|
J Biol Chem, Vol. 274, Issue 9, 5797-5809, February 26, 1999
Molecular Basis for the Enterocyte Tropism Exhibited by
Salmonella typhimurium Type 1 Fimbriae*
Krishnan
Thankavel §,
Ankur H.
Shah¶ ,
Michael S.
Cohen ,
Teruo
Ikeda**,
Robin G.
Lorenz §§,
Roy
Curtiss III¶, and
Soman N.
Abraham
From the Departments of Pathology and Microbiology,
Duke University Medical Center, Durham, North Carolina 27710, the
¶ Department of Biology, Washington University,
St. Louis, Missouri 63130, the ** Department of Veterinary
Microbiology, School of Veterinary Medicine, Azabu University,
Kanagawa 229, Japan, and the  Departments
of Pathology and Medicine, Washington University School of Medicine,
St. Louis, Missouri 63110
 |
ABSTRACT |
Salmonella typhimurium exhibits a
distinct tropism for mouse enterocytes that is linked to their
expression of type 1 fimbriae. The distinct binding traits of
Salmonella type 1 fimbriae is also reflected in their
binding to selected mannosylated proteins and in their ability to
promote secondary bacterial aggregation on enterocyte surfaces. The
determinant of binding in Salmonella type 1 fimbriae is a
35-kDa structurally distinct fimbrial subunit, FimHS,
because inactivation of fimHS abolished binding
activity in the resulting mutant without any apparent effect on
fimbrial expression. Surprisingly, when expressed in the absence of
other fimbrial components and as a translational fusion protein with MalE, FimHS failed to demonstrate any specific binding
tropism and bound equally to all cells and mannosylated proteins
tested. To determine if the binding specificity of
Salmonella type 1 fimbriae was determined by the fimbrial
shaft that is intimately associated with FimHS, we replaced
the amino-terminal half of FimHS with the corresponding
sequence from Escherichia coli FimH (FimHE) that contains the receptor binding domain of FimHE. The
resulting hybrid fimbriae bearing FimHES on a
Salmonella fimbrial shaft exhibited binding traits that
resembled that of Salmonella rather than E. coli fimbriae. Apparently, the quaternary constraints imposed by
the fimbrial shaft on the adhesin determine the distinct binding traits
of S. typhimurium type 1 fimbriae.
 |
INTRODUCTION |
Salmonella typhimurium is a highly evolved pathogen
that has adapted to invading and surviving for long periods in its
human and mouse hosts (1). The virulence of the organism has been attributed in part to its capacity to invade enterocytes and
macrophages and to survive and grow intracellularly within these cells.
A cluster of contiguous genes located in three pathogenicity islands, SPI-1, SPI-2, and the SelC locus in the chromosome of
S. typhimurium, has been implicated these activities (2, 3).
Many of the genes mediating bacterial entry into host cells are located
in SPI-1 (2). The entry mechanisms of Salmonella are quite
complex, involving an intimate interaction between the bacterium and
the host cell which results in the "exchange" of biochemical
signals. As a consequence of this interaction, a complex set of
signaling events is triggered in the host cell, leading to marked
cytoskeletal rearrangements, membrane ruffling, and bacterial uptake by
macropinocytosis (4). Central to these bacteria-host interactions is
the activation in the Salmonella spp. of a specialized
protein secretion system that directs the export of a variety of
proteins and, in some cases, their direct translocation into the host
cell (4, 5). This bacterial secretion system, referred to as type III
secretion system, does not appear to have any host cell specificity and has been shown to promote bacterial invasion of a wide range of host
cells. Yet, in nature Salmonella exhibits a specific tropism for the gut epithelium of the host, and the primary targets for the
invading Salmonella, at least in the initial stages of
infection, are typically the cells lining the gastrointestinal tract.
S. typhimurium expresses several hair-like appendages
(fimbriae) on its surface, whose function is as yet unclear. Since the fimbriae protrude peritrichously from the bacterial surface, it is
highly likely that these structures will greatly influence the nature
and intensity of any interactions that might occur between bacteria and
host cells. The most commonly expressed fimbriae on
Salmonella are the type 1 fimbriae, which are characterized by their capacity to bind mannose residues on host cell surfaces or in
soluble compounds (6). That these structures contribute to the
pathogenicity of S. typhimurium may be deduced from the findings that type 1-fimbriated Salmonella are significantly
more virulent than their fim minus counterparts (7, 41) and
from the recent observations that type 1 fimbriae are expressed
in vivo by S. typhimurium during an infection
(8). The type 1 fim gene cluster is located at 15 min in the
S. typhimurium chromosome (9); although not associated with
any known pathogenicity islands, the fim cluster maps
closely to a tRNA gene (10). Since most pathogenicity islands are
located next to tRNA genes (2), the fim locus of
Salmonella may be part of an as yet unrecognized pathogenicity island.
Type 1 fimbriae are expressed by Salmonella as well as most
species of bacteria in the family Enterobacteriaceae (11). Although type 1 fimbriae are defined by their capacity to mediate
mannose-specific binding reactions, it has become increasingly clear
that there exists significant heterogeneity among type 1 fimbriae from
different genera and even within the same species in their binding
affinities for mannosylated compounds with defined oligomannose motifs.
For example, Firon et al. (12) have reported a striking
difference between the binding specificity of type 1 fimbriae of
S. typhimurium and that of Escherichia coli and
Klebsiella pneumoniae type 1 fimbriae. Madison et
al. (13) demonstrated subtle but distinct differences in binding
specificity between recombinant type 1 fimbriae of E. coli
and K. pneumoniae. More recently, it has been reported that
there is heterogeneity in binding to different mannosylated glycoproteins among type 1 fimbriae of different E. coli
strains (14). These studies have also provided some clues to the
underlying molecular basis for the heterogeneity in type 1 fimbrial
binding. Whereas Sokurenko et al. (14) have linked
heterogeneity in the binding among type 1 fimbriae of E. coli to differences in the covalent structure in their adhesin,
FimHE, Madison et al. (13) have implicated the
fimbrial shaft in defining the fine binding specificity between
E. coli and K. pneumoniae type 1 fimbriae. In
view of the tropism exhibited by Salmonella for gut tissue, the association of type 1 fimbrial expression with virulent strains of
Salmonella, and the heterogeneity in binding specificity
among type 1 fimbriae of Salmonella and other
enterobacteria, we hypothesized that the type 1 fimbriae of S. typhimurium may play a critical role in modulating bacterial
tropism to the gut of the host. By virtue of their distal location on
the bacterium and their affinity for specific mannosylated residues,
they could determine which tissues are ultimately invaded by
Salmonella.
We have previously identified the corresponding mannose-binding
adhesins on E. coli, K. pneumoniae, Serratia
marcescens, and Enterobacter cloacae, and we have
shown that their sizes ranged between 27 and 29 kDa and that they are
antigenically conserved (15). Moreover, the gene encoding the adhesin
is invariably at the distal end of the fim gene cluster. The
complete DNA sequence of the Salmonella fim gene cluster has
been determined by Clegg and Swenson (25) (GenBankTM
accession number L19338), and it revealed some striking differences in
composition and location of genes with that of other enteric fim gene clusters. Based on predicted amino acid sequences
of the products of the Salmonella fim gene cluster, it was
not possible to identify the fimbrial adhesin. Nevertheless, a gene
located in the middle of the fim cluster was named
fimH, because it exhibited limited homology with the adhesin
of S fimbriae of E. coli. Thus, in addition to testing the
contribution of Salmonella type 1 fimbriae to tissue
tropism, we were interested in identifying and characterizing the
putative adhesin.
Here, we demonstrate that Salmonella type 1 fimbriae mediate
bacterial tropism for mouse gut epithelial cells (enterocytes) because,
unlike type 1 fimbriae of E. coli, Salmonella
type 1 fimbriae promoted strong bacterial binding to enterocytes but not to bladder epithelial cells. The distinct binding traits of Salmonella type 1 fimbriae were also reflected in their
selective binding to particular mannosylated proteins and in mediating
secondary aggregation of bacteria on the surface of enterocytes.
Inactivation of a gene (fimHS) encoding a 35-kDa
structurally distinct protein (fimHS) located in the middle
of the fim cluster resulted in loss of binding activity
without any loss of fimbrial expression. Surprisingly, when
FimHS was expressed in the absence of other fimbrial
proteins, the adhesin bound equally to enterocytes and bladder cells as well as to all mannosylated proteins tested. To see if the fimbrial shaft was responsible for the distinct binding specificity exhibited by
the fimbriae, we replaced the amino-terminal half of the
FimHS with the corresponding sequence from
FimHE, which contained the receptor binding domain of
FimHE. The resulting hybrid fimbriae expressed a chimeric
adhesin (FimHES) on a shaft comprised of Salmonella fimbrial protein, and its binding traits
resembled that exhibited by Salmonella fimbriae. Our
findings suggest that although the adhesin is the structurally distinct
FimH, the tropism exhibited by S. typhimurium type 1 fimbriae is determined by the fimbrial filament on which the
adhesin is presented.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Culture, and Plasmids
The bacterial strains and plasmids used in this work are
described in Table I. All strains were cultured in brain heart infusion broth or in Luria broth (BBL Microbiology Systems, Cockeysville, MD).
Culture of Mouse Gut and Bladder Epithelial Cells
The immortalized mouse proximal small intestinal epithelial cell
line SI-H10 was established from LFABP 596 to +21/tsA58
transgenic mice (16). These cells represent one of the first gut
epithelial cell lines of mouse origin to be used to demonstrate
adherence of enteric pathogens. These SI-H10 cells were cultured in
Dulbecco's modified Eagle's medium (BioWhittaker, Walkersville, MD)
containing 20% fetal calf serum (HyClone, Logan, UT) and 50 units of
penicillin/50 µg of streptomycin/ml (Life Technologies, Inc.) at
39 °C in a humidified atmosphere of 95% air, 5% CO2.
Immortalized mouse bladder epithelial cells MM45T.BL were obtained from
American Type Culture Collection (ATCC, Rockville, MD). These cells
were cultured in Dulbecco's modified Eagle's medium with 10%
heat-inactivated fetal calf serum at 37 °C in a humidified
atmosphere of 95% air, 5% CO2.
3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium Bromide
(MTT)1 Bacterial Adherence
Assay
This assay is based on the principle that live bacteria convert
MTT intracellularly to purple formazan in direct proportion to viable
bacterial cell number (17). The dye MTT (Sigma) is a yellow tetrazolium
salt. MTT is reduced by dehydrogenases (expressed intracellularly by
the bacteria) to form purple formazan with maximum absorbance at 570 nm. The crystals of formazan that are produced could be observed
microscopically in individual bacterial cells and could be quantitated
in a multiwell scanning spectrophotometer (enzyme-linked
immunosorbent assay reader). This MTT bacterial adherence assay is
a new, simple, inexpensive, and rapid colorimetric assay that we have
developed in our laboratory to study the adherence of live,
metabolically active bacteria. All the bacteria used in this study
processed the MTT equally and produced the same amount of formazan.
Increasing concentrations of bacteria produced corresponding increases
in formazan as measured by A570. Dead bacteria
and paraformaldehyde-fixed enterocytes or bladder epithelial cells do
not react with MTT.
Cultures of bacteria were grown in static flasks at 37 °C in LB
until bacteria were in mid-log phase growth. Bacteria were harvested
and washed twice in phosphate-buffered saline (PBS) by centrifugation
and resuspended in PBS. The suspensions were adjusted to 1 × 109 bacteria/ml (1 OD), and the suspensions were kept on
ice until used.
Enterocytes (SI-H10 cells) or bladder epithelial cells (MM45T.BL cells)
at a concentration of 0.15 × 106/ml were seeded in a
96-well tissue culture plate and allowed to grow in enriched medium (at
39 °C in the case of SI-H10 cells or 37 °C in the case of
MM45T.BL cells) with 5% CO2. Under these conditions, most
of the cells attached to the plastic surface of the dish and formed a
monolayer. Confluent monolayers were washed three times with sterile
PBS and were fixed overnight at 4 °C in sterile PBS containing 1.5%
paraformaldehyde. The monolayers were washed three times with sterile
PBS and pretreated for 1 h at room temperature with blocking
buffer (3% bovine serum albumin in PBS). Various amounts of bacteria
were incubated with the monolayers for 1 h at 37 °C in the
presence and absence of mM. Following adherence incubation,
nonadherent bacteria were removed by washing the cell monolayer 3 times
with PBS. Fifty µl of LB was applied to each monolayer and incubated
for 15 min at 37 °C. MTT was dissolved in PBS at 2 mg/ml,
filter-sterilized, and stored at 4 °C until use. Fifty µl of 2 mg/ml MTT was added to all wells, and the plates were incubated for 15 min at 37 °C to allow reduction of MTT to formazan by live bacteria.
The plates were centrifuged for 5 min at 1600 × g to
pellet the insoluble formazan-containing bacteria. Fluid from the wells
was removed by inverting and gently blotting plates onto absorbent
paper. 150 µl of isopropyl alcohol was added to the wells, and the
plates were sealed by Sealpette adhesive film (Midwest Scientific, St.
Louis, MO) and stored in the dark for 15 min at 37 °C to solubilize
the formazan. The remaining formazan crystals were completely dissolved
by mixing the well contents before measuring absorbance at 570 nm. All
absorbance readings were obtained using an automated 96-channel
microtiter plate reader (Bio-Rad) interfaced to a computer.
Mannosylated Glycoprotein-mediated Bacterial Aggregation
Assay
The binding of type 1 fimbriated bacteria to the
mannose-containing glycoproteins PAPM-BSA and HRP (Sigma) was studied
spectrophotometrically. The cultures of bacterial cells were
centrifuged, and the supernatants were removed, and each cell pellet
was washed twice in sterile PBS before being resuspended in PBS. 990 µl of each bacterial suspension (absorbance at 600 nm, 1.75) was
transferred to a cuvette. Ten µl of the glycoprotein solution at 5 mg/ml concentration in PBS was then added to each cuvette. The cuvettes
were covered with Parafilm and shaken gently for 1 min, at which point
they were placed into the spectrophotometer, and a reading at 600 nm was taken. As a control, 990 µl of bacterial suspension (absorbance at 600 nm, 1.75) was mixed with 10 µl of PBS. Subsequent readings were taken at 600 nm after a total elapsed time of 5, 15, and every 15 min thereafter for 1 h. The A600 reading
drops as the bacteria aggregate and settle at the bottom of the
cuvettes. Aggregation was expressed as absorbance as a function of time.
Transmission and Scanning Electron Microscopy
For transmission electron microscopy, bacteria from overnight
static liquid cultures were resuspended in PBS. A 25-µl aliquot of
the bacterial suspension was placed on top of a parlodion carbon-coated glow discharged grid for 30 s followed by staining with three drops of 1% phosphotungstic acid at pH 7.5. The grids were blotted dry
and examined in a Joel 100B electron microscope.
For scanning electron microscopy, SI-H10 cells were grown on glass
coverslips. The bacterial adherence experiment was carried out with
live cells. The cells with adherent bacteria were fixed with 2%
glutaraldehyde in PBS. The coverslips were washed twice with 0.1 M sodium cacodylate buffer, pH 7.3, at room temperature (RT) for 15 min. The cells were then postfixed with 1%
OsO4 in 0.1 M cacodylate buffer for 1 h at
RT, followed by two 15-min washes at RT with cacodylate buffer. The
cells were then dehydrated with ascending concentrations of ethanol at
RT for 10 min at each step: 50, 70, 90, and 100%. The coverslips, in
100% ethanol, were then transferred to a Polaron E3000 Critical Point
Drying Apparatus and critical point dried with CO2. Dried
coverslips were mounted on aluminum specimen mounts, coated with 300 Å of gold in a Polaron E5000 Sputter Coating Unit, and viewed with a
Hitachi S-450 Scanning Electron Microscope at 20 kV accelerating voltage.
DNA Manipulations
Restriction enzymes and DNA-modifying enzymes were used as
recommended by the suppliers (Boehringer Mannheim; New England Biolabs,
Beverly, MA). A complete list of plasmids that were generated as well
as their gene products are described in Table I.
Linker Insertion Mutagenesis of fimHS--
The
fimHS gene on the pISF101 plasmid was
inactivated by linker insertion mutagenesis. The S. typhimurium
fim operon from pISF101 plasmid was released by digestion with
SphI and subcloned into SphI-digested pUC 19 vector, and the resulting plasmid was named pKT301. pKT301 was digested
with Bsu36I, and the linear DNA was gel-purified. The
sequence of the primers that constitute the linker are primer Sty1, 5'
TCA TAA TAA TGA TTA GGT GAG GAT CC 3', and primer Sty2, 5' TG AGG ATC
CTC ACC TAA TCA TTA TTA 3'. These oligonucleotides were phosphorylated
and annealed and then ligated to the Bsu36I-linearized
pKT301. E. coli DH5 F'IQ competent cells were
transformed, and the resultant colonies were screened for the
introduced BamHI site present on the linker. DNA sequence
analysis (18) using the sense strand primer Sty3, 5' TAT CGG CGC GTC
GTT ATT TAG TC3', and antisense primer Sty4, 5' AGC AAC CAC AAA GCC TAA
AT3', was carried out on the linker-inserted clones containing the
BamHI site. One clone named pKT302, which contained an
inactivated fimHS in S. typhimurium
fim operon, was used to make the final construct in the pACYC184
plasmid. The mutant operon was subcloned into pACYC184 by digesting the
pKT302 plasmid with SphI and by ligating the gel-purified
12-kb mutant operon fragment into SphI-linearized pACYC184.
DH5 F'IQ competent cells were transformed with the ligation
mixture, and resultant colonies were screened by SphI and
BamHI digestion and confirmed by DNA sequencing. The final
construct was named pKT303. The plasmid was introduced into E. coli ORN103 by a method outlined by Sambrook et al.
(18).
Generation of malE/fimHS Gene Fusion
Construct--
The plasmid pISF101 that contains the entire type 1 fim gene cluster of S. typhimurium was used as
the PCR template to generate fimHS DNA sequence.
The PCR product was cloned into plasmid vector pMAL-p2 (New England
Biolabs, Beverly, MA) using standard techniques to produce the plasmid
pKT304. The vector pMAL-p2 encodes the affinity tag (MalE protein) and
the (Asp)10 linker, which have a molecular mass of approximately 42 kDa. Oligonucleotides were synthesized and purified commercially
(Integrated DNA Technologies, Inc., Coralville, IA). The following are
the sequences of the forward and reverse oligonucleotide primers used
to generate the fimHS DNA fragment employed in
this study: primer Sty5, 5' GCC GGA ATT CTG CCG TAA TTC AAA CGG GAC G
3', and primer Sty6, 5'GGG CAA GCT TCT ATT AAT CAT AAT CGA CTC GTA G
3'. Plasmids were introduced into E. coli ORN103 by heat
shock method as outlined by Sambrook et al. (18). Expression
vector pMAL-p2, amylose resin, antiserum against the maltose-binding
protein (MalE), and purified MalE were obtained from the New England
Biolabs (Beverly, MA).
Construction of the FimHES Chimera--
The
FimHES chimera-expressing clone was constructed by
replacing in the recombinant plasmid pISF101 the S. typhimurium 5' end region of fimHS gene
encoding amino acids 1-174 with corresponding E. coli 5'
end of the fimHE gene encoding amino acids
1-158. The strategy used required introducing two restriction sites
(NruI and HpaI sites) in the S. typhimurium sequence just upstream and downstream of the codons
encoding amino acids 1 and 174, respectively, of the
fimHS gene, and introducing the same restriction
sites in the fimHE sequence flanking codons
encoding amino acids 1-158. These sites were then used to replace the
fimHS sequence with the
fimHE sequence. The
fimHES chimera bearing S. typhimurium type 1 fimbrial operon was reassembled in pACYC184 with multiple subcloning steps.
PCR Mutagenesis and Subcloning of S. typhimurium Fim Sequence to
Introduce Internal NruI and HpaI Sites--
In order to carry out PCR
mutagenesis and to introduce internal NruI and
HpaI sites in the fimHS gene,
sequential PCR technology was used to generate a fragment of the
fim operon from nucleotides 5286 to 6452 in which an
NruI site and an HpaI site were introduced at
nucleotides 5685 and 6224, respectively. Six PCR primers were designed
and purchased from Life Technologies, Inc. Primer Sty7, CAGCGTAGTGCCGACAGAGG, is a sense primer located upstream of the AatII site at nucleotide 5379. Primer Sty8,
GTCGCGAGCGCGGGATGGGTG, is an antisense primer located at the first site
requiring mutation and includes the single base change at nucleotide
5684 to introduce an NruI site. Primer Sty9,
CCGCGCTCGCGACGGTTTGCCG, is a sense primer also located at the first
mutation site and contains the nucleotide change. These two primers
overlap by 13 nucleotides in the region to be mutated. Primer Sty10,
CCGGCGTTAACTTCACAGTTTTG, is an antisense primer. It contains two
nucleotide changes necessary (nucleotides 6224 and 6227) to introduce
an HpaI site. Primer Sty11, TGAAGTTAACGCCGGACAGGTCG, is a
sense primer that contains the two nucleotide changes present in primer
Sty10 to introduce the HpaI site. Primers Sty10 and Sty11
overlap by 15 bases in the region to be mutated. Primer Sty12,
AGCAACCACAAAGCCTAAAT, is an antisense primer, located just downstream
of the unique Bsu36I site. Three separate PCR reactions were
carried out on the pISF101 DNA template using the above described
primers. Primers Sty7 and Sty8 were used in one reaction, primers Sty9
and Sty10 in the second, and primers Sty11 and Sty12 in the third.
These three PCR reactions amplified products 404, 556, and 235 bp,
respectively. The three PCR products were gel-purified and then all
three were combined in a second round of PCR using primers Sty7 and
Sty12. This reaction amplified a 1167-bp fragment that was cloned into the pGEM-T vector. Transformants were screened for the presence of
NruI/HpaI fragments of approximately 500 bp. One
clone with this phenotype was designated pKT305, and the sequence of
the relevant regions was determined. The sequence analysis confirmed the introduction of the NruI and HpaI sites, as
well as the integrity of the rest of the relevant S. typhimurium sequences.
PCR Cloning of fimHE Region to Introduce Flanking
NruI and HpaI Sites--
A DNA fragment of the
fimHE encoding the amino acid residues 1-158
was generated from the pSH2 plasmid by PCR using primer Sty13,
CTCGCGACGGTTTGTAAAACCGCCAATGGT, and primer Sty14,
GTTAACTTCACAGCCGCCAGTAGGCAC, the former containing an NruI
site and the latter containing an HpaI site. The 498-bp
fragment generated in the PCR reaction was cloned into the pGEM-T
vector. Transformants were screened by restriction analysis for the
presence of the NruI/HpaI fragment. One clone
containing the 498-bp NruI/HpaI fragment was
sequenced. The sequence analysis confirmed the presence of the two
introduced restriction sites as well as the integrity of the sequence
of the entire PCR product. This clone was named pKT306.
Replacement of NruI/HpaI fimHS Fragment with
NruI/HpaI fimHE Fragment--
In the first of three
subcloning steps, pKT306 was specifically digested with NruI
and HpaI. The 498-bp fragment was gel-purified and cloned
into the 3.6-kb fragment of pKT305, which had also been
digested with NruI and HpaI and gel-purified.
This construction was screened by NruI and HpaI
digest for the presence of a 498-bp fragment. This plasmid was named
pKT307. Additional restriction enzyme analysis also confirmed the
presence of a KpnI site which was introduced from the
E. coli sequence. The second step in the reconstruction
involved subcloning 6727-bp PstI fragment from pISF101 into
the PstI site of pUC21 (This recombinant plasmid was named
pKT308) and replacing the AatII to Bsu36I
fragment in pKT308 with the comparable fragment from pKT307 which
contains the fimHE sequences. The plasmid pKT308
was initially linearized with Bsu36I and then partially
digested with AatII. The 8.9-kb fragment was gel-purified.
The plasmid pKT307 was digested to completion with AatII and
Bsu36I, and the 975-bp fragment was gel-purified and cloned
into the 8.9-kb fragment generated in the partial digest. The resultant
clones were screened by AatII/Bsu36I digests and
NruI/HpaI digest. One clone with the appropriate
phenotype was chosen and named pKT309. The final subcloning step to
assemble the chimeric fimHES-bearing operon in
pACYC184 required digesting pKT309 with PstI and gel
purifying the 6.7-kb fragment. This fragment was cloned into the 9-kb
PstI fragment from pISF101. Transformants were screened by
PstI digestion for the presence of two fragments, approximately 9 and 6.5 kb. There is a unique KpnI site in
the E. coli sequence in the region cloned into the S. typhimurium fim operon. There are no KpnI sites in the
pACYC184 vector or in the S. typhimurium fim operon. This
construct was named pKT310.
Assays for Fimbriation and Isolation of Type 1 Fimbriae
Bacterial cell expression of type 1 fimbriae was confirmed by
one or more of the following tests: mM-sensitive agglutination of
guinea pig erythrocytes and yeast (Candida albicans) cells, bacterial agglutination by anti-FimAS antiserum, and direct
binding of fimbriae-specific antibodies in enzyme-linked immunosorbent assays (19). Type 1 fimbriae were isolated and purified by
following the methods of Dodd and Eisenstein (20).
Extraction of Periplasmic Contents and Purification of
MalE/FimHS Fusion Protein
Once the expression of MalE/FimHS fusion was
confirmed by immunoblotting, we induced cultures with 0.3 mM isopropyl- -D-thiogalactopyranoside to
generate large amounts of the fusion protein in the periplasmic fraction (19). Periplasmic fluid was extracted from 2-liter culture
suspensions as described previously (19) and passed over a
Sepharose-amylose affinity column. The fusion protein was bound to the
column via its affinity tag (the MalE portion). Bound fusion protein
was subsequently eluted by the addition of 10 mM maltose,
and the eluate was subjected to SDS-PAGE (19).
SDS-PAGE, Immunoblotting, and Densitometry
Purified FimHS+ wild type,
FimHS mutant, and
FimHES+ hybrid fimbrial preparations (100-µl
volume each) were boiled for 5 min in 100 µl of 0.125 N
HCl. 100 µl of 0.1 N sodium hydroxide (NaOH) was added to
this mixture followed by the addition of 100 µl of 4× SDS-PAGE
sample buffer and boiling for 8 min. These fimbrial samples were
subjected to SDS-PAGE on a 15% slab gel by the method of Laemmli (21).
Purified MalE/FimHS fusion protein was subjected to
SDS-PAGE on a 10% slab gel. The proteins were subsequently electrophoretically transferred onto nitrocellulose membranes. The
immunostaining of specific protein was performed essentially as
described previously (19) using antisera raised against
FimAS or FimHE or MalE. Densitometric scannings
of protein bands were performed optically with the Eagle Eye II still
video system (Stratagene, La Jolla, CA).
Overlay Assays Employing Mouse Enterocytes, Bladder Epithelial
Cells, and Mannosylated Glycoproteins (PAPM-BSA and HRP)
Purified fusion protein comprising of MalE and FimHS
(MalE/FimHS) and MalE were subjected to SDS-PAGE and
transferred onto nitrocellulose membranes. After blocking in 3% bovine
serum albumin (BSA) in PBS for 1 h, the nitrocellulose blot was
overlaid with 5 × 106 biotinylated mouse enterocytes
or bladder cells in the presence and absence of 100 mM
mM (19). The mouse cells were biotinylated as described previously
(19). After 1 h of incubation at 22 °C, the blot was rinsed
several times with PBS, and the bound cells were probed with alkaline
phosphatase-conjugated avidin (Sigma) followed by the substrate
5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT)
(19). In the glycoprotein overlay assays, after blocking the
nitrocellulose blot in 3% BSA in PBS for 1 h, the membrane was
overlaid with 100 µg of HRP/ml of PBS for 1 h (in the presence
and absence of 100 mM mM) or 100 µg of PAPM-BSA/ml of
PBS for 1 h followed by incubation with 100 µg of HRP/ml of PBS
for 1 h. After 1 h of incubation at 22 °C, the blot was
rinsed several times with PBS. Bound HRP was directly detected by the
addition of its substrate, 4-chloro-1-naphthol.
Generation of Antisera
Antisera to FimHE and to FimAS were
raised as described earlier (19).
Protein Sequence Analysis
CLUSTAL X multiple sequence alignment program (22) was used to
align amino acid sequences. MacBOXSHADE program (23) was used to shade
identical amino acid residues.
 |
RESULTS |
Type 1 Fimbriae of S. typhimurium Promote Bacterial Binding to
Murine Enterocytes but Not to Bladder Epithelial Cells--
We
examined the adherence of two pairs of strains, the clinical S. typhimurium strain X4252 and its fim minus
derivative, S. typhimurium X4253, and the fim
minus laboratory E. coli strain, ORN103, and its recombinant
derivative, ORN103(pISF101) harboring the recombinant plasmid pISF101
encoding S. typhimurium type 1 fimbriae. The assays were
undertaken employing a previously described mouse enterocyte cell line,
SI-H10 (16) that was grown as a monolayer on microtiter plates. The
SI-H10 cells were rendered nonviable by paraformaldehyde fixation in
order to exclude the possible contribution of post-contact-induced
bacterial adherence events that typically require participation of a
viable host cell. It was also necessary to use nonviable enterocytes
because quantitation of adherent bacteria was dependent on assaying for
MTT processing by live bacteria, and the presence of any host
cell-derived formazan (MTT product) would have confounded the assay.
Type 1 fimbriated S. typhimurium X4252 and E. coli ORN103(pISF101) bound to the gut epithelial cells in large
numbers, whereas the nonfimbriated S. typhimurium X4253 and
E. coli ORN103 strain bound only minimally (Fig.
1A). Type 1 fimbriae of
Salmonella were specifically implicated in the binding
reactions because the adherence of both type 1 fimbriated strains was
markedly reduced in the presence of 100 mM
-methyl-D-mannopyranoside ( mM).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 1.
Differential binding of bacteria expressing
Salmonella and E. coli type 1 fimbriae to immobilized mouse gut and bladder epithelial cells.
A, adherence to the enterocyte cell line, SI-H10 cells.
B, adherence to the bladder epithelial cell line, MM45T.BL
cells.
|
|
To determine if the Salmonella type 1 fimbriae mediated a
distinct binding reaction from other enterobacterial type 1 fimbriae, we compared enterocyte binding of the recombinant bacteria expressing type 1 fimbriae of E. coli with those expressing
Salmonella fimbriae. We observed that the number of adherent
bacteria expressing Salmonella type 1 fimbriae was
considerably more than the number of adherent bacteria expressing
E. coli fimbriae (Fig. 1A). Since
Salmonella do not typically infect the urinary tract,
whereas E. coli is a frequent pathogen, we compared the
binding to mouse bladder epithelial cells of bacteria expressing
Salmonella and E. coli type 1 fimbriae (Fig.
1B). Whereas E. coli type 1 fimbriae mediated high levels of bacterial binding to bladder cells and lower levels of
binding to enterocytes (Fig. 1, A and B),
bacteria expressing Salmonella type 1 fimbriae bound only
enterocytes. Therefore, Salmonella and, perhaps, E. coli exhibit distinct binding tropisms in vitro
reflecting their colonization sites in vivo (Fig. 1, A and B).
Characterization of the Binding Properties of S. typhimurium Type 1 Fimbriae--
Heterogeneity in binding among different type 1 fimbriated bacteria may be manifested in differential binding to
selected mannosylated glycoproteins (14, 24). To confirm the distinct binding properties of Salmonella and E. coli type
1 fimbriae, we compared their ability to bind two mannosylated
glycoproteins, horseradish peroxidase (HRP) and
p-amino-phenyl- -D-mannopyranoside-BSA (PAPM-BSA). Fimbrial binding to the glycoproteins resulted in bacterial
aggregation and sedimentation that can be readily monitored by a fall
in the absorbance values of the mixture. Whereas bacteria expressing
E. coli or Salmonella type 1 fimbriae bound and
were aggregated by PAPM-BSA, only bacteria expressing E. coli type 1 fimbriae bound and were aggregated by HRP (Fig.
2, A and B). Thus,
compared with E. coli type 1 fimbriae, Salmonella
fimbriae exhibited a more selective binding reaction implying that its mannose-binding adhesin possesses a distinct recognition motif from
that on E. coli type 1 fimbriae.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Differential aggregation of bacteria
expressing Salmonella and E. coli
type 1 fimbriae by mannoproteins. A, aggregation
by p-aminophenyl- -D-mannopyranoside-BSA
(PAPM-BSA). B, aggregation by horseradish peroxidase (HRP).
Notice that whereas bacteria expressing native E. coli
fimbriae are aggregated by both mannoproteins, bacteria expressing
native Salmonella fimbriae are aggregated only by
PAPM-BSA.
|
|
Aggregative Bacterial Adherence Mediated by S. typhimurium Type 1 Fimbriae--
Another remarkable feature of Salmonella type
1 fimbriae-mediated adherence is that secondary bacterial aggregates
appeared to form around already adherent bacteria on the surface of
enterocytes. When the adherence of S. typhimurium X4252 or
E. coli ORN103(pISF101) to live SI-H10 enterocytes was
examined by light microscopy, the bacteria appeared to be associated
with the epithelial cells in distinct aggregates. The bacterial
aggregates on the surface of enterocytes appeared after about 45 min of
incubation, and the size of the aggregates increased with prolonged
incubation (data not shown). Many of the bacteria in the aggregates
seemed to be adhering to each other rather than to the enterocyte
surface. Scanning electron micrographs illustrating the peculiar
bacterial aggregation mediated by Salmonella type 1 fimbriae
on the surface of the gut epithelium is shown in Fig.
3, A and C. None of
the type 1 fimbriated bacteria appeared to bind each other prior to addition to the epithelial monolayer, indicating that this phenomenon is related to post-adhesion events. This phenomenon appeared to be
unique to Salmonella type 1 fimbriae because E. coli ORN103(pSH2) bound enterocytes but failed to form bacterial
aggregates (data not shown). None of the nonfimbriated S. typhimurium X4253 and E. coli ORN103 bound epithelial
cells or formed aggregates on enterocytes (Fig. 3, B and
D). This secondary adherence mediated by
Salmonella type 1 fimbriae could potentially augment its
tropic effects by amplifying the numbers of bacteria found associating with the enterocyte surface.

View larger version (174K):
[in this window]
[in a new window]
|
Fig. 3.
Scanning electron micrographs showing
aggregative bacterial adherence mediated by Salmonella
type 1 fimbriae on the surface of enterocytes. A,
adherent S. typhimurium X4252; B, nonadherent
fim S. typhimurium X4253;
C, adherent E. coli ORN103(pISF101) expressing
Salmonella type 1 fimbriae; D, nonadherent
E. coli ORN103. Notice that in each of the bacterial
aggregates in A and C, a substantial number of
bacteria appears to be attached to each other rather than to the
epithelial cell surface.
|
|
Identification of the Determinant of Adhesion on S. typhimurium
Type 1 Fimbriae--
We sought to identify the determinant on S. typhimurium type 1 fimbriae responsible for mediating specific
adherence to enterocytes. The organization and make up of genes within
the S. typhimurium fim cluster have been determined by Clegg
and Swenson (25). However, because of the dissimilarities in the size,
number, and location of various genes in the Salmonella fim
cluster and other enterobacterial fim clusters, it was not
possible to readily identify the determinant of binding. For example,
the regulatory genes of Salmonella (fimZ,
fimY, and fimW) are located at the 3' end of the
gene cluster, whereas the E. coli type 1 fimbrial operon regulatory genes (fimB and fimE) are located at
the 5' end of the gene cluster (Fig.
4A). Moreover, the DNA
sequence of the S. typhimurium fim locus has recently been
determined by Clegg and colleagues (GenBank accession number L19338
(25)), and none of the predicted protein sequences exhibited any
homology with the type 1 fimbrial adhesins of E. coli or
other enterobacteria.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 4.
Inactivation of fimHS
gene in the Salmonella fim gene cluster.
A, fim gene clusters of S. typhimurium
and E. coli. The letters above the
boxes identify the genes, and the numbers under
the boxes are the sizes of the mature gene products in
kilodaltons. The solid portions on some
boxes indicate sequences for signal peptides on secreted
products. Arrows indicate the direction of transcription.
Notice the differences in the number and orientation of the genes
between the two fim gene clusters. B, Western
blot analyses of isolated Salmonella type 1 fimbriae probed
with FimHE-specific antibody. A single immunoreactive band
corresponding to 35 kDa is indicated. C, transmission
electron micrographs of native Salmonella type 1 fimbriae
from strain ORN103(pISF101) and mutant FimHS-deficient
Salmonella fimbriae from strain ORN103(pKT303). No
morphological difference is apparent between the two fimbriae.
D, verification of the absence of FimHS in the
fimbriae isolated from ORN103(pKT303). WT, wild type;
MT, FimHS mutant. Western blots of
native Salmonella fimbriae are from ORN103(pISF101), and
mutant fimbriae are from ORN103(pKT303). Lanes 1 and
2 were reacted with antibodies to Salmonella FimA
(FimAS). Lanes 3 and 4 were reacted
with antibodies to FimHE. Notice that the intensity of the
FimAS band in lanes 1 and 2 are
comparable but that a 35-kDa immunoreactive band (representing
FimHS) is present in lane 3 but not in
lane 4.
|
|
It has previously been reported that the amino-terminal region of the
FimH proteins of a wide range of enteric bacteria was antigenically
conserved (15). Therefore, we used an antibody directed at a synthetic
peptide corresponding to residues 1-25 of FimHE to probe
for the Salmonella type 1 fimbrial adhesin. The fimbriae
were prepared from S. typhimurium X4252, and the antisera
reacted specifically with a band at 35 kDa on the Western blot (Fig.
4B). A similar band was detected when fimbriae from the
clone ORN103(pISF101) was probed with FimHE antisera (data not shown). Thus, despite the lack of homology in the primary structure
between FimHE and any of the gene products of
Salmonella fim cluster, the antibody reacted with a 35-kDa
protein. Presumably, the antibody was able to recognize conserved
conformational epitopes. An open reading frame encoding a 35-kDa
protein is present in the S. typhimurium gene cluster. This
gene is located in the middle of the fim gene cluster which
is distinct from the traditional location of enterobacterial
fimH at the distal 3' end of the gene cluster.
If the gene encoding the 35-kDa protein was the Salmonella
adhesin, we predicted that specific inactivation of this gene in the
Salmonella fim cluster would result in loss of the adhesive phenotype. We introduced in-frame translation termination codons within
the fimHS coding region in the fim
operon of pISF101. The insertion of the linker containing the in-frame
stop codons within the fimHS gene was verified
by DNA sequencing. The newly generated plasmid, pKT303 (also described
in Table I), was introduced into the
E. coli host strain ORN103. The resultant transformant was examined for fimbrial expression by electron microscopy and found to
express a comparable number of fimbriae per bacteria as E. coli ORN103(pISF101). Also, there appeared to be no obvious
difference in morphology between FimHS mutant
and wild type fimbriae (Fig. 4C). The length of the mutant fimbriae also appeared to be comparable to that of the wild type.
We confirmed biochemically that the mutant fimbriae were deficient in
the 35-kDa FimHS protein. We isolated fimbriae from the mutant ORN103(pKT303) and from ORN103- (pISF101) expressing wild type fimbriae and then probed them with an antibody raised against
a synthetic peptide corresponding to residues 1-25 of FimHE on a Western blot. A second Western blot was also
performed with an antibody to the 21-kDa FimA subunit of
Salmonella type 1 fimbriae (FimAS). As
shown in Fig. 4D, a 35-kDa protein was detected in the lane
containing wild type fimbriae (lane 3) but not in the lane
containing mutant fimbriae (lane 4), although both lanes
contained equal amounts of FimAS (see corresponding lanes 1 and 2). It is also noteworthy
that comparative densitometric analyses of FimAS and
FimHS bands in the wild type fimbrial preparation indicated
that the ratio of the adhesin to the major subunit is 1:10. This
contrasts with E. coli type 1 fimbriae where the ratio ranges from 1:100 to 1:60 (15).
We examined the ability of E. coli ORN103(pKT303) to bind
mouse gut and bladder epithelial cells and the two mannosylated proteins (PAPM-BSA and HRP). We found that in contrast to
ORN103(pISF101) expressing native Salmonella fimbriae, the
mutant ORN103(pKT303) expressing FimHS-deficient fimbriae
failed to mediate any appreciable binding to the monolayer of
enterocytes or to bladder cells (Fig. 1, A and
B). Moreover, bacteria expressing the mutant fimbriae were
not aggregated by either PAPM-BSA or HRP (Fig. 2, A and
B). Together, the data suggest that the 35-kDa
FimHS protein is the determinant on Salmonella
type 1 fimbriae responsible for mediating adherence. However, these
data do not preclude the contribution of other fimbrial components in
the binding process.
Expression of FimHS as a Translational Fusion Protein
with Maltose-binding Protein (MalE) and Examination of Its Adhesive
Capacity--
We sought to investigate if FimHS could
mediate its binding in the absence of other fimbrial proteins. We
cloned fimHS but found that the recombinant gene
product was highly unstable in the bacterial periplasm. We attempted to
stabilize the FimHS by expressing it as a translational
fusion protein with MalE as described previously for the stabilization
of FimHE (19). The periplasm was isolated, and the MalE and
MalE/FimHS proteins were affinity purified and analyzed by
SDS-PAGE. The difference in migration between MalE (lane 1)
and the MalE/FimHS fusion protein (lane 2)
corresponded to the size of FimHS (Fig.
5A). A Western blot using
antibodies to MalE (data not shown) and to FimHE confirmed that the 77-kDa protein was indeed a fusion of FimHS and
MalE (lane 4).

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 5.
Cloning, expression, and purification of a
stable FimHS as a translational fusion protein with MalE
and characterization of its binding properties. A,
Coomassie Blue-stained gel (lanes 1 and 2) and
Western blot (lanes 3 and 4) of MalE and
MalE/FimHS fusion proteins. Lanes 1 and
3 contain MalE. Lanes 2 and 4 contain
MalE/FimHS. The Western blot in lanes 3 and
4 were probed with FimHE-specific antibody. The
immunoreactive bands below the 77-kDa MalE/FimHS fusion
protein represent partially degraded forms of the full-length protein.
B, specific binding of mouse enterocytes (SI-H10 cells) to
immobilized MalE/FimHS. Purified MalE (lanes 1 and 3) and MalE/FimHS (lanes 2 and
4) were subjected to SDS-PAGE, blotted onto nitrocellulose
paper, and then subjected to a cell blotting assay. The assay was
undertaken in the absence (lanes 1 and 2) or
presence of 100 mM mM (lanes 3 and
4). Notice the lack of binding of cells to MalE in
lane 1 and the complete inhibition of the binding of cells
to MalE/FimHS in the presence of 100 mM mM
in lane 4. C, binding of mouse bladder epithelial
cells (MM45T.BL cells), HRP, and PAPM-BSA to immobilized
MalE/FimHS. Purified MalE (lanes 1, 3, 5, 7, and
9) and MalE/FimHS (lanes 2, 4, 6, 8,
and 10) were subjected to SDS-PAGE, blotted onto
nitrocellulose membrane, and then subjected to cell blotting or HRP
binding assays. Lanes 1-4 were blotted with mouse bladder
cells in the absence (lanes 1 and 2) and presence
of (lanes 3 and 4) of 100 mM mM.
Lanes 5-10 were reacted with HRP in the absence
(lanes 5 and 6) and presence of (lanes
7 and 8) 100 mM mM. Lanes 9 and 10 were pretreated with PAPM-BSA before exposure to HRP.
The binding of PAPM-BSA was indicated if pretreatment of blots with
PAPM-BSA blocked subsequent binding of HRP. The data show that
MalE/FimHS bound bladder cells as well as it bound
enterocytes (B). MalE/FimHS bound equally well
to HRP and PAPM-BSA. Notice that all the binding reactions mediated by
MalE/FimHS were inhibitable by 100 mM mM,
and MalE exhibited no binding reactions.
|
|
To determine whether the MalE/FimHS fusion protein could
bind enterocytes, we performed a cell blotting assay where
MalE/FimHS were immobilized onto nitrocellulose membrane
and then probed with biotinylated enterocytes in the presence and
absence of 100 mM mM. As shown in Fig. 5B,
the enterocytes bound MalE/FimHS (lane 2) but
not MalE (lane 1). Furthermore, this binding reaction was
inhibitable by mM (lane 4). Thus, FimHS alone
is capable of mediating mannose-inhibitable binding to mouse enterocytes.
To see if the isolated FimHS also exhibited the
characteristic binding specificity exhibited by Salmonella
type 1 fimbriae, we tested the ability of the immobilized protein to
bind bladder cells and the two mannosylated proteins, PAPM-BSA or HRP.
The binding to bladder cells was undertaken as described for
enterocytes. However, the assay for assessing binding to HRP is notable
because it involves a single step that simultaneously takes advantage of the highly mannosylated nature of the glycoprotein (reflected in its
ability to bind FimHS) and its intrinsic enzymatic
properties (reflected in its ability to react with the Western blot
substrate, 4-chloro-1-naphthol). Binding of PAPM-BSA to
FimHS was assessed by the ability of the glycoprotein to
block the binding of HRP to MalE/FimHS. Surprisingly, we
found that FimHS bound bladder cells as well as it bound
enterocytes, and it bound both mannosylated compounds equally well
(Fig. 5C). This was a surprising finding and indicated that
although Salmonella type 1 fimbriae appeared selective in
its binding of mannosylated compounds, its FimHS adhesin
did not exhibit this selective binding trait. In view of the fact that
in the native fimbriae, the FimHS is intimately associated
with the fimbrial shaft, it is likely that this structure may play a
role in mediating some of the selective binding traits of the fimbriae.
Creation and Characterization of Hybrid S. typhimurium Fimbriae
Containing Chimeric FimHES--
To explore further the
relative contribution of FimHS and the
Salmonella fimbrial shaft to fimbrial binding specificity,
we replaced a stretch comprising amino acid residues 1-173 of
FimHS with a corresponding stretch of residues 1-158 from
FimHE containing the receptor binding domain of
FimHE (19). We reasoned that if the shaft influenced the
binding specificity, then the resulting hybrid fimbriae would function
as Salmonella fimbriae. Alternatively, if the hybrid
fimbriae behaved more as E. coli fimbriae, then we would
assume that the primary structure of FimHS was responsible for the distinct binding traits of the fimbriae. The chimeric FimHES containing hybrid fimbriae expressed by
ORN103(pKT310) bound to enterocytes but failed to bind bladder cells
(Fig. 1, A and B). Moreover, FimHES
containing fimbriae bound and aggregated PAPM-BSA but not HRP (Fig. 2,
A and B). Thus, the hybrid fimbriae comprising
FimHES on a Salmonella shaft still retained the
binding traits of native Salmonella fimbriae. Conceivably,
the fimbrial shaft has an overriding influence on the binding
specificity regardless of the primary structure of the adhesin.
Several aspects regarding the morphology and composition of the hybrid
fimbriae were noted. Western blot analyses of the fimbriae employing
FimAS- and FimHE-specific antisera followed by
densitometry revealed that the amount of FimHES
incorporated into the fimbrial filament was approximately 40% less
than the level of FimHS in native Salmonella
fimbriae (Fig. 6A). This
observation may account for why the binding of the bacteria expressing
FimHES to the enterocytes was less than the binding of
bacteria expressing native Salmonella fimbriae (Fig. 1,
A and B). Transmission electron microscopy
revealed that the hybrid fimbriae were aberrant, with a curly and
tangled appearance throughout its entire length (Fig. 6B).
Type 1 fimbriae typically are highly stable organelles that require
boiling in 0.125 N hydrochloric acid (HCl) to induce
complete depolymerization. When we compared the stability of the hybrid
fimbriae with that of native Salmonella fimbriae, we found
that the hybrids were highly unstable. Whereas native
Salmonella fimbriae required HCl treatment followed by
boiling in SDS-PAGE sample buffer to be depolymerized, hybrid fimbriae
were completely depolymerized merely by boiling in SDS-PAGE sample
buffer at pH 6.8 (Fig. 6C). Thus, the incorporation of
partially heterologous FimHES into the
Salmonella fimbrial filament had a profound effect on both
fimbrial morphology and stability.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 6.
Generation and characterization of
Salmonella hybrid fimbriae containing a chimeric
FimHES. A, verification of the presence of
the chimeric FimHES in hybrid fimbriae produced by strain
ORN103(pKT310). WT, wild type; HB, hybrid.
Western blots of native Salmonella fimbriae from
ORN103(pISF101) (lanes 1 and 3) and chimeric
FimHES containing Salmonella fimbriae from
strain ORN103(pKT310) (lanes 2 and 4).
Lanes 1 and 2 were reacted with antibodies to
Salmonella FimA(FimAS). Lanes 3 and
4 were reacted with antibodies to FimHE. Notice
that the amounts of the FimAS in lanes 1 and
2 are comparable but that the amount of the 32-kDa
immunoreactive band (chimeric FimHES) in lane 4 is appreciably weaker than the 35-kDa immunoreactive band
(FimHS) in native Salmonella fimbriae in
lane 3. B, electron micrograph showing the
irregular and flaccid appearance of fimbriae from ORN103(pKT310)
containing chimeric FimHES. C, Coomassie
Blue-stained preparations of isolated wild type Salmonella
fimbriae (lanes 1 and 3) and fimbriae with
chimeric FimHES (lanes 2 and 4).
Lanes 1 and 2 were boiled only in SDS-PAGE sample
buffer. Lanes 3 and 4 were boiled first in HCl
and then in SDS-PAGE sample buffer. Unlike the native
Salmonella type 1 fimbriae, hybrid fimbriae were readily
depolymerized even in SDS-PAGE sample buffer.
|
|
 |
DISCUSSION |
Although it has been known for a relatively long time that
S. typhimurium expresses type 1 fimbriae, the potential
contribution of these organelles to infection has largely been ignored.
In light of recent observations from several different laboratories on
the role of E. coli and K. pneumoniae type 1 fimbriae in promoting bacterial infections and its harmful inflammatory
sequellae (19, 26, 27), it is conceivable that these organelles also
contribute significantly to the pathogenesis of Salmonella.
S. typhimurium invariably invades its hosts through the gut,
reflecting a distinct adhesive preference for gut tissue. A battery of
contiguous genes residing within SPI-1, a 40-kb pathogenicity island
mapping at 63 min in the S. typhimurium chromosome, is largely responsible for mediating entry of Salmonella into
epithelial cells (28). However, none of these genes appear to mediate
Salmonella's tropism for enterocytes. Indeed, many of these
"invasion-associated genes" are expressed only after the bacteria
has already established intimate contact with the host cell. We
reasoned that the determinant conferring tropism for gut tissue is an
already expressed bacterial surface moiety and is likely to be one or
more of its cell-surface fimbriae. Considering their length and
peritrichous orientation, these organelles could be the first bacterial
components to make contact with host tissue. Fimbriae have been
implicated in mediating tissue tropism in several pathogens. For
example, the fimbriae on pathogenic Neisseria gonorrheae
(29) and pyelonephritogenic E. coli (30) mediate bacterial
tropism for human genital cells and kidney tissue, respectively.
Salmonella type 1 fimbriae exhibit a distinct tropism for
gut tissue because it mediates high levels of bacterial binding to
mouse enterocytes but not to mouse bladder cells. The binding pattern
of Salmonella type 1 fimbriae contrasts with that of
E. coli type 1 fimbriae which mediated moderate bacterial
binding to enterocytes and even higher levels of bacterial binding to bladder cells. The binding patterns displayed by these fimbriae correlate with the natural sites of infection of their respective bacteria in the host. Salmonella typically infects the gut
and E. coli the urinary tract, but prior to infecting the
urinary tract the E. coli were probably inhabitants of the
gut. The distinct binding traits of Salmonella type 1 fimbriae is also evident from their ability to bind PAPM-BSA but not
HRP, whereas E. coli type 1 fimbriae bound well to both
mannosylated proteins. Conceivably, the Salmonella type 1 fimbriae are able to recognize a more limited range of oligomannose
motifs than E. coli type 1 fimbriae. That Salmonella type 1 fimbriae exhibit a distinct binding
pattern is supported by earlier work of Firon et al. (12)
who suggested that the "binding pocket" on the fimbriae is
sterically different from that on E. coli type 1 fimbriae.
To explain the tropism exhibited by Salmonella type 1 fimbriae, we speculate that the oligomannose motifs recognized by
Salmonella are absent or inaccessible on HRP and on bladder
cells but are present on PAPM-BSA and on enterocytes. The targeting of
S. typhimurium to the gut epithelium is clearly essential
because if this does not occur the infection is abrogated. Thus, the
contribution of type 1 fimbriae to the pathogenesis of S. typhimurium is potentially pivotal.
It is known that fimbriae-mediated bacterial binding to mucosal cells
can trigger various host cell responses that cumulatively can
significantly affect the course of the infectious process (27, 31).
What is less well known is that the specific coupling of bacterial
fimbriae with complementary receptors on host cells may activate genes
within the bacteria, notably those that enhance bacterial virulence
in vivo (32). One consequence of Salmonella type
1 fimbriae-mediated binding to enterocytes is the formation of discrete
bacterial aggregates on the surface of the gut epithelial cell. The
aggregates could be the combined effect of replication of attached
bacteria and recruitment of proximate bacteria through their fimbriae.
This phenomenon is seen with Salmonella type 1 fimbriae but
not with E. coli type 1 fimbriae. However, it is distinct
from bacterial aggregation mediated by the recently described thin
fimbriae of S. typhimurium (16) because it was not seen in
the absence of the host cell. That the Salmonella type 1 fimbrial adhesin is involved is indicated because aggregative adherence can be blocked by the addition of a D-mannose analog. The
mechanism could involve binding of Salmonella fimbriae to
mannosylated compounds on the surface of neighboring bacteria. Since
the aggregation does not occur when bacteria are cultured alone, it
appears that the expression of mannosylated compounds on the bacterial
surface occurs only after contact with the host cell. The proposed
mechanism is not unlike the aggregation of K. pneumoniae on
human intestinal cells where the interaction of a newly synthesized
capsule-like material and an, as yet, unidentified fimbriae have been
suggested (33). Aggregative adherence could be beneficial to the
bacteria because it enables them to increase their load on an
epithelial cell even when the specific fimbrial receptor density is limiting.
Several lines of evidence allow us to conclude that the
Salmonella fimbrial adhesin is the product of the
fimHS gene as follows: (i) a protein in
Salmonella fimbriae corresponding to the size of the
fimHS gene product cross-reacted with
anti-FimHE antibodies, (ii) inactivation of the
fimHS gene resulted in abolishment of binding activity in the mutant ORN103- (pKT303) without concomitant loss of fimbriae as determined by electron microscopy and by
biochemical analyses of mutant fimbriae, (iii) recombinant
FimHS, when expressed in the absence of other fimbrial
proteins bound mouse enterocytes in a D-mannose-inhibitable
fashion. Our findings confirm and extend the earlier report of an
association between the presence of 33-36-kDa proteins and functional
Salmonella type 1 fimbriae (34) and the prediction of Clegg
and Swenson (25) that the product of the fimHS
gene was the adhesin. Previous attempts to inactivate fimHS have resulted in loss of fimbrial
expression which has made it difficult to define precisely the
functional role of the gene product (35). This is probably attributable
to the polar effects of the fimHS mutation on
the downstream gene, fimF, which is critical to fimbrial
expression. Our studies have delinked fimbrial expression from FimHs
expression and in doing so revealed that the adhesin is not required
for the assembly of fimbriae.
Clegg and colleagues (25, 35-37) have reported on distinct aspects in
the genetic organization, expression, and regulation of fim
gene cluster of the S. typhimurium in relation to other enterobacterial fim gene clusters. Here, we have noted
several differences between FimHS and its counterpart on
other enterobacteria. First, its size is appreciably higher than the
size of the FimH molecule of other enterobacteria which typically
approximate 29 kDa (15). Second, fimHS maps at
the center of the fim cluster and not at the distal end as
is the case in other enterobacteria (25). Third, the amount of
FimHS relative to FimAS in the fimbriae appears
to be higher (1:10) rather than the 1:60 ratio found in E. coli type 1 fimbriae (15). Fourth, FimHS exhibits very
limited amino acid sequence similarity with other enterobacterial FimH. Fig. 7 depicts the extent of homology in
covalent structure even after progressive multiple sequence alignments
of FimHS and FimHE proteins. Although the
significance of these distinct traits of FimHS is currently
unknown, they may reflect evolutionary advances over other
enterobacterial type 1 fimbrial adhesins.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Predicted covalent structures of
FimHS and FimHE. Notice the limited
homology observed in their primary structure despite their capacity to
mediate mannose-specific binding reactions. This difference may
contribute in part to their distinct binding properties. The sequence
information was obtained from Refs. 25 and 42.
|
|
A very surprising finding was that FimHS, when isolated
from the fimbriae, failed to exhibit the selective binding specificity of native Salmonella fimbriae. Thus, in addition to binding
enterocytes and to PAPM-BSA, MalE/FimHS exhibited strong
binding to bladder cells and to HRP. This indicated that
FimHS is intrinsically capable of recognizing the same
mannose motifs bound by E. coli type 1 fimbriae. This is
remarkable when one considers that there is little homology in primary
structure between FimHS and FimHE. These
findings led us to conclude that the binding pattern exhibited by the
Salmonella fimbriae is not exclusively dependent on the primary structure of the adhesin. Since the adhesin is intimately associated with the fimbrial shaft, it is likely that the latter influences the binding traits of the former. We sought to assess the
relative contribution of the shaft in modulating binding pattern of the
fimbriae. Since it was reported that the receptor binding domain on
FimHE is comprised of epitopes formed by amino acid residues in the first half of the molecule (19), we replaced the
amino-terminal half of FimHS with the corresponding region on FimHE that contains the receptor binding domain on the
E. coli adhesin. The resulting hybrid fimbriae contained a
chimeric FimHES moiety with the receptor binding domain of
FimHE but was presented on a Salmonella fimbrial
shaft. The level of binding to enterocytes mediated by the hybrid
fimbriae was less than that of native Salmonella type 1 fimbriae, and this is probably a reflection of reduced levels (by about
40%) of the adhesin in the fimbriae. Nevertheless, its binding pattern
did not differ markedly from that of native Salmonella
fimbriae as indicated by their binding to enterocytes and PAPM-BSA and
their inability to bind bladder cells and HRP. Evidently, the loss of
the amino-terminal half of FimHs was not accompanied by a concomitant
loss of the distinct binding traits of Salmonella fimbriae.
One interpretation of this finding is that the binding domain of
FimHS is not contained in its amino-terminal half. This is
unlikely in view of the recent finding that the only difference in
primary structure between the FimH molecule of S. typhimurium type 1 fimbriae and the non-adhesive fimbriae of
Salmonella pullorum are eight amino acid substitutions, all located within the amino-terminal halves of the molecules (35). The
alternate and perhaps more plausible explanation is that the quaternary
constraints imposed on the adhesin by the fimbrial shaft, which is
comprised primarily of FimA and at least one minor subunit, FimF (35),
may have an overriding influence on the binding pattern exhibited by
the Salmonella fimbriae. That acquisition of functionally
important FimHE epitopes still did not confer on the hybrid
fimbriae the E. coli binding phenotype lends further support
to this notion. Thus, to reconcile the broad binding reactions exhibited by FimHS in its isolated state and the limited
binding reactions of the same molecule when incorporated in its
fimbriae, we have proposed a model. In this model we postulate that the binding pocket on the isolated FimHS is promiscuous in that
it is able to bind a broad range of mannosylated motifs enabling the
molecule to bind different mannosylated moieties on various cells or
soluble proteins. However, when incorporated into the fimbrial shaft,
only few of the mannosylated motifs are recognized by the
FimHS binding pocket because of the structural constraints imposed by the fimbrial shaft. This model provides the basis for the
limited binding reactions exhibited by Salmonella type 1 fimbriae and for the overriding influence of the fimbrial shaft on the binding reactions exhibited by the adhesin moiety (Fig.
8).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 8.
Model to explain the differential binding
traits of FimHS in its isolated state and when expressed on
the fimbrial filament. It is hypothesized that in its isolated
state, FimHS displays the ability to recognize various
mannosylated motifs (as depicted in the figure) which allows the
molecule to bind different mannosylated molecules on various cells or
in soluble proteins. However, when incorporated at the tips of the
Salmonella fimbrial shaft, FimHS is only able to
bind a narrow range of mannosylated motifs because of the structural
constraints imposed by the shaft, hence the narrow range of binding
exhibited by S. typhimurium type 1 fimbriae. We have also
depicted FimHS that are intercalated periodically along the
fimbrial length. As indicated, the binding pocket in these intercalated
FimHS are inaccessible in the quaternary conformation of
the fimbriae, and thus these molecules are essentially nonfunctional
until they are exposed by breakage. It is suspected that the sites of
intercalation of FimHS are more susceptible to breakage
from shear forces than other regions of the fimbriae. Thus even after
the loss of a fimbrial fragment, the residual filament can still
mediate attachment. It should be noted that the FimHs are likely to be
located much further apart on the filament than is depicted in the
figure.
|
|
Valuable clues on the structure of Salmonella type 1 fimbriae may be gleaned from the morphological and biochemical
characterization of the hybrid fimbriae containing FimHES.
That the hybrid fimbriae appeared wavy throughout its entire length and
was unstable suggests that FimHS was intercalated
longitudinally at multiple sites in the structure. Two models have been
proposed for the location of FimHE in native E. coli fimbriae. In the first model, FimHE is located
exclusively at the tips (38), which is analogous to the location of the
PapG adhesin of the well characterized E. coli P fimbriae.
In the second model, FimHE is located not only at the tips
of the filament, but also intercalated longitudinally (15). The second
model was supported by the subsequent finding that native E. coli type 1 fimbriae were significantly more prone to
fragmentation than the adhesin-deficient mutant fimbriae when subjected
to repeated cycles of freeze-thaw (39). Apparently, sites of
FimHE incorporation were the preferred sites of fimbrial breakage during freeze-thawing since adhesion properties of fimbrial fragments had increased (39). In view of the extraordinary instability of the hybrid fimbriae bearing the heterologous FimHES, it
is likely that the adhesin is incorporated more frequently into the structure than exclusively at the tips. More definitive studies are
currently underway in this laboratory to localize FimHS
more precisely in the fimbriae.
In summary, our studies indicate that the type 1 fimbriae on S. typhimurium is potentially critical to the infectious process because it determines the initial targeting of the bacteria to the gut.
The type 1 fimbriae of S. typhimurium mediates high level of
bacterial binding to enterocytes but not to bladder cells. The specific
determinant of adhesion on the fimbriae is its structurally distinct
35-kDa subunit, FimHS. Surprisingly, in the absence of other fimbrial components, FimHS exhibited a broad range of
mannose-sensitive binding reactions and did not display the selective
binding associated with Salmonella type 1 fimbriae. We
hypothesize that the tissue tropism exhibited by Salmonella
type 1 fimbriae is determined at least in part by the fimbrial shaft
which bears FimHS. It has previously been assumed that the
fimbrial shaft is an innocuous structure on which the adhesin is
strategically poised. Our studies indicate that these structures play a
more active role in the pathogenic process by defining the specific
receptor molecules and host cells that interact with the bacteria.
 |
ACKNOWLEDGEMENT |
We thank Dr. Meta Kuehn for critical review of
this manuscript.
 |
FOOTNOTES |
*
This work was supported in part by Research Grants AI 35678 and DK 50814 from the National Institutes of Health and the Charles E. Culpeper Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Depts. of Pathology and
Microbiology, Campus Box 3020, Duke University Medical Center, Durham,
NC 27710. Tel.: 919-684-6942; Fax: 919-684-2021; E-mail:
krishnan{at}acpub.duke.edu.
Howard Hughes Undergraduate Research Fellow.
§§
Charles E. Culpeper Medical Scholar.
 |
ABBREVIATIONS |
The abbreviations used are:
MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide;
PBS, phosphate-buffered saline;
BSA, bovine serum albumin;
PAPM-BSA, p-amino-phenyl- -D-mannopyranoside-BSA;
HRP, horseradish peroxidase;
PCR, polymerase chain reaction;
RT, room
temperature;
PAGE, polyacrylamide gel electrophoresis;
mM, -methyl-D-mannopyranoside;
kb, kilobase pair;
bp, base
pair.
 |
REFERENCES |
-
Finlay, B. B.,
and Falkow, S.
(1989)
Mol. Microbiol.
3,
1833-1841[Medline]
[Order article via Infotrieve]
-
Groisman, E. A.,
and Ochman, H.
(1996)
Cell
87,
791-794[CrossRef][Medline]
[Order article via Infotrieve]
-
Blanc-Potard, A.-B.,
and Groisman, E. A.
(1997)
EMBO J.
16,
5376-5385[CrossRef][Medline]
[Order article via Infotrieve]
-
Galan, J. E.
(1996)
Mol. Microbiol.
20,
263-271[CrossRef][Medline]
[Order article via Infotrieve]
-
Lee, C. A.
(1997)
Trends Microbiol.
5,
148-156[CrossRef][Medline]
[Order article via Infotrieve]
-
Duguid, J. P.,
Anderson, E. S.,
and Campbell, I.
(1966)
J. Pathol. Bacteriol
19,
107-138
-
Duguid, J. P.,
Dareker, M. R.,
and Wheater, D. W. F.
(1976)
J. Med. Microbiol.
9,
459-473[Abstract/Free Full Text]
-
Ewen, S. W. B.,
Naughton, P. J.,
Grant, G.,
Sojka, M.,
Allen-Vercoe, E.,
Bardocz, S.,
Thorns, C. J.,
and Pusztai, A.
(1997)
FEMS Immunol. Med. Microbiol.
18,
185-192[CrossRef][Medline]
[Order article via Infotrieve]
-
Sanderson, K. E.,
Hessel, A.,
and Rudd, K. E.
(1995)
Microbiol. Rev.
59,
241-303[Abstract/Free Full Text]
-
Swenson, D. L.,
Kim, K.-J.,
Six, E. W.,
and Clegg, S.
(1994)
Mol. Gen. Genet.
244,
216-218[Medline]
[Order article via Infotrieve]
-
Duguid, J. P., and Old, D. C. (1980) in Bacterial
Adherence, Receptors and Recognition (Beachey, E., ed) Series B,
Vol. 6, pp. 185-210, Chapman and Hall, Ltd., London
-
Firon, N.,
Ofek, I.,
and Sharon, N.
(1983)
Carbohydr. Res.
120,
235-249[CrossRef][Medline]
[Order article via Infotrieve]
-
Madison, B.,
Ofek, I.,
Clegg, S.,
and Abraham, S. N.
(1994)
Infect. Immun.
62,
843-848[Abstract/Free Full Text]
-
Sokurenko, E. V.,
Chesnokova, V.,
Doyle, R. J.,
and Hasty, D. L.
(1997)
J. Biol. Chem.
272,
17880-17886[Abstract/Free Full Text]
-
Abraham, S. N.,
Sun, D.,
Dale, J. B.,
and Beachey, E. H.
(1988)
Nature
336,
682-684[CrossRef][Medline]
[Order article via Infotrieve]
-
Sukupolvi, S.,
Lorenz, R. G.,
Gordon, J. I.,
Bian, Z.,
Pfeifer, J. D.,
Normark, S. J.,
and Rhen, M.
(1997)
Infect. Immun.
65,
5320-5325[Abstract]
-
Peck, R.
(1985)
J. Immunol. Methods
82,
131-140[CrossRef][Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., pp. 1.1-7.87, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Thankavel, K.,
Madison, B.,
Ikeda, T.,
Malaviya, R.,
Shaw, A. H.,
Arumugam, P. M.,
and Abraham, S. N.
(1997)
J. Clin. Invest.
100,
1123-1136[Medline]
[Order article via Infotrieve]
-
Dodd, D. C.,
and Eisenstein, B. I.
(1982)
Infect Immun.
38,
764-773[Abstract/Free Full Text]
-
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
-
Thompson, J. D.,
Gibson, T. J.,
Plewniak, F.,
Jeanmougin, F.,
and Higgins, D. G.
(1997)
Nucleic Acids Res.
25,
4876-4882[Abstract/Free Full Text]
-
Baron, M. D. (1998) MacBOXSHADE.http://www.isrec.isb-sib.ch/
software/BOX_form.html
-
Sokurenko, E. V.,
Chesnokova, V.,
Dykhuizen, D. E.,
Ofek, I.,
Wu, X. R.,
Krogfelt, K. A.,
Struve, C.,
Schembri, M. A.,
and Hasty, D. L.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8922-8926[Abstract/Free Full Text]
-
Clegg, S.,
and Swenson, D. L.
(1994)
in
Fimbriae: Adhesion, Genetics, Biogenesis and Vaccines (Klemm, P., ed), pp. 105-113, CRC Press, Inc., Boca Raton, FL
-
Connell, I.,
Agace, W.,
Klemm, P.,
Schembri, M.,
Marild, S.,
and Svanborg, C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
9827-9832[Abstract/Free Full Text]
-
Malaviya, R.,
Ikeda, T.,
Ross, E.,
and Abraham, S. N.
(1996)
Nature
381,
77-80[CrossRef][Medline]
[Order article via Infotrieve]
-
Mills, D. M.,
Bajaj, V.,
and Lee, C. A.
(1995)
Mol. Microbiol.
15,
749-759[CrossRef][Medline]
[Order article via Infotrieve]
-
Jonsson, A.-B.,
Ilver, D.,
Falk, P.,
Pepose, J.,
and Normark, S.
(1994)
Mol. Microbiol.
13,
403-416[Medline]
[Order article via Infotrieve]
-
Stromberg, N.,
Nyholm, P.-G.,
Pascher, I.,
and Normark, S.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
9340-9344[Abstract/Free Full Text]
-
Svanborg, C.,
Hedlund, M.,
Connell, H.,
Nilsson, A.,
and Wullt, B.
(1996)
Ann. N. Y. Acad. Sci.
797,
177-190[Medline]
[Order article via Infotrieve]
-
Zhang, J. P.,
and Normark, S.
(1996)
Science
273,
1234-1236[Abstract]
-
Favre-Bonte, S.,
Darfeuille-Michaud, A.,
and Forestier, C.
(1995)
Infect. Immun.
63,
1318-1328[Abstract]
-
Lockman, H. A.,
and Curtiss, R, III
(1992)
Mol. Microbiol.
6,
933-945[CrossRef][Medline]
[Order article via Infotrieve]
-
Hancox, L. S.,
Yeh, K. S.,
and Clegg, S.
(1998)
FEMS Immunol. Med. Microbiol.
19,
289-296
-
Clegg, S.,
Hull, S.,
Hull, R.,
and Pruckler, J.
(1985)
Infect. Immun.
48,
275-279[Abstract/Free Full Text]
-
Yeh, K. S.,
Hancox, L. S.,
and Clegg, S.
(1995)
J. Bacteriol.
177,
6861-6865[Abstract/Free Full Text]
-
Hanson, M. S.,
and Brinton, C. C., Jr.
(1988)
Nature
332,
265-268[CrossRef][Medline]
[Order article via Infotrieve]
-
Ponniah, S.,
Endres, R. O.,
Hasty, D. L.,
and Abraham, S. N.
(1991)
J. Bacteriol.
173,
4195-4202[Abstract/Free Full Text]
-
Orndorff, P. E.,
and Falkow, S.
(1984)
J. Bacteriol.
159,
736-744[Abstract/Free Full Text]
-
Van Der Velden, A. W. M.,
Baumler, A. J.,
Tsolis, R. M.,
and Heffron, F.
(1998)
Infect. Immun.
66,
2803-2808[Abstract/Free Full Text]
-
Klemm, P.,
and Christiansen, G.
(1987)
Mol. Gen. Genet.
208,
439-445[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Guo, S. Cao, L. Tu, P. Chen, C. Zhang, A. Jia, W. Yang, Z. Liu, H. Chen, and D. M. Schifferli
FimH alleles direct preferential binding of Salmonella to distinct mammalian cells or to avian cells
Microbiology,
May 1, 2009;
155(5):
1623 - 1633.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Dorman and C. P. Corcoran
Bacterial DNA topology and infectious disease
Nucleic Acids Res.,
February 1, 2009;
37(3):
672 - 678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. R. Field, A. N. Layton, J. Bispham, M. P. Stevens, and E. E. Galyov
Identification of Novel Genes and Pathways Affecting Salmonella Type III Secretion System 1 Using a Contact-Dependent Hemolysis Assay
J. Bacteriol.,
May 1, 2008;
190(9):
3393 - 3398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chessa, C. W. Dorsey, M. Winter, and A. J. Baumler
Binding Specificity of Salmonella Plasmid-encoded Fimbriae Assessed by Glycomics
J. Biol. Chem.,
March 28, 2008;
283(13):
8118 - 8124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. McFarland, S. Lucchini, J. C. D. Hinton, and C. J. Dorman
The Leucine-Responsive Regulatory Protein, Lrp, Activates Transcription of the fim Operon in Salmonella enterica Serovar Typhimurium via the fimZ Regulatory Gene
J. Bacteriol.,
January 15, 2008;
190(2):
602 - 612.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Guo, M. A. Lasaro, J.-C. Sirard, J.-P. Kraehenbuhl, and D. M. Schifferli
Adhesin-dependent binding and uptake of Salmonella enterica serovar Typhimurium by dendritic cells
Microbiology,
April 1, 2007;
153(4):
1059 - 1069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Foley, D. G. White, P. F. McDermott, R. D. Walker, B. Rhodes, P. J. Fedorka-Cray, S. Simjee, and S. Zhao
Comparison of Subtyping Methods for Differentiating Salmonella enterica Serovar Typhimurium Isolates Obtained from Food Animal Sources.
J. Clin. Microbiol.,
October 1, 2006;
44(10):
3569 - 3577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Duncan, E. L. Mann, M. S. Cohen, I. Ofek, N. Sharon, and S. N. Abraham
The Distinct Binding Specificities Exhibited by Enterobacterial Type 1 Fimbriae Are Determined by Their Fimbrial Shafts
J. Biol. Chem.,
November 11, 2005;
280(45):
37707 - 37716.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Althouse, S. Patterson, P. Fedorka-Cray, and R. E. Isaacson
Type 1 Fimbriae of Salmonella enterica Serovar Typhimurium Bind to Enterocytes and Contribute to Colonization of Swine In Vivo
Infect. Immun.,
November 1, 2003;
71(11):
6446 - 6452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-S. M. Park, M. Wolfgang, and M. Koomey
Modification of Type IV Pilus-Associated Epithelial Cell Adherence and Multicellular Behavior by the PilU Protein of Neisseria gonorrhoeae
Infect. Immun.,
July 1, 2002;
70(7):
3891 - 3903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. P. Van Loy, E. V. Sokurenko, and S. L. Moseley
The Major Structural Subunits of Dr and F1845 Fimbriae Are Adhesins
Infect. Immun.,
April 1, 2002;
70(4):
1694 - 1702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. C. Winther-Larsen, F. T. Hegge, M. Wolfgang, S. F. Hayes, J. P. M. van Putten, and M. Koomey
Neisseria gonorrhoeae PilV, a type IV pilus-associated protein essential to human epithelial cell adherence
PNAS,
December 18, 2001;
98(26):
15276 - 15281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. NAUGHTON, G. GRANT, M. SOJKA, S. BARDOCZ, C. J. THORNS, and A. PUSZTAI
Survival and distribution of cell-free SEF 21 of Salmonella enterica serovar Enteritidis in the stomach and various compartments of the rat gastrointestinal tract in vivo
J. Med. Microbiol.,
December 1, 2001;
50(12):
1049 - 1054.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Wilson, J. Elthon, S. Clegg, and B. D. Jones
Salmonella enterica Serovars Gallinarum and Pullorum Expressing Salmonella enterica Serovar Typhimurium Type 1 Fimbriae Exhibit Increased Invasiveness for Mammalian Cells
Infect. Immun.,
August 1, 2000;
68(8):
4782 - 4785.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|