Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le Beyec, J.
Right arrow Articles by Cardot, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le Beyec, J.
Right arrow Articles by Cardot, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 8, 4954-4961, February 19, 1999


The -700/-310 Fragment of the Apolipoprotein A-IV Gene Combined with the -890/-500 Apolipoprotein C-III Enhancer Is Sufficient to Direct a Pattern of Gene Expression Similar to That for the Endogenous Apolipoprotein A-IV Gene*

Johanne Le BeyecDagger §, Valérie ChauffetonDagger , Horng-Yuan Kan, Pierre-Luc JanvierDagger , Charlotte Cywiner-GolenzerDagger , François-Patrick ChateletDagger , Athina Despina KalopissisDagger , Vassilis Zannis, Jean ChambazDagger , Martine Pinçon-RaymondDagger , and Philippe CardotDagger

From Dagger  U.505 INSERM and UPRESA CNRS 7079, 15 rue de l'Ecole de Médecine, 75006 Paris, France and the  Section of Molecular Genetics, Cardiovascular Institute, Boston University Medical Center, Boston, Massachusetts 02118-2394

    ABSTRACT
Top
Abstract
Introduction
References

Spatial gene expression in the intestine is mediated by specific regulatory sequences. The three genes of the apoA-I/C-III/A-IV cluster are expressed in the intestine following cephalocaudal and crypt-to-villus axes. Previous studies have shown that the -780/-520 enhancer region of the apoC-III gene directs the expression of the apoA-I gene in both small intestinal villi and crypts, implying that other unidentified elements are necessary for a normal intestinal pattern of apoA-I gene expression. In this study, we have characterized transgenic mice expressing the chloramphenicol acetyltransferase gene under the control of different regions of the apoC-III and apoA-IV promoters. We found that the -890/+24 apoC-III promoter directed the expression of the reporter gene in crypts and villi and did not follow a cephalocaudal gradient of expression. In contrast, the -700/+10 apoA-IV promoter linked to the -500/-890 apoC-III enhancer directed the expression of the reporter gene in enterocytes with a pattern of expression similar to that of the endogenous apoA-IV gene. Furthermore, linkage of the -700/-310 apoA-IV distal promoter region to the -890/+24 apoC-III promoter was sufficient to restore the appropriate pattern of intestinal expression of the reporter gene. These findings demonstrate that the -700/-310 distal region of the apoA-IV promoter contains regulatory elements that, in combination with proximal promoter elements and the -500/-890 enhancer, are necessary and sufficient to restrict apoC-III and apoA-IV gene expression to villus enterocytes of the small intestine along the cephalocaudal axis.

    INTRODUCTION
Top
Abstract
Introduction
References

The mammalian small intestine is lined with a constantly renewing epithelium that is compartmentalized into a proliferative undifferentiated zone located in intestinal crypts and a nonproliferative differentiated zone located in the villi. The epithelium is composed of four specialized cell types that arise from stem cells located just above the base of the crypts (1). Enterocytes, mucus-producing goblet cells, and enteroendocrine cells differentiate as they migrate to the top of the villi, whereas Paneth cells differentiate and migrate to the base of the crypts. Each lineage completes its differentiation program through an orderly migration (2, 3). Enterocytes are the most abundant epithelial cells in the small intestine and express a variety of specific genes as they exit the crypt compartment. Despite the rapid renewal of the intestinal epithelium, numerous genes display a specific pattern of expression in enterocytes from the proximal to the distal intestine and from the crypt to the villus tip (4, 5).

Several studies performed with transgenic mice expressing a human gene or a reporter gene have established that spatial gene expression in the intestine is supported by specific regulatory sequences (6-11). Transcription of the intestinal fatty acid-binding protein (FABP-I)1 gene is strictly confined to the intestinal epithelium. The FABP-I promoter (-103/+28) is sufficient to direct transcription of the gene along the duodenum-to-colon axis. However, upstream sequences are needed to confine FABP-I expression to differentiated enterocytes of the villus. In particular, a 20-bp element located between nucleotides -263 and -244 of the promoter prevents FABP-I expression in crypt cells (6, 10). Liver and intestinal human apoB gene expression is governed by distinct regulatory regions. Intestinal expression requires a very distant element located between 33 and 70 kb 5' upstream from the apoB gene (11). Similarly, the -256/+22 proximal promoter of the human apoA-I gene is sufficient to direct its hepatic transcription. However, the sequences responsible for the intestinal expression reside 9 kb downstream from the human apoA-I gene (12).

The apoA-I gene is located on chromosome 11 in a cluster that also contains the apoC-III and apoA-IV genes. The human apoA-I gene is expressed at similar levels in the intestine and liver, whereas the human apoC-III gene is expressed predominantly in the liver and to a lesser extent in the intestine (13). The apoA-IV gene is mainly expressed in the intestine in humans and non-human primates. ApoA-IV is also expressed in the liver in mice (13, 14). The apoA-I and apoA-IV genes are transcribed in the same direction, whereas the apoC-III gene is transcribed in the opposite direction. The apoC-III/A-IV intergenic region therefore constitutes a common 6.6-kb 5'-flanking sequence for these two genes.

Since the three genes are expressed at different levels in the liver and intestine, this gene cluster represents an interesting model to decipher the molecular mechanisms involved in the determination of tissue-specific expression. The intestinal expression of the cluster is entirely restricted to enterocytes as they emerge from the crypt (15, 16) and decreases from the proximal to the distal small intestine (14). A preliminary report indicated that the apoC-III/A-IV intergenic region allows the intestinal expression of the apoA-IV gene in transgenic mice (17). More recently, Bisaha et al. (16) have demonstrated that the -890/-500 apoC-III enhancer is sufficient to direct the intestinal expression of the apoA-I gene. Based on these in vivo studies and previous in vitro promoter studies performed by us and others, we hypothesized that common regulatory sequences control the intestinal expression of the three genes of the cluster.

In this study, we generated transgenic mice expressing the CAT reporter gene under the control of specific regulatory sequences of the apoA-IV/C-III intergenic region. Analysis of these mouse lines showed that the -700/-310 apoA-IV promoter in combination with the -500/-890 apoC-III enhancer is sufficient for correct gene expression in the enterocytes along the proximal-to-distal and crypt-to-villus axes.

    MATERIALS AND METHODS

Generation of Transgenic Mice-- The different transgenes used in this study are shown in Fig. 1. The transgenes C3-CAT and eC3-A4-CAT were obtained by digestion of the pUCSH-CAT plasmid containing the -890/+24 5'-flanking region of the human apoC-III gene or the -700/+10 apoA-IV promoter region fused with the -500/-890 apoC-III enhancer region, respectively, with XbaI and BamHI (see Fig. 1A). These plasmids have previously been described (18, 19).

The transgene dA4-C3-CAT was obtained from a plasmid in which the human -890/+24 apoC-III promoter region fused upstream from the CAT reporter gene was linked in the opposite direction to the -700/+10 apoA-IV promoter region fused with the lacZ reporter gene. This vector was constructed as follows. The -700/+10 apoA-IV promoter region was amplified by polymerase chain reaction using nucleotide primers from -700 to -680 (coding strand) and from +10 to -10 (noncoding strand) containing a SalI and a HindIII restriction site, respectively. The resulting apoA-IV fragment was cloned upstream from the lacZ gene fused to a nuclear localization sequence (20); the C3-CAT fragment was then inserted in the BamHI and XbaI sites, upstream from the apoA-IV promoter in the opposite direction. The dA4-C3-CAT transgene was excised from the plasmid by digestion with BamHI and SmaI at a site located at nucleotide -310 in the apoA-IV promoter. Transgenes were dissolved at a concentration of 4 ng/µl and microinjected into fertilized eggs from C57BL/6J × CBA/J females mated with males of the same strain using established procedures (21).

Characterization of Transgenic Mice-- DNA was extracted from the tails of 10-15-day-old pups and then analyzed by polymerase chain reaction using oligonucleotide primers corresponding to sequences +163 to +189 (coding strand) and +696 to +670 (noncoding strand) of the CAT gene. Founder mice were then further analyzed by Southern blotting, and the copy number was estimated by densitometric scanning of autoradiograms as described previously (21). Positive founder F0 mice were outbred to generate lines of heterozygous mice.

CAT Assay-- Individual tissue samples were homogenized and assayed for CAT activity as described previously (22, 23). The concentration of soluble protein was determined by the Bio-Rad protein assay. The percentage of chloramphenicol converted to acetylated forms was determined either by densitometric scanning of autoradiograms or by scraping individual spots from the thin-layer chromatogram and counting in a scintillation counter. CAT activity is expressed as pmol of acetyl chloramphenicol generated per min/mg of protein after subtracting the background for each tissue from control mice, which do not express the CAT gene.

Preparation of Radiolabeled Probes-- Specific 300-bp cDNAs encoding the mouse apoC-III and apoA-IV genes were obtained by reverse transcription-polymerase chain reaction amplification and subcloned in the pBluescript KS plasmid. Oligonucleotides 5'-AGCCCAAGCTT+578ATGCAGCCCCGGACGCTCCTCA+599-3' (coding strand) and 5'-GCTCTAGA+2051TCACGACTCATAGCTGGAGTTGG+2028-3' (noncoding strand) and 5'-AGCCCAAGCTT+1AATCTGCACAGGGACACAGGTACA+24-3' (coding strand) and 5'-GCTCTAGA+300TAGCACCCCAAGTTTGTCCTGGA+277-3' (noncoding strand) were used for the amplification of apoC-III and apoA-IV sequences, respectively (24, 25). The two cDNAs were digested with XbaI and HindIII and ligated into the pBluescript KS vector that had previously been digested with XbaI/HindIII. A 265-bp fragment of the CAT gene was obtained from pUCSH-CAT by digestion with HindIII and EcoRI and cloned into the pBluescript SK vector.

Both sense and antisense mouse apoA-IV and apoC-III RNA probes (size: 300 bp) were generated using T3 and T7 RNA polymerases, respectively (Promega). Sense and antisense CAT riboprobes were synthesized with T7 and T3 polymerases, respectively. All probes were labeled using 35S-UTP.

In Situ Hybridization-- Adult mice were killed by cervical dislocation, and the entire small intestines were rapidly removed and divided into three parts representing the proximal, middle, and distal regions of the small intestine. The samples were fixed in 2% paraformaldehyde in phosphate-buffered saline, pH 7.2, and embedded in paraffin. Sections (4 µm thick) were mounted on glass slides.

In situ hybridization was performed by a modification of the method of Sassoon and Rosenthal (26). Sections of small intestine were hybridized with 200,000 cpm of probe/slide at 42 °C overnight. Tissues were washed for 30 min in 5× SSC (1× SSC = 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0) and 10 mM dithiothreitol at 50 °C, two times for 20 min in 2× SSC and 50% formamide at 60 °C, and for 10 min in 1× SSC at 37 °C and then treated for 30 min with RNase A. Subsequent washes in 1× and 0.1× SSC at 37 °C were followed by dehydration in graded ethanol for total desiccation. The washed slides were dipped into Kodak NTB2 emulsion, stored in the dark at -20 °C for 8-16 days, and then developed.

RNA Preparation and Analysis-- Total RNA from intestinal segments was extracted (RNazol kit, Bioprobe Systems), separated on 1.2% denaturing formaldehyde-agarose gels, and transferred onto Hybond N+ membranes (Amersham Pharmacia Biotech). The membranes were hybridized with the [32P]dCTP-labeled mouse apoC-III and apoA-IV cDNA probes in 50% formamide, 5× SSC, 5× Denhardt's solution, 0.04% pyrophosphate, 5 mM sodium Pi, and 0.1 mg/ml herring sperm DNA at 42 °C. Washings were performed in 1× SSC and 0.1% SDS at 65 °C. The quality and the amount of RNA samples were estimated using an 18 S RNA probe. Autoradiograms were scanned using an NIH Imager analysis program.

Histoenzymology-- Intestinal CAT activity was measured in the small intestine using the technique of Donoghue et al. (27, 28). Additional acetyl-CoA was added after 12 h of incubation. Slides were prepared from tissues of nontransgenic mice. Mice were analyzed and utilized as controls. Tissues were embedded in paraffin, and sections (4 µm thick) were stained using the periodic acid-Schiff technique to identify goblet cells and the Grimelius silver method to identify enteroendocrine cells.

    RESULTS

Generation of Transgenic Mice-- We generated transgenic mice expressing the CAT reporter gene under the control of either the human -890/+24 apoC-III promoter (C3-CAT) (Fig. 1B) or the human -700/+10 apoA-IV promoter fused to the -500/-890 apoC-III enhancer in the opposite direction to the apoA-IV promoter in accordance with the organization of the apoA-I/C-III/A-IV gene cluster (eC3-A4-CAT) (Fig. 1B). The number of transgene copies incorporated into the genome of each transgenic founder was determined by Southern blot analysis in comparison with increasing amounts of the transgene diluted in nontransgenic DNA (Fig. 1C and Table I).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Maps of the different transgenes used to generate transgenic mice and Southern blot analysis to determine transgene integration in the different transgenic mice. A, schematic representation of the apoA-I/C-III/A-IV gene cluster. The direction of transcription for each gene is shown by an arrow. The length of this cluster of genes is ~15 kb. The proximal promoters of apoA-I and apoC-III suffice for in vivo hepatic expression (250 and 500 bp in length, respectively). The -500/-890 apoC-III enhancer is required for intestinal apoA-I expression. The proximal promoter of apoA-IV (700 bp) is practically inactive in HepG2 and Caco-2 cells (19). B, maps of CAT constructs driven by segments of the human apoC-III and/or apoA-IV promoter that were used to generate transgenic mice (21). The C3-CAT transgene retains the entire human -890/+24 apoC-III promoter upstream from the CAT reporter gene. The eC3-A4-CAT corresponds to the -700/+10 apoA-IV promoter linked to the -500/-890 apoC-III enhancer. The two promoter segments are in their "normal" opposite direction. The dA4-C3-CAT contains the -890/+24 apoC-III promoter sequence fused to the -700/-310 apoA-IV distal gene promoter region. The two promoter segments are in their normal opposite direction. pb, base pair. C, Southern blot analysis of the different constructs in transgenic mice. EcoRI-digested mouse tail DNA (10 µg) was loaded onto a 0.8% agarose gel and then transferred to a Hybond N+ membrane and hybridized with a CAT probe (see "Materials and Methods"). Comparison with known copy numbers of transgenic DNA (20 to 0.5) allowed the determination of the copy number in each line. Tail DNA from a normal mouse was used for a negative control (control). Three transgenic mouse lines were analyzed for the C3-CAT transgene (V, W, and Y), the eC3-A4-CAT transgene (Zf, Zg, and Ze), and the dA4-C3-CAT transgene (A, B, and C).

                              
View this table:
[in this window]
[in a new window]
 
Table I
CAT activity in different tissues of CAT transgenic mice

CAT activity was determined in tissue extracts from adult transgenic mice of each line (Table I). In all cases, CAT activity was mainly detected in the liver and small intestine, although ectopic expression of the CAT gene was observed in the heart of C3-CAT transgenic mice. Despite differences in the level of expression of the transgene, tissular distribution of CAT activity was similar in the different lines produced with the same transgene. This distribution differed in different transgenes. In C3-CAT transgenic mice, the CAT activity in any part of the intestine did not exceed one-third of the liver activity measured. In contrast, in eC3-A4-CAT transgenic mice, the level of CAT activity in the proximal and middle regions of the small intestine was similar to that in the liver. From each construct, two mouse lines exhibiting the highest CAT activity were further studied: lines V and W of C3-CAT transgenic mice and lines Zf and Ze of eC3-A4-CAT transgenic mice.

Spatial Pattern of C3-CAT and eC3-A4-CAT Expression in the Small Intestine-- The spatial pattern of expression of the transgenes in the intestine along the crypt-to-villus and cephalocaudal axes was further determined and compared with that of endogenous mouse apoC-III and apoA-IV genes (Fig. 2). CAT activity did not vary along the small intestine when CAT gene expression was controlled by the -890/+24 apoC-III promoter (Fig. 2A). In contrast, CAT activity displayed a decreasing cephalocaudal gradient in eC3-A4-CAT mice (Fig. 2A). This expression pattern mimicked that of endogenous mouse apoA-IV and apoC-III mRNAs (Fig. 2B).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2.   Comparison of the distribution of endogenous mouse apoC-III and apoA-IV mRNAs with CAT activity along the intestinal cephalocaudal axis of transgenic and nontransgenic mice. A, distribution of CAT activity along the small intestine of the different transgenic mouse lines (C3-CAT and eC3-A4-CAT). The CAT activity of each intestinal segment (proximal, middle, and distal) was calculated relative to the total amount of CAT activity present in the small intestine of each transgenic mouse line. B, distribution of mouse apoA-IV and apoC-III mRNAs in the small intestine. Total RNA was prepared from each fragment, and 15 µg of total cellular RNA were examined by Northern blot analysis. Values are expressed as percent ratio of duodenal RNA.

Transgenic expression along the crypt-to-villus axis in the intestine was analyzed by in situ hybridization (Fig. 3). To demonstrate the specificity of the signal, an antisense and a sense CAT riboprobe were first hybridized to sections of nontransgenic and transgenic jejunum, respectively, as negative controls (Fig. 3, a and b). Using dark-field microscopy, a few scattered grains representing the background signal were seen with both probes. The CAT reporter gene driven by the human -890/+24 apoC-III promoter was expressed markedly in the crypt cells and lightly in the villus epithelial cells of the transgenic mice (Fig. 3d). The endogenous mouse apoC-III gene was expressed similarly in the crypt and villus epithelial cells (Fig. 3c). In contrast to C3-CAT transgenic mice, eC3-A4-CAT transgenic mice exhibited a pattern of CAT mRNA expression in the crypt-to-villus unit that was strikingly similar to that of the endogenous mouse apoA-IV mRNA (Fig. 3, e and f). These results suggest that the -700/+10 apoA-IV promoter contains a regulatory region that, in combination with the -500/-890 apoC-III enhancer, restricts the expression of the reporter gene to the villus, thus reproducing in the transgenic mice the crypt-to-villus gradient of expression that is observed for the endogenous apoA-IV gene.


View larger version (166K):
[in this window]
[in a new window]
 
Fig. 3.   Distribution of CAT mRNA and mouse apoC-III and apoA-IV mRNAs along the crypt-to-villus axis of the small intestine of adult mice. A sense or antisense CAT riboprobe and an antisense riboprobe for mouse apoC-III or apoA-IV were hybridized to a jejunal section of the intestine. In situ hybridization dark-field images are presented. a, shown is a control of jejunal sections from a nontransgenic mouse hybridized with an antisense CAT riboprobe. b, the specificity of the antisense CAT probe signal was assessed in the same experimental series by hybridization of jejunal sections of transgenic mouse with a sense CAT riboprobe. Only scattered grains are present in control sections a and b. c, shown are jejunal sections from a nontransgenic mouse hybridized with an antisense mouse apoC-III riboprobe. ApoC-III mRNA expression can be observed in villus-associated epithelial cells, and a specific signal is also seen in crypt-associated epithelial cells. d, shown are jejunal sections from a C3-CAT transgenic mouse hybridized with an antisense CAT riboprobe. CAT mRNA expression was strongest in epithelial cells of the crypt and at the base of the villus and decreased toward the villus tip. e, shown are jejunal sections from a nontransgenic mouse hybridized with an antisense mouse apoA-IV riboprobe. ApoA-IV mRNA was present from the villus base to the upper villus epithelial cells; apoA-IV mRNA was not observed in crypt epithelial cells. f, shown are jejunal sections from an eC3-A4-CAT transgenic mouse hybridized with an antisense CAT riboprobe. CAT mRNA expression was restricted to the villus-associated epithelial cells.

The ApoA-IV Distal Promoter Confers a Cephalocaudal and Crypt-to-Villus Expression Gradient to C3-CAT Transgenes-- To determine which region of the apoA-IV promoter was responsible for the expression pattern along both the cephalocaudal and crypt-to-villus axes, we generated additional mouse lines expressing the reporter CAT transgene under the control of the -890/+24 apoC-III promoter fused to the -310/-700 apoA-IV distal promoter region (Fig. 1B). Three founders were identified by polymerase chain reaction and were analyzed by Southern blotting (Fig. 1C).

As in C3-CAT transgenic mice, CAT activity was much higher in the liver than in the intestine of dA4-C3-CAT mice. However, in the latter, we observed a decreasing gradient of CAT activity from the proximal to the distal region of the intestine (Fig. 4). This pattern of expression differed from that of C3-CAT transgenic mice (Fig. 2). Thus, the addition of the -310/-700 apoA-IV distal promoter region to the -890/+24 apoC-III promoter restored the cephalocaudal pattern of expression observed for the endogenous apoC-III gene.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4.   Detection of CAT activity in the liver and in segments of the small intestine of dA4-C3-CAT transgenic mice. Samples from homogenates of the liver and different parts of the small intestine were assayed for CAT activity as described under "Materials and Methods." The presence of the -310/-700 apoA-IV promoter sequence establishes an appropriate cephalocaudal pattern of gene expression.

The expression of the transgene in the crypt-to-villus unit was visualized by histochemical staining of the nuclei of CAT-expressing cells in the small intestine. No staining was observed in control mice (Fig. 5, a and a') or in the lamina propria of transgenic mice (Fig. 5). CAT histochemistry revealed a pattern of expression similar to that observed previously by in situ hybridization. Crypt and villus nuclei were stained in C3-CAT transgenic samples (Fig. 5, b and b'), whereas staining was restricted to the villus in eC3-A4-CAT transgenic mice (c and c') as well as in dA4-C3-CAT transgenic samples (d and d'). Thus, the addition of the -310/-700 apoA-IV distal promoter region restricted the expression of the dA4-C3-CAT transgene to the villus in a pattern similar to that of endogenous apoA-IV, but not of endogenous apoC-III.


View larger version (138K):
[in this window]
[in a new window]
 
Fig. 5.   Pattern of CAT activity along the intestinal crypt-to-villus axis of the three different transgenic mice. Histochemical staining for CAT activity with no counterstaining was performed as described under "Materials and Methods." Sections were photographed with phase-contrast (a-d) and with bright-field (a'-d'). Nontransgenic proximal intestine was incubated in the complete staining mixture (a and a'). No staining was observed in either crypt (asterisks) or villus (arrows) epithelial cells. In transgenic sections, only nuclei were stained (visible as a black deposit). This staining appears to be specific since it was observed only in the transgenic mice (compare a and a' with the other panels). In the proximal section of the intestine from C3-CAT transgenic mice (b and b'), CAT staining was observed in both crypt and villus epithelial cells. The patterns of CAT staining along the crypt-to-villus axis of adult mice expressing the eC3-A4-CAT (c and c') and dA4-C3-CAT (d and d') constructs are indistinguishable and are restricted to villus epithelial cells.

After double staining the villus epithelial cells from dA4-C3-CAT intestine, neither enteroendocrine cells, visualized by Grimelius staining (Fig. 6, a and b), nor the goblet cells, visualized by periodic acid-Schiff staining (Fig. 6c), coincided with the specific staining of nuclei of CAT-expressing cells. These results suggest that the -310/-700 apoA-IV distal promoter region is sufficient to restrict gene expression to villus enterocytes along the cephalocaudal axis.


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 6.   Double histochemical staining analysis of the villus-associated epithelial cells. CAT-stained sections of the proximal intestine of the dA4-C3-CAT transgenic lines were further stained by the Grimelius silver method to visualize the enteroendocrine cells and with periodic acid-Schiff base to visualize the goblet cells. With the Grimelius silver method, enteroendocrine cells appear with a diffuse brown cytoplasmic staining (a and b, open arrows), and nuclei of CAT-expressing cells are dark (a and b). With periodic acid-Schiff staining, mucins in the goblet cells are stained pink (c, arrowheads), and nuclei of CAT expressing cells are stained brown (c). Only the villus epithelial cells are stained histochemically with CAT (a-c). Nuclei of the enteroendocrine cells appear to be negative within CAT staining (a and b). Periodic acid-Schiff-stained goblet cells do not appear to express the CAT reporter gene (c). Cell nuclei are designated by closed arrows and are negative for CAT staining.


    DISCUSSION

A preliminary report has shown that the entire intergenic region between the apoC-III and apoA-IV genes directs a pattern of expression of the transgene similar to that of endogenous apoA-IV (17). This expression was abolished with shorter constructs lacking the apoC-III promoter region. Bisaha et al. (16) showed that the apoC-III enhancer, located at nucleotide -520 upstream from the transcription initiation site of the apoC-III gene, is sufficient to direct the intestinal expression of the apoA-I gene, the third gene of the apoA-I/C-III/A-IV cluster, but not to restrict its expression to the villus. This prompted us to decipher the regulatory regions responsible for the accurate expression of apoA-IV by combining the apoC-III enhancer and the apoA-IV promoter. In our present study, we found that a combination of the -890/-500 apoC-III enhancer and the -700/-310 apoA-IV distal promoter allowed the intestinal expression of the apoA-IV gene in transgenic mice, specifically in the villus enterocytes, with a cephalocaudal gradient. Taken together, these results demonstrate that the appropriate lineage-specific crypt-to-villus and cephalocaudal patterns of human apoA-IV expression in transgenic mouse intestine require both the apoC-III enhancer and the apoA-IV distal promoter.

Our findings indicate that CAT activity in the intestine and liver in mice expressing the eC3-A4-CAT transgene reproduces the correct pattern of expression of endogenous mouse apoA-IV rather than that of human apoA-IV, which is predominantly expressed in the intestine. Lauer et al. (17) reported no expression of the human apoA-IV gene in the liver of transgenic mice expressing human apoA-IV genomic sequences containing 5'-flanking regions 0.3-7.7 kb long and a 3'-flanking region 1.5 kb long. These results, taken conjunction with our own, suggest that a hepatic silencer may reside downstream from nucleotide +24 of the human apoA-IV gene. It is possible that either a silencer in the human apoA-IV promoter or differences in the nuclear activities between humans and rodents may account for this difference in tissue-specific expression of the apoA-IV gene. Similarly, the weak ectopic expression of the C3-CAT and eC3-A4-CAT transgenes in tissues other than those of the liver and intestine may reflect the lack of tissue-specific silencers in the -890/+24 apoC-III and -700/+10 apoA-IV promoter regions.

In vitro transfection assays in the Caco-2 cell line showed that the transcription of the apoA-IV gene is controlled by hepatocyte nuclear factor 4 (HNF4), which binds to its proximal promoter region and requires the presence of other transcription factors that recognize elements of the apoC-III enhancer (19, 29). Similarly, the transcription of apoA-I and apoC-III genes is driven through a synergy between HNF4 and others factors that bind the apoC-III enhancer (16, 30-34). HNF4 binds the hormone response elements located in the three proximal promoters and in the apoC-III enhancer. Bisaha et al. (16) have shown that a region of the apoC-III enhancer containing the HNF4-binding site is insufficient to drive in vivo the intestinal expression of the apoA-I gene. Nevertheless, this factor could actively participate in the determination of intestinal apoA-I/C-III/A-IV gene expression. An HNF4-binding site has also been described in the FABP-I proximal enhancer, which is essential for intestinal expression (35). Furthermore, the involvement of HNF4 in the onset of intestinal functions has been demonstrated by the interruption of intestine development under extinction of the HNF4 homolog in Drosophila (36).

The eC3-A4-CAT transgene, which retains the -890/-500 apoC-III enhancer and -700/+10 apoA-IV promoter regions, was able to direct a pattern of CAT activity among intestinal segments that resembled both the pattern of endogenous mouse apoA-IV and that observed in rats and chickens (14, 37). Furthermore, the expression of the reporter gene was restricted to villus cells in a manner similar to the expression pattern of the endogenous mouse apoA-IV gene and also to that observed in rats (38). These results suggest that the apoA-IV promoter contains an element prohibiting the transcription of the reporter gene in crypt epithelial cells and in the distal part of the small intestine.

As already discussed, the apoC-III promoter region was not sufficient to restrict intestinal expression along the crypt-to-villus and cephalocaudal gradients. The addition of the -700/-310 apoA-IV distal promoter to the apoC-III enhancer allowed the expression of the reporter gene to mimic the cephalocaudal gradient displayed by endogenous mouse apoC-III. Furthermore, the -700/-310 apoA-IV promoter region retained the elements sufficient to restrict expression to villus-associated enterocytes. These findings indicate that the -310/-700 apoA-IV promoter region confers two suppressor functions, one prohibiting gene expression in the distal small intestine and the other prohibiting gene expression in crypt epithelial cells.

The spatial patterns of gene expression in the intestine involve both positive and negative elements. This has also been reported for the rat FABP-I gene, the rat liver fatty acid-binding protein gene, and the sucrase-isomaltase gene (6, 7, 10). Simon et al. (10) identified a 20-nucleotide element in the FABP-I promoter that modulates the intestinal cellular and spatial expression of the FABP-I gene. This element acts as a suppressor of gene expression in the distal small intestine/colon, as a suppressor of gene activation in the crypt, and as a suppressor of gene expression in the Paneth cell lineage (10). No sequence in the -700/-310 apoA-IV distal promoter significantly matched this 20-bp element. Thus, it is reasonable to hypothesize that in both apoA-IV and FABP-I, a distinct element controls a similar appropriate pattern of gene expression. Whether these two different elements bind similar or different repressors of gene expression in crypts and the distal part of the intestine remains to be established.

    ACKNOWLEDGEMENTS

We thank Carole Lasne, Maryse Séau, and Jeannine Demeurie for expert technical assistance.

    FOOTNOTES

* This work was supported by INSERM, University Paris VI; National Science Foundation Grant INT 9341607; and ECC Grant BIOTECH XT 960052.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed. Tel.: 33-142346899; Fax: 33-143251615.

    ABBREVIATIONS

The abbreviations used are: FABP-I, intestinal fatty acid-binding protein; bp, base pair(s); kb, kilobase pair(s); CAT, chloramphenicol acetyltransferase; HNF4, hepatic nuclear factor 4.

    REFERENCES
Top
Abstract
Introduction
References
  1. Gordon, J. I., and Hermiston, M. L. (1994) Curr. Opin. Cell Biol. 6, 795-803[CrossRef][Medline] [Order article via Infotrieve]
  2. Schmidt, G. H., Wilkinson, M. M., and Ponder, B. A. J. (1985) Cell 40, 425-429[CrossRef][Medline] [Order article via Infotrieve]
  3. Hermiston, M. L., and Gordon, J. I. (1995) Am. J. Physiol. 269, G813-G822[Abstract/Free Full Text]
  4. Henning, S. J., Rubin, D. C., and Shulman, R. J. (1994) in Physiology of the Gastrointestinal Tract (Johnson, L. R., ed), 3rd Ed., pp. 571-610, Raven Press, New York
  5. Hermiston, M. L., Green, R. P., and Gordon, J. I. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8866-8870[Abstract/Free Full Text]
  6. Cohn, S. T., Simon, T. C., Roth, K. A., Birkenmeir, E. H., and Gordon, J. I (1992) J. Cell Biol. 119, 27-44[Abstract/Free Full Text]
  7. Simon, T. C., Roth, K. A., and Gordon, J. I. (1993) J. Biol. Chem. 268, 18345-18358[Abstract/Free Full Text]
  8. Crossman, M. W., Hauft, S. M., and Gordon, J. I. (1994) J. Cell Biol. 126, 1547-1564[Abstract/Free Full Text]
  9. Markowitz, A. J., Wu, G. D., Bierkenmeier, E. H., and Traber, P. G. (1993) Am. J. Physiol. 265, G526-G539[Abstract/Free Full Text]
  10. Simon, T. C., Roberts, L. J. J., and Gordon, J. I. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8685-8689[Abstract/Free Full Text]
  11. Nielsen, L. B., McCormick, S. P. A., Pierotti, V., Tam, C., Gunn, M. D., Shizuya, H., and Young, S. G. (1997) J. Biol. Chem. 272, 29752-29758[Abstract/Free Full Text]
  12. Walsh, A., Ito, Y., and Breslow, J. L. (1989) J. Biol. Chem. 264, 6488-6494[Abstract/Free Full Text]
  13. Zannis, V. I., Cole, F. S., Jackson, C. L., Kurnit, C. L., and Karathanasis, S. K. (1985) Biochemistry 24, 4450-4455[CrossRef][Medline] [Order article via Infotrieve]
  14. Elshourbagy, N. A., Boguski, M. S., Liao, W. S. L., Jefferson, L. S., Gordon, J. I., and Taylor, J. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8242-8246[Abstract/Free Full Text]
  15. Gutierrez, E. D., Grapperhaus, K. J., and Rubin, D. C. (1995) Am. J. Physiol. 269, G500-G511[Abstract/Free Full Text]
  16. Bisaha, J. G., Simon, T. C., Gordon, J. I., and Breslow, J. L. (1995) J. Biol. Chem. 270, 19979-19988[Abstract/Free Full Text]
  17. Lauer, S. J., Simonet, W. S., Bucay, N., de Silva, H. V., and Taylor, J. M. (1991) Circulation 84, 1390 (abstr.)
  18. Ogami, K., Hadzopoulou-Cladaras, M., Cladaras, C., and Zannis, V. I. (1990) J. Biol. Chem. 265, 9808-9815[Abstract/Free Full Text]
  19. Ktistakis, E., Lacorte, J.-M., Katrakili, N., Zannis, V. I., and Talianidis, I. (1994) Nucleic Acids Res. 22, 4689-4696[Abstract/Free Full Text]
  20. Li, Z., Marchand, P., Humbert, J., Babinet, C., and Paulin, D. (1993) Development (Camb.) 117, 947-959[Abstract]
  21. Le Beyec, J., Benetollo, C., Chauffeton, V., Domiar, A., Lafrenière, M.-J., Chambaz, J., Cardot, P., and Kalopissis, A. (1998) Transgenics 2, 211-220
  22. Pothier, F., Ouellet, M., Julien, J. P., and Guerin, S. L. (1992) DNA Cell Biol. 11, 83-90[Medline] [Order article via Infotrieve]
  23. Gorman, C., Moffat, L., and Howard, B. (1982) Mol. Cell. Biol. 2, 1044-1051[Abstract/Free Full Text]
  24. Januzzi, J. L., Azrolan, A., O'Connell, A., Aalto-Setälä, K., and Breslow, J. L. (1992) Genomics 14, 1081-1088[CrossRef][Medline] [Order article via Infotrieve]
  25. Reue, K., and Leete, T. H. (1991) J. Biol. Chem. 266, 12715-12721[Abstract/Free Full Text]
  26. Sassoon, D., and Rosenthal, N. (1993) Methods Enzymol. 225, 384-404[Medline] [Order article via Infotrieve]
  27. Donoghue, M. J., Alvarez, J. D., Merlie, J. P., and Sanes, J. R. (1991) J. Cell Biol. 115, 423-434[Abstract/Free Full Text]
  28. Donoghue, M. J., Morris-Valero, R., Johnson, Y. R., Merlie, J. P., and Sanes, J. R. (1992) Cell 69, 67-77[CrossRef][Medline] [Order article via Infotrieve]
  29. Vergnes, L., Taniguchi, T., Omori, K., Zakin, M. M., and Ochoa, A. (1997) Biochim. Biophys. Acta 1348, 299-310[Medline] [Order article via Infotrieve]
  30. Ladias, J. A. A., Hadzopoulou-Cladaras, M., Kardassis, D., Cardot, P., Cheng, J., Zannis, V. I., and Cladaras, C. (1992) J. Biol. Chem. 267, 15849-15860[Abstract/Free Full Text]
  31. Mietus-Snyder, M., Sladek, F. M., Ginsburg, G. S., Kuo, F., Ladias, J. A. A., Darnell, J. E., and Karathanasis, S. (1992) Mol. Cell. Biol. 12, 1708-1718[Abstract/Free Full Text]
  32. Ginsburg, G. S., Ozer, J., and Karathanasis, S. (1995) J. Clin. Invest. 96, 528-538
  33. Talianidis, I., Tambakaki, A., Toursounova, J., and Zannis, V. I. (1995) Biochemistry 34, 10298-10309[CrossRef][Medline] [Order article via Infotrieve]
  34. Kardassis, D., Tzameli, I., Hadzopoulou-Cladaras, M., Talianidis, I., and Zannis, V. I. (1997) Arterioscler. Thromb. Vasc. Biol. 17, 222-232[Abstract/Free Full Text]
  35. Rottman, J. N., and Gordon, J. I. (1993) J. Biol. Chem. 268, 11994-12002[Abstract/Free Full Text]
  36. Zhong, W., Sladek, F. M., and Darnell, J. E. (1993) EMBO J. 12, 537-544[Medline] [Order article via Infotrieve]
  37. Steinmetz, A., Hermann, M., Nimpf, J., Aebersold, R., Ducret, A., Weinberg, R. B., and Schneider, W. J. (1998) J. Biol. Chem. 273, 10543-10549[Abstract/Free Full Text]
  38. Rubin, D. C. (1992) Am. J. Physiol. 263, G853-G863[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Leng, S. Lu, Y. Yao, Z. Kan, G. S. Morris, B. R. Stair, M. A. Cherny, and D. D. Black
Hepatocyte nuclear factor-4 mediates apolipoprotein A-IV transcriptional regulation by fatty acid in newborn swine enterocytes
Am J Physiol Gastrointest Liver Physiol, August 1, 2007; 293(2): G475 - G483.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Bietrix, D. Yan, M. Nauze, C. Rolland, J. Bertrand-Michel, C. Comera, S. Schaak, R. Barbaras, A. K. Groen, B. Perret, et al.
Accelerated Lipid Absorption in Mice Overexpressing Intestinal SR-BI
J. Biol. Chem., March 17, 2006; 281(11): 7214 - 7219.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Peignon, S. Thenet, C. Schreider, S. Fouquet, A. Ribeiro, E. Dussaulx, J. Chambaz, P. Cardot, M. Pincon-Raymond, and J. Le Beyec
E-cadherin-dependent Transcriptional Control of Apolipoprotein A-IV Gene Expression in Intestinal Epithelial Cells: A ROLE FOR THE HEPATIC NUCLEAR FACTOR 4
J. Biol. Chem., February 10, 2006; 281(6): 3560 - 3568.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Archer, D. Sauvaget, V. Chauffeton, P.-E. Bouchet, J. Chambaz, M. Pincon-Raymond, P. Cardot, A. Ribeiro, and M. Lacasa
Intestinal Apolipoprotein A-IV Gene Transcription Is Controlled by Two Hormone-Responsive Elements: A Role for Hepatic Nuclear Factor-4 Isoforms
Mol. Endocrinol., September 1, 2005; 19(9): 2320 - 2334.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Gao, Y. Wei, Y. Huang, D. Liu, G. Liu, M. Wu, L. Wu, Q. Zhang, Z. Zhang, R. Zhang, et al.
The Expression of Intact and Mutant Human apoAI/CIII/AIV/AV Gene Cluster in Transgenic Mice
J. Biol. Chem., April 1, 2005; 280(13): 12559 - 12566.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Carriere, R. Vidal, K. Lazou, M. Lacasa, F. Delers, A. Ribeiro, M. Rousset, J. Chambaz, and J. M. Lacorte
HNF-4-dependent Induction of Apolipoprotein A-IV Gene Transcription by an Apical Supply of Lipid Micelles in Intestinal Cells
J. Biol. Chem., February 18, 2005; 280(7): 5406 - 5413.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Carrier, G. Deblois, C. Champigny, E. Levy, and V. Giguere
Estrogen-related Receptor {alpha} (ERR{alpha}) Is a Transcriptional Regulator of Apolipoprotein A-IV and Controls Lipid Handling in the Intestine
J. Biol. Chem., December 10, 2004; 279(50): 52052 - 52058.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Lu, Y. Yao, H. Wang, S. Meng, X. Cheng, and D. D. Black
Regulation of apo A-IV transcription by lipid in newborn swine is associated with a promoter DNA-binding protein
Am J Physiol Gastrointest Liver Physiol, February 1, 2003; 284(2): G248 - G254.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Sauvaget, V. Chauffeton, D. Citadelle, F.-P. Chatelet, C. Cywiner-Golenzer, J. Chambaz, M. Pincon-Raymond, P. Cardot, J. Le Beyec, and A. Ribeiro
Restriction of Apolipoprotein A-IV Gene Expression to the Intestine Villus Depends on a Hormone-responsive Element and Parallels Differential Expression of the Hepatic Nuclear Factor 4alpha and gamma Isoforms
J. Biol. Chem., September 6, 2002; 277(37): 34540 - 34548.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. A. Ostos, D. Recalde, N. Baroukh, A. Callejo, M. Rouis, G. Castro, and M. M. Zakin
Fructose Intake Increases Hyperlipidemia and Modifies Apolipoprotein Expression in Apolipoprotein AI-CIII-AIV Transgenic Mice
J. Nutr., May 1, 2002; 132(5): 918 - 923.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
E. A. FISCHER, M.-C. VERPONT, L. A. GARRETT-SINHA, P. M. RONCO, and J. A. ROSSERT
Klf6 Is a Zinc Finger Protein Expressed in a Cell-Specific Manner during Kidney Development
J. Am. Soc. Nephrol., April 1, 2001; 12(4): 726 - 735.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Georgopoulos, H.-Y. Kan, C. Reardon-Alulis, and V. Zannis
The SP1 sites of the human apoCIII enhancer are essential for the expression of the apoCIII gene and contribute to the hepatic and intestinal expression of the apoA-I gene in transgenic mice
Nucleic Acids Res., December 15, 2000; 28(24): 4919 - 4929.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Vergnes, N. Baroukh, M. A. Ostos, G. Castro, N. Duverger, M. N. Nanjee, J. Najib, J.-C. Fruchart, N. E. Miller, M. M. Zakin, et al.
Expression of Human Apolipoprotein A-I/C-III/A-IV Gene Cluster in Mice Induces Hyperlipidemia but Reduces Atherogenesis
Arterioscler. Thromb. Vasc. Biol., October 1, 2000; 20(10): 2267 - 2274.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. J. Antes, S. A. Goodart, C. Huynh, M. Sullivan, S. G. Young, and B. Levy-Wilson
Identification and Characterization of a 315-Base Pair Enhancer, Located More than 55 Kilobases 5' of the Apolipoprotein B Gene, That Confers Expression in the Intestine
J. Biol. Chem., August 18, 2000; 275(34): 26637 - 26648.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-Y. Kan, S. Georgopoulos, and V. Zannis
A Hormone Response Element in the Human Apolipoprotein CIII (ApoCIII) Enhancer Is Essential for Intestinal Expression of the ApoA-I and ApoCIII Genes and Contributes to the Hepatic Expression of the Two Linked Genes in Transgenic Mice
J. Biol. Chem., September 22, 2000; 275(39): 30423 - 30431.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le Beyec, J.
Right arrow Articles by Cardot, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le Beyec, J.
Right arrow Articles by Cardot, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement