|
J Biol Chem, Vol. 274, Issue 8, 5213-5221, February 19, 1999
Regions of Endonuclease EcoRII Involved in DNA Target
Recognition Identified by Membrane-bound Peptide Repertoires*
Monika
Reuter ,
Jens
Schneider-Mergener§,
Dagmar
Kupper,
Andreas
Meisel¶,
Petra
Mackeldanz,
Detlev H.
Krüger, and
Cornelia
Schroeder
From the Institutes of Virology and § Medical
Immunology, Humboldt University Medical School (Charité),
D-10098 Berlin, Germany
 |
ABSTRACT |
Target sequence-specific DNA binding regions of
the restriction endonuclease EcoRII were identified by
screening a membrane-bound EcoRII-derived peptide scan with
an EcoRII recognition site (CCWGG) oligonucleotide duplex.
Dodecapeptides overlapping by nine amino acids and representing the
complete protein were prepared by spot synthesis. Two separate DNA
binding regions, amino acids 88-102 and amino acids 256-273, which
share the consensus motif KXRXXK, emerged.
Screening 570 single substitution analogues obtained by exchanging
every residue of both binding sites for all other amino acids
demonstrated that replacing basic residues in the consensus motifs
significantly reduced DNA binding. EcoRII mutant enzymes
generated by substituting alanine or glutamic acid for the consensus
lysine residues in DNA binding site I expressed attenuated DNA binding,
whereas corresponding substitutions in DNA binding site II caused
impaired cleavage, but enzyme secondary structure was unaffected.
Furthermore, Glu96, which is part of a potential catalytic
motif and also locates to DNA binding site I, was demonstrated to be
critical for DNA cleavage and binding. Homology studies of DNA binding
site II revealed strong local homology to SsoII
(recognition sequence, CCNGG) and patterns of sequence conservation,
suggesting the existence of functionally related DNA binding sites in
diverse restriction endonucleases with recognition sequences containing
terminal C:G or G:C pairs.
 |
INTRODUCTION |
Type II restriction endonucleases
(ENases)1 are ideal models
for investigating the molecular basis of specificity in the interaction of proteins with their specific DNA recognition sites. More than 2900 type II ENases isolated from different sources have been described,
representing more than 200 individual DNA sequence specificities (1).
They form one of the most comprehensive groups of functionally similar
proteins with distinct DNA binding specificities. As phylogenetically
diverse enzymes coded by eubacteria, archaebacteria, and viruses
evolved to recognize identical DNA sequences, a variety of structures
and mechanisms involved in DNA recognition can be expected.
EcoRII belongs to the IIE type of ENases characterized by
their essential interaction with two copies of the recognition site for
DNA cleavage. This cooperative mode of action limits their efficiency
of DNA restriction and may reflect additional biological functions
besides the defense of the host cell against invading foreign DNA (for
reviews, see Refs. 2 and 3). In bridging two DNA recognition sites in
cis or trans, type IIE ENases resemble proteins
involved in DNA replication and recombination, as well as in
transcription control, in pro- and eukaryotes (2-6). The dimeric
EcoRII ENase associates with two DNA sites (7-9) in a distance-dependent fashion through a DNA bending/looping
mechanism (10). Up to now, functional domains of EcoRII have
not been identified, and it is not known how DNA recognition is
realized at the amino acid level. The crystal structure of an
EcoRII-DNA complex remains to be determined.
Restriction ENases are remarkably recognition site-specific enzymes.
This is borne out in a high affinity (association constants, Ka 108-109
M 1) to their recognition sequence, a low
affinity to sites differing by only 1 base pair, and the precise
coupling of DNA recognition and site-specific cleavage. The structural
elements that make specific contacts with DNA target sites differ in
all ENase-DNA co-crystal structures analyzed so far, whereas their
tertiary and quaternary structure and the residues involved in
catalysis show a degree of conservation (cf. Refs. 11 and 12
for review). The structural data base of ENases is still too limited to
infer rules of protein-DNA recognition and, in particular, to decide whether these may define a protein-DNA recognition code. The
theoretical interest and practical impact of such recognition rules
make faster methods of identifying DNA binding sites in proteins most desirable.
We used spot synthesis (13) to prepare EcoRII-derived
peptide scans bound C-terminally to continuous cellulose membranes. Peptide scans have been applied successfully to the investigation of
linear or discontinuous protein-protein (14-16), or protein-metal (17)
contact sites. We have now adapted the peptide scan approach to
investigate protein-DNA contacts.
The study presented here led to the identification of two
EcoRII peptides capable of sequence-specific DNA binding.
EcoRII mutants constructed with mutations in these DNA
binding sites had altered DNA binding and scission properties. The
sequence of one of the two DNA binding sites led to the discovery of a putative family of DNA binding peptides in diverse restriction enzymes.
 |
EXPERIMENTAL PROCEDURES |
Determination of the EcoRII-encoding Nucleotide Sequence--
At
the onset of this study, there were two GenBankTM entries
for the complete nucleotide sequence of the ecoRII ENase
gene, X16025 (18) and M26404 (19), which differ in six nucleotides and
include two frameshifts. Before synthesizing peptide scans, it was
necessary to clarify these uncertainties. We sequenced our
EcoRII expression plasmid (10) originating from pR209 (19) in both directions. By using the Thermo Sequenase de-AzaG-Kit (Amersham
Pharmacia Biotech), it was possible to resolve a track of four
guanines, otherwise appearing as three, corresponding to nucleotide
position 676-678 of the sequence M26404. Except for this one
additional G and the deletion of a C at nucleotide position 710, our
results match sequence M26404. The revised nucleotide sequence was
submitted to GenBankTM (accession number AJ224995).
Synthesis of Peptide Scans--
All cellulose-bound
EcoRII-derived peptides were prepared semiautomatically on a
spot synthesizer (Abimed GmbH, Langefeld, Germany) as described
previously in detail (20).
Oligonucleotide Design and Labeling--
For testing the
specific binding of DNA to EcoRII peptides the
following synthetic oligonucleotide duplex (30-mer) was used: 5'CGTAACGAATATCCAGGGTTACGACGTCGA/
5'TCGACGTCGTAACCCTGGATATTCGTTACG (the
EcoRII-specific recognition site is underlined). Competition experiments were performed in the presence of an excess of the above
specific duplex or the following unspecific oligonucleotide duplex:
5'CGATCGACGATCGCGTATTATACGCGATCG/5'CGATCGCGTATAATACGCGATCGTCGATCG. The oligonucleotides were end-labeled with
[ -32P]ATP (ICN Biomedicals GmbH) using T4
polynucleotide kinase (MBI Fermentas) and purified by gel filtration on
probequant columns (Amersham Pharmacia Biotech).
DNA-Peptide Binding Experiments--
The cellulose-bound peptide
scan was rinsed for 5 min in methanol and then preincubated for 1 h in 100 mM maleic acid, 150 mM NaCl, 1%
blocking reagent (Boehringer Mannheim), pH 7.5, followed by three
washes with EcoRII binding buffer (33 mM
TrisOAc, 66 mM KOAc, 10 mM
Mg(OAc)2; pH 7.6) for 10 min. Usually the peptide scan was
incubated with 25 pmol of 5' 32P-labeled substrate DNA in a
total volume of 10 ml of EcoRII binding buffer for 1 h
at room temperature. The membrane was washed three times for 5 min with
EcoRII binding buffer and air-dried. The bound radioactivity
per peptide spot was quantitated by phosphorimaging (PhosphorImager,
type SI) and processed with ImageQuant software (Molecular Dynamics
GmbH). To compare data from different experiments, a serial dilution of
a 14C standard was included with each experiment, and the
absolute amount of radioactivity was taken into account. Peptide scans were stripped of bound radioactivity either by electroblotting and/or
extended washing steps in EcoRII binding buffer supplemented with 2 M NaCl or 1 M
K2HPO4, pH 8.0.
Site-specific Mutagenesis--
Oligonucleotide-directed
mutagenesis was carried out according to Vandeyar et al.
(21). The 1294-base pair EcoRI/PstI fragment from
expression vector pQE-30 containing the coding region for ENase
EcoRII (10) was cloned in M13mp18. Potential active site mutants were obtained by replacement of Glu at positions 96 and 234 and
Asp at position 130 by Ala. DNA binding site I double mutants were
obtained by substituting both lysines 92 and 97 by either Ala or Glu.
Analogously, Ala or Glu substituents were introduced into DNA binding
site II for lysines 263 and 268. The mutations were verified twice by
sequencing, after mutagenesis and again after re-cloning into the
expression vector pQE-30. The sequence of the whole ecoRIIR
gene was determined as described above. The quadruple mutations in the
DNA binding sites were constructed by ligating suitable
KpnI/EcoRV DNA fragments of the four double mutants. After DNA transformation and propagation in Escherichia coli JM109 (pDK1 R M+), the cloning
sites, as well as the mutations themselves, were confirmed by resequencing.
Protein Expression and Purification and Western
Blots--
Mutant and wild-type N-terminally His6-tagged
EcoRII proteins were purified by affinity chromatography on
nickel-nitrilotriacetic acid-agarose columns as described (10). In a
further purification step, the most concentrated protein fractions were
loaded onto HiTrap® Heparin Sepharose (Amersham Pharmacia Biotech).
EcoRII of 95% purity eluted at 600 mM NaCl in
20 mM potassium phosphate buffer (pH 7.0) with 1 mM EDTA. Protein-containing fractions were analyzed on 12%
polyacrylamide gels, and protein concentrations were determined
spectrophotometrically at 280 nm. After electroblotting of
polyacrylamide gels for 1 h, the nitrocellulose membrane was rinsed with phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4,
1.5 mM KH2PO4; pH 7.3) and blocked
for 1 h in phosphate-buffered saline with 10% neonatal calf serum
and 0.2% Tween. The blot was incubated for 1 h with primary
antibody (polyclonal rabbit EcoRII antiserum) diluted 1:2000
in blocking solution. After five 10-min washes with phosphate-buffered
saline, 0.2% Tween, peroxidase-labeled secondary antibody
(donkey-anti-rabbit peroxidase, Pierce) was added 1:2500 for 1 h
in blocking solution followed by five washes with phosphate-buffered
saline, 0.2% Tween. EcoRII bands were visualized by
chemiluminescence using SuperSignalTMULTRA (Pierce)
diluted 1:5 in water.
Enzyme Activity Assay--
The plasmid pBR322 (0.1 pmol; six
EcoRII sites per molecule) was cleaved to completion with
BamHI, extracted with phenol and chloroform, and
precipitated with ethanol. The redissolved DNA was incubated with 0.3 pmol of EcoRII wild-type or mutant proteins in 20 µl at
37 °C. Cleavage was monitored on 0.9% agarose gels.
The capacity of the enzyme variants to be activated to cleave resistant
DNA was tested by incubating 200 ng of phage T3 DNA (3 sites per
40,000-base pair genome) in the presence of an approximately 200-fold
molar excess of an EcoRII site-containing oligonucleotide duplex and 1 pmol of the enzyme in 20 µl for 90 min at 37 °C. DNA
fragments were separated on 0.7% agarose (22).
Assays for Protein-DNA Interaction: Gel Retardation and
KD Determination--
A radioactively labeled 191-base
pair polymerase chain reaction fragment (0.025 pmol) containing
one EcoRII-specific DNA recognition sequence was incubated
with increasing protein concentrations (0-5 pmol) in a 20-µl
reaction volume containing 33 mM TrisOAc (pH 7.6), 66 mM KOAc, 10 mM CaCl2, 10%
glycerol, bovine serum albumin (10 µg/ml) for 20 min at room
temperature. Reactions were immediately loaded on 5% polyacrylamide
gels, and electrophoresis was run at 4 °C. Results were analyzed
with a PhosphorImager (Molecular Dynamics GmbH). The ratio of
protein-bound to total radioactivity was calculated for each lane, and
the apparent KD was determined as the enzyme
concentration at which 50% of the total radioactivity was bound.
Comparison of DNA-protein complexes formed by EcoRII and its
mutants, shown in Fig. 5b, was made after incubating 0.025 pmol of polymerase chain reaction fragment with 2 pmol of the
respective protein for 20 min at room temperature.
CD Spectrometry of Purified EcoRII and Its Mutants--
For
circular dichroism spectroscopy, the proteins purified to 95% were
used at concentrations of about 1 mg/ml except for the quadruple
mutants K92E/K97E/K263E/K268E (0.26 mg/ml) and K92E/K97E/K263A/K268A (0.15 mg/ml). Three successive runs from 250 to 190 nm were performed in a cuvette with a 0.1-mm light path in a Jobin Yvon Dichrograph III
at a bandwidth of 5 nm, a scanning rate of 0.01 nm/s, and a time
constant of 1 s.
Phage Titration on E. coli Strains Expressing Wild-type and
Mutant EcoRII--
Phage grown on a Dcm E. coli strain was diluted in SM buffer (23), and 0.5 ml was
incubated with 0.3 ml of E. coli JM109 carrying plasmids
coding for the different EcoRII mutants or the wild-type
enzyme for 20 min at 37 °C. To improve phage adsorption, the
indicator cells were grown in the presence of 0.2% maltose. The
virus-host cell mixture plus 3 ml of top agar was then poured on LB
plates and incubated at 37 °C overnight.
Homology Studies--
A BLAST search was conducted of the
sequences of the EcoRII DNA binding peptides against the
SwissProt data base. Sequences of isoschizomers of EcoRII,
SsoII, NgoPII and LlaII were accessed through REBASE (1) and GenBankTM. The multiple alignment
(Higgins-Sharp) and the homology matching (Lipman-Pearson FASTA)
routines of the PC-based sequence analysis package DNAsis 2.5 (Hitachi)
were initially used for alignments of the total EcoRII
sequence to other ENases in the data base. Taking account of the
unusual length of the EcoRII sequence and the locations of
the two DNA binding sites, the search was repeated for the left and the
right halves of the EcoRII sequence. Sets of ENase sequences
were submitted to the multiple alignment program DIALIGN 2.0 (24) at
the Web site .
 |
RESULTS |
Sequence-specific DNA Binding Regions Identified in EcoRII Peptide
Scans--
The entire amino acid sequence presented as a set of 132 covalently cellulose-bound dodecapeptides overlapping by 9 amino acids
was screened for its ability to bind EcoRII recognition site-containing oligonucleotide duplexes. The length and overlap of the
peptides in the scan were chosen because individual segments of
discontinuous DNA binding sites generally do not exceed 9-12 amino
acids. Fig. 1a shows that
peptides from two regions distant in the primary sequence exhibit high
affinity to the oligonucleotide. The influence of Mg2+ ions
on DNA-peptide binding is evident by comparing Fig. 1a and Fig. 1b. The quantitative effect of Mg2+ is
shown in Fig. 1c. Because Mg2+ ions clearly
diminished unspecific DNA binding to several EcoRII peptides, all subsequent DNA binding experiments were carried out in
the presence of 10 mM Mg(OAc)2.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 1.
DNA binding to a synthetic
EcoRII dodecapeptide scan comprising the complete
amino acid sequence. A cellulose membrane with 132 EcoRII-derived peptide spots was incubated with a
radioactively labeled specific oligonucleotide duplex in the absence
(a) and in the presence (b) of 10 mM
Mg2+; c exhibits the quantitative differences in
the presence (black) or absence (gray) of
magnesium. The N-terminal peptide of the protein is at position A1, and
the C-terminal peptide is at G12.
|
|
To examine whether the interaction with the DNA substrate was specific
to the EcoRII recognition sequence CCWGG, the following series of competition experiments was carried out: (i) binding of the
labeled specific oligonucleotide duplex alone, (ii) binding as in i
with saturating amounts of an unlabeled, unspecific oligonucleotide, and (iii) binding as in i with saturating amounts of an unlabeled, specific oligonucleotide. The unspecific competitor was designed so as
to avoid any homology with the EcoRII recognition sequence at the dinucleotide level. Competing oligonucleotide duplexes were
saturating with respect to total peptide in the spots and represented a
104-105 molar excess of unlabeled over labeled
substrate. Data from series of competition experiments were compared
quantitatively on the basis of a 14C standard.
Under stringent competitive conditions, only five dodecapeptide spots
specifically bound oligonucleotides containing the EcoRII DNA recognition site (Fig. 2). The
binding of labeled specific oligonucleotide duplex to the peptides was
not reduced by saturating concentrations of unlabeled unspecific
oligonucleotides. In contrast, the same concentration of unlabeled
specific competitor DNA decreased the binding of labeled specific
substrate below 1%. In comparison to an EcoRII-specific
substrate, the labeled unspecific oligonucleotide duplex itself bound
to these peptides with an efficiency between 1% and, maximally, 10%
(data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2.
Binding of a specific substrate under
competitive conditions. DNA binding was performed in the absence
(white) and in the presence of saturating amounts of
unspecific (black) or sequence-specific (gray)
competitor DNA. The peptide sequences of the spots that bound the
substrate, as well as the minimal consensus motif present in both amino
acid sequences, are indicated at the bottom.
|
|
Two specific DNA binding regions spanning 15 and 18 amino acids,
located between EcoRII amino acid positions 88-102 (binding site I) and 256-273 (binding site II) were thus identified under highly competitive binding conditions. Both potential binding regions
share the minimal consensus motif KXRXXK (Fig.
2), which does not occur elsewhere in the EcoRII sequence.
Substitution Analysis Reveals Residues Critical for Peptide-DNA
Binding--
Substitution analogues of both potential DNA binding
sites of EcoRII were synthesized in which every amino acid
of the original sequence is replaced by all others. Fig.
3 depicts the layout of the peptide scan,
where each binding site is represented by 15 rows and 21 columns. The
original (wild-type) sequence occurs twice in each row: in the
left-most spot and in the column of the substituent corresponding to
the original residue. To evaluate the influence of single substitutions
on DNA binding, we calculated the initial binding efficiency
(i.e. to the wild-type peptide) as the average over all 30 original peptide spots plus or minus the 3-fold S.D. All binding
efficiencies outside this range were considered significant. It is
evident that certain basic amino acids had a significant influence on
DNA binding to both sites. Considerable effects of amino acid exchanges
on DNA binding are seen at the consensus motif lysine and arginine
residues at positions 92, 94, 97, and 98, as well as tryptophan 102 in
the first binding region and, more pronounced, at positions 263, 265, and 268 in the second binding region (cf. Fig. 2).

View larger version (144K):
[in this window]
[in a new window]
|
Fig. 3.
Influence of single amino acid substitution
on binding of EcoRII-specific DNA sequences. The
amino acid sequences and positions of both potential binding regions
are indicated at the left. Substituents at the respective
position are indicated horizontally. Binding strength within
the 3-fold S.D. range calculated from DNA binding to all spots of
unsubstituted EcoRII peptides is shown in gray.
Substitutions that decreased DNA binding are represented as white
squares; increased DNA binding is shown in black.
Upper panel, binding site I; lower panel, binding
site II.
|
|
Replacement of Critical Lysine Residues Alters DNA Binding
Properties but Not the Secondary Structure of EcoRII--
Following
the leads from the substitution experiment, both lysines (boldface
letters) in each potential binding site (site I,
RHFGKTRNEKRITRW; site II,
NSVSNRRKSRAGKSLELH) were replaced by neutral
alanine or acidic glutamic acid residues, yielding the double mutants
K92A/K97A, K92E/K97E, K263A/K268A, and K263E/K268E and the quadruple
mutants K92A/K97A/K263A/K268A, K92A/K97A/K263E/K268E,
K92E/K97E/K263A/K268A, and K92E/K97E/K263E/K268E. On expression in
E. coli, wild-type and mutant EcoRII appeared in
both the soluble and the insoluble fractions (cf. Ref. 9). The quadruple mutants K92E/K97E/K263E/K268E and K92E/K97E/K263A/K268A produced the lowest yields of soluble endonuclease proteins. All EcoRII derivatives eluted from nickel-nitrilotriacetic acid
columns under the same conditions as the wild-type protein. Western
blot analysis of the purified wild-type and the eight DNA binding site mutant proteins confirmed their reactivity toward polyclonal
EcoRII antibodies and the presence of one predominant band
at the molecular weight of the wild-type protein (data not shown).
Three CD spectra for each EcoRII mutant enzyme were
accumulated, and the secondary structure was calculated according to
Chen et al. (25). Fig. 4 shows
that the CD spectra of the wild-type and the DNA binding site mutants
do not reveal obvious differences in secondary structure of the
proteins. Because of the lower protein concentrations available for the
spectrometric measurements of the quadruple mutants
K92E/K97E/K263E/K268E and K92E/K97E/K263A/K268A, their spectra
exhibited a lower signal-to-noise ratio than those from the other
proteins.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
CD spectrometry of purified N-terminally
His6-tagged EcoRII and its mutants.
For circular dichroism spectroscopy protein preparations purified to
95% had a concentration of about 1 mg/ml, except for the quadruple
mutants K92E/K97E/K263E/K268E (0.26 mg/ml) and K92E/K97E/K263A/K268A
(0.15 mg/ml). Three successive measurements from 250 to 190 nm were
performed using a cuvette with a 0.1-mm path length in a Jobin Yvon
Dichrograph III at a bandwidth of 5 nm, a scanning rate of 0.01 nm/s,
and a time constant of 1 s.
|
|
The DNA binding behavior of wild-type EcoRII and its
derivatives mutated in one or both binding sites was compared by gel retardation assays in the absence of Mg2+ ions to prevent
DNA cleavage (Fig. 5). Constant low DNA
concentration and varying protein concentrations, covering at least 2 orders of magnitude, were employed to determine the apparent
dissociation constants KD(app) of
EcoRII-DNA complexes. For the calculation of
KD(app) values, we made the simplifying
assumption that given the excess of enzyme over DNA, only one substrate
(S) binding site of the enzyme dimer (E) was
occupied. The obtained constants shown in Fig. 5a were
therefore calculated according to KD = [S][E]/[SE].

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5.
Apparent dissociation constant determination
for EcoRII-DNA complexes. a, DNA
binding affinity of EcoRII wild-type and mutants were
evaluated after incubating varying concentrations of the respective
enzyme with 1 nM 32P-labeled 190-base pair
polymerase chain reaction fragment with a single cognate recognition
site. After polyacrylamide gel electrophoresis at 4 °C, results were
quantitated by phosphorimaging. KD(app)
value was determined by gel shift assays as described by Carey (53). *,
arithmetic means of 3-6 independent determinations; #, value exceeds
highest tested enzyme concentration. b, gel retardation of
the EcoRII-DNA complexes after separation on a 5%
polyacrylamide gel (for reaction conditions, see under "Experimental
Procedures").
|
|
The replacement of both K residues by A in DNA binding site I
(K92A/K97A) led to a 6-fold decrease in DNA binding and the formation
of slower migrating complexes in comparison to wild-type EcoRII, whereas the introduction of E in place of K
(K92E/K97E) nearly abolished DNA binding. In contrast, both binding
site II mutants showed dissociation constants comparable to wild-type. The KD values of the quadruple mutants substituted
in both binding sites exceeded those of the individual binding site mutants from which they were composed. Furthermore, the gel mobility shift assay with the quadruple mutant enzymes reproducibly separated a
number of complexes distinct in size and/or conformation from the
EcoRII wild-type-DNA complex (Fig. 5b). It was
evident from competition experiments with a 1000-fold molar excess of
unspecific or specific unlabeled DNA that the residual binding capacity
of the EcoRII mutants was still recognition
sequence-specific (data not shown).
Impaired Restriction Activity of EcoRII DNA Binding Site
Mutants--
The catalytic activity of the eight mutant enzymes was
tested on linearized pBR322 DNA and compared with the wild-type enzyme (Fig. 6a). Alanine
substitutions in DNA binding site I at positions 92 and 97 did not
reduce cleavage activity compared with the EcoRII wild-type
ENase. However, lysine exchanges to glutamic acid caused a strong
decrease in DNA cleavage activity, without a concomitant change in
recognition site specificity (Fig. 6a). This was apparently correlated to the extremely weak substrate binding of the mutant enzyme
K92E/K97E (cf. Fig. 5), consistent with a repulsion of DNA
phosphates by the introduced negative charges. Monitoring the time
dependence of pBR322 cleavage confirmed the low but still measurable
cleavage rate of K92E/K97E (data not shown). Both mutations in DNA
binding site II and all of the quadruple mutations resulted in
catalytically inactive enzymes (Fig. 6a). Even after 2 h, no DNA hydrolysis could be detected under standard EcoRII
reaction conditions (data not shown).

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 6.
Cleavage of pBR322 by EcoRII
wild-type and its mutant enzymes. BamHI-linearized
pBR322 DNA (0.6 pmol of EcoRII sites) was incubated in 20 µl with 0.3 pmol of homogeneous EcoRII wild-type enzyme or
the respective mutant proteins altered in one or both binding sites
(a) or in the putative active site (b) for 1 h at 37 °C and analyzed on 0.9% agarose gel. Molecular weight
markers: 1-kb ladder (Life Technologies, Inc.).
|
|
Table I summarizes the properties of all
constructed EcoRII mutants and additionally includes the
ability of the enzymes to be activated by site-containing
oligonucleotides to cleave resistant DNA sites, as well as their
efficiency of restricting phage reproduction in E. coli
host cells. EcoRII can be activated in trans to
cleave single, resistant recognition sites, e.g. on viral T3
and T7 DNA, by co-incubation with another, susceptible DNA (26) or even
by short synthetic oligonucleotide duplexes carrying the canonical
recognition sequence (22).
The alanine substitutions in binding site I yielded a mutant with a
6-fold increased KD(app) value for DNA
that behaved like the wild-type in the other investigated parameters.
This is not surprising, because the assays were run under optimal
conditions. For example, the ratio of enzyme dimers to recognition
sites of 1:2 employed in the cleavage reactions was sufficient to
counteract the reduced substrate affinity of K92A/K97A. For the
glutamic acid mutant in the same binding site, DNA binding was hardly
detectable, and catalytic activity was very weak. These in
vitro features of K92E/K97E match a significant decrease of phage
restriction to only 1 order of magnitude, as opposed to 4 orders of
magnitude by the EcoRII wild-type and the K92A/K97A mutant.
Both binding site II mutants were catalytically inactive in
vitro and could not be transactivated but were still capable of
restricting phage by approximately 1-2 orders of magnitude.
Conceivably, the physiological environment offers more appropriate
conditions for the mutant enzymes, because K263A/K268A can be
stimulated to cleave DNA in vitro in the presence of 5-50
mM
Mn2+.2
Restriction in vivo may also be related to tight
repressor-like binding of the binding site II mutants to their very
frequent recognition sites in the genome. The four enzyme variants
with mutations in both binding sites exhibited in vitro
characteristics similar to those of the binding site II mutants but
with significantly reduced DNA binding, and they no longer restricted
phage in the host cell.
DNA Binding Site I Overlaps a Potential Catalytic Motif--
A
search for catalytically relevant amino acid residues based on the
crystal structures of ENase-DNA complexes (cf. Refs. 11, 27,
and 28 for review) detected at least three potential catalytic
consensus motifs P(D/E)Xn(D/E)X(K/R), two
of which are in the vicinity of binding site I (Fig.
7a). Both acidic amino acid
residues in the consensus motif were found to be important for cleavage
in the ENases EcoRI and EcoRV (cf.
review in Ref. 11). We have constructed mutants E96A, D130A, and E234A
in the three potential catalytic motifs of EcoRII.
Substituting glutamic acid at position 96 by alanine eliminated DNA
cleavage (Fig. 6b) and binding (data not shown), whereas
when alanine was introduced into equivalent positions of the two other
potential catalytic motifs,
111PEX17DCK132 and
214PDX18ELH236, it was
tolerated, and DNA cleavage activity was almost unaffected (Fig.
6b). These results clearly implicated Glu96 of
the first potential catalytic motif located in DNA binding site I as
critical for catalysis.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 7.
DNA binding sites in the restriction ENase
EcoRII: conserved residues and similar motifs in other
ENases. a, location of DNA binding sites and of
potential catalytic motifs in the sequence of EcoRII. Amino
acid residues marked with a "c" belong to potential
catalytic consensus motifs identified by computer search. b,
homology studies of EcoRII DNA binding sites I and II.
Alignments of the two binding sites (between vertical lines)
and nine flanking residues are shown. All EcoRII residues
and similar residues of other enzymes are in capital
letters. Identical residues are in boldface. Homologies
spanning three residues or more are on a gray background.
Gaps are indicated by . Residues known to be essential for catalysis
are boxed (cf. details described under
"Discussion"). A consensus amino acid is defined at positions where
60% of the residues are homologous (* above the predominant residue
indicates the occasional presence of other amino acids of its homology
group(s), defined as follows: {K;R;H}, {D;E}, {F;Y},
{I;L;M;V}, {D;N}, {E;Q}, {N;Q}, and {S;T}).
Boldface indicates conservation 80%. The positions
of the first residue are numbered at the left and
recognition sites (with "/" for the cleavage site, where known) at
the right. The recognition site of CglI has not
been determined. c, pairwise comparison of peptides aligned
to DNA binding site II. The percentages of identical (first
number) and similar (second number) residues of the
peptides aligned in b (excluding the flanking sequences) are
shown. For each enzyme, the highest scoring alignment, as judged by the
sum of the identical plus 0.5 times the similar residues, is identified
by a gray background, and the enzyme number is in
superscript.
|
|
Sequence Alignments Identify DNA Binding Site II Analogues in Other
Restriction Endonucleases--
A BLAST search of EcoRII DNA
binding sites I and II produced three ENases with similarities to
binding site II, SsoII, NgoPII, and
LlaII. All available amino acid sequences of their
isoschizomers (1) were then screened to yield ScrFI,
MthTI, and DpnII (Fig. 7b). Further
close relatives of LlaII (MboI and MJ0600) and of NgoPII (FnuDI) are not shown here because the
respective sequence elements are nearly identical. Sequences related to
DNA binding site II were also found in CglI and
CviAII (Fig. 7b). The core sequences of the
alignment (Fig. 7b, between vertical lines) were compared for every pair of enzymes, revealing similarities not only
among truly homologous enzymes with identical recognition sites, such
as LlaII and DpnII, but also, for example,
between NgoPII and DpnII, the recognition sites
of which share only the outer G:C pairs (Fig. 7c). However,
the greatest similarity between EcoRII DNA binding site II
and all other analyzed ENase sequences was observed to SsoII
(Fig. 7c). It appears especially significant that the
homology to SsoII as well as ScrFI is focal to
DNA binding site II, as both enzymes are specific to CCNGG, a
degenerate version of the EcoRII DNA recognition sequence.
To see whether the identified DNA binding site II analogues would be
juxtaposed by multiple alignment of the whole set of enzymes (Fig.
7b), their total sequences were submitted to DIALIGN 2.0, a
program designed to identify local similarities in functionally related
proteins, the sequences of which are not necessarily globally related.
DIALIGN 2.0 is particularly suitable for the task as it was the only of
five alignment programs to identify all DNA binding sites in a set of
11 diverse helix-turn-helix proteins of vastly different size (24).
DIALIGN 2.0 aligned the DNA binding site II analogues in
EcoRII, SsoII, ScrFI,
NgoPII, MthTI, LlaII, and
DpnII as the regions of maximal similarity of these enzymes. The same maximal alignment score for the binding site II analogues of
these enzymes, as well as of FnuDI and MboI (see
above), resulted when a larger set of sequences that additionally
included LlaI, NgoFVII, HpaII, and
Cfr10I was analyzed, enzymes selected for resemblances to
the enzymes shown in Fig. 7b. NgoFVII is a
CglI homolog with a known recognition sequence (GCSGC) but
with less similarity to DNA binding site II than CglI
itself; HpaII is another type IIE enzyme (1) and
LlaI (open reading frame 3) encodes a subunit of a complex
restriction endonuclease (29) that, like CviAII, contains
the KXRXXK motif.
Surprisingly, three different peptides of the type IIE ENase
NaeI were identified by independent alignment routines.
NaeI 58-75 (Fig. 7b) emerged from a FASTA
homology search (cf. the procedure described under "Experimental
Procedures") of the C-terminal half of the EcoRII
sequence, NaeI 188-205 emerged from the DIALIGN 2.0 analysis of the enzyme set shown in Fig. 7b, and
NaeI 147-164 emerged from the alignment of the enlarged set
of enzymes. All three NaeI peptides include a leucine
corresponding to Leu274 and a glycine corresponding to
Gly267 of EcoRII DNA binding site II, the most
conserved residue of the alignment in Fig. 7b. By random mutagenesis,
Holtz and Topal (30) located functionally essential residues in all
three of these NaeI peptides, including Thr63,
Glu70, Gly155, and Gly196, and a
recent domain analysis (31) placed the latter two peptides in the
C-terminal DNA binding domain of NaeI, whereas peptide 58-75 is in the N-terminal part of the enzyme predicted to be involved
in catalysis and dimerization. NaeI 58-75 was included in
Fig. 7b because the Thr and Glu residues (boxed)
implicated in catalysis (30) belong to the consensus residues of the alignment.
Although the BLAST search of EcoRII DNA binding site I did
not pick up any other ENases, a similar peptide in SfiI was
located by a Higgins-Sharp alignment (cf. the procedure described under "Experimental Procedures") (Fig. 7b). SfiI is
functionally related to EcoRII in requiring, and
simultaneously cleaving, two copies of its recognition site; however,
it does this not as a dimer but a tetramer (6). A mutational analysis
of SfiI is not available.
 |
DISCUSSION |
Deconstruction of the EcoRII-DNA Interaction--
We were
interested in the structural basis of target recognition by the
restriction ENase EcoRII. Because crystallographic information was not available, we explored an alternative approach to
the study of DNA-protein affinity, synthetic peptide scans. The
procedure that allowed the identification of sequence-specific DNA
binding to matrix-bound peptides comprised the following elements: unspecific DNA binding was lowered in the presence of Mg2+
ions (Fig. 1, b and c) and suppressed in the
presence of an excess of unlabeled unspecific competitor DNA, designed
to differ from the target site-containing DNA at the dinucleotide
level. Specific binding was only suppressed by an excess of unlabeled
specific competitor DNA (Fig. 2). The peptide scan approach allowed us to delineate two potential DNA binding sites of EcoRII.
Type II DNA restriction ENases generally bind palindromic
double-stranded DNA recognition sites in a symmetrical fashion
(normally as dimers); a number of residues within one or two
5-15-amino acid regions, and shorter peptides or individual amino
acids from different parts of the ENase monomer establish direct or
water-mediated contacts with bases and phosphate groups of the DNA
target site. Can any degree of specificity of such a complex
DNA-protein interaction be preserved after breaking up a
three-dimensional binding site into short peptide modules? Attempts to
model DNA binding specificity of a protein by peptides in solution
often fail (cf. Ref. 32). One exception is the dodecapeptide
WDGMAAGNAEIER comprising the extended chain region
(underlined) of EcoRI. This peptide binds specifically to
GAATTC with Ka = 3 × 104
M 1, i.e. about 5000 times weaker
than EcoRI itself. Judging by inhibition studies of enzymes
with related recognition sequences the target specificity of this
peptide was retained (33).
In general, incorporation of DNA binding peptides into macromolecular
frameworks appears to be necessary to overcome the loss of
conformational and translational entropy accompanying sequence-specific association of a peptide with DNA (cf. Ref. 32). Thus,
incorporation of peptides involved in sequence-specific DNA
recognition, e.g. of zinc fingers into a phage display coat
protein (34), or of a recognition helix from a helix-loop-helix protein
into an antibody Fab domain (35), reproduced the DNA sequence
specificities of the original proteins. Stanojevic and Verdine (32)
introduced a new experimental approach to the quest they defined as the
deconstruction of sequence-specific DNA-protein interactions by
tethering DNA binding domains covalently to DNA. The close proximity of
the peptide to its target sequence overcomes the entropic and energetic barriers to peptide DNA recognition.
Johnson et al. (36) extended the concept of induced fit from
purely macromolecular to peptide-DNA interactions by demonstrating that
the intrinsically flexible DNA binding peptides of basic helix-loop-helix and leucine zipper proteins assume -helical conformation after binding DNA. Compared with peptides in solution, peptide scans offer two features that potentially facilitate
sequence-specific induced fit to oligonucleotides: 1) the terminal
covalent attachment of the peptide to the membrane reduces
conformational entropy, and 2) the high local concentration of each
peptide may counterbalance the loss of several orders of magnitude of
affinity associated with the transition from the macromolecular to the
peptide/oligonucleotide level.
Both DNA binding sites identified in the EcoRII peptide scan
are hydrophilic and characterized by an abundance of positively charged
residues. Conversely, not all positively charged peptides in the
peptide scan specifically bound to DNA, for example, LAVKTTCKDRWR (amino acids 262-273), the peptide in spot F8. Another relatively basic region, G3-G6, only bound to the specific probe in the absence of Mg2+ (Fig. 1). The substitution experiment confirmed the
importance of the basic residues of the discovered conserved motif,
KXRXXK. A critical role seems to be played by
Lys268 because Arg was the only tolerated replacement (Fig.
3). At certain positions (Thr93, Lys97,
Arg261, and Arg262), binding of the specific
oligonucleotide was only abrogated by introducing acidic residues (Fig.
3). Replacement of several amino acids by lysine and/or arginine in the
peptides actually enhanced binding, indicating an increase in the
strength of nonspecific interactions. However, where the substitution
by basic amino acids had no effect, the contribution of the original
residues (Thr93, Trp102, and
Leu272) to specific binding can be inferred to exceed the
gain in strength of nonspecific electrostatic interactions.
Of course, the function of individual residues for sequence-specific
DNA binding by the protein cannot be directly extrapolated from the
results at the peptide level. In particular, we cannot predict whether
the lysines of the motif KXRXXK form base or
backbone contacts or are important for the geometry or the charge
distribution at the DNA binding sites. However, we have demonstrated
that these lysines play an important role in DNA binding, as all eight
mutant enzymes in which these lysines were replaced by alanine or
glutamic acid exhibited impaired DNA binding and/or cleavage (Table
I).
Although the substitution peptide scan experiment may emphasize the
contribution of electrostatic binding at the expense of other types of
interaction, basic amino acids do play a direct role in
sequence-specific interactions of all six restriction ENases of which
the recognition site complexes have been analyzed crystallographically
(for a review, see Refs. 11, 27, and 28). To cite two examples of
sequence-specific DNA binding predominantly involving lysine and
arginine residues, the rel domain of p50 (37, 38) and the tumor
suppressor factor p53 (39), contain seven (p50) or six (p53) basic
amino acids in their target recognition sites, of which four (p50) or
two (p53) form hydrogen bonds to DNA bases, and the others of which
bind to the phosphate groups. These latter interactions are termed the
indirect readout, as they reflect the sequence-specific conformation of
the DNA backbone (40, 41).
Implications for the Structure of the EcoRII-DNA Complex--
How
do the two DNA binding sites identified in the primary sequence of
EcoRII relate to the substrate binding sites of the enzyme?
EcoRII operates as a dimer binding two DNA recognition sequences at two substrate binding sites (2, 3, 7-10, 42), the
functional equivalence of which is indicated by cleavage kinetics (43),
by the capacity for simultaneous cleavage at both DNA recognition
sequences independent of the orientation of the internal A/T pairs
(10). Hence, neither substrate-binding site exhibits DNA strand
preference in the recognition and cleavage process.
Type II ENases with palindromic recognition sites generally form
rotationally symmetrical dimer-DNA complexes with the monomers establishing nonsymmetrical contacts to both strands of the recognition site and cleaving each strand separately (11). By this logic, the
EcoRII dimer should require four catalytic sites, one for each strand of each of the two DNA target sequences. It is reasonable to propose that these are formed by two catalytic centers from each
monomer. We have presented evidence (Fig. 6b) that
Glu96 in DNA binding site I is essential for cleavage and
could be part of a classical catalytic motif
P(D/E)Xn(D/E)X(K/R) (Fig. 7a).
Similar to the case of FokI (27, 12) a second catalytic motif is as yet unaccounted for, and in view of the 5-base pair distance between the scissile phosphodiester bonds, it is difficult to
envisage cleavage of both DNA strands by a single catalytic center, as
this would necessitate a rearrangement of the whole enzyme-substrate complex.
We hypothesize that both of the predicted DNA binding sites
I and II participate in the formation of each of the two
equivalent substrate-binding sites of EcoRII. This
configuration is consistent with the behavior of the DNA binding site
mutants. For example, the substitutions K92E/K97E in binding site I
nearly abolished binding of single site substrates to the enzyme dimer,
so both EcoRII substrate binding sites must have been
affected. In the quadruple mutants, binding site II governed catalytic
activity, whereas binding site I determined the stability of the
enzyme-DNA complex. Glu96, which is essential for catalysis
is also located in binding site I (Figs. 5-7; Table I). In summary,
changes in either of the identified DNA binding sites always affected
binding or cleavage at both substrate-binding sites of the
EcoRII dimer. It still remains to be shown whether the
substrate binding sites of the EcoRII dimer are sequestered
to the monomers or involve DNA binding sites from both monomers.
In general, the organization of EcoRII functional regions
(Fig. 7a) derived from our studies resembles that proposed
for NaeI, another member of the type IIE ENases. For
NaeI, one functional domain located by random mutagenesis
near the N terminus includes acidic, possibly catalytic amino acid
residues, and a basic region where amino acid substitutions attenuate
DNA binding. The second, more C-terminal domain can be expressed
separately and includes a larger basic region required for DNA binding
(30, 31).
Related DNA Binding Motifs in Diverse Restriction ENases--
The
great similarity of DNA binding site II of EcoRII (/CCWGG)
to a sequence in SsoII (/CCNGG) and its considerable
resemblance to a ScrFI (CC/NGG) sequence lends independent
support to a role of this site in sequence-specific DNA recognition
(Fig. 7b), especially because EcoRII is a type
IIE enzyme, whereas SsoII and ScrFI are mutually
unrelated type II enzymes. Their distinct cleavage preferences necessitate differences in DNA recognition sequence specificity, which
may be reflected in the sequence differences of the EcoRII DNA binding site II analogues.
Unlike DNA methyltransferases (MTases), type II ENases have not been
subtyped according to patterns of secondary structure, catalytic and
DNA binding motifs (cf. Ref. 44), with the exception of a
group of ENases homologous to EcoRI, in which this
assignment was based on the EcoRI 3D structure (45, 46).
Janulaitis (46) also mentioned the existence of islands of sequence
homology in other groups of ENases with related recognition sites but
as yet unknown DNA binding sites. A different approach was taken by
Jeltsch et al. (44), who attempted to reconstruct
evolutionary trees of type II ENases by progressive, multiple sequence
alignments and to assess the significance of the resulting groups of
pairwise related enzymes by a multistep Monte-Carlo analysis of their
recognition sequences. Although enzymes within the same group usually
had similar recognition sequences, EcoRII and
NgoPII (GG/CC) emerged as the closest relatives. This result
agrees with the local sequence similarity of the two enzymes discovered
by the BLAST search and confirmed by DIALIGN 2.0 (cf. the
procedure described under "Results").
The target-recognition domains of (cytosine-C5) DNA MTases have a
conserved general structure (47, 48). Several attempts have been made
at finding common DNA recognition principles in cognate ENases and
MTases. Sequence similarities between the region of EcoRII
encompassing Arg265 and Lys268 (part of
KXRXXK in binding site II) and MTases specific to
CCWGG or CCNGG, in an RXXK motif of their predicted target
recognition domains (49), were already discovered by Kossykh et
al. (50). In earlier, related studies, Janulaitis et
al. (51) identified conserved motifs shared by other cognate
ENases and MTases, whereas Swaminathan et al. (52) found
scattered, short fragments of homology between several ENases and
MTases sharing recognition sites with central CG.
Our homology study (Fig. 7, b and c) identified
sequences related to DNA binding site II in several ENases with
terminal G:C or C:G base pairs as the only common feature of their
diverse recognition sequences (Fig. 7b). These peptides may
constitute modules for sequence-specific DNA recognition, specialized
to read C:G or G:C in different contexts. Their overall similarity is
striking, and it will be interesting to establish how the differences between them relate to their specific DNA targets and whether other
families of DNA recognition modules exist. Peptide scans, which have
proved their utility for identifying DNA binding regions in proteins
specifically interacting with DNA, could provide further clues.
 |
ACKNOWLEDGEMENTS |
We are very grateful to Andrea Kunz for help
in DNA sequencing of EcoRII mutants and to Ursula Scherneck
for skillful technical assistance. We thank Jürgen Alves (Zentrum
Biochemie, Medizinische Hochschule Hannover, Institut für
Biopysikalische Chemie) for his advice and help with CD spectrometry.
We are obliged to Geoffrey Wilson (New England Biolabs) for the
sequences of SfiI and FnuDI.
 |
FOOTNOTES |
*
This work was supported by Deutsche Forschungsgemeinschaft
Grant Re 879/2-1, Bundesministerium für Bildung und Forschung (BMBF FKZ 0311014), Fonds der Chemischen Industrie, and
Universitäre Forschungsförderung of the Humboldt University
Medical School (Charité).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
We dedicate this paper to Prof. Hans-Alfred Rosenthal on the occasion
of his 75th birthday.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ224995.
To whom correspondence should be addressed. Tel.: 49-30-2802-2388 or 49-30-2802-2387; Fax 49-30-2802-2180.
¶
Present address: Department of Neurology, Humboldt University
Medical School (Charité), D-10098 Berlin, Germany.
 |
ABBREVIATIONS |
The abbreviations used are:
ENase, restriction
endonuclease;
MTase, methyltransferase.
2
M. Reuter and P. Mackeldanz, unpublished results.
 |
REFERENCES |
-
Roberts, R. J.,
and Macelis, D.
(1998)
Nucleic Acids Res.
26,
338-350[Abstract/Free Full Text]
-
Bickle, T. A.,
and Krüger, D. H.
(1993)
Microbiol. Rev.
57,
434-450[Abstract/Free Full Text]
-
Krüger, D. H.,
Kupper, D.,
Meisel, A.,
Reuter, M.,
and Schroeder, C.
(1995)
FEMS Microbiol. Rev.
17,
177-184[Medline]
[Order article via Infotrieve]
-
Topal, M. D.,
and Conrad, M.
(1993)
Nucleic Acids Res.
27,
2599-2603
-
Jo, K.,
and Topal, M. D.
(1995)
Science
267,
1817-1820[Abstract/Free Full Text]
-
Wentzell, L. M.,
Nobbs, T. J.,
and Halford, S. E.
(1995)
J. Mol. Biol.
248,
581-595[CrossRef][Medline]
[Order article via Infotrieve]
-
Gabbara, S.,
and Bhagwat, A. S.
(1992)
J. Biol. Chem.
267,
18623-18630[Abstract/Free Full Text]
-
Petrauskene, O. V.,
Karpova, E. A.,
Gromova, E. S.,
and Guschlbauer, W.
(1994)
Biochem. Biophys. Res. Commun.
198,
885-890[CrossRef][Medline]
[Order article via Infotrieve]
-
Kupper, D.,
Reuter, M.,
Mackeldanz, P.,
Meisel, A.,
Alves, J.,
Schroeder, C.,
and Krüger, D. H.
(1995)
Protein Expression Purif.
6,
1-9[CrossRef][Medline]
[Order article via Infotrieve]
-
Reuter, M.,
Kupper, D.,
Meisel, A.,
Schroeder, C.,
and Krüger, D. H.
(1998)
J. Biol. Chem.
273,
8294-8300[Abstract/Free Full Text]
-
Pingoud, A.,
and Jeltsch, A.
(1997)
Eur. J. Biochem.
246,
1-22[Medline]
[Order article via Infotrieve]
-
Aggarwal, A. K.,
and Wah, D. A.
(1998)
Curr. Opin. Struct. Biol.
8,
19-25[CrossRef][Medline]
[Order article via Infotrieve]
-
Frank, R.
(1992)
Tetrahedron
48,
9211-9232
-
Kramer, A.,
Keitel, T.,
Winkler, K.,
Stöcklein, W.,
Höhne, W.,
and Schneider-Mergener, J.
(1997)
Cell
91,
799-809[CrossRef][Medline]
[Order article via Infotrieve]
-
Rüdiger, S.,
Germeroth, L.,
Schneider-Mergener, J.,
and Bukau, B.
(1997)
EMBO J.
16,
1501-1507[CrossRef][Medline]
[Order article via Infotrieve]
-
Reineke, U.,
Sabat, R.,
Volk, H.-D.,
and Schneider-Mergener, J.
(1998)
Protein Sci.
7,
951-960[Medline]
[Order article via Infotrieve]
-
Malin, R.,
Steinbrecher, R.,
Jannsen, J.,
Semmler, W.,
Noll, B.,
Johannsen, B.,
Frömmel, C.,
Höhne, W.,
and Schneider-Mergener, J.
(1995)
J. Am. Chem. Soc.
117,
11821-11822[CrossRef]
-
Kossykh, V.,
Repyk, A.,
Kaliman, A.,
and Buryanov, Y.
(1989)
Biochim. Biophys. Acta
1009,
290-292[Medline]
[Order article via Infotrieve]
-
Bhagwat, A. S.,
Johnson, B.,
Weule, K.,
and Roberts, R. J.
(1990)
J. Biol. Chem.
265,
767-773[Abstract/Free Full Text]
-
Kramer, A.,
and Schneider-Mergener, J.
(1998)
Meth. Mol. Biol.
87,
25-39[Medline]
[Order article via Infotrieve]
-
Vandeyar, M. A.,
Weiner, M. P.,
Hutton, C. J.,
and Batt, C. A.
(1988)
Gene
65,
129-133[CrossRef][Medline]
[Order article via Infotrieve]
-
Pein, C.-D.,
Reuter, M.,
Cech, D.,
and Krüger, D. H.
(1989)
FEBS Lett.
245,
141-144[CrossRef][Medline]
[Order article via Infotrieve]
-
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., p. A.7,
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Morgenstern, B.,
Werner, T.,
and Dress, A. W. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
12098-12103[Abstract/Free Full Text]
-
Chen, Y. H.,
Yang, J. T.,
and Martinez, H. M.
(1972)
Biochemistry
22,
4120-4131
-
Krüger, D. H.,
Barcak, G. J.,
Reuter, M.,
and Smith, H. O.
(1988)
Nucleic Acids Res.
16,
3997-4008[Abstract/Free Full Text]
-
Wah, D. A.,
Hirsch, J. A.,
Dorner, L. F.,
Schildkraut, I.,
and Aggarwal, A. K.
(1997)
Nature
388,
97-100[CrossRef][Medline]
[Order article via Infotrieve]
-
Newman, M.,
Lunnen, K.,
Wilson, G.,
Greci, J.,
Schildkraut, I.,
and Phillips, S. E. V.
(1998)
EMBO J.
17,
5466-5476[CrossRef][Medline]
[Order article via Infotrieve]
-
O'Sullivan, D. J.,
Zagula, K.,
and Klaenhammer, T. R.
(1995)
J. Bacteriol.
177,
134-143[Abstract/Free Full Text]
-
Holtz, J. K.,
and Topal, M. D.
(1994)
J. Biol. Chem.
269,
27286-27290[Abstract/Free Full Text]
-
Colandene, J. D.,
and Topal, M. D.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
3531-3536[Abstract/Free Full Text]
-
Stanojevic, D.,
and Verdine, G. L.
(1995)
Nature Struct. Biol.
2,
450-457[CrossRef][Medline]
[Order article via Infotrieve]
-
Jeltsch, A.,
Alves, J.,
Urbanke, C.,
Maass, G.,
Eckstein, H.,
Lianshan, Z.,
Bayer, E.,
and Pingoud, A.
(1995)
J. Biol. Chem.
270,
5122-5129[Abstract/Free Full Text]
-
Choo, Y.,
and Klug, A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11163-11167[Abstract/Free Full Text]
-
McLane, K. E.,
Burton, D. R.,
and Ghazal, P.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5214-5218[Abstract/Free Full Text]
-
Johnson, H. P.,
Lindstrom, J.,
Baase, W. A.,
and von Hippel, P. H.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4840-4844[Abstract/Free Full Text]
-
Ghosh, G.,
Van Duyne, G.,
Ghosh, S.,
and Sigler, P. B.
(1995)
Nature
373,
303-310[CrossRef][Medline]
[Order article via Infotrieve]
-
Müller, C. W.,
Rey, F. A.,
Sodeoka, M.,
Verdine, G. L.,
and Harrison, S. C.
(1995)
Nature
373,
311-317[CrossRef][Medline]
[Order article via Infotrieve]
-
Cho, Y.,
Gorina, S.,
Jeffrey, P. D.,
and Pavletich, N. P.
(1994)
Science
265,
346-355[Abstract/Free Full Text]
-
Otwinowski, Z.,
Schewitz, R. W.,
Zhang, R. G.,
Lawson, C. L.,
Joachimiak, A.,
Marmorstein, R. Q.,
Luisi, B. F.,
and Sigler, P. B.
(1988)
Nature
335,
321-329[CrossRef][Medline]
[Order article via Infotrieve]
-
Wenz, C.,
Jeltsch, A.,
and Pingoud, A.
(1996)
J. Biol. Chem.
271,
5565-5573[Abstract/Free Full Text]
-
Pein, C.-D.,
Reuter, M.,
Meisel, A.,
Cech, D.,
and Krüger, D. H.
(1991)
Nucleic Acids Res.
19,
5139-5142[Abstract/Free Full Text]
-
Petrauskene, O. V.,
Babkina, O. V.,
Tashlitsky, V. N.,
Kazankov, G. M.,
and Gromova, E. S.
(1998)
FEBS Lett.
425,
29-34[CrossRef][Medline]
[Order article via Infotrieve]
-
Jeltsch, A.,
Kröger, M.,
and Pingoud, A.
(1995)
Gene
160,
7-16[CrossRef][Medline]
[Order article via Infotrieve]
-
Siksnys, V.,
Timinskas, A.,
Klimasauskas, S.,
Butkus, V.,
and Janulaitis, A.
(1995)
Gene
157,
311-314[CrossRef][Medline]
[Order article via Infotrieve]
-
Janulaitis, A.
(1996)
Biologija
2,
28-31
-
Trautner, T. A.,
Pawlek, B.,
Behrens, B.,
and Willert, J.
(1996)
EMBO J.
15,
1434-1442[Medline]
[Order article via Infotrieve]
-
Lange, C.,
Wild, C.,
and Trautner, T. A.
(1996)
EMBO J.
15,
1443-1450[Medline]
[Order article via Infotrieve]
-
Gopal, J.,
Yebra, M. J.,
and Bhagwat, A.
(1994)
Nucleic Acids Res.
22,
4482-4488[Abstract/Free Full Text]
-
Kossykh, V. G.,
Repyk, A. V.,
and Hattman, S.
(1993)
Gene
125,
65-68[CrossRef][Medline]
[Order article via Infotrieve]
-
Janulaitis, A.,
Vaisvila, R.,
Timinskas, A.,
Klimasauskas, S.,
and Butkus, V.
(1992)
Nucleic Acids Res.
20,
6051-6056[Abstract/Free Full Text]
-
Swaminathan, N.,
Mead, D. A.,
McMaster, K.,
George, D.,
Van Etten, J. L.,
and Skowron, P. M.
(1996)
Nucleic Acids Res.
24,
2463-2469[Abstract/Free Full Text]
-
Carey, J.
(1991)
Methods Enzymol.
208,
103-117[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Takahashi, H. Matsuno, H. Furusawa, and Y. Okahata
Direct Monitoring of Allosteric Recognition of Type IIE Restriction Endonuclease EcoRII
J. Biol. Chem.,
May 30, 2008;
283(22):
15023 - 15030.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ohno, N. Handa, M. Watanabe-Matsui, N. Takahashi, and I. Kobayashi
Maintenance Forced by a Restriction-Modification System Can Be Modulated by a Region in Its Modification Enzyme Not Essential for Methyltransferase Activity
J. Bacteriol.,
March 15, 2008;
190(6):
2039 - 2049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Gemmen, R. Millin, and D. E. Smith
DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
Nucleic Acids Res.,
May 24, 2006;
34(10):
2864 - 2877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Grazulis, E. Manakova, M. Roessle, M. Bochtler, G. Tamulaitiene, R. Huber, and V. Siksnys
Structure of the metal-independent restriction enzyme BfiI reveals fusion of a specific DNA-binding domain with a nonspecific nuclease
PNAS,
November 1, 2005;
102(44):
15797 - 15802.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yamasaki, T. Kigawa, M. Inoue, M. Tateno, T. Yamasaki, T. Yabuki, M. Aoki, E. Seki, T. Matsuda, Y. Tomo, et al.
Solution Structure of the B3 DNA Binding Domain of the Arabidopsis Cold-Responsive Transcription Factor RAV1
PLANT CELL,
December 1, 2004;
16(12):
3448 - 3459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mucke, D. H. Kruger, and M. Reuter
Diversity of Type II restriction endonucleases that require two DNA recognition sites
Nucleic Acids Res.,
November 1, 2003;
31(21):
6079 - 6084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mucke, V. Pingoud, G. Grelle, R. Kraft, D. H. Kruger, and M. Reuter
Asymmetric Photocross-linking Pattern of Restriction Endonuclease EcoRII to the DNA Recognition Sequence
J. Biol. Chem.,
April 12, 2002;
277(16):
14288 - 14293.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Pingoud, E. Kubareva, G. Stengel, P. Friedhoff, J. M. Bujnicki, C. Urbanke, A. Sudina, and A. Pingoud
Evolutionary Relationship between Different Subgroups of Restriction Endonucleases
J. Biol. Chem.,
April 12, 2002;
277(16):
14306 - 14314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Pingoud and A. Jeltsch
Structure and function of type II restriction endonucleases
Nucleic Acids Res.,
September 15, 2001;
29(18):
3705 - 3727.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Kubareva, H. Thole, A. S. Karyagina, T. S. Oretskaya, A. Pingoud, and V. Pingoud
Identification of a base-specific contact between the restriction endonuclease SsoII and its recognition sequence by photocross-linking
Nucleic Acids Res.,
March 1, 2000;
28(5):
1085 - 1091.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mucke, R. Lurz, P. Mackeldanz, J. Behlke, D. H. Kruger, and M. Reuter
Imaging DNA Loops Induced by Restriction Endonuclease EcoRII. A SINGLE AMINO ACID SUBSTITUTION UNCOUPLES TARGET RECOGNITION FROM COOPERATIVE DNA INTERACTION AND CLEAVAGE
J. Biol. Chem.,
September 22, 2000;
275(39):
30631 - 30637.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|