
|---|
Bovine retinal pigmented epithelial cells express
an inducible nitric oxide synthase (NOS-2) after activation with
interferon- The enzyme nitric oxide synthase
(NOS)1 transforms
L-arginine into nitric oxide (NO) and
L-citrulline in the presence of oxygen, NADPH,
tetrahydrobiopterin, flavin mononucleotide, and FAD (1, 2). Three
isoforms of NOS have been identified. Two isoforms are expressed
continuously: NOS-1 is present essentially in neurons of the central
and peripheral nervous system (3), and NOS-3 is localized originally in
the plasma membrane of vascular endothelial cells (4). These enzymes,
via an increase of the intracellular calcium concentration, produce
small amounts of NO, which are involved in neurotransmission and
vasorelaxation (3, 4). On the other hand, the inducible isoform, NOS-2,
whose expression requires protein synthesis, is calcium- and
calmodulin-independent and is generally expressed in different cell
types only after transcriptional activation by endotoxins or cytokines
(5, 6). NO produced by NOS-2 plays a role in immunological defenses as an antitumoral, antimicrobial, and antiviral agent (5-7). NO is also
considered to be a mediator of autoimmune and inflammatory responses
(5).
In the retina, Müller glial cells can express NOS-2 after
endotoxin and cytokine stimulation (8). Retinal pigmented epithelial (RPE) cells from bovine (9), human (10), and murine (11, 12) species
also contain the NOS-2 isoform. Indeed, we demonstrated previously that
in bovine RPE cells, NOS-2 was induced by combined treatment with
lipopolysaccharide (LPS) and interferon- The regulation of NOS-2 induction is dependent on signal transduction
activated by endotoxin, cytokines, and growth factors (6, 13). These
signals are the result of the activation of serine/threonine or
tyrosine kinases (14, 15). In bovine RPE cells, the accumulation of
NOS-2 mRNA and the accompanying NO release induced by LPS and
IFN- Cell Cultures--
Bovine RPE cells were prepared as reported
previously (9) and cultured in DMEM supplemented with 10% fetal calf
serum (Life Technologies, Cergy-Pontoise, France), 2.5 µg/ml
Fungizone, 50 µg/ml gentamycin, and 2 mM L-glutamine.
Cultures were homogeneous and contained only RPE cells, as
characterized by immunohistochemistry with anti-cytokeratin monoclonal
antibody KL-1 (24). Cells at passages 1-5 were used for experiments.
Retinal Müller glial (RMG) cells were cultured from eyeballs from
mice at postnatal day 10 according to Hicks and Courtois (25). Early
subcultures (up to three passages) were used for transfection experiments.
Chemicals, Cytokines, and Antibodies--
LPS from
Salmonella typhimurium, PDTC, and genistein were obtained
from Sigma (St. Quentin-Fallavier, France). The specific inhibitor of
MAP kinase kinase (PD98059), the upstream kinase that phosphorylates
and activates ERK kinases, and the two rabbit polyclonal antibodies
against either total p38 MAP kinase or against only the phosphorylated
form of p38 MAP kinase were obtained from BioLabs (Ozyme,
Montigny-le-Bretonneux, France). The specific inhibitor of p38 MAP
kinase (SB 203580) was obtained from Calbiochem (Meudon, France). The
rabbit polyclonal antibody against IRF-1 and the two polyclonal
antibodies against either total ERK2 or against only the phosphorylated
forms of ERKs were obtained from Santa Cruz (TEBU, Le Perray en
Yvelines, France). Bovine recombinant IFN- Assay for Nitrite--
Confluent RPE cells in 12-well culture
plates (averaging 105 cells/well) were treated with LPS and
IFN- Transfection Assays--
Promoters of the murine NOS-2 gene
ligated upstream of the luciferase gene (gift of Dr. C. J. Lowenstein, Johns Hopkins University, Baltimore) (26) or of the murine
IRF-1 gene ligated upstream of the luciferase gene (gift of Dr. R. Pine, Public Health Research Institute, New York) (27) were transfected
into RPE cells using Lipofectin (Life Technologies) as described (28).
The vector pGL2-basic (lacking a promoter) and the vector Promega
pGL2-control (containing the SV40 early promoter and enhancer) served
as negative and positive controls, respectively. Briefly, the
transfection medium containing 10 µg of plasmid DNA and 60 µl of
Lipofectin reagent in 2 ml of serum-free DMEM was incubated for 20 min
at room temperature and then diluted with serum-free DMEM to a final volume of 5 ml and added to RPE cells, plated the day before. The
transfection process occurred at 37 °C for 5 h, then 5 ml of
DMEM containing 20% fetal calf serum was added to the cells. The cells
were incubated for 60 h and stimulated during the last 12 h
with different combinations of LPS and IFN- Electrophoretic Mobility Shift Assay (EMSA)--
Whole cell
extracts were prepared from cultured bovine RPE cells treated with LPS
and IFN- Western Blot Analysis--
For MAP kinase analysis, RPE cells
were serum starved for 48 h before stimulation. After a 2-h
pretreatment with PDTC or protein kinase inhibitors, cells were treated
with LPS and IFN- Reverse Transcriptase-PCR Analysis of IRF-1 mRNA--
RPE
cells were pretreated or not with PDTC and protein kinase inhibitors
2 h before stimulation with LPS and IFN- Statistical Analysis--
Results were expressed as mean ± S.E. They were analyzed statistically by Mann-Whitney U
test. p values less than 0.05 were considered as significant.
Transfection of Bovine RPE Cells with the NOS-2
Promoter--
Because we have demonstrated previously that the
accumulation of NOS-2 mRNA by the combination of LPS and IFN- Inhibitory Effects of PD98059 and SB 203580 on Nitrite Accumulation
and NOS-2-regulated Luciferase Activity Induced by LPS/IFN- Effects of Genistein and PDTC on IRF-1 Activation--
Because we
have recently described the activation of IRF-1 by inducers of NOS-2
(23), we tested the effect of genistein and PDTC on LPS/IFN- Regulation of IRF-1 Protein and mRNA Accumulation in RPE
Cells--
When cells were stimulated with LPS/IFN- Induction and Regulation of the Promoter of IRF-1--
To address
whether the inhibitory effects of the antioxidants and protein kinase
inhibitors on IRF-1 mRNA accumulation were caused by the prevention
of IRF-1 gene transcription, we decided to analyze the induction of the
promoter of IRF-1 (Fig. 6) by transitory
transfection assays with two different constructs of murine reporter
gene of the IRF-1 promoter coupled to luciferase (27). When bovine RPE
cells were not stimulated (bar 1) or stimulated with LPS
alone (bar 2), no increase of luciferase activity was detected. Stimulation with IFN- Activation of ERK and p38 MAP Kinase by LPS and IFN- We have demonstrated that induction of NOS-2 activity in RPE cells
by LPS/IFN- Transfection analysis with luciferase-reporter constructs containing
the promoter of NOS-2 demonstrated that LPS/IFN- The inhibition of LPS/IFN- The sensitivity of LPS/IFN- By using the nonspecific tyrosine kinase inhibitor, genistein, we
demonstrated that induction of the IRF-1 gene and IRF-1 activation
required the action of tyrosine kinases. This phenomenon could be
explained by an inhibition of the phosphorylation of one component of
the JAK/STAT pathway, a transductory signal already described for the
IFN- Our study suggests the existence of different intracellular
signaling pathways in NOS-2 induction in RPE cells because tyrosine kinase inhibitors blocked NOS-2 mRNA accumulation, without
affecting NF-
(IFN-
) and lipopolysaccharide (LPS). Experiments were
performed to investigate the involvement of interferon regulatory
factor-1 (IRF-1) on NOS-2 induction and its regulation by NOS-2
inhibitors such as pyrrolidine dithiocarbamate (PDTC), an antioxidant,
or protein kinase inhibitors. Analysis by transitory transfections showed that LPS, alone or with IFN-
, stimulated activity of the murine NOS-2 promoter fragment linked upstream of luciferase and its
suppression by PDTC and by the different protein kinase inhibitors, genistein (tyrosine kinase inhibitor), PD98059 (mitogen-actived protein
(MAP) kinase kinase inhibitor), and SB 203580 (p38 MAP inhibitor).
Using specific antibodies, we have confirmed that extracellular
signal-regulated kinases and p38 MAP kinase were activated by LPS and
IFN-
in retinal pigmented epithelial cells. Analysis by reverse
transcriptase-polymerase chain reaction, Western blot, and
electrophoretic mobility shift assay demonstrated that IFN-
alone or
combined with LPS induced an accumulation of IRF-1 mRNA and protein
and IRF-1 DNA binding. Transfections assays with the IRF-1 promoter
showed an induction of this promoter with IFN-
, potentiated by LPS.
The decrease of LPS/IFN-
-induced IRF-1 promoter activity, IRF-1
synthesis, and IRF-1 activation, by PDTC, genistein, PD98059, and SB
203580, could explained in part the inhibition of the NOS-2 induction
by these compounds. Our results demonstrate that IRF-1 is necessary for
NOS-2 induction by LPS and IFN-
and that its synthesis requires the
involvement of a redox-sensitive step, the activation of tyrosine
kinases, and extracellular signal-regulated kinases 1/2 and p38 MAP kinases.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
(IFN-
) but not
individually (9).
require tyrosine kinase signaling and oxidative mechanisms
(16). We have also demonstrated that the transcription factor nuclear
factor-
B (NF-
B) is required in LPS/IFN-
-induced NOS-2 mRNA
accumulation in bovine RPE cells (16) as in many different cell types
such as murine macrophages (17, 18), vascular smooth muscle cells (19),
or 3T3 fibroblasts (20). In RPE cells, the antioxidant
pyrrolidinedithiocarbamate (PDTC) but not the tyrosine kinase inhibitor
genistein reduces the nuclear translocation of NF-
B and the
formation of NF-
B·DNA complexes induced by LPS/IFN-
(16).
Furthermore, the fact that LPS/IFN-
-induced NOS-2 mRNA
accumulation is sensitive to cycloheximide (16) suggests that
transcriptional factors that depend on protein synthesis are required
for NOS-2 induction in RPE cells. In this context, different studies
have reported the necessity of interferon regulatory factor-1 (IRF-1),
transcriptionally induced by IFN-
, in NOS-2 gene induction (21, 22).
In bovine RPE cells, we have demonstrated that IRF-1 mRNA
accumulation can be modulated after IFN-
and IFN-
treatment (23),
also suggesting a role for this transcription factor in NOS-2 induction
in RPE cells. In this study we have attempted to elucidate further the
role of IRF-1 in NOS-2 induction in bovine RPE cells. Our results
demonstrate that NOS-2 inducers (LPS/IFN-
) increase IRF-1 mRNA
and protein accumulation and induce the formation of IRF-1·DNA
complexes. Analysis of the effects of NOS-2 inhibitors, genistein,
PDTC, and inhibitors of extracellular signal-regulated kinase (ERK) and
p38 mitogen-activated protein (MAP) kinase pathways reveal that these
compounds block LPS/IFN-
-induced IRF-1 mRNA accumulation and
suppress the LPS/IFN-
-stimulated activity of IRF-1.
![]()
MATERIALS AND METHODS
was generously provided
by Dr. T. Ramp (Ciba-Geigy, Basel, Switzerland). Mouse recombinant
IFN-
was obtained from Peprotech (TEBU).
in the absence or presence of protein kinase inhibitors or PDTC
in fresh DMEM and 10% fetal calf serum. After 72 h of incubation,
the nitrite concentration was determined in cell-free culture
supernatants using the spectrophotometric method based on the Griess
reaction, as described previously (9).
. When used, PDTC and
protein kinase inhibitors were added 2 h before the stimulation. After rinsing with phosphate-buffered saline, cells were lysed with
reporter lysis buffer (Promega, Charbonnières, France), and cell
extracts were used for luciferase assays with the Promega kit in a
luminometer (EG&G Berthold, Evry, France). To control transfection
efficiency, pSV
-galactosidase plasmid (Promega) was cotransfected
with the luciferase reporter constructs in a 1:4 ratio. After
stimulation,
-galactosidase activities were measured by colorimetric
assay using
o-nitrophenyl-
-D-galactopyranoside substrate
in 96-well plate-reading spectrophotometer (Bio-Rad, Ivry/Seine,
France). The results showed that the difference in the relative
efficiency of transfection between constructs was negligible (data not shown).
for 12 h for IRF-1 analysis. In some experiments,
cells were pretreated for 2 h with PDTC or protein kinase
inhibitor before stimulation. Cells were washed three times in cold
phosphate-buffered saline and lysed as described previously (23). EMSAs
with double-stranded consensus oligonucleotide IRF-1 (GGAAGCGAAAATGAAATTGACT) were performed as described previously (23).
for distinct periods, washed with
phosphate-buffered saline, and then scraped into lysis buffer as
described (23). Samples were centrifuged, and after one freeze/thaw
cycle, 100 µg of supernatant proteins was subjected to
SDS-polyacrylamide gel electrophoresis. Proteins were then transferred
to an Immobilon membrane (Millipore, St. Quentin en Yvelines, France)
by electroblotting. Western blot analysis using different polyclonal
antibodies specific for IRF-1, total p38 MAP kinase, active p38 MAP
kinase, ERK2, and active ERK kinases was performed as described
previously (23).
. After different times
of incubation, total RNA was extracted from treated cells by cell lysis
in guanidinium isothiocyanate followed by phenol acid extraction. 1 µg of RNA was reverse transcribed for 90 min at 42 °C with 200 units of superscript Moloney murine leukemia virus reverse
transcriptase (Life Technologies), using random hexamers. 2 µl of
cDNA was added to each PCR, and amplification was performed with
the oligonucleotide primers specific for mouse IRF-1, and GAPDH as
described previously (23, 29).
![]()
RESULTS
could be impaired by antioxidants and tyrosine kinase inhibitors (16),
we attempted to establish whether these effects were the result of the
prevention of NOS-2 gene transcription. For this, we decided to analyze
the induction of the promoter of NOS-2 by transitory transfection of
the NOS-2 promoter linked to the luciferase gene reporter. Transfected
cells were stimulated for 12 h to measure the maximal luciferase
activity (Fig. 1A). When
bovine RPE cells were stimulated with LPS (bar 2), it
appeared that there was an increase of the luciferase activity; none
was observed in unstimulated cells (bar 1) or in cells
stimulated with IFN-
alone (bar 3). When cells were
stimulated with the combination of LPS and IFN-
(bar 4), the luciferase activity was similar to that observed with LPS alone.
Control experiments revealed that no luciferase activity was detected
in LPS/IFN-
-stimulated RPE cells transfected with the promoterless
pGL2-basic construct, and a large increase of luciferase activity in
unstimulated cells transfected with the SV40 early promoter/enhancer
pGL2-control (data not shown). Pretreatment with PDTC (bars
5 and 7) or genistein (bars 6 and
8) markedly inhibited the increase of luciferase activity
caused by LPS alone or LPS/IFN-
, demonstrating the role of tyrosine
kinases and oxidative mechanisms in the induction of the NOS-2 gene in
bovine RPE cells. To understand the apparent failure of the NOS-2
promoter to respond to IFN-
, murine RMG cells, expressing NOS-2
after LPS/IFN-
stimulation (8), were transfected with the same
construct. Results reported in Fig. 1B show that IFN-
alone had no effect on luciferase activity (bar 3). A
greater increase of the luciferase activity by LPS/IFN-
stimulation
rather than by LPS alone was also seen (bar 4 compared with
bar 2), suggesting a difference in the induction of the
murine promoter in bovine RPE cells and murine RMG cells.

View larger version (14K):
[in a new window]
Fig. 1.
Induction of NOS-2 promoter and regulation by
genistein and PDTC. Panel A, bovine RPE cells, after
transitory transfections, were pretreated without (bars
1-4) or with PDTC (bars 5 and 7) or
genistein (bars 6 and 8) and then stimulated for
12 h without (bar 1) or with 1 µg/ml LPS
(bar 2), 100 units/ml IFN-
(bar 3), LPS and
IFN-
(bar 4), LPS with 10 µM PDTC
(bar 5), LPS with 90 µM genistein (bar
6), LPS/IFN-
with PDTC (bar 7), or LPS/IFN-
with
genistein (bar 8). Panel B, mouse RMG cells,
after transitory transfections, were stimulated for 12 h without
(bar 1) or with 1 µg/ml LPS (bar 2), 100 units/ml IFN-
(bar 3), or LPS/IFN-
(bar 4).
In each case, the luciferase activity was measured as described under
"Materials and Methods." The results are expressed as a
multiplication factor compared with the luciferase activity detected in
nontreated RPE cells. The means ± S.E. of three experiments run
in triplicate are shown. **# p < 0.01 versus nontreated cells (bar 1) and
** p < 0.01 versus LPS/IFN-
treated cells (bar 4).
in RPE
Cells--
To investigate the type of protein kinase pathway which
could be involved in NOS-2 induction in RPE cells, a specific inhibitor of MAP kinase kinase (PD98059), the upstream kinase that phosphorylates and activates ERK kinases, and a specific inhibitor of the p38 MAP
kinase (SB 203580), were first tested on NO production caused by LPS
and IFN-
. As shown in Table I, the
stimulated NO release determined from the nitrite level in the culture
supernatants was decreased by 56 and 65% in the presence of PD98059 or
SB 203580, respectively. Transfection experiments demonstrated that
stimulation of the transfected cells with LPS/IFN-
after
pretreatment with PD98059 reduced luciferase activity by 65% (Table
I). Similar treatment with SB 203580 also prevented LPS/IFN-
-induced
luciferase activity by 87% (Table I). These results suggest that the
signaling pathway involved in NOS-2 induction is affected by inhibitors of ERK and p38 MAP kinase pathways.
Effect of genistein, PD98059, and SB 203580 on nitrite accumulation and
NOS-2 promoter induction by LPS/IFN-
in combination with 90 µM genistein, 10 µM PD98059, or 25 µM SB 203580 for 72 h. For the luciferase activity,
after transitory transfections RPE cells were pretreated for 2 h
without or with 90 µM genistein, 10 µM
PD98059, or 25 µM SB 203580 and then stimulated with 1 µg/ml LPS and 100 units/ml IFN-
in combination with genistein,
PD98059, or SB 203580 for 12 h. Values (means ± S.E.) are
expressed as a percentage of maximal nitrite accumulation or maximal
luciferase activity after LPS and IFN-
treatment. ** indicates
p < 0.01, very significantly different from
LPS/IFN-
.
-induced
IRF-1 activation. EMSA studies (Fig. 2)
revealed the presence of one major and two minor DNA-protein complexes
in extracts of RPE cells stimulated with IFN-
alone (lane
3) or by the coaddition of LPS and IFN-
(lane 5).
These complexes were absent in control (lane 1) and in
LPS-treated cells (lane 2). The formation of these complexes
was prevented by the addition of excess unlabeled IRF-1 oligonucleotide
(lane 7), demonstrating the specificity of the DNA-protein
interaction. The middle darker complex appears to correspond to the
probe complexed with IRF-1, whereas the fainter bands might correspond
to complexes formed with other members of the IRF family such as IRF-2
(30). The amount of the complexes observed after the LPS/IFN-
stimulation decreased in the presence of genistein (lane 4)
or PDTC (lane 6), indicating that tyrosine kinase inhibitor
and antioxidant induced a decrease of IRF-1 binding to its specific DNA
target sequence.

View larger version (129K):
[in a new window]
Fig. 2.
Effect of genistein and PDTC on the IRF-1
activation. Cells were incubated for 12 h with different
combinations of stimulants: medium alone (lane 1), 1 µg/ml
LPS (lane 2), 100 units/ml IFN-
(lane 3),
LPS/IFN-
and 90 µM genistein (lane 4),
LPS/IFN-
(lanes 5 and 7), and LPS/IFN-
and
10 µM PDTC (lane 6). When used, PDTC and
genistein were added to the cells 2 h before stimulation. Cell
extracts were prepared and analyzed for IRF-1 binding activity in the
EMSAs. Excess of unlabeled oligonucleotide was added to verify the
specificity of complex formation (lane 7). The experiment
shown represents one of three independent EMSAs that gave similar
results.
, but not in
untreated cells, Western blot analysis revealed a transitory expression of the IRF-1 protein with a maximal signal observed at 24 h (Fig. 3A). Results depicted in Fig.
3B demonstrate that IFN-
alone was able to induce IRF-1
expression (lane 2). Furthermore, the addition of genistein
(lane 4) or PDTC (lane 5) inhibited the IRF-1
protein accumulation by 53 and 66%, respectively, after 24 h of
treatment with LPS/IFN-
(lane 3). By reverse
transcriptase-PCR analysis (Fig.
4A), we also observed a rapid
and transient IRF-1 mRNA accumulation in cells stimulated with
IFN-
alone or with LPS/IFN-
, but not in unstimulated cells
(lane 1). The IRF-1 mRNA accumulation was similar with
IFN-
alone or when combined with LPS; the maximal signal was
observed after 3 or 6 h of stimulation (Fig. 4B).
Analysis of the effects of the different inhibitors of NOS-2 induction
revealed that IRF-1 mRNA accumulation induced by LPS/IFN-
after
3 h of stimulation was decreased by pretreatment with PDTC or
genistein (Fig. 5A). More
specific analysis with the two distinct MAP kinase inhibitors (Fig.
5B) demonstrated that pretreatment with PD98059 (lane
3) or SB 203580 (lane 5) at a concentration that
inhibited NOS-2 expression prevented the LPS/IFN-
-induced IRF-1
mRNA accumulation.

View larger version (57K):
[in a new window]
Fig. 3.
Expression and regulation of IRF-1
protein. Panel A, cells were incubated without
(lane 1) or with 1 µg/ml LPS and 100 units/ml IFN-
for
12 h (lane 2), 24 h (lane 3), or
48 h (lane 4). Cell lysates (100 µg) were subjected
to SDS-polyacrylamide gel electrophoresis followed by immunoblotting
with anti-IRF-1 antibody as described under "Materials and
Methods." Panel B, cells were incubated for 24 h
without (lane 1) or with 100 units/ml IFN-
(lane
2), IFN-
and 1 µg/ml LPS (lane 3), LPS/IFN-
and
90 µM genistein (lane 4), or LPS/IFN-
and
10 µM PDTC (lane 5). When used, PDTC and
genistein were added to the cells 2 h before stimulation. In each
case the experiment shown represents one of three independent blots
that gave identical results. Evaluation of the IRF-1 protein signal by
densitometric analysis is shown below.

View larger version (30K):
[in a new window]
Fig. 4.
Kinetics of IRF-1 mRNA accumulation.
Panel A, RPE cells were stimulated without (lane
1) or with 100 units/IFN-
alone (lanes 2,
4, 6, and 8) or combined with 1 µg/ml LPS (lanes 3, 5, 7, and
9). RNA was then harvested after 3 h (lanes
2 and 3), 6 h (lanes 4 and
5), 12 h (lanes 6 and 7), or
24 h (lanes 8 and 9) of stimulation, and the
levels of IRF-1 and GAPDH mRNAs were assessed successively by
reverse transcriptase-PCR as described under "Materials and
Methods." The experiment shown in panel A represents one
of three independent trials that gave similar results. Data in
panel B are presented as the relative amount of IRF-1
normalized to the relative amount of GADPH, and values are the
means ± S.E. of three independent experiments.
, IFN-
;
,
LPS + IFN-
.

View larger version (27K):
[in a new window]
Fig. 5.
Regulation of IRF-1 mRNA accumulation by
PDTC, genistein, and specific MAP kinase inhibitors. Panel
A, confluent RPE cells were stimulated without (lane 1)
or with 100 units/ml IFN-
(lane 2), 1 µg/ml LPS and
IFN-
(lane 3), LPS/IFN-
and 10 µM PDTC
(lane 4), and LPS/IFN-
and 90 µM genistein
(lane 5). Panel B, cells were stimulated without
(lane 1) or with 1 µg/ml LPS and 100 units/ml IFN-
(lanes 2 and 4), LPS/IFN-
with 10 µM PD98059 (lane 3), and LPS/IFN-
with 25 µM SB 203580 (lane 5). When used, protein
kinase inhibitors were added to the cells 2 h before stimulation.
After 3 h, total RNA was isolated, and the levels of IRF-1 and
GAPDH mRNAs were assessed by reverse transcriptase-PCR analysis as
described under "Materials and Methods." Densitometric analysis of
the IRF-1 band corrected for GAPDH expression is shown below. The
experiment shown represents one of three independent trials that gave
similar results.
(bar 3) increased
luciferase activity and was increased greatly by the coaddition of LPS
in the culture medium (bar 4). The addition of genistein
(bar 5) or PDTC (bar 6) largely decreased the
luciferase activity induced by LPS/IFN-
. Furthermore, the
LPS/IFN-
-induced luciferase activity was reduced in cells previously
coincubated with PD98059 (bar 7) or with SB 203580 (bar 8) at concentrations that prevented IRF-1 mRNA
accumulation. Taken together, these results demonstrated that PDTC and
protein kinase inhibitors prevented the induction of IRF-1 gene and the
accompanying IRF-1 expression and activity.

View larger version (17K):
[in a new window]
Fig. 6.
Induction of IRF-1 promoter and regulation by
PDTC, genistein, and MAP kinase inhibitors. Bovine RPE cells,
after transitory transfections with the (
3.4/+0.168) IRF-1 promoter
Luc construct (panel A) or the (
0.160/+0.168) IRF-1
promoter Luc construct (panel B), were stimulated for
12 h without (bars 1) or with 1 µg/ml LPS (bars
2), 100 units/ml IFN-
(bars 3), LPS and IFN-
(bars 4), LPS/IFN-
with 90 µM genistein
(bars 5), LPS/IFN-
with 10 µM PDTC
(bars 6), LPS/IFN-
with 10 µM PD98059
(bars 7), or LPS/IFN-
with 25 µM SB 203580 (bars 8). When used, PDTC and protein kinase inhibitors were
added to the cells 2 h before stimulation. The luciferase activity
was measured as described under "Materials and Methods." The
results are the mean values of three independent experiments run in
triplicate.
# indicates p < 0.05 versus nontreated cells (bars 1),
indicates
p < 0.05 versus LPS/IFN-
-treated cells
(bars 4), 
# is p < 0.01 versus nontreated cells (bars 1), and 
is
p < 0.01 versus LPS/IFN-
-treated cells
(bars 4).
in RPE
Cells--
To investigate further the association of ERK and p38 MAP
kinase activation with NOS-2 induction in RPE cells, serum-starved RPE
cells were treated with LPS and IFN-
alone or combined. The activation of ERK and p38 MAP kinase was determined by Western blot
analysis, using antibodies specific for the activated forms of the two
kinases. Fig. 7A shows that
p38 MAP kinase phosphorylation was observed only after LPS treatment
(lane 3) but not after IFN-
stimulation (lane
2) or in unstimulated cells (lane 1). The coaddition of
LPS and IFN-
induced maximal accumulation of active phosphorylated p38 MAP kinase (lane 4), which was largely prevented by
genistein (lane 5) and by SB 203580 (lane 6). In
contrast, stimulation of cells with IFN-
(Fig. 7B,
lane 2) or with LPS (lane 3) induced ERK1/2
phosphorylation as noted by the appearance of the characteristic doublet of 42 and 44 kDa, which was absent in unstimulated cells (lane 1). Maximal phosphorylation occurred with the combined
stimulation of LPS and IFN-
(lane 4). This
LPS/IFN-
-induced phosphorylation of ERK1/2 was decreased in the
presence of genistein (lane 5). Pretreatment with PD98059
(lane 6), the MEK1 inhibitor, resulted in an inhibition of
ERK1/2 activation caused by LPS/IFN-
.

View larger version (61K):
[in a new window]
Fig. 7.
Western blot of phosphorylated p38 MAP kinase
(panel A) and ERK1/2 (panel B).
Serum-starved RPE cells were treated for 15 min without (lanes
1) or with 100 units/ml IFN-
(lanes 2), 1 µg/ml
LPS (lanes 3), LPS/IFN-
(lanes 4), LPS/IFN-
with 90 µM genistein (lanes 5), or LPS/IFN-
with either 25 µM SB 203580 (lane 6 in
panel A) or 10 µM PD98059 (lane 6 in panel B). When used, protein kinase inhibitors were added
to the cells 2 h before stimulation. After 15 min of stimulation,
cells were lysed and subjected to immunoblot analysis using antibodies
specific for the active p38 MAP kinase (panel A,
top) or for the active ERK kinases (panel B,
top), as described under "Materials and Methods."
Parallel blots were run, using the antibodies recognizing the total p38
MAP kinase (panel A, bottom) or total ERK2
(panel B, bottom). In each case the experiment
shown represents one of three independent blots that gave identical
results.
![]()
DISCUSSION
implicates a transcriptional mechanism dependent upon
the IFN-
-activated factor, IRF-1, and that transcription of IRF-1
and NOS-2 can be regulated by different MAP kinase pathways and
oxidative mechanisms.
mediated transcriptional regulation of NOS-2 gene expression, explaining in part
the accumulation of NOS-2 mRNA after LPS and IFN-
stimulation (16, 23). In bovine RPE cells, LPS, but not IFN-
alone, increased murine NOS-2 promoter activity, as reported previously in murine macrophages with the same promoter (18, 26). However, in contrast to
murine macrophages, IFN-
did not potentiate LPS-induced promoter induction in bovine RPE cells. It could be the result of a species effect because in transfection experiments of this murine promoter in
RMG cells from mice, we observed a potentiation of the induction of the
promoter by the addition of IFN-
with LPS. The lack of an IFN-
effect on the murine-derived constructs in bovine cells suggests the
absence of one or more nuclear factors in bovine RPE cells which are
required for maximal expression of the murine promoter or the existence
of factors in bovine cells which could not recognize the murine
promoter. This incapacity of the murine NOS-2 promoter to respond to
IFN-
in bovine RPE cells is similar to the hyporesponsiveness of the
human NOS-2 promoter transfected in murine macrophages to IFN-
,
alone or combined with other cytokines (31, 32).
-induced NOS-2 promoter activity by
genistein and by PDTC, reported previously as inhibitors of NOS-2
mRNA accumulation in RPE cells (16), confirmed the direct involvement of tyrosine kinase and oxidative pathways in the induction of the NOS-2 gene in bovine RPE cells. We have identified some protein
kinases involved in the LPS/IFN-
-induced NOS-2 pathway by using
specific antibodies and specific inhibitors of MAP kinases. We
demonstrated that ERK1/2, described previously as a target of growth
factors in RPE cells (33, 34), was also activated by the inducers of
NOS-2 (LPS and IFN-
) and that LPS was also able to activate p38 MAP
kinase. The inhibition of LPS/IFN-
-induced luciferase activity
related to the NOS-2 promoter construct and of LPS/IFN-
-induced NO
production by specific inhibitors of either the ERK1/2 pathway
(PD98059) or the p38 MAP kinase pathway (SB 203580) suggested the
participation of these two MAP kinase pathways in the induction of
NOS-2, as described recently in brain astrocytes and microglial cells
(35). In cardiomyocytes, interleukin-1
/IFN-
-induced NOS-2
mRNA synthesis also involved activation of the ERK pathway (36),
whereas in DLD-1 cells neither ERK1/2 nor p38 MAP kinase was required
for the regulation of NOS-2 mRNA by IFN-
/interleukin-1
/tumor necrosis factor-
(37). These differences reflect probably the cell
type-, species-, and stimuli-specific regulation of the NOS-2 gene.
-induced NOS-2 mRNA accumulation to
cycloheximide (16) and the transcriptional activation of IRF-1 after
IFN-
stimulation (23) indicate the importance of this factor in the
induction of NOS-2 in RPE cells, as demonstrated previously in other
cell types (21, 22, 38-40). Reverse transcriptase-PCR analysis
confirmed that IRF-1 mRNA is synthesized de novo in
contrast to IRF-2, its repressor constitutively expressed in RPE cells (23). Because these two factors are similar but apparently compete for
the same cis-acting recognition sequences, leading to
opposite effects on gene transcription (30), the accumulation of IRF-1 and the decrease of IRF-2 after LPS/IFN-
treatment could favor the
interaction of IRF-1 with the NOS-2 promoter, resulting in an
activation of NOS-2 gene transcription. Furthermore, we demonstrated by
Western blot and EMSA that IFN-
induced IRF-1 protein accumulation and the formation of DNA·IRF-1 binding sequence complexes. These effects of IFN-
are attributable to activation of the IRF-1 gene by
IFN-
in RPE cells because it was able to increase luciferase activity in transfection experiments with the IRF-1 promoter
constructs. Furthermore, LPS, which is required for NOS-2 induction,
slightly potentiated IFN-
-induced IRF-1 gene transcription and the
consecutive IRF-1 activation but had no effect by itself on the
induction of IRF-1. This suggests an effect of LPS on the induction of
the IRF-1 promoter only when cells are already stimulated with IFN-
, as suggested in HepG2 cells transfected with the same plasmids, where
tumor necrosis factor-
, ineffective by itself, largely potentiated
the IFN-
response (27).
(14). As concerns the MAP kinases, our results with specific
inhibitors demonstrated that ERK1/2 and p38 MAP kinase are partially
involved in IRF-1 induction. However, because MAP kinases are required
for IRF-1 induction, they are not sufficient since LPS that activated
ERK1/2 and p38 MAP kinase had no effect on IRF-1 promoter activity. An
additional tyrosine kinase-dependent step, such as involves
JAK kinases, suggested above, could be necessary for IRF-1 induction.
Furthermore, we have demonstrated that the antioxidant PDTC, which
blocked NOS-2 promoter activation (Fig. 1) and NOS-2 mRNA
accumulation (16), is also able to prevent IRF-1 promoter activation,
IRF-1 mRNA and protein accumulation, and IRF-1-DNA interactions.
The presence of consensus sequences for NF-
B in the IRF-1 promoter
(27) could be responsible for this redox-sensitive step in IRF-1 gene transcription. An important finding in the present study is that although IFN-
alone induced binding of IRF-1, it failed to induce NOS-2 mRNA and nitrite production. However, inhibition of
LPS/IFN-
-induced IRF-1 activation partially prevented NOS-2
induction, demonstrating that induction of IRF-1 is required to induce
NOS-2 in bovine RPE cells. In this context, RPE cells are very similar
to other cells types, such as macrophages (21, 22) or islet cells (40), where IRF-1 has been reported to be necessary, but not sufficient, for
the induction of NOS-2.
B binding (16) but inhibiting the induction of IRF-1.
This suggests that for NOS-2 expression, two factors, NF-
B and
IRF-1, are necessary but not sufficient alone, and their activation or induction implicates a redox-sensitive process, tyrosine kinases and
MAP kinases.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. C. J. Lowenstein for the generous gift of NOS-2 promoter construct, Dr. R. Pine for IRF-1 promoter constructs, Dr. D. S. McDevitt for critical reading, and H. Coet for photographic work.
| |
FOOTNOTES |
|---|
* This work was supported by grants from Association Française Retinitis Pigmentosa.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Développement,
Vieillissement et Pathologie de la Rétine, INSERM U450, 29 rue Wilhem, 75016 Paris, France. Tel.: 33-1-4525 2193; Fax:
33-1-4050-0195; E-mail: ogoureau{at}infobiogen.fr.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
NOS, nitric oxide
synthase;
NO, nitric oxide;
RPE, retinal pigmented epithelial;
LPS, lipopolysaccharide;
IFN-
, interferon-
;
NF-
B, nuclear factor
B;
PDTC, pyrrolidine dithiocarbamate;
IRF, interferon regulatory
factor;
ERK, extracellular signal-regulated kinase;
MAP, mitogen-activated protein;
DMEM, Dulbecco's modified Eagle's medium;
RMG, retinal Müller glial;
EMSA, electrophoretic mobility shift
assay;
PCR, polymerase chain reaction;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Blanchette, P. Pouliot, and M. Olivier Role of protein tyrosine phosphatases in the regulation of interferon-{gamma}-induced macrophage nitric oxide generation: implication of ERK pathway and AP-1 activation J. Leukoc. Biol., March 1, 2007; 81(3): 835 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Forget, D. J. Gregory, L. A. Whitcombe, and M. Olivier Role of Host Protein Tyrosine Phosphatase SHP-1 in Leishmania donovani-Induced Inhibition of Nitric Oxide Production. Infect. Immun., November 1, 2006; 74(11): 6272 - 6279. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Mason, J. Fiore, T. Kobayashi, K. S. Masek, Y. Choi, and C. A. Hunter TRAF6-Dependent Mitogen-Activated Protein Kinase Activation Differentially Regulates the Production of Interleukin-12 by Macrophages in Response to Toxoplasma gondii Infect. Immun., October 1, 2004; 72(10): 5662 - 5667. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jaramillo, P. H. Naccache, and M. Olivier Monosodium Urate Crystals Synergize with IFN-{gamma} to Generate Macrophage Nitric Oxide: Involvement of Extracellular Signal-Regulated Kinase 1/2 and NF-{kappa}B J. Immunol., May 1, 2004; 172(9): 5734 - 5742. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jaramillo, D. C. Gowda, D. Radzioch, and M. Olivier Hemozoin Increases IFN-{gamma}-Inducible Macrophage Nitric Oxide Generation Through Extracellular Signal-Regulated Kinase- and NF-{kappa}B-Dependent Pathways J. Immunol., October 15, 2003; 171(8): 4243 - 4253. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Zhang, A. Weber, B. Li, R. Lyons, P. R. Contag, A. F. Purchio, and D. B. West An Inducible Nitric Oxide Synthase-Luciferase Reporter System for In Vivo Testing of Anti-inflammatory Compounds in Transgenic Mice J. Immunol., June 15, 2003; 170(12): 6307 - 6319. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kobayashi, H. Miwa, S. Watanabe, M. Tsujii, R. N. Dubois, and N. Sato Cyclooxygenase-2 downregulates inducible nitric oxide synthase in rat intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, September 1, 2001; 281(3): G688 - G696. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kikuchi, L. Tenneti, and S. A. Lipton Role of p38 Mitogen-Activated Protein Kinase in Axotomy-Induced Apoptosis of Rat Retinal Ganglion Cells J. Neurosci., July 1, 2000; 20(13): 5037 - 5044. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Jiang and P. Brecher N-Acetyl-L-Cysteine Potentiates Interleukin-1{beta} Induction of Nitric Oxide Synthase : Role of p44/42 Mitogen-Activated Protein Kinases Hypertension, April 1, 2000; 35(4): 914 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. N. Jabbour, H. O. D. Critchley, L.-y. Yu-Lee, and S. C. Boddy Localization of Interferon Regulatory Factor-1 (IRF-1) in Nonpregnant Human Endometrium: Expression of IRF-1 Is Up-Regulated by Prolactin during the Secretory Phase of the Menstrual Cycle J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4260 - 4265. [Abstract] [Full Text] |
||||
![]() |
K. Bellmann, V. Burkart, J. Bruckhoff, H. Kolb, and J. Landry p38-dependent Enhancement of Cytokine-induced Nitric-oxide Synthase Gene Expression by Heat Shock Protein 70 J. Biol. Chem., June 9, 2000; 275(24): 18172 - 18179. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Casola, N. Burger, T. Liu, M. Jamaluddin, A. R. Brasier, and R. P. Garofalo Oxidant Tone Regulates RANTES Gene Expression in Airway Epithelial Cells Infected with Respiratory Syncytial Virus. ROLE IN VIRAL-INDUCED INTERFERON REGULATORY FACTOR ACTIVATION J. Biol. Chem., June 1, 2001; 276(23): 19715 - 19722. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. R. Sunil, A. J. Connor, Y. Guo, J. D. Laskin, and D. L. Laskin Activation of type II alveolar epithelial cells during acute endotoxemia Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L872 - L880. [Abstract] [Full Text] [PDF] |