|
J Biol Chem, Vol. 274, Issue 8, 4954-4961, February 19, 1999
The -700/-310 Fragment of the Apolipoprotein A-IV Gene Combined
with the -890/-500 Apolipoprotein C-III Enhancer Is Sufficient to
Direct a Pattern of Gene Expression Similar to That for the Endogenous
Apolipoprotein A-IV Gene*
Johanne
Le Beyec §,
Valérie
Chauffeton ,
Horng-Yuan
Kan¶,
Pierre-Luc
Janvier ,
Charlotte
Cywiner-Golenzer ,
François-Patrick
Chatelet ,
Athina Despina
Kalopissis ,
Vassilis
Zannis¶,
Jean
Chambaz ,
Martine
Pinçon-Raymond , and
Philippe
Cardot
From U.505 INSERM and UPRESA CNRS 7079, 15 rue de
l'Ecole de Médecine, 75006 Paris, France and the ¶ Section
of Molecular Genetics, Cardiovascular Institute, Boston University
Medical Center, Boston, Massachusetts 02118-2394
 |
ABSTRACT |
Spatial gene expression in the intestine is
mediated by specific regulatory sequences. The three genes of the
apoA-I/C-III/A-IV cluster are expressed in the intestine following
cephalocaudal and crypt-to-villus axes. Previous studies have shown
that the -780/-520 enhancer region of the apoC-III gene directs the
expression of the apoA-I gene in both small intestinal villi and
crypts, implying that other unidentified elements are necessary for a normal intestinal pattern of apoA-I gene expression. In this study, we
have characterized transgenic mice expressing the chloramphenicol acetyltransferase gene under the control of different regions of the
apoC-III and apoA-IV promoters. We found that the -890/+24 apoC-III
promoter directed the expression of the reporter gene in crypts and
villi and did not follow a cephalocaudal gradient of expression. In
contrast, the 700/+10 apoA-IV promoter linked to the 500/ 890
apoC-III enhancer directed the expression of the reporter gene in
enterocytes with a pattern of expression similar to that of the
endogenous apoA-IV gene. Furthermore, linkage of the 700/ 310
apoA-IV distal promoter region to the 890/+24 apoC-III promoter was
sufficient to restore the appropriate pattern of intestinal expression
of the reporter gene. These findings demonstrate that the 700/ 310
distal region of the apoA-IV promoter contains regulatory elements
that, in combination with proximal promoter elements and the
500/ 890 enhancer, are necessary and sufficient to restrict apoC-III
and apoA-IV gene expression to villus enterocytes of the small
intestine along the cephalocaudal axis.
 |
INTRODUCTION |
The mammalian small intestine is lined with a constantly renewing
epithelium that is compartmentalized into a proliferative undifferentiated zone located in intestinal crypts and a
nonproliferative differentiated zone located in the villi. The
epithelium is composed of four specialized cell types that arise from
stem cells located just above the base of the crypts (1). Enterocytes,
mucus-producing goblet cells, and enteroendocrine cells differentiate
as they migrate to the top of the villi, whereas Paneth cells
differentiate and migrate to the base of the crypts. Each lineage
completes its differentiation program through an orderly migration (2, 3). Enterocytes are the most abundant epithelial cells in the small
intestine and express a variety of specific genes as they exit the
crypt compartment. Despite the rapid renewal of the intestinal epithelium, numerous genes display a specific pattern of expression in
enterocytes from the proximal to the distal intestine and from the
crypt to the villus tip (4, 5).
Several studies performed with transgenic mice expressing a human gene
or a reporter gene have established that spatial gene expression in the
intestine is supported by specific regulatory sequences (6-11).
Transcription of the intestinal fatty acid-binding protein
(FABP-I)1 gene is strictly
confined to the intestinal epithelium. The FABP-I promoter ( 103/+28)
is sufficient to direct transcription of the gene along the
duodenum-to-colon axis. However, upstream sequences are needed to
confine FABP-I expression to differentiated enterocytes of the villus.
In particular, a 20-bp element located between nucleotides -263 and
-244 of the promoter prevents FABP-I expression in crypt cells (6,
10). Liver and intestinal human apoB gene expression is governed by
distinct regulatory regions. Intestinal expression requires a very
distant element located between 33 and 70 kb 5' upstream from the apoB
gene (11). Similarly, the 256/+22 proximal promoter of the human
apoA-I gene is sufficient to direct its hepatic transcription. However,
the sequences responsible for the intestinal expression reside 9 kb
downstream from the human apoA-I gene (12).
The apoA-I gene is located on chromosome 11 in a cluster that also
contains the apoC-III and apoA-IV genes. The human apoA-I gene is
expressed at similar levels in the intestine and liver, whereas the
human apoC-III gene is expressed predominantly in the liver and to a
lesser extent in the intestine (13). The apoA-IV gene is mainly
expressed in the intestine in humans and non-human primates. ApoA-IV is
also expressed in the liver in mice (13, 14). The apoA-I and apoA-IV
genes are transcribed in the same direction, whereas the apoC-III gene
is transcribed in the opposite direction. The apoC-III/A-IV intergenic
region therefore constitutes a common 6.6-kb 5'-flanking sequence for these two genes.
Since the three genes are expressed at different levels in the liver
and intestine, this gene cluster represents an interesting model to
decipher the molecular mechanisms involved in the determination of
tissue-specific expression. The intestinal expression of the cluster is
entirely restricted to enterocytes as they emerge from the crypt (15,
16) and decreases from the proximal to the distal small intestine (14).
A preliminary report indicated that the apoC-III/A-IV intergenic region
allows the intestinal expression of the apoA-IV gene in transgenic mice
(17). More recently, Bisaha et al. (16) have demonstrated
that the 890/ 500 apoC-III enhancer is sufficient to direct the
intestinal expression of the apoA-I gene. Based on these in
vivo studies and previous in vitro promoter studies
performed by us and others, we hypothesized that common regulatory
sequences control the intestinal expression of the three genes of the cluster.
In this study, we generated transgenic mice expressing the CAT reporter
gene under the control of specific regulatory sequences of the
apoA-IV/C-III intergenic region. Analysis of these mouse lines showed
that the 700/ 310 apoA-IV promoter in combination with the
500/ 890 apoC-III enhancer is sufficient for correct gene expression
in the enterocytes along the proximal-to-distal and crypt-to-villus axes.
 |
MATERIALS AND METHODS |
Generation of Transgenic Mice--
The different transgenes used
in this study are shown in Fig. 1. The transgenes C3-CAT and eC3-A4-CAT
were obtained by digestion of the pUCSH-CAT plasmid containing the
890/+24 5'-flanking region of the human apoC-III gene or the
-700/+10 apoA-IV promoter region fused with the 500/ 890 apoC-III
enhancer region, respectively, with XbaI and
BamHI (see Fig. 1A). These plasmids have
previously been described (18, 19).
The transgene dA4-C3-CAT was obtained from a plasmid in which the human
890/+24 apoC-III promoter region fused upstream from the CAT reporter
gene was linked in the opposite direction to the 700/+10 apoA-IV
promoter region fused with the lacZ reporter gene. This
vector was constructed as follows. The 700/+10 apoA-IV promoter
region was amplified by polymerase chain reaction using nucleotide
primers from 700 to 680 (coding strand) and from +10 to 10
(noncoding strand) containing a SalI and a
HindIII restriction site, respectively. The resulting
apoA-IV fragment was cloned upstream from the lacZ gene
fused to a nuclear localization sequence (20); the C3-CAT fragment was
then inserted in the BamHI and XbaI sites,
upstream from the apoA-IV promoter in the opposite direction. The
dA4-C3-CAT transgene was excised from the plasmid by digestion with
BamHI and SmaI at a site located at nucleotide
-310 in the apoA-IV promoter. Transgenes were dissolved at a
concentration of 4 ng/µl and microinjected into fertilized eggs from
C57BL/6J × CBA/J females mated with males of the same strain
using established procedures (21).
Characterization of Transgenic Mice--
DNA was extracted from
the tails of 10-15-day-old pups and then analyzed by polymerase chain
reaction using oligonucleotide primers corresponding to sequences +163
to +189 (coding strand) and +696 to +670 (noncoding strand) of the CAT
gene. Founder mice were then further analyzed by Southern blotting, and
the copy number was estimated by densitometric scanning of
autoradiograms as described previously (21). Positive founder
F0 mice were outbred to generate lines of heterozygous mice.
CAT Assay--
Individual tissue samples were homogenized and
assayed for CAT activity as described previously (22, 23). The
concentration of soluble protein was determined by the Bio-Rad protein
assay. The percentage of chloramphenicol converted to acetylated forms was determined either by densitometric scanning of autoradiograms or by
scraping individual spots from the thin-layer chromatogram and counting
in a scintillation counter. CAT activity is expressed as pmol of acetyl
chloramphenicol generated per min/mg of protein after subtracting the
background for each tissue from control mice, which do not express the
CAT gene.
Preparation of Radiolabeled Probes--
Specific 300-bp
cDNAs encoding the mouse apoC-III and apoA-IV genes were obtained
by reverse transcription-polymerase chain reaction amplification and
subcloned in the pBluescript KS plasmid. Oligonucleotides
5'-AGCCCAAGCTT+578ATGCAGCCCCGGACGCTCCTCA+599-3'
(coding strand) and
5'-GCTCTAGA+2051TCACGACTCATAGCTGGAGTTGG+2028-3'
(noncoding strand) and
5'-AGCCCAAGCTT+1AATCTGCACAGGGACACAGGTACA+24-3'
(coding strand) and
5'-GCTCTAGA+300TAGCACCCCAAGTTTGTCCTGGA+277-3'
(noncoding strand) were used for the amplification of apoC-III and apoA-IV sequences, respectively (24, 25). The two cDNAs were
digested with XbaI and HindIII and ligated into
the pBluescript KS vector that had previously been digested with
XbaI/HindIII. A 265-bp fragment of the CAT gene
was obtained from pUCSH-CAT by digestion with HindIII and
EcoRI and cloned into the pBluescript SK vector.
Both sense and antisense mouse apoA-IV and apoC-III RNA probes (size:
300 bp) were generated using T3 and T7 RNA polymerases, respectively
(Promega). Sense and antisense CAT riboprobes were synthesized with T7
and T3 polymerases, respectively. All probes were labeled using
35S-UTP.
In Situ Hybridization--
Adult mice were killed by cervical
dislocation, and the entire small intestines were rapidly removed and
divided into three parts representing the proximal, middle, and distal
regions of the small intestine. The samples were fixed in 2%
paraformaldehyde in phosphate-buffered saline, pH 7.2, and embedded in
paraffin. Sections (4 µm thick) were mounted on glass slides.
In situ hybridization was performed by a modification of the
method of Sassoon and Rosenthal (26). Sections of small intestine were
hybridized with 200,000 cpm of probe/slide at 42 °C overnight. Tissues were washed for 30 min in 5× SSC (1× SSC = 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0) and
10 mM dithiothreitol at 50 °C, two times for 20 min in
2× SSC and 50% formamide at 60 °C, and for 10 min in 1× SSC at
37 °C and then treated for 30 min with RNase A. Subsequent washes in
1× and 0.1× SSC at 37 °C were followed by dehydration in graded
ethanol for total desiccation. The washed slides were dipped into Kodak
NTB2 emulsion, stored in the dark at 20 °C for 8-16 days, and
then developed.
RNA Preparation and Analysis--
Total RNA from intestinal
segments was extracted (RNazol kit, Bioprobe Systems), separated on
1.2% denaturing formaldehyde-agarose gels, and transferred onto Hybond
N+ membranes (Amersham Pharmacia Biotech). The membranes
were hybridized with the [32P]dCTP-labeled mouse apoC-III
and apoA-IV cDNA probes in 50% formamide, 5× SSC, 5× Denhardt's
solution, 0.04% pyrophosphate, 5 mM sodium Pi,
and 0.1 mg/ml herring sperm DNA at 42 °C. Washings were performed in
1× SSC and 0.1% SDS at 65 °C. The quality and the amount of RNA
samples were estimated using an 18 S RNA probe. Autoradiograms were
scanned using an NIH Imager analysis program.
Histoenzymology--
Intestinal CAT activity was measured in the
small intestine using the technique of Donoghue et al. (27,
28). Additional acetyl-CoA was added after 12 h of incubation.
Slides were prepared from tissues of nontransgenic mice. Mice were
analyzed and utilized as controls. Tissues were embedded in paraffin,
and sections (4 µm thick) were stained using the periodic acid-Schiff
technique to identify goblet cells and the Grimelius silver method to
identify enteroendocrine cells.
 |
RESULTS |
Generation of Transgenic Mice--
We generated transgenic mice
expressing the CAT reporter gene under the control of either the human
-890/+24 apoC-III promoter (C3-CAT) (Fig.
1B) or the human -700/+10
apoA-IV promoter fused to the -500/-890 apoC-III enhancer in the
opposite direction to the apoA-IV promoter in accordance with the
organization of the apoA-I/C-III/A-IV gene cluster (eC3-A4-CAT) (Fig.
1B). The number of transgene copies incorporated into the
genome of each transgenic founder was determined by Southern blot
analysis in comparison with increasing amounts of the transgene diluted
in nontransgenic DNA (Fig. 1C and Table
I).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1.
Maps of the different transgenes used to
generate transgenic mice and Southern blot analysis to determine
transgene integration in the different transgenic mice.
A, schematic representation of the apoA-I/C-III/A-IV gene
cluster. The direction of transcription for each gene is shown by an
arrow. The length of this cluster of genes is ~15 kb. The
proximal promoters of apoA-I and apoC-III suffice for in
vivo hepatic expression (250 and 500 bp in length, respectively).
The -500/-890 apoC-III enhancer is required for intestinal apoA-I
expression. The proximal promoter of apoA-IV (700 bp) is practically
inactive in HepG2 and Caco-2 cells (19). B, maps of CAT
constructs driven by segments of the human apoC-III and/or apoA-IV
promoter that were used to generate transgenic mice (21). The C3-CAT
transgene retains the entire human -890/+24 apoC-III promoter upstream
from the CAT reporter gene. The eC3-A4-CAT corresponds to the -700/+10
apoA-IV promoter linked to the -500/-890 apoC-III enhancer. The two
promoter segments are in their "normal" opposite direction. The
dA4-C3-CAT contains the -890/+24 apoC-III promoter sequence fused to
the 700/-310 apoA-IV distal gene promoter region. The two promoter
segments are in their normal opposite direction. pb, base
pair. C, Southern blot analysis of the different
constructs in transgenic mice. EcoRI-digested mouse
tail DNA (10 µg) was loaded onto a 0.8% agarose gel and then
transferred to a Hybond N+ membrane and hybridized
with a CAT probe (see "Materials and Methods"). Comparison with
known copy numbers of transgenic DNA (20 to 0.5) allowed the determination of the copy number in each line. Tail
DNA from a normal mouse was used for a negative control
(control). Three transgenic mouse lines were analyzed for
the C3-CAT transgene (V, W, and Y), the eC3-A4-CAT transgene (Zf, Zg,
and Ze), and the dA4-C3-CAT transgene (A, B, and C).
|
|
CAT activity was determined in tissue extracts from adult transgenic
mice of each line (Table I). In all cases, CAT activity was mainly
detected in the liver and small intestine, although ectopic expression
of the CAT gene was observed in the heart of C3-CAT transgenic mice.
Despite differences in the level of expression of the transgene,
tissular distribution of CAT activity was similar in the different
lines produced with the same transgene. This distribution differed in
different transgenes. In C3-CAT transgenic mice, the CAT activity in
any part of the intestine did not exceed one-third of the liver
activity measured. In contrast, in eC3-A4-CAT transgenic mice, the
level of CAT activity in the proximal and middle regions of the small
intestine was similar to that in the liver. From each construct, two
mouse lines exhibiting the highest CAT activity were further studied:
lines V and W of C3-CAT transgenic mice and lines Zf and Ze of
eC3-A4-CAT transgenic mice.
Spatial Pattern of C3-CAT and eC3-A4-CAT Expression in the Small
Intestine--
The spatial pattern of expression of the transgenes in
the intestine along the crypt-to-villus and cephalocaudal axes was further determined and compared with that of endogenous mouse apoC-III
and apoA-IV genes (Fig. 2). CAT activity
did not vary along the small intestine when CAT gene expression was
controlled by the -890/+24 apoC-III promoter (Fig. 2A). In
contrast, CAT activity displayed a decreasing cephalocaudal gradient in
eC3-A4-CAT mice (Fig. 2A). This expression pattern mimicked
that of endogenous mouse apoA-IV and apoC-III mRNAs (Fig.
2B).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of the distribution of endogenous
mouse apoC-III and apoA-IV mRNAs with CAT activity along the
intestinal cephalocaudal axis of transgenic and nontransgenic
mice. A, distribution of CAT activity along the
small intestine of the different transgenic mouse lines (C3-CAT and
eC3-A4-CAT). The CAT activity of each intestinal segment (proximal,
middle, and distal) was calculated relative to the total amount of CAT
activity present in the small intestine of each transgenic mouse line.
B, distribution of mouse apoA-IV and apoC-III mRNAs in
the small intestine. Total RNA was prepared from each fragment, and 15 µg of total cellular RNA were examined by Northern blot analysis.
Values are expressed as percent ratio of duodenal RNA.
|
|
Transgenic expression along the crypt-to-villus axis in the intestine
was analyzed by in situ hybridization (Fig.
3). To demonstrate the specificity of the
signal, an antisense and a sense CAT riboprobe were first hybridized to
sections of nontransgenic and transgenic jejunum, respectively, as
negative controls (Fig. 3, a and b). Using
dark-field microscopy, a few scattered grains representing the
background signal were seen with both probes. The CAT reporter gene
driven by the human 890/+24 apoC-III promoter was expressed markedly
in the crypt cells and lightly in the villus epithelial cells of the
transgenic mice (Fig. 3d). The endogenous mouse apoC-III gene was expressed similarly in the crypt and villus epithelial cells
(Fig. 3c). In contrast to C3-CAT transgenic mice, eC3-A4-CAT transgenic mice exhibited a pattern of CAT mRNA expression in the
crypt-to-villus unit that was strikingly similar to that of the
endogenous mouse apoA-IV mRNA (Fig. 3, e and
f). These results suggest that the 700/+10 apoA-IV
promoter contains a regulatory region that, in combination with the
500/ 890 apoC-III enhancer, restricts the expression of the reporter
gene to the villus, thus reproducing in the transgenic mice the
crypt-to-villus gradient of expression that is observed for the
endogenous apoA-IV gene.

View larger version (166K):
[in this window]
[in a new window]
|
Fig. 3.
Distribution of CAT mRNA and mouse apoC-III
and apoA-IV mRNAs along the crypt-to-villus axis of the small
intestine of adult mice. A sense or antisense CAT riboprobe and an
antisense riboprobe for mouse apoC-III or apoA-IV were hybridized to a
jejunal section of the intestine. In situ hybridization
dark-field images are presented. a, shown is a control of
jejunal sections from a nontransgenic mouse hybridized with an
antisense CAT riboprobe. b, the specificity of the antisense
CAT probe signal was assessed in the same experimental series by
hybridization of jejunal sections of transgenic mouse with a sense CAT
riboprobe. Only scattered grains are present in control sections
a and b. c, shown are jejunal sections
from a nontransgenic mouse hybridized with an antisense mouse apoC-III
riboprobe. ApoC-III mRNA expression can be observed in
villus-associated epithelial cells, and a specific signal is also seen
in crypt-associated epithelial cells. d, shown are jejunal
sections from a C3-CAT transgenic mouse hybridized with an antisense
CAT riboprobe. CAT mRNA expression was strongest in epithelial
cells of the crypt and at the base of the villus and decreased toward
the villus tip. e, shown are jejunal sections from a
nontransgenic mouse hybridized with an antisense mouse apoA-IV
riboprobe. ApoA-IV mRNA was present from the villus base to the
upper villus epithelial cells; apoA-IV mRNA was not observed in
crypt epithelial cells. f, shown are jejunal sections from
an eC3-A4-CAT transgenic mouse hybridized with an antisense CAT
riboprobe. CAT mRNA expression was restricted to the
villus-associated epithelial cells.
|
|
The ApoA-IV Distal Promoter Confers a Cephalocaudal and
Crypt-to-Villus Expression Gradient to C3-CAT Transgenes--
To
determine which region of the apoA-IV promoter was responsible for the
expression pattern along both the cephalocaudal and crypt-to-villus
axes, we generated additional mouse lines expressing the reporter CAT
transgene under the control of the -890/+24 apoC-III promoter fused to
the -310/ 700 apoA-IV distal promoter region (Fig. 1B).
Three founders were identified by polymerase chain reaction and were
analyzed by Southern blotting (Fig. 1C).
As in C3-CAT transgenic mice, CAT activity was much higher in the liver
than in the intestine of dA4-C3-CAT mice. However, in the latter, we
observed a decreasing gradient of CAT activity from the proximal to the
distal region of the intestine (Fig. 4).
This pattern of expression differed from that of C3-CAT transgenic mice
(Fig. 2). Thus, the addition of the -310/-700 apoA-IV distal promoter
region to the -890/+24 apoC-III promoter restored the cephalocaudal
pattern of expression observed for the endogenous apoC-III gene.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4.
Detection of CAT activity in the liver and in
segments of the small intestine of dA4-C3-CAT transgenic
mice. Samples from homogenates of the liver and different
parts of the small intestine were assayed for CAT activity as described
under "Materials and Methods." The presence of the 310/ 700
apoA-IV promoter sequence establishes an appropriate cephalocaudal
pattern of gene expression.
|
|
The expression of the transgene in the crypt-to-villus unit was
visualized by histochemical staining of the nuclei of CAT-expressing cells in the small intestine. No staining was observed in control mice
(Fig. 5, a and a')
or in the lamina propria of transgenic mice (Fig. 5). CAT
histochemistry revealed a pattern of expression similar to that
observed previously by in situ hybridization. Crypt and
villus nuclei were stained in C3-CAT transgenic samples (Fig. 5,
b and b'), whereas staining was restricted to the
villus in eC3-A4-CAT transgenic mice (c and c')
as well as in dA4-C3-CAT transgenic samples (d and
d'). Thus, the addition of the 310/ 700 apoA-IV distal
promoter region restricted the expression of the dA4-C3-CAT transgene
to the villus in a pattern similar to that of endogenous apoA-IV, but
not of endogenous apoC-III.

View larger version (138K):
[in this window]
[in a new window]
|
Fig. 5.
Pattern of CAT activity along the intestinal
crypt-to-villus axis of the three different transgenic mice.
Histochemical staining for CAT activity with no counterstaining was
performed as described under "Materials and Methods." Sections were
photographed with phase-contrast (a-d) and with
bright-field (a'-d'). Nontransgenic proximal
intestine was incubated in the complete staining mixture (a
and a'). No staining was observed in either crypt
(asterisks) or villus (arrows) epithelial cells.
In transgenic sections, only nuclei were stained (visible as a
black deposit). This staining appears to be specific since
it was observed only in the transgenic mice (compare a and
a' with the other panels). In the proximal section of the
intestine from C3-CAT transgenic mice (b and b'),
CAT staining was observed in both crypt and villus epithelial cells.
The patterns of CAT staining along the crypt-to-villus axis of adult
mice expressing the eC3-A4-CAT (c and c') and
dA4-C3-CAT (d and d') constructs are
indistinguishable and are restricted to villus epithelial cells.
|
|
After double staining the villus epithelial cells from dA4-C3-CAT
intestine, neither enteroendocrine cells, visualized by Grimelius
staining (Fig. 6, a and
b), nor the goblet cells, visualized by periodic acid-Schiff
staining (Fig. 6c), coincided with the specific staining of
nuclei of CAT-expressing cells. These results suggest that the
310/ 700 apoA-IV distal promoter region is sufficient to
restrict gene expression to villus enterocytes along the cephalocaudal axis.

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 6.
Double histochemical staining analysis of the
villus-associated epithelial cells. CAT-stained sections of
the proximal intestine of the dA4-C3-CAT transgenic lines were further
stained by the Grimelius silver method to visualize the enteroendocrine
cells and with periodic acid-Schiff base to visualize the goblet cells.
With the Grimelius silver method, enteroendocrine cells appear with a
diffuse brown cytoplasmic staining (a and
b, open arrows), and nuclei of CAT-expressing
cells are dark (a and b). With
periodic acid-Schiff staining, mucins in the goblet cells are stained
pink (c, arrowheads), and nuclei of
CAT expressing cells are stained brown (c). Only
the villus epithelial cells are stained histochemically with CAT
(a-c). Nuclei of the enteroendocrine cells appear to be
negative within CAT staining (a and b). Periodic
acid-Schiff-stained goblet cells do not appear to express the CAT
reporter gene (c). Cell nuclei are designated by
closed arrows and are negative for CAT staining.
|
|
 |
DISCUSSION |
A preliminary report has shown that the entire intergenic region
between the apoC-III and apoA-IV genes directs a pattern of expression
of the transgene similar to that of endogenous apoA-IV (17). This
expression was abolished with shorter constructs lacking the apoC-III
promoter region. Bisaha et al. (16) showed that the apoC-III
enhancer, located at nucleotide -520 upstream from the transcription
initiation site of the apoC-III gene, is sufficient to direct the
intestinal expression of the apoA-I gene, the third gene of the
apoA-I/C-III/A-IV cluster, but not to restrict its expression to the
villus. This prompted us to decipher the regulatory regions responsible
for the accurate expression of apoA-IV by combining the apoC-III
enhancer and the apoA-IV promoter. In our present study, we found that
a combination of the 890/ 500 apoC-III enhancer and the 700/ 310
apoA-IV distal promoter allowed the intestinal expression of the
apoA-IV gene in transgenic mice, specifically in the villus
enterocytes, with a cephalocaudal gradient. Taken together, these
results demonstrate that the appropriate lineage-specific
crypt-to-villus and cephalocaudal patterns of human apoA-IV expression
in transgenic mouse intestine require both the apoC-III enhancer and
the apoA-IV distal promoter.
Our findings indicate that CAT activity in the intestine and liver in
mice expressing the eC3-A4-CAT transgene reproduces the correct pattern
of expression of endogenous mouse apoA-IV rather than that of human
apoA-IV, which is predominantly expressed in the intestine. Lauer
et al. (17) reported no expression of the human apoA-IV gene
in the liver of transgenic mice expressing human apoA-IV genomic
sequences containing 5'-flanking regions 0.3-7.7 kb long and a
3'-flanking region 1.5 kb long. These results, taken conjunction with
our own, suggest that a hepatic silencer may reside downstream from
nucleotide +24 of the human apoA-IV gene. It is possible that either a
silencer in the human apoA-IV promoter or differences in the nuclear
activities between humans and rodents may account for this difference
in tissue-specific expression of the apoA-IV gene. Similarly, the weak
ectopic expression of the C3-CAT and eC3-A4-CAT transgenes in tissues
other than those of the liver and intestine may reflect the lack
of tissue-specific silencers in the 890/+24 apoC-III and 700/+10
apoA-IV promoter regions.
In vitro transfection assays in the Caco-2 cell line showed
that the transcription of the apoA-IV gene is controlled by hepatocyte nuclear factor 4 (HNF4), which binds to its proximal promoter region
and requires the presence of other transcription factors that recognize
elements of the apoC-III enhancer (19, 29). Similarly, the
transcription of apoA-I and apoC-III genes is driven through a synergy
between HNF4 and others factors that bind the apoC-III enhancer (16,
30-34). HNF4 binds the hormone response elements located in the three
proximal promoters and in the apoC-III enhancer. Bisaha et
al. (16) have shown that a region of the apoC-III enhancer
containing the HNF4-binding site is insufficient to drive in
vivo the intestinal expression of the apoA-I gene. Nevertheless,
this factor could actively participate in the determination of
intestinal apoA-I/C-III/A-IV gene expression. An HNF4-binding site has
also been described in the FABP-I proximal enhancer, which is essential
for intestinal expression (35). Furthermore, the involvement of HNF4 in
the onset of intestinal functions has been demonstrated by the
interruption of intestine development under extinction of the HNF4
homolog in Drosophila (36).
The eC3-A4-CAT transgene, which retains the 890/ 500 apoC-III
enhancer and 700/+10 apoA-IV promoter regions, was able to direct a
pattern of CAT activity among intestinal segments that resembled both
the pattern of endogenous mouse apoA-IV and that observed in rats and
chickens (14, 37). Furthermore, the expression of the reporter gene was
restricted to villus cells in a manner similar to the expression
pattern of the endogenous mouse apoA-IV gene and also to that observed
in rats (38). These results suggest that the apoA-IV promoter contains
an element prohibiting the transcription of the reporter gene in crypt
epithelial cells and in the distal part of the small intestine.
As already discussed, the apoC-III promoter region was not sufficient
to restrict intestinal expression along the crypt-to-villus and
cephalocaudal gradients. The addition of the 700/ 310 apoA-IV distal
promoter to the apoC-III enhancer allowed the expression of the
reporter gene to mimic the cephalocaudal gradient displayed by
endogenous mouse apoC-III. Furthermore, the 700/ 310 apoA-IV promoter region retained the elements sufficient to restrict
expression to villus-associated enterocytes. These findings indicate
that the 310/ 700 apoA-IV promoter region confers two suppressor
functions, one prohibiting gene expression in the distal small
intestine and the other prohibiting gene expression in crypt epithelial cells.
The spatial patterns of gene expression in the intestine involve both
positive and negative elements. This has also been reported for the rat
FABP-I gene, the rat liver fatty acid-binding protein gene, and the
sucrase-isomaltase gene (6, 7, 10). Simon et al. (10)
identified a 20-nucleotide element in the FABP-I promoter that
modulates the intestinal cellular and spatial expression of the FABP-I
gene. This element acts as a suppressor of gene expression in the
distal small intestine/colon, as a suppressor of gene activation in the
crypt, and as a suppressor of gene expression in the Paneth cell
lineage (10). No sequence in the 700/ 310 apoA-IV distal promoter
significantly matched this 20-bp element. Thus, it is reasonable to
hypothesize that in both apoA-IV and FABP-I, a distinct element
controls a similar appropriate pattern of gene expression. Whether
these two different elements bind similar or different repressors of
gene expression in crypts and the distal part of the intestine remains
to be established.
 |
ACKNOWLEDGEMENTS |
We thank Carole Lasne, Maryse Séau, and
Jeannine Demeurie for expert technical assistance.
 |
FOOTNOTES |
*
This work was supported by INSERM, University Paris VI;
National Science Foundation Grant INT 9341607; and ECC Grant BIOTECH XT
960052.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 33-142346899;
Fax: 33-143251615.
 |
ABBREVIATIONS |
The abbreviations used are:
FABP-I, intestinal
fatty acid-binding protein;
bp, base pair(s);
kb, kilobase pair(s);
CAT, chloramphenicol acetyltransferase;
HNF4, hepatic nuclear factor
4.
 |
REFERENCES |
-
Gordon, J. I.,
and Hermiston, M. L.
(1994)
Curr. Opin. Cell Biol.
6,
795-803[CrossRef][Medline]
[Order article via Infotrieve]
-
Schmidt, G. H.,
Wilkinson, M. M.,
and Ponder, B. A. J.
(1985)
Cell
40,
425-429[CrossRef][Medline]
[Order article via Infotrieve]
-
Hermiston, M. L.,
and Gordon, J. I.
(1995)
Am. J. Physiol.
269,
G813-G822[Abstract/Free Full Text]
-
Henning, S. J.,
Rubin, D. C.,
and Shulman, R. J.
(1994)
in
Physiology of the Gastrointestinal Tract (Johnson, L. R., ed), 3rd Ed., pp. 571-610, Raven Press, New York
-
Hermiston, M. L.,
Green, R. P.,
and Gordon, J. I.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8866-8870[Abstract/Free Full Text]
-
Cohn, S. T.,
Simon, T. C.,
Roth, K. A.,
Birkenmeir, E. H.,
and Gordon, J. I
(1992)
J. Cell Biol.
119,
27-44[Abstract/Free Full Text]
-
Simon, T. C.,
Roth, K. A.,
and Gordon, J. I.
(1993)
J. Biol. Chem.
268,
18345-18358[Abstract/Free Full Text]
-
Crossman, M. W.,
Hauft, S. M.,
and Gordon, J. I.
(1994)
J. Cell Biol.
126,
1547-1564[Abstract/Free Full Text]
-
Markowitz, A. J.,
Wu, G. D.,
Bierkenmeier, E. H.,
and Traber, P. G.
(1993)
Am. J. Physiol.
265,
G526-G539[Abstract/Free Full Text]
-
Simon, T. C.,
Roberts, L. J. J.,
and Gordon, J. I.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
8685-8689[Abstract/Free Full Text]
-
Nielsen, L. B.,
McCormick, S. P. A.,
Pierotti, V.,
Tam, C.,
Gunn, M. D.,
Shizuya, H.,
and Young, S. G.
(1997)
J. Biol. Chem.
272,
29752-29758[Abstract/Free Full Text]
-
Walsh, A.,
Ito, Y.,
and Breslow, J. L.
(1989)
J. Biol. Chem.
264,
6488-6494[Abstract/Free Full Text]
-
Zannis, V. I.,
Cole, F. S.,
Jackson, C. L.,
Kurnit, C. L.,
and Karathanasis, S. K.
(1985)
Biochemistry
24,
4450-4455[CrossRef][Medline]
[Order article via Infotrieve]
-
Elshourbagy, N. A.,
Boguski, M. S.,
Liao, W. S. L.,
Jefferson, L. S.,
Gordon, J. I.,
and Taylor, J. M.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
8242-8246[Abstract/Free Full Text]
-
Gutierrez, E. D.,
Grapperhaus, K. J.,
and Rubin, D. C.
(1995)
Am. J. Physiol.
269,
G500-G511[Abstract/Free Full Text]
-
Bisaha, J. G.,
Simon, T. C.,
Gordon, J. I.,
and Breslow, J. L.
(1995)
J. Biol. Chem.
270,
19979-19988[Abstract/Free Full Text]
-
Lauer, S. J.,
Simonet, W. S.,
Bucay, N.,
de Silva, H. V.,
and Taylor, J. M.
(1991)
Circulation
84,
1390 (abstr.)
-
Ogami, K.,
Hadzopoulou-Cladaras, M.,
Cladaras, C.,
and Zannis, V. I.
(1990)
J. Biol. Chem.
265,
9808-9815[Abstract/Free Full Text]
-
Ktistakis, E.,
Lacorte, J.-M.,
Katrakili, N.,
Zannis, V. I.,
and Talianidis, I.
(1994)
Nucleic Acids Res.
22,
4689-4696[Abstract/Free Full Text]
-
Li, Z.,
Marchand, P.,
Humbert, J.,
Babinet, C.,
and Paulin, D.
(1993)
Development (Camb.)
117,
947-959[Abstract]
-
Le Beyec, J.,
Benetollo, C.,
Chauffeton, V.,
Domiar, A.,
Lafrenière, M.-J.,
Chambaz, J.,
Cardot, P.,
and Kalopissis, A.
(1998)
Transgenics
2,
211-220
-
Pothier, F.,
Ouellet, M.,
Julien, J. P.,
and Guerin, S. L.
(1992)
DNA Cell Biol.
11,
83-90[Medline]
[Order article via Infotrieve]
-
Gorman, C.,
Moffat, L.,
and Howard, B.
(1982)
Mol. Cell. Biol.
2,
1044-1051[Abstract/Free Full Text]
-
Januzzi, J. L.,
Azrolan, A.,
O'Connell, A.,
Aalto-Setälä, K.,
and Breslow, J. L.
(1992)
Genomics
14,
1081-1088[CrossRef][Medline]
[Order article via Infotrieve]
-
Reue, K.,
and Leete, T. H.
(1991)
J. Biol. Chem.
266,
12715-12721[Abstract/Free Full Text]
-
Sassoon, D.,
and Rosenthal, N.
(1993)
Methods Enzymol.
225,
384-404[Medline]
[Order article via Infotrieve]
-
Donoghue, M. J.,
Alvarez, J. D.,
Merlie, J. P.,
and Sanes, J. R.
(1991)
J. Cell Biol.
115,
423-434[Abstract/Free Full Text]
-
Donoghue, M. J.,
Morris-Valero, R.,
Johnson, Y. R.,
Merlie, J. P.,
and Sanes, J. R.
(1992)
Cell
69,
67-77[CrossRef][Medline]
[Order article via Infotrieve]
-
Vergnes, L.,
Taniguchi, T.,
Omori, K.,
Zakin, M. M.,
and Ochoa, A.
(1997)
Biochim. Biophys. Acta
1348,
299-310[Medline]
[Order article via Infotrieve]
-
Ladias, J. A. A.,
Hadzopoulou-Cladaras, M.,
Kardassis, D.,
Cardot, P.,
Cheng, J.,
Zannis, V. I.,
and Cladaras, C.
(1992)
J. Biol. Chem.
267,
15849-15860[Abstract/Free Full Text]
-
Mietus-Snyder, M.,
Sladek, F. M.,
Ginsburg, G. S.,
Kuo, F.,
Ladias, J. A. A.,
Darnell, J. E.,
and Karathanasis, S.
(1992)
Mol. Cell. Biol.
12,
1708-1718[Abstract/Free Full Text]
-
Ginsburg, G. S.,
Ozer, J.,
and Karathanasis, S.
(1995)
J. Clin. Invest.
96,
528-538
-
Talianidis, I.,
Tambakaki, A.,
Toursounova, J.,
and Zannis, V. I.
(1995)
Biochemistry
34,
10298-10309[CrossRef][Medline]
[Order article via Infotrieve]
-
Kardassis, D.,
Tzameli, I.,
Hadzopoulou-Cladaras, M.,
Talianidis, I.,
and Zannis, V. I.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
222-232[Abstract/Free Full Text]
-
Rottman, J. N.,
and Gordon, J. I.
(1993)
J. Biol. Chem.
268,
11994-12002[Abstract/Free Full Text]
-
Zhong, W.,
Sladek, F. M.,
and Darnell, J. E.
(1993)
EMBO J.
12,
537-544[Medline]
[Order article via Infotrieve]
-
Steinmetz, A.,
Hermann, M.,
Nimpf, J.,
Aebersold, R.,
Ducret, A.,
Weinberg, R. B.,
and Schneider, W. J.
(1998)
J. Biol. Chem.
273,
10543-10549[Abstract/Free Full Text]
-
Rubin, D. C.
(1992)
Am. J. Physiol.
263,
G853-G863[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Leng, S. Lu, Y. Yao, Z. Kan, G. S. Morris, B. R. Stair, M. A. Cherny, and D. D. Black
Hepatocyte nuclear factor-4 mediates apolipoprotein A-IV transcriptional regulation by fatty acid in newborn swine enterocytes
Am J Physiol Gastrointest Liver Physiol,
August 1, 2007;
293(2):
G475 - G483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Bietrix, D. Yan, M. Nauze, C. Rolland, J. Bertrand-Michel, C. Comera, S. Schaak, R. Barbaras, A. K. Groen, B. Perret, et al.
Accelerated Lipid Absorption in Mice Overexpressing Intestinal SR-BI
J. Biol. Chem.,
March 17, 2006;
281(11):
7214 - 7219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Peignon, S. Thenet, C. Schreider, S. Fouquet, A. Ribeiro, E. Dussaulx, J. Chambaz, P. Cardot, M. Pincon-Raymond, and J. Le Beyec
E-cadherin-dependent Transcriptional Control of Apolipoprotein A-IV Gene Expression in Intestinal Epithelial Cells: A ROLE FOR THE HEPATIC NUCLEAR FACTOR 4
J. Biol. Chem.,
February 10, 2006;
281(6):
3560 - 3568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Archer, D. Sauvaget, V. Chauffeton, P.-E. Bouchet, J. Chambaz, M. Pincon-Raymond, P. Cardot, A. Ribeiro, and M. Lacasa
Intestinal Apolipoprotein A-IV Gene Transcription Is Controlled by Two Hormone-Responsive Elements: A Role for Hepatic Nuclear Factor-4 Isoforms
Mol. Endocrinol.,
September 1, 2005;
19(9):
2320 - 2334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gao, Y. Wei, Y. Huang, D. Liu, G. Liu, M. Wu, L. Wu, Q. Zhang, Z. Zhang, R. Zhang, et al.
The Expression of Intact and Mutant Human apoAI/CIII/AIV/AV Gene Cluster in Transgenic Mice
J. Biol. Chem.,
April 1, 2005;
280(13):
12559 - 12566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Carriere, R. Vidal, K. Lazou, M. Lacasa, F. Delers, A. Ribeiro, M. Rousset, J. Chambaz, and J. M. Lacorte
HNF-4-dependent Induction of Apolipoprotein A-IV Gene Transcription by an Apical Supply of Lipid Micelles in Intestinal Cells
J. Biol. Chem.,
February 18, 2005;
280(7):
5406 - 5413.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Carrier, G. Deblois, C. Champigny, E. Levy, and V. Giguere
Estrogen-related Receptor {alpha} (ERR{alpha}) Is a Transcriptional Regulator of Apolipoprotein A-IV and Controls Lipid Handling in the Intestine
J. Biol. Chem.,
December 10, 2004;
279(50):
52052 - 52058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lu, Y. Yao, H. Wang, S. Meng, X. Cheng, and D. D. Black
Regulation of apo A-IV transcription by lipid in newborn swine is associated with a promoter DNA-binding protein
Am J Physiol Gastrointest Liver Physiol,
February 1, 2003;
284(2):
G248 - G254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Sauvaget, V. Chauffeton, D. Citadelle, F.-P. Chatelet, C. Cywiner-Golenzer, J. Chambaz, M. Pincon-Raymond, P. Cardot, J. Le Beyec, and A. Ribeiro
Restriction of Apolipoprotein A-IV Gene Expression to the Intestine Villus Depends on a Hormone-responsive Element and Parallels Differential Expression of the Hepatic Nuclear Factor 4alpha and gamma Isoforms
J. Biol. Chem.,
September 6, 2002;
277(37):
34540 - 34548.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Ostos, D. Recalde, N. Baroukh, A. Callejo, M. Rouis, G. Castro, and M. M. Zakin
Fructose Intake Increases Hyperlipidemia and Modifies Apolipoprotein Expression in Apolipoprotein AI-CIII-AIV Transgenic Mice
J. Nutr.,
May 1, 2002;
132(5):
918 - 923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. FISCHER, M.-C. VERPONT, L. A. GARRETT-SINHA, P. M. RONCO, and J. A. ROSSERT
Klf6 Is a Zinc Finger Protein Expressed in a Cell-Specific Manner during Kidney Development
J. Am. Soc. Nephrol.,
April 1, 2001;
12(4):
726 - 735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Georgopoulos, H.-Y. Kan, C. Reardon-Alulis, and V. Zannis
The SP1 sites of the human apoCIII enhancer are essential for the expression of the apoCIII gene and contribute to the hepatic and intestinal expression of the apoA-I gene in transgenic mice
Nucleic Acids Res.,
December 15, 2000;
28(24):
4919 - 4929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Vergnes, N. Baroukh, M. A. Ostos, G. Castro, N. Duverger, M. N. Nanjee, J. Najib, J.-C. Fruchart, N. E. Miller, M. M. Zakin, et al.
Expression of Human Apolipoprotein A-I/C-III/A-IV Gene Cluster in Mice Induces Hyperlipidemia but Reduces Atherogenesis
Arterioscler. Thromb. Vasc. Biol.,
October 1, 2000;
20(10):
2267 - 2274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Antes, S. A. Goodart, C. Huynh, M. Sullivan, S. G. Young, and B. Levy-Wilson
Identification and Characterization of a 315-Base Pair Enhancer, Located More than 55 Kilobases 5' of the Apolipoprotein B Gene, That Confers Expression in the Intestine
J. Biol. Chem.,
August 18, 2000;
275(34):
26637 - 26648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-Y. Kan, S. Georgopoulos, and V. Zannis
A Hormone Response Element in the Human Apolipoprotein CIII (ApoCIII) Enhancer Is Essential for Intestinal Expression of the ApoA-I and ApoCIII Genes and Contributes to the Hepatic Expression of the Two Linked Genes in Transgenic Mice
J. Biol. Chem.,
September 22, 2000;
275(39):
30423 - 30431.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|