JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faure, V.
Right arrow Articles by Goureau, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faure, V.
Right arrow Articles by Goureau, O.

J Biol Chem, Vol. 274, Issue 8, 4794-4800, February 19, 1999


Role of Interferon Regulatory Factor-1 and Mitogen-activated Protein Kinase Pathways in the Induction of Nitric Oxide Synthase-2 in Retinal Pigmented Epithelial Cells*

Violaine Faure, Christiane Hecquet, Yves Courtois, and Olivier GoureauDagger

From Développement, Vieillissement et Pathologie de la Rétine, U450, INSERM, Paris 75016, France

    ABSTRACT
Top
Abstract
Introduction
References

Bovine retinal pigmented epithelial cells express an inducible nitric oxide synthase (NOS-2) after activation with interferon-gamma (IFN-gamma ) and lipopolysaccharide (LPS). Experiments were performed to investigate the involvement of interferon regulatory factor-1 (IRF-1) on NOS-2 induction and its regulation by NOS-2 inhibitors such as pyrrolidine dithiocarbamate (PDTC), an antioxidant, or protein kinase inhibitors. Analysis by transitory transfections showed that LPS, alone or with IFN-gamma , stimulated activity of the murine NOS-2 promoter fragment linked upstream of luciferase and its suppression by PDTC and by the different protein kinase inhibitors, genistein (tyrosine kinase inhibitor), PD98059 (mitogen-actived protein (MAP) kinase kinase inhibitor), and SB 203580 (p38 MAP inhibitor). Using specific antibodies, we have confirmed that extracellular signal-regulated kinases and p38 MAP kinase were activated by LPS and IFN-gamma in retinal pigmented epithelial cells. Analysis by reverse transcriptase-polymerase chain reaction, Western blot, and electrophoretic mobility shift assay demonstrated that IFN-gamma alone or combined with LPS induced an accumulation of IRF-1 mRNA and protein and IRF-1 DNA binding. Transfections assays with the IRF-1 promoter showed an induction of this promoter with IFN-gamma , potentiated by LPS. The decrease of LPS/IFN-gamma -induced IRF-1 promoter activity, IRF-1 synthesis, and IRF-1 activation, by PDTC, genistein, PD98059, and SB 203580, could explained in part the inhibition of the NOS-2 induction by these compounds. Our results demonstrate that IRF-1 is necessary for NOS-2 induction by LPS and IFN-gamma and that its synthesis requires the involvement of a redox-sensitive step, the activation of tyrosine kinases, and extracellular signal-regulated kinases 1/2 and p38 MAP kinases.

    INTRODUCTION
Top
Abstract
Introduction
References

The enzyme nitric oxide synthase (NOS)1 transforms L-arginine into nitric oxide (NO) and L-citrulline in the presence of oxygen, NADPH, tetrahydrobiopterin, flavin mononucleotide, and FAD (1, 2). Three isoforms of NOS have been identified. Two isoforms are expressed continuously: NOS-1 is present essentially in neurons of the central and peripheral nervous system (3), and NOS-3 is localized originally in the plasma membrane of vascular endothelial cells (4). These enzymes, via an increase of the intracellular calcium concentration, produce small amounts of NO, which are involved in neurotransmission and vasorelaxation (3, 4). On the other hand, the inducible isoform, NOS-2, whose expression requires protein synthesis, is calcium- and calmodulin-independent and is generally expressed in different cell types only after transcriptional activation by endotoxins or cytokines (5, 6). NO produced by NOS-2 plays a role in immunological defenses as an antitumoral, antimicrobial, and antiviral agent (5-7). NO is also considered to be a mediator of autoimmune and inflammatory responses (5).

In the retina, Müller glial cells can express NOS-2 after endotoxin and cytokine stimulation (8). Retinal pigmented epithelial (RPE) cells from bovine (9), human (10), and murine (11, 12) species also contain the NOS-2 isoform. Indeed, we demonstrated previously that in bovine RPE cells, NOS-2 was induced by combined treatment with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma ) but not individually (9).

The regulation of NOS-2 induction is dependent on signal transduction activated by endotoxin, cytokines, and growth factors (6, 13). These signals are the result of the activation of serine/threonine or tyrosine kinases (14, 15). In bovine RPE cells, the accumulation of NOS-2 mRNA and the accompanying NO release induced by LPS and IFN-gamma require tyrosine kinase signaling and oxidative mechanisms (16). We have also demonstrated that the transcription factor nuclear factor-kappa B (NF-kappa B) is required in LPS/IFN-gamma -induced NOS-2 mRNA accumulation in bovine RPE cells (16) as in many different cell types such as murine macrophages (17, 18), vascular smooth muscle cells (19), or 3T3 fibroblasts (20). In RPE cells, the antioxidant pyrrolidinedithiocarbamate (PDTC) but not the tyrosine kinase inhibitor genistein reduces the nuclear translocation of NF-kappa B and the formation of NF-kappa B·DNA complexes induced by LPS/IFN-gamma (16). Furthermore, the fact that LPS/IFN-gamma -induced NOS-2 mRNA accumulation is sensitive to cycloheximide (16) suggests that transcriptional factors that depend on protein synthesis are required for NOS-2 induction in RPE cells. In this context, different studies have reported the necessity of interferon regulatory factor-1 (IRF-1), transcriptionally induced by IFN-gamma , in NOS-2 gene induction (21, 22). In bovine RPE cells, we have demonstrated that IRF-1 mRNA accumulation can be modulated after IFN-alpha and IFN-gamma treatment (23), also suggesting a role for this transcription factor in NOS-2 induction in RPE cells. In this study we have attempted to elucidate further the role of IRF-1 in NOS-2 induction in bovine RPE cells. Our results demonstrate that NOS-2 inducers (LPS/IFN-gamma ) increase IRF-1 mRNA and protein accumulation and induce the formation of IRF-1·DNA complexes. Analysis of the effects of NOS-2 inhibitors, genistein, PDTC, and inhibitors of extracellular signal-regulated kinase (ERK) and p38 mitogen-activated protein (MAP) kinase pathways reveal that these compounds block LPS/IFN-gamma -induced IRF-1 mRNA accumulation and suppress the LPS/IFN-gamma -stimulated activity of IRF-1.

    MATERIALS AND METHODS

Cell Cultures-- Bovine RPE cells were prepared as reported previously (9) and cultured in DMEM supplemented with 10% fetal calf serum (Life Technologies, Cergy-Pontoise, France), 2.5 µg/ml Fungizone, 50 µg/ml gentamycin, and 2 mM L-glutamine. Cultures were homogeneous and contained only RPE cells, as characterized by immunohistochemistry with anti-cytokeratin monoclonal antibody KL-1 (24). Cells at passages 1-5 were used for experiments. Retinal Müller glial (RMG) cells were cultured from eyeballs from mice at postnatal day 10 according to Hicks and Courtois (25). Early subcultures (up to three passages) were used for transfection experiments.

Chemicals, Cytokines, and Antibodies-- LPS from Salmonella typhimurium, PDTC, and genistein were obtained from Sigma (St. Quentin-Fallavier, France). The specific inhibitor of MAP kinase kinase (PD98059), the upstream kinase that phosphorylates and activates ERK kinases, and the two rabbit polyclonal antibodies against either total p38 MAP kinase or against only the phosphorylated form of p38 MAP kinase were obtained from BioLabs (Ozyme, Montigny-le-Bretonneux, France). The specific inhibitor of p38 MAP kinase (SB 203580) was obtained from Calbiochem (Meudon, France). The rabbit polyclonal antibody against IRF-1 and the two polyclonal antibodies against either total ERK2 or against only the phosphorylated forms of ERKs were obtained from Santa Cruz (TEBU, Le Perray en Yvelines, France). Bovine recombinant IFN-gamma was generously provided by Dr. T. Ramp (Ciba-Geigy, Basel, Switzerland). Mouse recombinant IFN-gamma was obtained from Peprotech (TEBU).

Assay for Nitrite-- Confluent RPE cells in 12-well culture plates (averaging 105 cells/well) were treated with LPS and IFN-gamma in the absence or presence of protein kinase inhibitors or PDTC in fresh DMEM and 10% fetal calf serum. After 72 h of incubation, the nitrite concentration was determined in cell-free culture supernatants using the spectrophotometric method based on the Griess reaction, as described previously (9).

Transfection Assays-- Promoters of the murine NOS-2 gene ligated upstream of the luciferase gene (gift of Dr. C. J. Lowenstein, Johns Hopkins University, Baltimore) (26) or of the murine IRF-1 gene ligated upstream of the luciferase gene (gift of Dr. R. Pine, Public Health Research Institute, New York) (27) were transfected into RPE cells using Lipofectin (Life Technologies) as described (28). The vector pGL2-basic (lacking a promoter) and the vector Promega pGL2-control (containing the SV40 early promoter and enhancer) served as negative and positive controls, respectively. Briefly, the transfection medium containing 10 µg of plasmid DNA and 60 µl of Lipofectin reagent in 2 ml of serum-free DMEM was incubated for 20 min at room temperature and then diluted with serum-free DMEM to a final volume of 5 ml and added to RPE cells, plated the day before. The transfection process occurred at 37 °C for 5 h, then 5 ml of DMEM containing 20% fetal calf serum was added to the cells. The cells were incubated for 60 h and stimulated during the last 12 h with different combinations of LPS and IFN-gamma . When used, PDTC and protein kinase inhibitors were added 2 h before the stimulation. After rinsing with phosphate-buffered saline, cells were lysed with reporter lysis buffer (Promega, Charbonnières, France), and cell extracts were used for luciferase assays with the Promega kit in a luminometer (EG&G Berthold, Evry, France). To control transfection efficiency, pSVbeta -galactosidase plasmid (Promega) was cotransfected with the luciferase reporter constructs in a 1:4 ratio. After stimulation, beta -galactosidase activities were measured by colorimetric assay using o-nitrophenyl-beta -D-galactopyranoside substrate in 96-well plate-reading spectrophotometer (Bio-Rad, Ivry/Seine, France). The results showed that the difference in the relative efficiency of transfection between constructs was negligible (data not shown).

Electrophoretic Mobility Shift Assay (EMSA)-- Whole cell extracts were prepared from cultured bovine RPE cells treated with LPS and IFN-gamma for 12 h for IRF-1 analysis. In some experiments, cells were pretreated for 2 h with PDTC or protein kinase inhibitor before stimulation. Cells were washed three times in cold phosphate-buffered saline and lysed as described previously (23). EMSAs with double-stranded consensus oligonucleotide IRF-1 (GGAAGCGAAAATGAAATTGACT) were performed as described previously (23).

Western Blot Analysis-- For MAP kinase analysis, RPE cells were serum starved for 48 h before stimulation. After a 2-h pretreatment with PDTC or protein kinase inhibitors, cells were treated with LPS and IFN-gamma for distinct periods, washed with phosphate-buffered saline, and then scraped into lysis buffer as described (23). Samples were centrifuged, and after one freeze/thaw cycle, 100 µg of supernatant proteins was subjected to SDS-polyacrylamide gel electrophoresis. Proteins were then transferred to an Immobilon membrane (Millipore, St. Quentin en Yvelines, France) by electroblotting. Western blot analysis using different polyclonal antibodies specific for IRF-1, total p38 MAP kinase, active p38 MAP kinase, ERK2, and active ERK kinases was performed as described previously (23).

Reverse Transcriptase-PCR Analysis of IRF-1 mRNA-- RPE cells were pretreated or not with PDTC and protein kinase inhibitors 2 h before stimulation with LPS and IFN-gamma . After different times of incubation, total RNA was extracted from treated cells by cell lysis in guanidinium isothiocyanate followed by phenol acid extraction. 1 µg of RNA was reverse transcribed for 90 min at 42 °C with 200 units of superscript Moloney murine leukemia virus reverse transcriptase (Life Technologies), using random hexamers. 2 µl of cDNA was added to each PCR, and amplification was performed with the oligonucleotide primers specific for mouse IRF-1, and GAPDH as described previously (23, 29).

Statistical Analysis-- Results were expressed as mean ± S.E. They were analyzed statistically by Mann-Whitney U test. p values less than 0.05 were considered as significant.

    RESULTS

Transfection of Bovine RPE Cells with the NOS-2 Promoter-- Because we have demonstrated previously that the accumulation of NOS-2 mRNA by the combination of LPS and IFN-gamma could be impaired by antioxidants and tyrosine kinase inhibitors (16), we attempted to establish whether these effects were the result of the prevention of NOS-2 gene transcription. For this, we decided to analyze the induction of the promoter of NOS-2 by transitory transfection of the NOS-2 promoter linked to the luciferase gene reporter. Transfected cells were stimulated for 12 h to measure the maximal luciferase activity (Fig. 1A). When bovine RPE cells were stimulated with LPS (bar 2), it appeared that there was an increase of the luciferase activity; none was observed in unstimulated cells (bar 1) or in cells stimulated with IFN-gamma alone (bar 3). When cells were stimulated with the combination of LPS and IFN-gamma (bar 4), the luciferase activity was similar to that observed with LPS alone. Control experiments revealed that no luciferase activity was detected in LPS/IFN-gamma -stimulated RPE cells transfected with the promoterless pGL2-basic construct, and a large increase of luciferase activity in unstimulated cells transfected with the SV40 early promoter/enhancer pGL2-control (data not shown). Pretreatment with PDTC (bars 5 and 7) or genistein (bars 6 and 8) markedly inhibited the increase of luciferase activity caused by LPS alone or LPS/IFN-gamma , demonstrating the role of tyrosine kinases and oxidative mechanisms in the induction of the NOS-2 gene in bovine RPE cells. To understand the apparent failure of the NOS-2 promoter to respond to IFN-gamma , murine RMG cells, expressing NOS-2 after LPS/IFN-gamma stimulation (8), were transfected with the same construct. Results reported in Fig. 1B show that IFN-gamma alone had no effect on luciferase activity (bar 3). A greater increase of the luciferase activity by LPS/IFN-gamma stimulation rather than by LPS alone was also seen (bar 4 compared with bar 2), suggesting a difference in the induction of the murine promoter in bovine RPE cells and murine RMG cells.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1.   Induction of NOS-2 promoter and regulation by genistein and PDTC. Panel A, bovine RPE cells, after transitory transfections, were pretreated without (bars 1-4) or with PDTC (bars 5 and 7) or genistein (bars 6 and 8) and then stimulated for 12 h without (bar 1) or with 1 µg/ml LPS (bar 2), 100 units/ml IFN-gamma (bar 3), LPS and IFN-gamma (bar 4), LPS with 10 µM PDTC (bar 5), LPS with 90 µM genistein (bar 6), LPS/IFN-gamma with PDTC (bar 7), or LPS/IFN-gamma with genistein (bar 8). Panel B, mouse RMG cells, after transitory transfections, were stimulated for 12 h without (bar 1) or with 1 µg/ml LPS (bar 2), 100 units/ml IFN-gamma (bar 3), or LPS/IFN-gamma (bar 4). In each case, the luciferase activity was measured as described under "Materials and Methods." The results are expressed as a multiplication factor compared with the luciferase activity detected in nontreated RPE cells. The means ± S.E. of three experiments run in triplicate are shown. **# p < 0.01 versus nontreated cells (bar 1) and ** p < 0.01 versus LPS/IFN-gamma treated cells (bar 4).

Inhibitory Effects of PD98059 and SB 203580 on Nitrite Accumulation and NOS-2-regulated Luciferase Activity Induced by LPS/IFN-gamma in RPE Cells-- To investigate the type of protein kinase pathway which could be involved in NOS-2 induction in RPE cells, a specific inhibitor of MAP kinase kinase (PD98059), the upstream kinase that phosphorylates and activates ERK kinases, and a specific inhibitor of the p38 MAP kinase (SB 203580), were first tested on NO production caused by LPS and IFN-gamma . As shown in Table I, the stimulated NO release determined from the nitrite level in the culture supernatants was decreased by 56 and 65% in the presence of PD98059 or SB 203580, respectively. Transfection experiments demonstrated that stimulation of the transfected cells with LPS/IFN-gamma after pretreatment with PD98059 reduced luciferase activity by 65% (Table I). Similar treatment with SB 203580 also prevented LPS/IFN-gamma -induced luciferase activity by 87% (Table I). These results suggest that the signaling pathway involved in NOS-2 induction is affected by inhibitors of ERK and p38 MAP kinase pathways.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Effect of genistein, PD98059, and SB 203580 on nitrite accumulation and NOS-2 promoter induction by LPS/IFN-gamma
For nitrite determination, measured by Griess reaction as described under "Materials and Methods," cells were incubated with or without 1 µg/ml LPS and 100 units/ml IFN-gamma in combination with 90 µM genistein, 10 µM PD98059, or 25 µM SB 203580 for 72 h. For the luciferase activity, after transitory transfections RPE cells were pretreated for 2 h without or with 90 µM genistein, 10 µM PD98059, or 25 µM SB 203580 and then stimulated with 1 µg/ml LPS and 100 units/ml IFN-gamma in combination with genistein, PD98059, or SB 203580 for 12 h. Values (means ± S.E.) are expressed as a percentage of maximal nitrite accumulation or maximal luciferase activity after LPS and IFN-gamma treatment. ** indicates p < 0.01, very significantly different from LPS/IFN-gamma .

Effects of Genistein and PDTC on IRF-1 Activation-- Because we have recently described the activation of IRF-1 by inducers of NOS-2 (23), we tested the effect of genistein and PDTC on LPS/IFN-gamma -induced IRF-1 activation. EMSA studies (Fig. 2) revealed the presence of one major and two minor DNA-protein complexes in extracts of RPE cells stimulated with IFN-gamma alone (lane 3) or by the coaddition of LPS and IFN-gamma (lane 5). These complexes were absent in control (lane 1) and in LPS-treated cells (lane 2). The formation of these complexes was prevented by the addition of excess unlabeled IRF-1 oligonucleotide (lane 7), demonstrating the specificity of the DNA-protein interaction. The middle darker complex appears to correspond to the probe complexed with IRF-1, whereas the fainter bands might correspond to complexes formed with other members of the IRF family such as IRF-2 (30). The amount of the complexes observed after the LPS/IFN-gamma stimulation decreased in the presence of genistein (lane 4) or PDTC (lane 6), indicating that tyrosine kinase inhibitor and antioxidant induced a decrease of IRF-1 binding to its specific DNA target sequence.


View larger version (129K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of genistein and PDTC on the IRF-1 activation. Cells were incubated for 12 h with different combinations of stimulants: medium alone (lane 1), 1 µg/ml LPS (lane 2), 100 units/ml IFN-gamma (lane 3), LPS/IFN-gamma and 90 µM genistein (lane 4), LPS/IFN-gamma (lanes 5 and 7), and LPS/IFN-gamma and 10 µM PDTC (lane 6). When used, PDTC and genistein were added to the cells 2 h before stimulation. Cell extracts were prepared and analyzed for IRF-1 binding activity in the EMSAs. Excess of unlabeled oligonucleotide was added to verify the specificity of complex formation (lane 7). The experiment shown represents one of three independent EMSAs that gave similar results.

Regulation of IRF-1 Protein and mRNA Accumulation in RPE Cells-- When cells were stimulated with LPS/IFN-gamma , but not in untreated cells, Western blot analysis revealed a transitory expression of the IRF-1 protein with a maximal signal observed at 24 h (Fig. 3A). Results depicted in Fig. 3B demonstrate that IFN-gamma alone was able to induce IRF-1 expression (lane 2). Furthermore, the addition of genistein (lane 4) or PDTC (lane 5) inhibited the IRF-1 protein accumulation by 53 and 66%, respectively, after 24 h of treatment with LPS/IFN-gamma (lane 3). By reverse transcriptase-PCR analysis (Fig. 4A), we also observed a rapid and transient IRF-1 mRNA accumulation in cells stimulated with IFN-gamma alone or with LPS/IFN-gamma , but not in unstimulated cells (lane 1). The IRF-1 mRNA accumulation was similar with IFN-gamma alone or when combined with LPS; the maximal signal was observed after 3 or 6 h of stimulation (Fig. 4B). Analysis of the effects of the different inhibitors of NOS-2 induction revealed that IRF-1 mRNA accumulation induced by LPS/IFN-gamma after 3 h of stimulation was decreased by pretreatment with PDTC or genistein (Fig. 5A). More specific analysis with the two distinct MAP kinase inhibitors (Fig. 5B) demonstrated that pretreatment with PD98059 (lane 3) or SB 203580 (lane 5) at a concentration that inhibited NOS-2 expression prevented the LPS/IFN-gamma -induced IRF-1 mRNA accumulation.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3.   Expression and regulation of IRF-1 protein. Panel A, cells were incubated without (lane 1) or with 1 µg/ml LPS and 100 units/ml IFN-gamma for 12 h (lane 2), 24 h (lane 3), or 48 h (lane 4). Cell lysates (100 µg) were subjected to SDS-polyacrylamide gel electrophoresis followed by immunoblotting with anti-IRF-1 antibody as described under "Materials and Methods." Panel B, cells were incubated for 24 h without (lane 1) or with 100 units/ml IFN-gamma (lane 2), IFN-gamma and 1 µg/ml LPS (lane 3), LPS/IFN-gamma and 90 µM genistein (lane 4), or LPS/IFN-gamma and 10 µM PDTC (lane 5). When used, PDTC and genistein were added to the cells 2 h before stimulation. In each case the experiment shown represents one of three independent blots that gave identical results. Evaluation of the IRF-1 protein signal by densitometric analysis is shown below.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4.   Kinetics of IRF-1 mRNA accumulation. Panel A, RPE cells were stimulated without (lane 1) or with 100 units/IFN-gamma alone (lanes 2, 4, 6, and 8) or combined with 1 µg/ml LPS (lanes 3, 5, 7, and 9). RNA was then harvested after 3 h (lanes 2 and 3), 6 h (lanes 4 and 5), 12 h (lanes 6 and 7), or 24 h (lanes 8 and 9) of stimulation, and the levels of IRF-1 and GAPDH mRNAs were assessed successively by reverse transcriptase-PCR as described under "Materials and Methods." The experiment shown in panel A represents one of three independent trials that gave similar results. Data in panel B are presented as the relative amount of IRF-1 normalized to the relative amount of GADPH, and values are the means ± S.E. of three independent experiments. bullet , IFN-gamma ; open circle , LPS + IFN-gamma .


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   Regulation of IRF-1 mRNA accumulation by PDTC, genistein, and specific MAP kinase inhibitors. Panel A, confluent RPE cells were stimulated without (lane 1) or with 100 units/ml IFN-gamma (lane 2), 1 µg/ml LPS and IFN-gamma (lane 3), LPS/IFN-gamma and 10 µM PDTC (lane 4), and LPS/IFN-gamma and 90 µM genistein (lane 5). Panel B, cells were stimulated without (lane 1) or with 1 µg/ml LPS and 100 units/ml IFN-gamma (lanes 2 and 4), LPS/IFN-gamma with 10 µM PD98059 (lane 3), and LPS/IFN-gamma with 25 µM SB 203580 (lane 5). When used, protein kinase inhibitors were added to the cells 2 h before stimulation. After 3 h, total RNA was isolated, and the levels of IRF-1 and GAPDH mRNAs were assessed by reverse transcriptase-PCR analysis as described under "Materials and Methods." Densitometric analysis of the IRF-1 band corrected for GAPDH expression is shown below. The experiment shown represents one of three independent trials that gave similar results.

Induction and Regulation of the Promoter of IRF-1-- To address whether the inhibitory effects of the antioxidants and protein kinase inhibitors on IRF-1 mRNA accumulation were caused by the prevention of IRF-1 gene transcription, we decided to analyze the induction of the promoter of IRF-1 (Fig. 6) by transitory transfection assays with two different constructs of murine reporter gene of the IRF-1 promoter coupled to luciferase (27). When bovine RPE cells were not stimulated (bar 1) or stimulated with LPS alone (bar 2), no increase of luciferase activity was detected. Stimulation with IFN-gamma (bar 3) increased luciferase activity and was increased greatly by the coaddition of LPS in the culture medium (bar 4). The addition of genistein (bar 5) or PDTC (bar 6) largely decreased the luciferase activity induced by LPS/IFN-gamma . Furthermore, the LPS/IFN-gamma -induced luciferase activity was reduced in cells previously coincubated with PD98059 (bar 7) or with SB 203580 (bar 8) at concentrations that prevented IRF-1 mRNA accumulation. Taken together, these results demonstrated that PDTC and protein kinase inhibitors prevented the induction of IRF-1 gene and the accompanying IRF-1 expression and activity.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   Induction of IRF-1 promoter and regulation by PDTC, genistein, and MAP kinase inhibitors. Bovine RPE cells, after transitory transfections with the (-3.4/+0.168) IRF-1 promoter Luc construct (panel A) or the (-0.160/+0.168) IRF-1 promoter Luc construct (panel B), were stimulated for 12 h without (bars 1) or with 1 µg/ml LPS (bars 2), 100 units/ml IFN-gamma (bars 3), LPS and IFN-gamma (bars 4), LPS/IFN-gamma with 90 µM genistein (bars 5), LPS/IFN-gamma with 10 µM PDTC (bars 6), LPS/IFN-gamma with 10 µM PD98059 (bars 7), or LPS/IFN-gamma with 25 µM SB 203580 (bars 8). When used, PDTC and protein kinase inhibitors were added to the cells 2 h before stimulation. The luciferase activity was measured as described under "Materials and Methods." The results are the mean values of three independent experiments run in triplicate. star # indicates p < 0.05 versus nontreated cells (bars 1), star  indicates p < 0.05 versus LPS/IFN-gamma -treated cells (bars 4), star star # is p < 0.01 versus nontreated cells (bars 1), and star star is p < 0.01 versus LPS/IFN-gamma -treated cells (bars 4).

Activation of ERK and p38 MAP Kinase by LPS and IFN-gamma in RPE Cells-- To investigate further the association of ERK and p38 MAP kinase activation with NOS-2 induction in RPE cells, serum-starved RPE cells were treated with LPS and IFN-gamma alone or combined. The activation of ERK and p38 MAP kinase was determined by Western blot analysis, using antibodies specific for the activated forms of the two kinases. Fig. 7A shows that p38 MAP kinase phosphorylation was observed only after LPS treatment (lane 3) but not after IFN-gamma stimulation (lane 2) or in unstimulated cells (lane 1). The coaddition of LPS and IFN-gamma induced maximal accumulation of active phosphorylated p38 MAP kinase (lane 4), which was largely prevented by genistein (lane 5) and by SB 203580 (lane 6). In contrast, stimulation of cells with IFN-gamma (Fig. 7B, lane 2) or with LPS (lane 3) induced ERK1/2 phosphorylation as noted by the appearance of the characteristic doublet of 42 and 44 kDa, which was absent in unstimulated cells (lane 1). Maximal phosphorylation occurred with the combined stimulation of LPS and IFN-gamma (lane 4). This LPS/IFN-gamma -induced phosphorylation of ERK1/2 was decreased in the presence of genistein (lane 5). Pretreatment with PD98059 (lane 6), the MEK1 inhibitor, resulted in an inhibition of ERK1/2 activation caused by LPS/IFN-gamma .


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 7.   Western blot of phosphorylated p38 MAP kinase (panel A) and ERK1/2 (panel B). Serum-starved RPE cells were treated for 15 min without (lanes 1) or with 100 units/ml IFN-gamma (lanes 2), 1 µg/ml LPS (lanes 3), LPS/IFN-gamma (lanes 4), LPS/IFN-gamma with 90 µM genistein (lanes 5), or LPS/IFN-gamma with either 25 µM SB 203580 (lane 6 in panel A) or 10 µM PD98059 (lane 6 in panel B). When used, protein kinase inhibitors were added to the cells 2 h before stimulation. After 15 min of stimulation, cells were lysed and subjected to immunoblot analysis using antibodies specific for the active p38 MAP kinase (panel A, top) or for the active ERK kinases (panel B, top), as described under "Materials and Methods." Parallel blots were run, using the antibodies recognizing the total p38 MAP kinase (panel A, bottom) or total ERK2 (panel B, bottom). In each case the experiment shown represents one of three independent blots that gave identical results.


    DISCUSSION

We have demonstrated that induction of NOS-2 activity in RPE cells by LPS/IFN-gamma implicates a transcriptional mechanism dependent upon the IFN-gamma -activated factor, IRF-1, and that transcription of IRF-1 and NOS-2 can be regulated by different MAP kinase pathways and oxidative mechanisms.

Transfection analysis with luciferase-reporter constructs containing the promoter of NOS-2 demonstrated that LPS/IFN-gamma mediated transcriptional regulation of NOS-2 gene expression, explaining in part the accumulation of NOS-2 mRNA after LPS and IFN-gamma stimulation (16, 23). In bovine RPE cells, LPS, but not IFN-gamma alone, increased murine NOS-2 promoter activity, as reported previously in murine macrophages with the same promoter (18, 26). However, in contrast to murine macrophages, IFN-gamma did not potentiate LPS-induced promoter induction in bovine RPE cells. It could be the result of a species effect because in transfection experiments of this murine promoter in RMG cells from mice, we observed a potentiation of the induction of the promoter by the addition of IFN-gamma with LPS. The lack of an IFN-gamma effect on the murine-derived constructs in bovine cells suggests the absence of one or more nuclear factors in bovine RPE cells which are required for maximal expression of the murine promoter or the existence of factors in bovine cells which could not recognize the murine promoter. This incapacity of the murine NOS-2 promoter to respond to IFN-gamma in bovine RPE cells is similar to the hyporesponsiveness of the human NOS-2 promoter transfected in murine macrophages to IFN-gamma , alone or combined with other cytokines (31, 32).

The inhibition of LPS/IFN-gamma -induced NOS-2 promoter activity by genistein and by PDTC, reported previously as inhibitors of NOS-2 mRNA accumulation in RPE cells (16), confirmed the direct involvement of tyrosine kinase and oxidative pathways in the induction of the NOS-2 gene in bovine RPE cells. We have identified some protein kinases involved in the LPS/IFN-gamma -induced NOS-2 pathway by using specific antibodies and specific inhibitors of MAP kinases. We demonstrated that ERK1/2, described previously as a target of growth factors in RPE cells (33, 34), was also activated by the inducers of NOS-2 (LPS and IFN-gamma ) and that LPS was also able to activate p38 MAP kinase. The inhibition of LPS/IFN-gamma -induced luciferase activity related to the NOS-2 promoter construct and of LPS/IFN-gamma -induced NO production by specific inhibitors of either the ERK1/2 pathway (PD98059) or the p38 MAP kinase pathway (SB 203580) suggested the participation of these two MAP kinase pathways in the induction of NOS-2, as described recently in brain astrocytes and microglial cells (35). In cardiomyocytes, interleukin-1beta /IFN-gamma -induced NOS-2 mRNA synthesis also involved activation of the ERK pathway (36), whereas in DLD-1 cells neither ERK1/2 nor p38 MAP kinase was required for the regulation of NOS-2 mRNA by IFN-gamma /interleukin-1beta /tumor necrosis factor-alpha (37). These differences reflect probably the cell type-, species-, and stimuli-specific regulation of the NOS-2 gene.

The sensitivity of LPS/IFN-gamma -induced NOS-2 mRNA accumulation to cycloheximide (16) and the transcriptional activation of IRF-1 after IFN-gamma stimulation (23) indicate the importance of this factor in the induction of NOS-2 in RPE cells, as demonstrated previously in other cell types (21, 22, 38-40). Reverse transcriptase-PCR analysis confirmed that IRF-1 mRNA is synthesized de novo in contrast to IRF-2, its repressor constitutively expressed in RPE cells (23). Because these two factors are similar but apparently compete for the same cis-acting recognition sequences, leading to opposite effects on gene transcription (30), the accumulation of IRF-1 and the decrease of IRF-2 after LPS/IFN-gamma treatment could favor the interaction of IRF-1 with the NOS-2 promoter, resulting in an activation of NOS-2 gene transcription. Furthermore, we demonstrated by Western blot and EMSA that IFN-gamma induced IRF-1 protein accumulation and the formation of DNA·IRF-1 binding sequence complexes. These effects of IFN-gamma are attributable to activation of the IRF-1 gene by IFN-gamma in RPE cells because it was able to increase luciferase activity in transfection experiments with the IRF-1 promoter constructs. Furthermore, LPS, which is required for NOS-2 induction, slightly potentiated IFN-gamma -induced IRF-1 gene transcription and the consecutive IRF-1 activation but had no effect by itself on the induction of IRF-1. This suggests an effect of LPS on the induction of the IRF-1 promoter only when cells are already stimulated with IFN-gamma , as suggested in HepG2 cells transfected with the same plasmids, where tumor necrosis factor-alpha , ineffective by itself, largely potentiated the IFN-gamma response (27).

By using the nonspecific tyrosine kinase inhibitor, genistein, we demonstrated that induction of the IRF-1 gene and IRF-1 activation required the action of tyrosine kinases. This phenomenon could be explained by an inhibition of the phosphorylation of one component of the JAK/STAT pathway, a transductory signal already described for the IFN-gamma (14). As concerns the MAP kinases, our results with specific inhibitors demonstrated that ERK1/2 and p38 MAP kinase are partially involved in IRF-1 induction. However, because MAP kinases are required for IRF-1 induction, they are not sufficient since LPS that activated ERK1/2 and p38 MAP kinase had no effect on IRF-1 promoter activity. An additional tyrosine kinase-dependent step, such as involves JAK kinases, suggested above, could be necessary for IRF-1 induction. Furthermore, we have demonstrated that the antioxidant PDTC, which blocked NOS-2 promoter activation (Fig. 1) and NOS-2 mRNA accumulation (16), is also able to prevent IRF-1 promoter activation, IRF-1 mRNA and protein accumulation, and IRF-1-DNA interactions. The presence of consensus sequences for NF-kappa B in the IRF-1 promoter (27) could be responsible for this redox-sensitive step in IRF-1 gene transcription. An important finding in the present study is that although IFN-gamma alone induced binding of IRF-1, it failed to induce NOS-2 mRNA and nitrite production. However, inhibition of LPS/IFN-gamma -induced IRF-1 activation partially prevented NOS-2 induction, demonstrating that induction of IRF-1 is required to induce NOS-2 in bovine RPE cells. In this context, RPE cells are very similar to other cells types, such as macrophages (21, 22) or islet cells (40), where IRF-1 has been reported to be necessary, but not sufficient, for the induction of NOS-2.

Our study suggests the existence of different intracellular signaling pathways in NOS-2 induction in RPE cells because tyrosine kinase inhibitors blocked NOS-2 mRNA accumulation, without affecting NF-kappa B binding (16) but inhibiting the induction of IRF-1. This suggests that for NOS-2 expression, two factors, NF-kappa B and IRF-1, are necessary but not sufficient alone, and their activation or induction implicates a redox-sensitive process, tyrosine kinases and MAP kinases.

    ACKNOWLEDGEMENTS

We thank Dr. C. J. Lowenstein for the generous gift of NOS-2 promoter construct, Dr. R. Pine for IRF-1 promoter constructs, Dr. D. S. McDevitt for critical reading, and H. Coet for photographic work.

    FOOTNOTES

* This work was supported by grants from Association Française Retinitis Pigmentosa.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Développement, Vieillissement et Pathologie de la Rétine, INSERM U450, 29 rue Wilhem, 75016 Paris, France. Tel.: 33-1-4525 2193; Fax: 33-1-4050-0195; E-mail: ogoureau{at}infobiogen.fr.

    ABBREVIATIONS

The abbreviations used are: NOS, nitric oxide synthase; NO, nitric oxide; RPE, retinal pigmented epithelial; LPS, lipopolysaccharide; IFN-gamma , interferon-gamma ; NF-kappa B, nuclear factor kappa B; PDTC, pyrrolidine dithiocarbamate; IRF, interferon regulatory factor; ERK, extracellular signal-regulated kinase; MAP, mitogen-activated protein; DMEM, Dulbecco's modified Eagle's medium; RMG, retinal Müller glial; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    REFERENCES
Top
Abstract
Introduction
References
  1. Marletta, M. A. (1994) Cell 78, 927-930[CrossRef][Medline] [Order article via Infotrieve]
  2. Knowles, R. G., and Moncada, S. (1994) Biochem. J. 298, 249-258
  3. Christopherson, K. S., and Bredt, D. S. (1997) J. Clin. Invest. 100, 2424-2429[Medline] [Order article via Infotrieve]
  4. Förstermann, U., Closs, E. I., Pollock, J. S., Nakane, M., Schwarz, P., Gath, I., and Kleinert, H. (1994) Hypertension 23, 1121-1131[Abstract]
  5. MacMicking, J., Xie, Q., and Nathan, C. (1997) Annu. Rev. Immunol. 15, 323-350[CrossRef][Medline] [Order article via Infotrieve]
  6. Nathan, C. (1997) J. Clin. Invest. 100, 2417-2423[Medline] [Order article via Infotrieve]
  7. Fang, F. C. (1997) J. Clin. Invest. 99, 2818-2825[Medline] [Order article via Infotrieve]
  8. Goureau, O., Hicks, D., Courtois, Y., and de Kozak, Y. (1994) J. Neurochem. 63, 310-317[Medline] [Order article via Infotrieve]
  9. Goureau, O., Lepoivre, M., Becquet, F., and Courtois, Y. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4276-4280[Abstract/Free Full Text]
  10. Goureau, O., Hicks, D., and Courtois, Y. (1994) Biochem. Biophys. Res. Commun. 198, 120-126[CrossRef][Medline] [Order article via Infotrieve]
  11. Sparrow, J. R., Nathan, C., and Vodovotz, Y. (1994) Exp. Eye Res. 59, 129-139[CrossRef][Medline] [Order article via Infotrieve]
  12. Liversidge, J., Grabowsky, P., Ralston, S., Benjamin, N., and Forrester, J. V. (1994) Immunology 83, 404-409[Medline] [Order article via Infotrieve]
  13. Goureau, O., Becquet, F., and Courtois, Y. (1995) in Degenerative Diseases of the Retina (Anderson, R. E., La Vail, M. M., and Hollyfield, J. G., eds), pp. 61-68, Plenum Publishing Corp., New York
  14. Darnell, J. E., Kerr, I. M., and Stark, G. R. (1994) Science 264, 1415-1421[Abstract/Free Full Text]
  15. Ulevitch, R. J., and Tobias, P. S. (1994) Curr. Opin. Immunol. 6, 125-130[CrossRef][Medline] [Order article via Infotrieve]
  16. Faure, V., Courtois, Y., and Goureau, O. (1998) Am. J. Physiol. 275, C208-C215[Abstract/Free Full Text]
  17. Xie, Q., Kashiwabara, Y., and Nathan, C. (1994) J. Biol. Chem. 269, 4705-4708[Abstract/Free Full Text]
  18. Murphy, W. J., Muroi, M., Zhang, C. X., Suzuki, T., and Russell, S. W. (1996) J. Endotoxin Res. 3, 381-393
  19. Spink, J., Cohen, J., and Evans, T. J. (1995) J. Biol. Chem. 270, 29541-29547[Abstract/Free Full Text]
  20. Kleinert, H., Euchenhofer, C., Ihrig-Biedert, I., and Förstermann, U. (1996) Mol. Pharmacol. 49, 15-21[Abstract]
  21. Kamijo, R., Harada, H., Matsuyama, T., Bosland, M., Gerecitano, J., Shapiro, D., Le, J., Koh, S. I., Kimura, T., Green, S. J., Mak, T. W., Taniguchi, T., and Vilcek, J. (1994) Science 263, 1612-1615[Abstract/Free Full Text]
  22. Martin, E., Nathan, C., and Xie, Q. W. (1994) J. Exp. Med. 180, 977-984[Abstract/Free Full Text]
  23. Faure, V., Courtois, Y., and Goureau, O. (1997) J. Biol. Chem. 272, 32169-32175[Abstract/Free Full Text]
  24. Becquet, F., Goureau, O., Soubrane, G., Coscas, G., Courtois, Y., and Hicks, D. (1994) Exp. Cell Res. 212, 374-382[CrossRef][Medline] [Order article via Infotrieve]
  25. Hicks, D., and Courtois, Y. (1992) Exp. Eye Res. 51, 119-129
  26. Lowenstein, C. J., Alley, E. W., Raval, P., Snowman, A. M., Snyder, S. H., Russell, S. W., and Murphy, W. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9730-9734[Abstract/Free Full Text]
  27. Pine, R. (1997) Nucleic Acids Res. 25, 4346-4354[Abstract/Free Full Text]
  28. Renaud, F., Desset, S., Oliver, L., Gimenez-Gallego, G., Van Obberghen, E., Courtois, Y., and Laurent, M. (1996) J. Biol. Chem. 271, 2801-2811[Abstract/Free Full Text]
  29. Goureau, O., Bellot, J., Thillaye, B., Courtois, Y., and de Kozak, Y. (1995) J. Immunol. 154, 6518-6523[Abstract]
  30. Harada, H., Fujita, T., Miyamoto, M., Kimura, Y., Maruyama, M., Furia, A., Miyata, T., and Taniguchi, T (1989) Cell 58, 729-739[CrossRef][Medline] [Order article via Infotrieve]
  31. Spitsin, S. V., Koprowski, H., and Michaels, F. H. (1996) Mol. Med. 2, 226-235[Medline] [Order article via Infotrieve]
  32. Zhang, X., Laubach, V. E., Alley, E. W., Edwards, K. A., Sherman, P. A., Russell, S. W., and Murphy, W. J. (1996) J. Leukocyte Biol. 59, 575-585[Abstract]
  33. Hinton, D. R., He, S., Graf, K., Yang, D., Hsueh, W. A., Ryan, S. J., and Law, R. E. (1998) Exp. Cell Res. 239, 11-15[CrossRef][Medline] [Order article via Infotrieve]
  34. Guillonneau, X., Bryckaert, M., Launay-Longo, C., Courtois, Y., and Mascarelli, F. (1998) J. Biol. Chem. 273, 22367-22373[Abstract/Free Full Text]
  35. Bhat, N. R., Zhang, P., Lee, J. C., and Hogan, E. L. (1998) J. Neurosci. 18, 1633-1641[Abstract/Free Full Text]
  36. Singh, K., Balligand, J., Fischer, T. A., Smith, T. W., and Kelly, R. A. (1996) J. Biol. Chem. 271, 1111-1117[Abstract/Free Full Text]
  37. Kleinert, H., Euchenhofer, C., Fritz, G., Ihrig-Biedert, I., and Förstermann, U. (1998) Br. J. Pharmacol. 123, 1716-1722[CrossRef][Medline] [Order article via Infotrieve]
  38. Hecker, M., Preiss, C., Klemm, P., and Busse, R. (1996) Br. J. Pharmacol. 118, 2178-2184[Medline] [Order article via Infotrieve]
  39. Fujimura, M., Tominaga, T., Kato, I., Takasawa, S., Kawase, M., Taniguchi, T., Okamoto, H., and Yoshimoto, T. (1997) Brain Res. 759, 247-250[CrossRef][Medline] [Order article via Infotrieve]
  40. Flodström, M., and Eizirik, D. L. (1997) Endocrinology 138, 2747-2753[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
J. Blanchette, P. Pouliot, and M. Olivier
Role of protein tyrosine phosphatases in the regulation of interferon-{gamma}-induced macrophage nitric oxide generation: implication of ERK pathway and AP-1 activation
J. Leukoc. Biol., March 1, 2007; 81(3): 835 - 844.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
G. Forget, D. J. Gregory, L. A. Whitcombe, and M. Olivier
Role of Host Protein Tyrosine Phosphatase SHP-1 in Leishmania donovani-Induced Inhibition of Nitric Oxide Production.
Infect. Immun., November 1, 2006; 74(11): 6272 - 6279.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. J. Mason, J. Fiore, T. Kobayashi, K. S. Masek, Y. Choi, and C. A. Hunter
TRAF6-Dependent Mitogen-Activated Protein Kinase Activation Differentially Regulates the Production of Interleukin-12 by Macrophages in Response to Toxoplasma gondii
Infect. Immun., October 1, 2004; 72(10): 5662 - 5667.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Jaramillo, P. H. Naccache, and M. Olivier
Monosodium Urate Crystals Synergize with IFN-{gamma} to Generate Macrophage Nitric Oxide: Involvement of Extracellular Signal-Regulated Kinase 1/2 and NF-{kappa}B
J. Immunol., May 1, 2004; 172(9): 5734 - 5742.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Jaramillo, D. C. Gowda, D. Radzioch, and M. Olivier
Hemozoin Increases IFN-{gamma}-Inducible Macrophage Nitric Oxide Generation Through Extracellular Signal-Regulated Kinase- and NF-{kappa}B-Dependent Pathways
J. Immunol., October 15, 2003; 171(8): 4243 - 4253.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Zhang, A. Weber, B. Li, R. Lyons, P. R. Contag, A. F. Purchio, and D. B. West
An Inducible Nitric Oxide Synthase-Luciferase Reporter System for In Vivo Testing of Anti-inflammatory Compounds in Transgenic Mice
J. Immunol., June 15, 2003; 170(12): 6307 - 6319.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
O. Kobayashi, H. Miwa, S. Watanabe, M. Tsujii, R. N. Dubois, and N. Sato
Cyclooxygenase-2 downregulates inducible nitric oxide synthase in rat intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, September 1, 2001; 281(3): G688 - G696.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Kikuchi, L. Tenneti, and S. A. Lipton
Role of p38 Mitogen-Activated Protein Kinase in Axotomy-Induced Apoptosis of Rat Retinal Ganglion Cells
J. Neurosci., July 1, 2000; 20(13): 5037 - 5044.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
B. Jiang and P. Brecher
N-Acetyl-L-Cysteine Potentiates Interleukin-1{beta} Induction of Nitric Oxide Synthase : Role of p44/42 Mitogen-Activated Protein Kinases
Hypertension, April 1, 2000; 35(4): 914 - 918.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. N. Jabbour, H. O. D. Critchley, L.-y. Yu-Lee, and S. C. Boddy
Localization of Interferon Regulatory Factor-1 (IRF-1) in Nonpregnant Human Endometrium: Expression of IRF-1 Is Up-Regulated by Prolactin during the Secretory Phase of the Menstrual Cycle
J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4260 - 4265.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Bellmann, V. Burkart, J. Bruckhoff, H. Kolb, and J. Landry
p38-dependent Enhancement of Cytokine-induced Nitric-oxide Synthase Gene Expression by Heat Shock Protein 70
J. Biol. Chem., June 9, 2000; 275(24): 18172 - 18179.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Casola, N. Burger, T. Liu, M. Jamaluddin, A. R. Brasier, and R. P. Garofalo
Oxidant Tone Regulates RANTES Gene Expression in Airway Epithelial Cells Infected with Respiratory Syncytial Virus. ROLE IN VIRAL-INDUCED INTERFERON REGULATORY FACTOR ACTIVATION
J. Biol. Chem., June 1, 2001; 276(23): 19715 - 19722.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
V. R. Sunil, A. J. Connor, Y. Guo, J. D. Laskin, and D. L. Laskin
Activation of type II alveolar epithelial cells during acute endotoxemia
Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L872 - L880.
[Abstract] [Full Text] [PDF]