![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 9, 5491-5498, February 26, 1999
-Latrotoxin Receptor Is a
Member of the CIRL Family of G-protein-coupled Receptors*
§,
,
,
,
From the
Departments of Pharmacology and
Physiology and Neuroscience and Environmental Medicine, New
York University Medical Center, New York, New York 10016 and
¶ Department of Pharmacology, University of Michigan Medical
School, Ann Arbor, Michigan 48109
| |
ABSTRACT |
|---|
|
|
|---|
Poisoning with Poisoning with black widow spider venom results in the activation
of spontaneous synaptic activity in the peripheral nervous system (1).
The major component of the venom that is responsible for the toxic
effects in vertebrates is Stimulation of neurotransmitter release by Two types of high affinity CIRL is a G-protein-coupled receptor
(GPCR)1 with an unusually
large N-terminal extracellular region that contains domains characteristic of cell adhesion proteins. CIRL is an interesting example of a two-subunit GPCR (18). Its two noncovalently bound subunits (p120 and p85) result from the expression of one gene followed
by endogenous proteolytic cleavage of the precursor protein in its
extracellular region close to the first transmembrane segment. Similar
posttranslational modification was reported for leukocyte antigen CD97,
a large orphan GPCR homologous to CIRL (21).
The functional properties of CIRL as an We now show that in addition to neuronal receptors neurexin I Cloning and Sequencing of CIRL-2 and CIRL-3--
Molecular
cloning experiments were performed according to established procedures
and protocols (18, 22). Screening of a directionally cloned rat brain
cDNA library in Expression Constructs--
The eukaryotic expression constructs
of CIRLs were designed so that they contained minimal noncoding
sequence in the 5'-region. The CIRL-2 expression plasmid pCDCIRL-2 was
prepared by triple ligation of the fragment
BamHI/MfeI of the clone 15-12 and the fragment
MfeI/XhoI of the clone 15-19 into expression
vector pCDNA 3.1 Zeo (+) (Invitrogen), predigested with restriction
endonucleases BamHI and XhoI. The CIRL-3
expression plasmid pCDCIRL-3 was prepared by ligation of the fragment
NotI/XhoI of the clone 17-20 into the same
expression vector, predigested with
NotI/XhoI.
Northern Blotting--
Commercially available blots
(CLONTECH) containing ~2 µg of
poly(A)+ RNA from human tissues were prehybridized for
24 h at 42 °C in the buffer H (50% formamide, 5×
saline/sodium phosphate/EDTA, 5× Denhardt solution, 1.5% SDS, 200 µg/ml sonicated salmon sperm DNA, 2.5 mM sodium
pyrophosphate) followed by hybridization in the same buffer under
stringent conditions (50 °C, 16 h) with [ Antibody Preparation--
A DNA fragment encoding the
extracellular region of CIRL-2 was prepared by a PCR reaction on
pCDCIRL-2 as template with primers CGAGGATCCTTCAGCAGAGCAGCCTTGCCA and
GTGCTCGAGGTGGCTGCATGCACACGTCGT. The 2500-base pair polymerase chain
reaction product was digested with restriction endonucleases
BamHI and XhoI and subcloned into predigested
vectors pET21a to yield plasmid pET21CIRL-2. The plasmid was
transformed into the Escherichia coli BL21(DE3) strain, and individual colonies were isolated and propagated in 1 liter of LB media
at room temperature until bacterial cultures reached mid log phase
(~8 h). At this point,
isopropyl-1-thio-b-D-galactopyranoside solution was added
to 50 µM final concentration. 4 h post-induction, the cells were harvested, washed, and lysed by ultrasound sonication in
50 ml of hypotonic buffer A (10 mM NaCl, 25 mM
Tris-HCl, pH 8.0) with the addition of protease inhibitors mixture
(Boehringer Mannheim). The lysate was centrifuged for 30 min at 40,000 rpm, and the insoluble pellet was resuspended in 50 ml of buffer B (450 mM NaCl, 8 M urea, 25 mM Tris-HCl,
pH 8.0) and centrifuged for 30 min at 40,000 rpm. The supernatant was
chromatographed on 2 ml of Ni2+-matrix (Novagen)
pre-equilibrated with the buffer B. After intermediate washes with
buffer B supplemented with 50 mM imidazole, the
extracellular CIRL-2 fragment was eluted in buffer B containing 200 mM imidazole. The eluate was sequentially dialyzed against
buffer B with gradually decreased concentration of urea from 6 M to zero. The recombinant proteins were used for custom
production of antibodies in rabbits (Alpha Diagnostics).
Expression of CIRLs in COS Cells--
Expression plasmids
encoding CIRLs (pCDR7, pCDCIRL-2, and pCDCIRL-3) were transfected into
COS-7 cells by LipofectAMINE procedure with Opti-MEM I serum-free
medium according to the manufacturer's protocol (Life Technologies,
Inc.). The transfected cells were harvested 48-72 h after transfection.
For Western blotting analysis, approximately 30% of the COS cells
harvested from one 100-mm dish were solubilized with 2% Triton X-100
low salt buffer (10 mM NaCl, 20 mM Tris-HCl, pH
7.5). After a 15-min centrifugation at 80,000 × g, the
supernatant was incubated with 20 µl of Purification of CIRL and Its Homologs Define a Novel Family of GPCRs--
In the
course of molecular cloning of CIRL (CIRL-1), two sets of cDNA
clones were isolated that were homologous and yet significantly different from CIRL-1 cDNA (18). Significant homology of these novel sequences with CIRL cDNA was found in the region encoding the
N-terminal region of CIRL. These clones were characterized by mapping
with restriction endonucleases and partial DNA sequencing. Several
clones were identified that contained a large open reading frame with a
Kozak consensus sequence and upstream stop codons in all frames in the
5'-end and a poly(A) sequence in the 3'-end, suggesting that they
contained full-length cDNAs with respect to the coding sequence.
These cDNA clones were sequenced completely on both strands.
The protein sequences of CIRL-2 and CIRL-3 were deduced from the
cDNA sequences. Multiple alignment of three CIRL sequences revealed
significant homology of these proteins (Fig.
1A). A major difference among
them was that CIRL-3 contained an additional small domain in the
N-terminal region right after the signal peptide sequence (Fig.
1B). The cytoplasmic C-terminal region of CIRLs was
significantly less conserved in these proteins than their extracellular
and membrane domains. Also, the Ser, Thr, and Pro-rich domain (STP
domain) located in the center of the N-terminal extracellular region of
CIRLs showed very little degree of conservation.
We analyzed the sequences of the newly cloned proteins by BLAST
searches of protein data bases. The searches revealed that the CIRLs is
a subfamily of the secretin receptor family of GPCRs. CIRLs have seven
transmembrane hydrophobic segments that are homologous to other members
of the secretin receptor family. Several large orphan GPCRs were
identified by searches that are significantly homologous to CIRLs not
only in their transmembrane hydrophobic segments but also in a
relatively short (about 80 residues) region that is adjacent to the
transmembrane core N-terminus and, therefore, should be exposed
extracellularly (Fig. 1B). Because this domain is involved
in the endogenous proteolytic processing of CIRL-1 and possibly other
receptors, we propose to name it GPS which stands for GPCR
proteolytic
site.2
Interestingly, the N-terminal tails of other members of the secretin
receptor family, in addition to the large orphan GPCRs, are also
homologous to CIRLs. However, this region of homology is separated by
about 350 residues from the transmembrane core of CIRLs (Fig.
1B). The same Cys-rich motif is also found in other large
orphan receptors of the secretin receptor family.
In the N termini, after the domain found only in CIRL-3, the CIRLs have
domains homologous to a sea urchin lectin and to olfactomedin (Fig.
1B). The variable between homologs STP domain is followed by
a region that is homologous between the CIRL homologs and three recently discovered genes of the BAI (brain-specific angiogenesis inhibitor) family (23, 24).
Tissue Distribution of CIRLs--
To further characterize CIRL-2
and CIRL-3, we analyzed their tissue distribution by Northern blotting
(Fig. 2). In contrast with CIRL-1, which
is predominantly expressed in brain, CIRL-2 messages were found almost
in all tissues tested although in variable concentrations. The highest
levels of CIRL-2 were found in placenta, heart, lung, kidney, pancreas,
spleen, and ovary. Brain, liver, and testis showed intermediate amounts
of CIRL-2. The lowest quantities of this mRNA were detected in
skeletal muscle, whereas in thymus and peripheral blood leukocytes, no
signal could be detected at this level of sensitivity. The CIRL-3
mRNA was expressed predominantly in brain with significantly lower
levels in heart, placenta, pancreas, kidney, and testis.
Expression of CIRLs in COS Cells--
Structural similarity
between CIRL-1 and its newly cloned homologs CIRL-2 and CIRL-3
suggested that the latter two may also serve as receptors of
The results of the binding experiments were confirmed by precipitation
of solubilized transfected cells with an immobilized Functional Expression of CIRL-2 in Chromaffin Cells and HEK293
Cells--
The functional properties of CIRL-2 were examined in HEK293
cells and bovine chromaffin cells. When transfected HEK293 cells were
exposed to 50 pM
We have previously shown that overexpression of CIRL-1 in chromaffin
cells results in at least 10-fold increase in their sensitivity to the
toxin (7, 18). The ability of CIRL-2 to support
We previously demonstrated that expression of CIRL-1 inhibits
Ca2+-dependent secretion in permeabilized
chromaffin cells in the absence of Low Affinity
To reconcile these apparently contradictory data, we tested various
tissues for the presence of The action of Several independent experiments indicate that CIRL-2 is an
Unexpectedly, Northern blotting experiments revealed that, in contrast
to CIRL-1 and CIRL-3, CIRL-2 is a ubiquitously expressed protein.
A highly sensitive assay was developed to detect CIRL-2 in tissues. We
raised anti-CIRL-2 antibody, which was directed against the
extracellular domain of the receptor. A similar antibody against CIRL-1
showed very little cross-reactivity with CIRL-2 and vice versa. Using these antibodies, we were able to detect CIRL-1 and CIRL-2 in tissue extracts enriched by a chromatography on immobilized What might be the consequences of CIRL-1, CIRL-2, and CIRL-3 define a novel family of GPCRs. The homology
of their protein sequence is quite strong, and their domain structure
is almost identical. At least two of them, CIRL-1 and CIRL-2, are
Homology searches indicate that CIRLs are part of a novel growing
family of large orphan GPCRs with unusual structural features. These
receptors include leukocyte antigen CD97, EMR1 hormone receptor (F4/80), the BAI family, an orphan receptor from brain similar to
Drosophila melanogaster cadherin-related tumor suppresser, MEGF2 protein, and two putative GPCRs identified by sequencing the
Caenorhabditis elegans genome (GenBankTM
accession numbers Z54306 and U39848). The members of this family share
highest homology in their transmembrane domains and in a short adjacent extracellular Cys-rich GPS domain. CIRL-1, CIRL-2, and CD97 are proteolytically processed endogenously (18, 21), and the integrity of
the GPS domain is required for the proteolytic processing of CIRL-1.2 We may therefore hypothesize that all orphan GPCRs
with the GPS motif are endogenously cleaved and, thus, consist of two
heterologous subunits similarly to CIRL-1.
Another common structural feature of this family of large orphan GPCRs
is that the extracellular regions of these receptors contain structural
modules typical for cell adhesion or extracellular matrix proteins.
These modules include EGF motifs, thrombospondin repeats, STP or
mucin-like domains, and lectin- and olfactomedin-related domains. These
"chimeric" receptors may therefore have a dual function as
signaling receptors and cell adhesion proteins. It is also possible
that intercellular contacts may serve as agonists to activate these receptors.
-latrotoxin, a neurotoxic
protein from black widow spider venom, results in a robust increase of
spontaneous synaptic transmission and subsequent degeneration of
affected nerve terminals. The neurotoxic action of
-latrotoxin
involves extracellular binding to its high affinity receptors as a
first step. One of these proteins, CIRL, is a neuronal
G-protein-coupled receptor implicated in the regulation of secretion.
We now demonstrate that CIRL has two close homologs with a similar
domain structure and high degree of overall identity. These novel
receptors, which we propose to name CIRL-2 and CIRL-3, together with
CIRL (CIRL-1) belong to a recently identified subfamily of large orphan
receptors with structural features typical of both G-protein-coupled
receptors and cell adhesion proteins. Northern blotting experiments
indicate that CIRL-2 is expressed ubiquitously with highest
concentrations found in placenta, kidney, spleen, ovary, heart, and
lung, whereas CIRL-3 is expressed predominantly in brain similarly to
CIRL-1. It appears that CIRL-2 can also bind
-latrotoxin, although
its affinity to the toxin is about 14 times less than that of CIRL-1. When overexpressed in chromaffin cells, CIRL-2 increases their sensitivity to
-latrotoxin stimulation but also inhibits
Ca2+-regulated secretion. Thus, CIRL-2 is a
functionally competent receptor of
-latrotoxin. Our findings suggest
that although the nervous system is the primary target of low doses of
-latrotoxin, cells of other tissues are also susceptible to the
toxic effects of
-latrotoxin because of the presence of CIRL-2, a
low affinity receptor of the toxin.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
-latrotoxin, a large protein with multiple
ankyrin repeats (2-4). Purified
-latrotoxin causes spontaneous
neurotransmitter release at neuromuscular junctions and in preparations
of central neurons such as synaptosomes, brain slices, and primary
neuronal cell cultures (5). It has been recently shown that the toxic
effects of
-latrotoxin are not restricted to the nervous system and
that it can also augment secretion from chromaffin cells and
-pancreatic cells (6-8). Spontaneous
-latrotoxin-stimulated
secretion is paralleled by an increase in transmembrane cation fluxes
through induced large conductance channels of unknown nature (9). It
has been thus suggested that ionophoric properties of
-latrotoxin
are at the basis of its toxic effects. However, at least part of the
action of
-latrotoxin may be independent of cation fluxes both in
neurons and secretory cells (7, 8, 10-12).
-latrotoxin correlates
with its extracellular binding to high affinity membrane receptors (5,
13). The toxin-binding sites in membrane preparations were originally
identified in ligand binding assays with radiolabeled toxin (14). In
those experiments, the
-latrotoxin receptors were detected only in
the preparations of neural tissues. By immunofluorescence with
anti-
-latrotoxin antibodies, it was shown that
-latrotoxin-binding sites are localized presynaptically in
neuro-muscular synapses and therefore might be directly involved in the
regulation of neuronal exocytosis (15).
-latrotoxin receptors were identified by
purification and molecular cloning: neurexin I
, a
calcium-dependent receptor (16, 17), and a
calcium-independent receptor, CIRL, also called latrophilin (18, 19).
The interaction of neurexin I
with
-latrotoxin significantly
contributes to the effects of the toxin only in physiological
high-Ca2+ media, whereas CIRL is important for the toxic
effects either in physiological or in nominally Ca2+-free
media (20).
-latrotoxin receptor were
confirmed by the analysis of secretion in transfected chromaffin cells
and
-pancreatic cells (7, 8, 18). When overexpressed, CIRL renders
them supersensitive to the toxin. Interestingly, overexpression of CIRL
in chromaffin cells also results in the modulation of physiologically
evoked secretion in the absence of any stimulation with
-latrotoxin.
The ATP-dependent stage of secretion is specifically
inhibited by CIRL expression, suggesting that this receptor couples to
exocytosis (7).
and
CIRL, another
-latrotoxin-binding protein exists that is a
ubiquitously expressed homolog of CIRL. This membrane protein, which we
named CIRL-2, binds
-latrotoxin with lower affinity than CIRL
(CIRL-1). Overexpression of CIRL-2 in chromaffin cells indicates that
it is a functional receptor of
-latrotoxin and that, similarly to
CIRL-1, it couples to exocytosis. Our results suggest that
-latrotoxin can produce toxic effects not only in neurons but also
in other tissues.
![]()
EXPERIMENTAL PROCEDURES
-Latrotoxin was purified from lyophilized black widow spider
glands and radioactively labeled with 125I by chloramine T
procedure. The toxin was immobilized on BrCN-Sepharose as described
(16). Chromaffin cell and HEK293 cell transfections and functional
analysis of CIRLs were performed as described previously (7, 18).
ZAPII (kindly provided by Dr. James Boulter,
Salk Institute) has resulted in the isolation of clones highly
homologous to the 5'-region of CIRL-1 cDNA (18) but yet
significantly different according to restriction endonuclease mapping
and partial sequencing. Two sets of overlapping clones were identified
encoding CIRL-2 cDNA (15-1, 15-7, 15-11, 15-12, 15-14, 15-19,
and 15-20) and CIRL-3 cDNA (17-1, 17-2, 17-9, 17-14, 17-15,
17-17, 17-20, and 17-21). All plasmids were sequenced with T3 and T7
primers. The potentially full-length clones 15-19, 15-12, 17-9, and
17-20 were sequenced on both strands using synthetic primers. In
addition, all clones were sequenced in the regions of alternative
splicing, identified by restriction endonuclease mapping.
-32P]dCTP uniformly labeled probes of full-length
CIRL-2 or CIRL-3 (Random Primed DNA labeling kit, Boehringer Mannheim).
The unincorporated label was removed with ProbeQuant G-50 Micro Columns
(Amersham Pharmacia Biotech). For hybridization, the probes were
diluted with buffer H to final concentrations of 5-7 × 107 cpm/ml. After the hybridization, the blots were washed
3-4 times for 25 min each in 2× SSC (0.15 M NaCl and
0.015 M sodium citrate) with 1% SDS at ascending
temperatures starting from 60 °C, with 2 °C increment. The blots
were dried and autoradiographed with an x-ray film and intensifying
screen at
70 °C for 3-7 days.
-latrotoxin-agarose for
16 h with rotation. After 2 washes with phosphate-buffered saline,
the beads were eluted with 50 µl of 2× SDS sample buffer. 15 µl of
the eluate was analyzed by separation in 10% SDS gel electrophoresis
followed by Western blotting with anti-CIRL-1 and anti-CIRL-2 antibodies.
-Latrotoxin Receptors from Multiple
Tissues--
Approximately 5 g of each frozen rat tissue (brain,
heart, lung, kidney, spleen) and 0.5 g of ovaries (Pel-Freez
Biologicals) were homogenized (Polytron) in 25 ml of a low salt buffer
(10 mM NaCl, 20 mM Tris-HCl, final pH 7.5) with
protease inhibitors mixture (Boehringer Mannheim) followed by 2%
Triton X-100 solubilization for 3 h, and 30 min of centrifugation at
80,000 × g. The 15-ml supernatant fractions were
incubated with 50 µl of
-latrotoxin-agarose and washed twice with
a high salt buffer (750 mM NaCl, 20 mM
Tris-HCl, 1% Triton X-100, pH 7.5). Protein from the beads was eluted
with SDS sample buffer followed by SDS electrophoresis and Western blotting with the appropriate polyclonal antibodies.
![]()
RESULTS

View larger version (88K):
[in a new window]

View larger version (36K):
[in a new window]
Fig. 1.
The structure of the CIRL
receptors. A, the amino acid sequences of CIRL-2 and
CIRL-3 (GenBankTM accession numbers AF063102, AF063103) are shown
aligned with the sequence of CIRL-1 (U72487). The alignment was
produced by Clustal algorithm. B, the domain model of the
CIRLs. The N-terminal domain shown after the signal peptide sequence is
present only in CIRL-3. SR, the secretin receptor family;
PM, plasma membrane.

View larger version (61K):
[in a new window]
Fig. 2.
CIRL-2 and CIRL-3 mRNA tissue
distribution. Commercially available blots
(CLONTECH) containing ~2 µg of
poly(A)+ RNA from the indicated human tissues were
hybridized under stringent conditions with uniformly labeled
full-length CIRL-2 and CIRL-3 cDNA probes. In the bottom
panel, RNA loading control, as shown, was obtained by
rehybridizing the blots with actin cDNA probe
(CLONTECH). Extra bands in heart and skeletal
muscle represent additional actin forms known to be expressed in these
tissues. Numbers on the left indicate positions of molecular
weight markers (kilobases). Periph. Blood Leuc., peripheral
blood leukocytes.
-latrotoxin. To test this hypothesis, the expression plasmids
encoding CIRL-2 and CIRL-3 were prepared on the basis of pcDNA3.1
eukaryotic vector and transfected into COS cells. The transfected cells
were analyzed for their
-latrotoxin binding activity using
radiolabeled
-latrotoxin. CIRL-1- and CIRL-2-expressing cells bound
iodinated
-latrotoxin specifically, whereas no binding was observed
in CIRL-3 and mock-transfected cells (data not shown). The binding
activity of CIRL-2 transfected cells was reproducibly lower than of the
cells expressing CIRL-1. This could be explained by either lower
affinity of CIRL-2 or by different expression efficiency of the
receptors or by both. To discriminate between these possibilities, we
analyzed
-latrotoxin binding activity of CIRL-1- and
CIRL-2-expressing cells by Scatchard plots (Fig.
3). The cells that were transfected with
CIRL-2 plasmid showed higher concentration of
-latrotoxin-binding
sites. However, the affinity of CIRL-2 to
-latrotoxin was about 14 times lower than the affinity of CIRL-1.

View larger version (14K):
[in a new window]
Fig. 3.
Scatchard plot analysis of
-latrotoxin binding to CIRL-1 and CIRL-2 expressed
in COS cells. Approximately 30% of the COS cells harvested from
one 100-mm dish 72 h after transfection with CIRL-1 (filled
squares) or CIRL-2 (open squares) expression plasmids
was used for each measurement in the 125I-
-latrotoxin
binding assay. The value of the binding was calculated by subtraction
of the nonspecific binding obtained in the presence of cold 0.1 µM
-latrotoxin from the total binding for each
125I-
-latrotoxin concentration. B/F,
bound/free ([125I-
-latrotoxin]).
-latrotoxin
matrix. The adsorbed proteins were eluted from
-latrotoxin-agarose and analyzed by Western blotting with anti-CIRL-1 and anti-CIRL-2 antibodies directed against their N-terminal extracellular regions (Fig. 4). Both CIRL-1 and CIRL-2 were
specifically detected by the antibodies as Mr
120,000 bands. This result indicates that CIRL-2 is an
-latrotoxin-binding protein and that it is proteolytically processed
in the same manner as CIRL-1. With a long exposure shown, some
cross-reactivity of the antibodies could be noted. No CIRLs were
detected in mock-transfected COS cells, although Northern blotting
indicated that CIRL-2 is ubiquitously expressed protein. We may thus
assume that either this cell line does not contain CIRL-2 at all or the
simian protein is not recognized by our antibody raised against the rat
protein or that the levels of this receptor in COS cells are beyond the
sensitivity of this assay. Neither anti-CIRL-1 nor anti-CIRL-2 antibody
could produce any staining of CIRL-3 transfected cells on Western
blots.

View larger version (76K):
[in a new window]
Fig. 4.
Expression of CIRL-1 and CIRL-2 in COS
cells. Approximately 30% of the COS cells harvested from one
100-mm dish 72 h after transient transfection with appropriate
plasmid was solubilized in 2% Triton X-100 low salt buffer followed by
binding with 20 µl of
-latrotoxin-agarose and two washes with a
high salt buffer. Protein from the beads was eluted with 50 µl of 2×
SDS sample buffer followed by SDS electrophoresis of a 15-µl sample
in a 10% polyacrylamide gel and Western blotting with polyclonal
antibodies raised against extracellular region (p120) of CIRL-1 and
CIRL-2. Numbers on the right indicate positions of molecular
weight markers (kDa).
-latrotoxin in PSS containing both
Ca2+ and Mg2+, CIRL-2 supported a substantial
45Ca uptake as did CIRL-1 (Fig.
5). A small amount of
-latrotoxin-stimulated uptake occurred in cells expressing pCMVneo
and in untransfected cells (not shown), suggesting the presence of an
endogenous
-latrotoxin receptor.

View larger version (11K):
[in a new window]
Fig. 5.
CIRL-2 supports Ca2+ entry
elicited by
-latrotoxin. HEK293 cells
were transfected with plasmids for CIRL-1, CIRL-2, or pCMVneo (a
control) by the LipofectAMINE protocol. Two days later, the cells were
incubated with or without 50 pM
-latrotoxin
(±Ltx) in PSS containing 2.2 mM
Ca2+ and 0.5 mM Mg2+ and 3 µCi/ml
45Ca2+. After 5 min, the cells were immediately
rinsed three times in PSS, and the amount of
45Ca2+ in the cells was determined by liquid
scintillation spectrometry. n = 4 wells/group.
-latrotoxin-induced Ca2+ influx was also coupled to an increase in secretion.
Chromaffin cells were cotransfected with a plasmid encoding human
growth hormone (hGH) and with either a plasmid encoding the CIRL-2 or a
control plasmid. Transiently expressed hGH is stored in secretory granules and serves as a marker for regulated secretion from the small
population of transfected cells. Chromaffin cells expressing CIRL-2 and
hGH were incubated for 4 min with various concentrations of
-latrotoxin in PSS without Ca2+ or Mg2+ and
with 0.2 mM EGTA. The incubation with toxin in the absence of Ca2+ (during which no secretion occurs (7) was followed
by an incubation with PSS containing Ca2+ and
Mg2+. Expression of CIRL-2 enhanced the sensitivity of
cells to
-latrotoxin, as evidenced by the shift to the left in the
dose response curve for hGH secretion (Fig.
6). Thus, CIRL-2 functions as an
-latrotoxin receptor. Furthermore, as is the case with CIRL itself,
CIRL-2 binds latrotoxin in the absence of Ca2+.

View larger version (13K):
[in a new window]
Fig. 6.
Expression of CIRL-2 increases the
sensitivity of intact chromaffin cells to stimulation by
-latrotoxin. Chromaffin cells were transfected
with plasmids for hGH and either CIRL-2 (filled circles) or
pCMVneo (open circles) by calcium phosphate precipitates as
described. Five days later, cells were incubated with the indicated
concentrations of
-latrotoxin in PSS without Ca2+ or
Mg2+ and with 0.2 mM EGTA. After 4 min, the
toxin was removed, and the cells were incubated for an additional 5 min
in PSS containing 2.2 mM Ca2+ and 0.5 mM Mg2+. The amounts of hGH (panel
A) and catecholamine (panel B) released into the medium
and the amounts remaining in the cells were determined.
n = 4 wells/group.
-latrotoxin (7). The data
suggested that CIRL-1 regulates secretion by slowing a specific step in
the ATP-dependent priming pathway. We thus determined
whether CIRL-2 was similarly able to regulate secretion in
permeabilized cells. Chromaffin cells transfected with or without
CIRL-2 were permeabilized with 20 µM digitonin for 4 min
in KGEP buffer 139 mM potassium glutamate, 20 mM PIPES, pH 6.6, 2 mM MgATP, 5 mM
EGTA) containing 2 mM MgATP but without Ca2+
followed by a 2-min stimulation with 30 µM
Ca2+ in the continuing presence of MgATP. Expression of
CIRL-2 inhibited Ca2+-dependent secretion by
42% (Fig. 7), which is comparable with the inhibition seen with CIRL-1. Thus, we conclude that the CIRL-2 protein is a functional
-latrotoxin receptor with properties (e.g. Ca2+-independence of
-latrotoxin
binding, inhibition of secretion in permeabilized cells) that resemble
those of CIRL-1.

View larger version (11K):
[in a new window]
Fig. 7.
CIRL-2 expression reduces
Ca2+-stimulated secretion in permeabilized chromaffin
cells. Chromaffin cells were transfected with plasmids for hGH and
either CIRL-2 or pCMVneo as in Fig. 2. Four-six days later, cells were
permeabilized with 20 µM digitonin in KGEP buffer without
Ca2+ for 4 min followed by incubation for 2 min with or
without 30 µM Ca2+ in KGEP. MgATP (2 mM) was included in both incubations. The amounts of hGH
(panel A) and catecholamine (panel B) released
into the medium and the amounts remaining in the cells were determined.
n = 4 wells/group.
-Latrotoxin Receptors in Nonneural
Tissues--
Our experiments on the expression of CIRL-2 indicated
that CIRL-2 is an
-latrotoxin-binding protein and that it can serve as a functional receptor of the toxin. The mRNA of CIRL-2 was detected in various tissues not belonging to the nervous system, in
some of them (e.g. kidney) at significantly higher
concentrations than in brain. However, the presence of
-latrotoxin
receptors in other than neural or neuroendocrine tissues has never been reported. We prepared crude kidney membranes and analyzed them for
binding of radiolabeled
-latrotoxin in the same manner as we did
with brain membranes. No statistically significant specific binding
could be detected in kidney membranes in this assay (data not shown).
-latrotoxin receptors using a more
sensitive assay (Fig. 8). The tissues
were homogenized and extracted with a Triton X-100-containing buffer,
and the extracts were chromatographed on
-latrotoxin-agarose. The
adsorbed proteins were eluted with the SDS sample buffer and analyzed
by Western blotting with anti-CIRL-1 and anti-CIRL-2 antibody. The
staining with anti-CIRL-1 antibody verified the presence of CIRL-1
exclusively in neural tissues. In contrast, CIRL-2 was detected in
almost all tissues tested, although the relative amount of CIRL-2 in brain extracts was noticeably higher than could be predicted from the
results of Northern blotting. A possible explanation would be
cross-reactivity of the anti-CIRL-2 antibody with significant amounts
of CIRL-1 purified from the brain along with CIRL-2.

View larger version (89K):
[in a new window]
Fig. 8.
Tissue distribution of
-latrotoxin receptors. Approximately 5 g
(0.5 g for ovaries) of each frozen rat tissue indicated (Pel-Freez
Biologicals) were homogenized (Polytron) in 25 ml of a low salt buffer
with protease inhibitors (Boehringer Mannheim), followed by 2% Triton
X-100 solubilization and high speed centrifugation. The 15-ml
supernatant fractions were incubated with 50 µl of
-latrotoxin-agarose and washed twice with high salt buffer. Protein
from the beads was eluted with 150 µl of SDS sample buffer followed
by 10% SDS electrophoresis of a 15-µl sample in 10% polyacrylamide
gel and Western blotting with anti-CIRL-1 and anti-CIRL-2 antibodies.
Numbers on the right indicate positions of molecular mass
markers (kDa).
![]()
DISCUSSION
-latrotoxin in neurons requires its extracellular
binding to high affinity membrane receptors of two structurally and
functionally different types. Type I or calcium-dependent receptors are represented by neurexin I
and, possibly, other neurexins that are neuron-specific cell membrane proteins with one
transmembrane domain and the extracellular region typical for cell
adhesion molecules. Neurexin I
is responsible for part of
-latrotoxin effects in physiological Ca2+-containing
media. Type II receptors can bind
-latrotoxin independently of
Ca2+ presence in the extracellular media. CIRL, a recently
discovered representative of the second class of
-latrotoxin
receptors, is a G-protein-coupled receptor with unusual two-subunit
structure. We now demonstrate that CIRL (CIRL-1) belongs to a novel
family of large orphan GPCRs that is encoded by at least three
different genes. One of these proteins, CIRL-2, is a low affinity
calcium-independent receptor of
-latrotoxin. Our current data
suggest that the toxic effects of
-latrotoxin have an even more
complex mechanism than was thought earlier because, in addition to two
high affinity neuronal receptors, a third, low affinity receptor exists
that is expressed ubiquitously.
-latrotoxin receptor. When expressed in COS cells, it binds
radiolabeled
-latrotoxin with affinity in the nM range,
which is approximately 14 times lower than the affinity of CIRL-1. In
HEK293 cells with overexpressed CIRL-2,
-latrotoxin stimulates
robust Ca2+ fluxes, an effect that follows the interaction
of the toxin with its receptors. Finally, in a chromaffin cell system
that allows analysis of secretion quantitatively, CIRL-2 overexpression
results in a significant increase in their sensitivity to
-latrotoxin. This effect is less pronounced than in the cells with
overexpressed CIRL-1 (7), which correlates with a lower affinity of
CIRL-2 to the toxin.
-Latrotoxin has been thought to be a specific presynaptic neurotoxin
because the primary site of its physiologic toxicity is the
neuromuscular junctions (5).
-latrotoxin (Fig. 8). In close agreement with the data from Northern blotting, CIRL-2 was detected in brain, heart, lung, kidney, and spleen
tissues, whereas CIRL-1 could be found only in brain. CIRL-2, detected
in this experiment, must represent an
-latrotoxin-binding protein,
because it was precipitated with
-latrotoxin-agarose. We may
therefore conclude that
-latrotoxin receptors are present in
nonneural tissues. CIRL-2 concentrations in various tissues are
significantly lower than the concentration of CIRL-1 in brain, which
hampered their direct detection by the 125I-latrotoxin
binding assay. Another possible explanation would be that CIRL-2 in
nonneuronal cells is not transported to the plasma membrane. However,
this seems unlikely because when CIRL-2 is overexpressed in nonneuronal
COS cells,
-latrotoxin receptors can be reliably detected on the
cell surface.
-latrotoxin interaction with
CIRL-2 in nonneural tissues?
-Latrotoxin treatment in neurons produces two major effects, spontaneous neurotransmitter release and
degeneration of nerve terminals accompanied by general cytotoxicity. In
nonneuronal cells, secretory granules, if present, can undergo exocytosis in response to
-latrotoxin. This has been demonstrated for chromaffin and
-pancreatic cells and may be also true for secretory cells of other types.
-Latrotoxin also induces formation of cation-selective pores of high
conductance after the binding to its receptors. The fact that these
pores are permeable to Ca2+ may explain cytotoxic effects
as well as the secretagogue function of the toxin. In
CIRL-1-transfected HEK293 cells, robust Ca2+ transmembrane
fluxes were observed (7). A similar effect was noted in nontransfected
cells, however it was weaker and required higher concentrations of the
toxin (25). One of the explanations of this effect is that
-latrotoxin interacts with endogenous CIRL-2. If
-latrotoxin
could induce similar cation channels in various nonneuronal cells, they
would cause cellular toxicity as a result of Ca2+ entry.
-latrotoxin-binding proteins. In our experiments, no
-latrotoxin
binding of CIRL-3 could be detected. However, because the expression of
CIRL-3 could not be verified with available antibodies, we cannot make
any definite conclusion about
-latrotoxin binding properties of
CIRL-3 at this time.
-Latrotoxin produces strong intracellular response as a result of
its interaction with CIRL-1 and CIRL-2. However, it remains unclear
whether
-latrotoxin can work as an agonist or antagonist of CIRL and
produce any receptor-mediated signaling. Our recent experiments with
C-terminal deletion mutants of CIRL-1 suggest that G-protein-signaling
is not critically important for
-latrotoxin-stimulated secretion in
chromaffin cells (25). The endogenous ligands of CIRLs are not known
yet. Chromaffin cell transfection experiments suggest that CIRLs may
act as physiological receptors and regulators of secretion because
overexpression of CIRL-1 and CIRL-2 results in the inhibition of
calcium-evoked secretion (Ref. 7 and Fig. 7). Identification of
endogenous ligands and intracellular effectors of CIRLs in the future
experiments will be a next important step to better understand the
physiological importance of the CIRLs.
| |
FOOTNOTES |
|---|
* This study was supported by National Institutes of Health Public Health Service Grants R01NS35098 and R01NS34937 (NINDS) (to A. G. P.) and R01DK27959 (NIDDK) (to R. W. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF063102 and AF063103.
§ To whom correspondence should be addressed: Dept. of Pharmacology, New York University Medical Center, 550 First Ave., MSB-202, New York, NY 10016. Fax: 212-263-7133; E-mail: ichtck01{at}mcrcr.med.nyu.edu.
2 V. Krasnoperov, K. Ichtchenko, and A. G. Petrenko, manuscript in preparation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: GPCR, G-protein-coupled receptor; PSS, physiological salt solution; hGH, human growth hormone; PIPES, 1,4-piperazinediethanesulfonic acid.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Lajus, P. Vacher, D. Huber, M. Dubois, M.-N. Benassy, Y. Ushkaryov, and J. Lang {alpha}-Latrotoxin Induces Exocytosis by Inhibition of Voltage-dependent K+ Channels and by Stimulation of L-type Ca2+ Channels via Latrophilin in beta-Cells J. Biol. Chem., March 3, 2006; 281(9): 5522 - 5531. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, D. Lee, L. Wang, M. Khvotchev, S. K. Chiew, L. Arunachalam, T. Collins, Z.-P. Feng, and S. Sugita N-Terminal Insertion and C-Terminal Ankyrin-Like Repeats of {alpha}-Latrotoxin Are Critical for Ca2+-Dependent Exocytosis J. Neurosci., November 2, 2005; 25(44): 10188 - 10197. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Y. Kostrominova, D. E. Dow, R. G. Dennis, R. A. Miller, and J. A. Faulkner Comparison of gene expression of 2-mo denervated, 2-mo stimulated-denervated, and control rat skeletal muscles Physiol Genomics, July 14, 2005; 22(2): 227 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M Silva, J. Liu-Gentry, A. S Dickey, D. W Barnett, and S. Misler {alpha}-Latrotoxin increases spontaneous and depolarization-evoked exocytosis from pancreatic islet {beta}-cells J. Physiol., June 15, 2005; 565(3): 783 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ahmed, M. Torrado, R. D. Zinovieva, V. V. Senatorov, G. Wistow, and S. I. Tomarev Gene Expression Profile of the Rat Eye Iridocorneal Angle: NEIBank Expressed Sequence Tag Analysis Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3081 - 3090. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Moriguchi, K. Haraguchi, N. Ueda, M. Okada, T. Furuya, and T. Akiyama DREG, a developmentally regulated G protein-coupled receptor containing two conserved proteolytic cleavage sites Genes Cells, June 1, 2004; 9(6): 549 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Leemans, A. A. te Velde, S. Florquin, R. J. Bennink, K. de Bruin, R. A. W. van Lier, T. van der Poll, and J. Hamann The Epidermal Growth Factor-Seven Transmembrane (EGF-TM7) Receptor CD97 Is Required for Neutrophil Migration and Host Defense J. Immunol., January 15, 2004; 172(2): 1125 - 1131. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Volynski, M. Capogna, A. C. Ashton, D. Thomson, E. V. Orlova, C. F. Manser, R. R. Ribchester, and Y. A. Ushkaryov Mutant {alpha}-Latrotoxin (LTXN4C) Does Not Form Pores and Causes Secretion by Receptor Stimulation: THIS ACTION DOES NOT REQUIRE NEUREXINS J. Biol. Chem., August 15, 2003; 278(33): 31058 - 31066. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Krasnoperov, Y. Lu, L. Buryanovsky, T. A. Neubert, K. Ichtchenko, and A. G. Petrenko Post-translational Proteolytic Processing of the Calcium-independent Receptor of alpha -Latrotoxin (CIRL), a Natural Chimera of the Cell Adhesion Protein and the G Protein-coupled Receptor. ROLE OF THE G PROTEIN-COUPLED RECEPTOR PROTEOLYSIS SITE (GPS) MOTIF J. Biol. Chem., November 22, 2002; 277(48): 46518 - 46526. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Krasnoperov, M. A. Bittner, W. Mo, L. Buryanovsky, T. A. Neubert, R. W. Holz, K. Ichtchenko, and A. G. Petrenko Protein-tyrosine Phosphatase-sigma Is a Novel Member of the Functional Family of alpha -Latrotoxin Receptors J. Biol. Chem., September 20, 2002; 277(39): 35887 - 35895. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stacey, G.-W. Chang, S. L. Sanos, L. R. Chittenden, L. Stubbs, S. Gordon, and H.-H. Lin EMR4, a Novel Epidermal Growth Factor (EGF)-TM7 Molecule Up-regulated in Activated Mouse Macrophages, Binds to a Putative Cellular Ligand on B Lymphoma Cell Line A20 J. Biol. Chem., August 2, 2002; 277(32): 29283 - 29293. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tobaben, T. C. Sudhof, and B. Stahl Genetic Analysis of alpha -Latrotoxin Receptors Reveals Functional Interdependence of CIRL/Latrophilin 1 and Neurexin 1alpha J. Biol. Chem., February 15, 2002; 277(8): 6359 - 6365. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Carson-Walter, D. N. Watkins, A. Nanda, B. Vogelstein, K. W. Kinzler, and B. St. Croix Cell Surface Tumor Endothelial Markers Are Conserved in Mice and Humans Cancer Res., September 1, 2001; 61(18): 6649 - 6655. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Hlubek, E. L. Stuenkel, V. G. Krasnoperov, A. G. Petrenko, and R. W. Holz Calcium-Independent Receptor for alpha -Latrotoxin and Neurexin H Facilitate Toxin-Induced Channel Formation: Evidence That Channel Formation Results from Tethering of Toxin to Membrane Mol. Pharmacol., March 1, 2000; 57(3): 519 - 528. [Abstract] [Full Text] |
||||
![]() |
H.-J. Kreienkamp, H. Zitzer, E. D. Gundelfinger, D. Richter, and T. M. Bockers The Calcium-independent Receptor for alpha -Latrotoxin from Human and Rodent Brains Interacts with Members of the ProSAP/SSTRIP/Shank Family of Multidomain Proteins J. Biol. Chem., October 13, 2000; 275(42): 32387 - 32390. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||